Está en la página 1de 107

C L E G II O E T U D II O S E N T F II C O S C N O L G II C O S CO O L E G D ES S T U D O CII E N T F C O TE E C N O L G C O O L E G OD D EE S T U D O SC E N T F C O SY YT E C N O L G C O S D E L T A D O E B A S C O D E ES S T A D D TA A B A S C D E LE S T A D OD D ET A B A S C O

DIRECCIONACADEMICA

SECUENCIADIDCTICA

Biologacontempornea

FECHA

Enero2008

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

DIRECTORIO

DirectorGeneral DirectorAcadmico DepartamentodePlanesyProgramas Elaboraron

M:V:Z.FernandoOropezaCorrea M.E.ElmerJimnezRicardez Lic. Ma.DelaPazSarmiento Ing.Ma.GuadalupedelaCruzMerito Biol.MaritzaMoyerLandero Biol.JessHernndezVelsquez Dr.ArmandoAriasJimnez Ing.OmarRodrguezCampos Ing.TiloChicoPozo Bio.JoseManuelHerreraGallegos Bio.MiguelA.RodrguezSoberano. Bio.JavierOsorioSantos Bio.ClaroHernndezHenndez Ing.SaturninoVelsquezValencia.

Asignatura: BiologaContempornea Semestre: VI

EstematerialesvigenteapartirdeEnerodel2008 Seautorizasureproduccinparcialototal,previa AutorizacinporescritodelCECyTETabasco.

ESTEPROGRAMAESSOLOPARAUSODELDOCENTE

BiologaContempornea

FDA03

II

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

REFLEXININICIAL

Abriraloseducandoselmundocientficotcnicoyeldelos procedimientos,tambinesprimordial,peroigualmenteinsuficiente. esforzosoabrirleslaspuertasdelmundodelooxiologico,afinde desarrollar, en ellos la dimensin valorar o actitudinal. Como consecuencia durante el desarrollo de cada actividad de una secuencia didctica es primordial, adems de desarrollar los contenidosfacticosyprocedimentales,rescatarvalores. Nos referimos a los valores universales: libertad (expresin, eleccinytransito)justicia(igualdadyequidad)solidaridad (Colaboracinyayudamutua). Enestamaterialoseducandodebernformarunpensamiento categorialquecombineladimensinfacticaylaprocedimental.que los educando construyan su propio conocimiento acerca de los temastratadosenlasprcticasposteriores.

BiologaContempornea

FDA03

III

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

PRESENTACIN

LaBiologaContempornea,esunadelascienciasmsatractivaseinteresantesporsumateriade estudio,enlosltimostiemposhaalcanzadounaslidamadurezyplenaautonomacientfica.Loanteriores producto del desarrollo de metodologas que le son propias y la distinguen como la comparacin, la observacinyelestablecimientodeprocedimientosparticularesparalaexperimentacin. Lamateriatiene,asmismo,el propsitodeincrementarelconocimientodelosalumnos,estimular suintersporlaactividadcientficaydesarrollaractividadesresponsablesenlapreservacindelasaludy delmundoenquevivimos. Consideramos que el concluir este curso, los alumnospodrn observar almundo biolgico en una etapasuperiordeapreciacinesdecir,queconoceryentenderaquellosmecanismosquerigenfisiolgica yanatmicamentealosseresvivos,desdelosnivelesmaselementaleshastalosmscomplejos. La Biologa Contempornea, esta elaborada con los nuevos programas y enfoque de la materia que persiguelossiguientesobjetivosparticulares: Fortalecer la misin de que los seres vivos presentan caractersticas nicas, producto de interaccionesqumicasentreloscompuestosorgnicos. Integrarelconceptodeclulacomounidadestructuralyfuncionaldelosseresvivos. Presentacin de la diversidad de mecanismos fisiolgicos y anatmicos que se desarrollan en los seresvivos. Presentacindelosprocesosmetablicoshumanos, quelepermitanalestudiantedeentenderlos cambios fisiolgicosyanatmicosqueelmismoatraviesa.

Esperamos que al adquirir la experiencia conceptual de la materia viva y el conocimiento de su organismocomoservivo,elalumnologreunaapreciacinobjetivaqueredundeenlaactitudcriticasobreel mundodondeseencuentrainmerso,alsentirsepartedelanaturalezaquelerodea,aprenderarespetarla comoserespetaasmismoypercibirlanecesidaddeconservacinensuentornonatural. Es nuestro deseo que este programa de estudios estimule al joven estudiante, la practica de la observacin de la experimentacin como actividad cotidiana en el que hacer dentro y fuera del aula, para formarenlunverdaderointersenlanaturalezaquelemotiveyloencaucehaciaelconocimientocientfico yparaproporcionareldesarrollomentalnecesarioparadarsolucinalosproblemasdesuvidadiaria.

BiologaContempornea

FDA03

IV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

PROGRAMADEESTUDIO

NOMBREDELAMATERIA UNIDADI.

1 Nivelcelular 1.1. Clulaseucariticas 1.2. Clulasprocariticas 1.3. Estructurayfuncin


UNIDADII.

2Nivelbioqumico 2.1.Bioelementos 2.2 Biomolculas

UNIDADIII.

3.Nivelfisiolgico 3.1Transporte(activoypasivo) 3.2Respiracin(aerobiayanaerobia) 3.3Fotosntesis(Faseluminosayfaseobscura) 3.4Reproduccin(mitosisymeiosis) 3.5Ciclocelular

UNIDADIV 4.Nivelgentico 4.1cidosnucleicos 4.2Sntesisdeprotenas UNIDADV 5.Niveltecnolgico 5.1Biotecnologa 5.2 DNArecombinante

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

BiologaContempornea

FDA03

VI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

MARCOCONCEPTUAL CELULA
CELULA

NIVELCELULAR

NIVELBIOQUIMICO

NIVELFISIOLOGICO

NIVEL GENETICO

NIVEL TECNOLO

CELULAS EUCARIOTICA

CELULAS PROCARIOTIC

BIBIOMOLECULAS

BIOELEMENTOS

TRANSPORTE

RESPIRACION REPRODUCCION

ACIDOS NUCLEICOS

BIOTECNOLOGIA

ESTRUCTURAY FUNCION

ACTIVO

PASIVO AEROBIA ANAEROBIO

MITOSIS MEIOSIS

SISNTESISDE PROTEINA

DNA RECOMBINAN

FOTOSISNTESIS

CICLOCELULAR

FASELUMINOSA

FASE OBSCURA

BiologaContempornea

FDA03

VII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

PROPOSITODELAASIGNATURA Laasignaturadebiologacontemporneatienecomopropsitointroduciralalumnoenel conocimientodelabiologacelularymolecularapartirdecinconivelesqueson:celular, bioqumico,fisiolgico,genticoytecnolgico.

OBJETIVODEAPRENDIZAJE Elalumnoreforzaralosconocimientosdelabiologacontemporneaanivelmolecularyla importanciaquetieneestaensuentorno.

PRODUCTOESPERADO Al trmino del semestre el alumno conocer y diferenciara los niveles moleculares as comolaimportanciaenelmbitosocial,tecnolgicoyambiental.

METODOLOGIA Para lograr los objetivos prepuestos se realizarn revisiones bibliograficas incluyendo revistascientficas,ascomoelusodelinternet. Laparticipacindepersonalexternoespecializadoenlostemasdeintersconloscuales losalumnospodrninteractuarpormediodeconferenciasascomovisitasainstituciones acadmicasyprivadas.

EVALUACION

EVIDENCIAS Desempeo Producto Conocimiento Actitud Total

PONDERACIN 30 30 15 25 100%

BiologaContempornea

FDA03

IX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

SUGERENCIASPARATRABAJARLAASIGNATURA

Enelprogramaserealizalapresentacindelaasignatura,elpropsito,elproductoesperadoascomosu metodologaysuscriteriosdeevaluacin. Lasecuenciadidctica,lacualsedivideendiferentesaspectos: A. Encabezado: En este de especifica la asignatura, el nombre del Instructor, la unidad, tema y subtemasatratar. B. Motivacin: Son actividades que debe realizar el Instructor para despertar inters en el alumno paraelestudiodelostemas. C. Apertura: Este se realiza para comenzar la secuencia didctica y permite explorar que tanto se sabedelatemticaquesetratarenelobjetodeestudio. D. Desarrollo: Son acciones que facilitan y permiten el aprendizaje de los contenidos temticos revisados en la unidad. Estas actividades de aprendizaje son realizadas en las sesiones presencialesynopresenciales. E. Cierre:Sonprocesosqueseemplean paraconcluirloscontenidosdelaprendizajeadquirido. F. Mtodos y Tcnicas de enseanza: Son actividades de enseanzaaprendizaje que se llevan a cabodentrodelaulaparafacilitarelaprendizajedeloseducandos. G. Materialyequipodidctico:Sontodoslosrecursosmaterialesqueseutilizanparaeldesarrollode lasactividades. H. Actividades previas para el alumno: Son las que se realizan antes de tener contacto con toda lecturaocontenidosdelaunidad. I. Actividadesdelmaestro:Sonlasactividadesquedesarrollael Instructorparalarealizacindela secuenciadidctica. J. Bibliografa: Son todas aquellas fuentes de informacin donde se consulta, se complementa y se extraelainformacinrequerida.

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CUADROPROGRAMTICODESESIONESPRESENCIALES
Sesin Contenido Inicio Actividades Presentacindeldocente. Presentacindelprograma. Encuadre. Evaluacindiagnostica. PeriododeRecuperacin: 10al14deMarzodel2008. Hrs: 2.1.Bioelementos 2.2Biomoleculas Cierre Inicio UnidadIII 3.Nivelfisiolgico Sesiones correspondientes a la UnidadIII 3.1Transporte Del01al18deAbrildel2008. (activoypasivo) Evaluacin del 2 parcial del 21 3.2Respiracin al25deAbrildel2008. (aerobiayanaerobia) PeriododeRecuperacin: Del28 al30deAbrildel2008 . Hrs: 3.3Fotosntesis (Faseluminosayfaseobscura) 3.4Reproduccin (mitosisymeiosis) 3.5Ciclocelular Cierre Inicio UnidadIV Sesiones correspondiente a la 4Nivelgentico UnidadIVyV. Del06 al30deMayodel2008. 4.1cidosnucleicos 4.2Sntesisdeprotenas er Evaluacin del 3 parcialdel 02 UnidadV al06deJuniodel2008. PeriododeRecuperacin: Del09al13deJuniodel2008. Hrs: 5.Niveltecnolgico 5.1Biotecnologa 5.2DNArecombinante Cierre UnidadII. 2Nivelbioqumico Estrategiasdeaprendizaje. (grupal,enequipoeindividual)

UnidadI. Sesiones correspondientes a la unidadIyII 1.Nivelcelular Del05al29deFebrerodel2008. 1.1.Clulaeucariticas er Evaluacin del 1 parcialdel 03 1.2.Clulasprocariticas al07deMarzodel2008. 1.3Estructurayfuncin

Presentacindelaunidad. Encuadre. Estrategiasdeaprendizaje. (grupal,enequipoeindividual)

Presentacindelaunidad. Encuadre. Estrategiasdeaprendizaje. (grupal,enequipoeindividual)

BiologaContempornea

FDA03

XI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

UNIDADI
NIVELCELULAR

BiologaContempornea

FDA03

XII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

Biologacontempornea.

Nivelcelular

Subtema:

Antecedenteshistricos

Objetivo:

Altrminodeaunidadelalumnosercapazdeidentificarlasestructurascelulares yfuncionesencadaunodeellas. Antecedenteshistricosdelasclulas.

TemaIntegrador:

SECUENCIADIDCTICADEPRESENTACIN ACTIVIDAD DESARROLLO a)Atravsdelaintegracinenequiposselesproporcionarrevistascientficasy materiqal bibliogrfico para que el alumno pueda retroalimentarse y pueda as compartirsusideasconlosdems. 1.Motivacin b)Selesproporcionarnmaterialesdidcticosloscualesutilizarnparaplasmar susideas. c) Mediante una discusin los alumnos pueden unificar criterios del tema discutido. Tiempo:20min.

2.Apertura

Integrar equipos, analizar los temas a discutir y elaborar un mapa conceptual a cercadelosantecedenteshistricosdelaclula.(Previainvestigacindeltema). Tiempo:10min.

ACTIVIDAD

DESARROLLO

El mapa conceptual ser plasmado en un rotafolio con toda claridad y escritura legible. 3.Desarrollo Seseleccionarndosotresequiposqueexpondrnelmapaconceptual. Tiempo:10min.

BiologaContemporneo

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Se elegir el mapa conceptual mejor elaborado, unificando los criterios de todos losequipos,quedandoestocomoevidencia

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Integracindeequipos,tcnicasexpositivas.

Evidenciasdel Alumno

Elalumnocontarconsumapaconceptual,contando consusapuntesfinales delasdiscusionesysustareas.

Materialyequipo Didctico

Papelbonds,marcadores,juegosdegeometras,cintacanela,previainvestigacin deltema,rotafolios,lpicesyborrador.

Actividadesprevias paraelalumno

Investigacinpreviadeltema Anlisisdeltema. Elaboracindelmapaconceptual(porequipo).

Actividadesdel maestro

El facilitador se encargar de supervisar las actividades de los alumnos como orientador.

BiologaContemporneo

FDA03

XI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContemporneo

FDA03

XII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea.

Nivelcelular

Subtema:

Clulaeucarioticas

Objetivo:

Elalumnoconocerlaanatomadelasclulaseucariticas.

TemaIntegrador:

Laclulacomounorganismovivo.

SECUENCIADIDCTICA1 ACTIVIDAD DESARROLLO

1.Motivacin

El alumno traer diferentes modelos anatmicos (trabajo manual) de clulas eucariticas,pararepresentarloenformagrupal. Seintegraranenequiposparaidentificaryenlistarcadauna delaspartesquela componen.(10Minutos)

Este tema tiene como objetivo relacionar los conocimientos anteriores del estudiante,medianteunaprcticadelaboratorio(prctica1). 2.Apertura A) Mediante materiales didcticos se realizaran dibujos, en donde ejemplifiquelaspartesdelasclulas B) Los alumnos a travs de la prctica comprendern como se encuentraestructuradalaclulaeucarionte.

ACTIVIDAD

DESARROLLO

3.Desarrollo

a)Integracinenequipos. b)Seanalizaranlaspartesdelasclulas. c)Realizadoelanlisisseelaboraruncuestionarioguiadoporelfacilitador. d)Seleccionarunelementodecadaequipoparaladiscusindelcuestionario.

BiologaContemporneo

FDA03

XIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Seentregaradichocuestionarioalfacilitador. Elalumnodeberhabercomprendidocomoestaintegradaunaclulaeucariota.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Seintegraraequiposdetrabajo. Discusinguiada. Trabajorealizadosporequipo.

Cuestionarioseinformacinbibliogrficas. Evidenciasdel Alumno

Materialyequipo Didctico

Hojasblancas,lpiz,gomadeborrar,materialfotocopiado.

Actividadesprevias paraelalumno

Retroalimentacindelostemasquesediscutirn. Seleccindematerialesbibliogrficos

Actividadesdel maestro

1. El facilitador revisar que los alumnos cuenten con la informacin necesaria referentealostemaadesarrollar. 2.despejardudasdelalumnoyrealizaractividadeseneltiempomarcados. 3.revisarelinformedeloscuestionarioselaboradosporlosequipos.

BiologaContemporneo

FDA03

XIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContemporneo

FDA03

XV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea.

Nivelcelular

Subtema:

Clulaprocariotas

Objetivo:

En este tema el alumnoidentificara si las clulas procarionte consta de ncleo o no,lalocalizacindesuADNysutipodeforma. Clulaygentica.

TemaIntegrador:

SECUENCIADIDCTICA2 ACTIVIDAD DESARROLLO

1.Motivacin

En este tema los alumnos indagaran sobre el origen de la clula y algunas similitudes con los virus en donde se conocern la importancia de esta organizacin dentro de la biologa contempornea y ser estudiada de una forma definida.

2.Apertura

A manera de introduccin el facilitador iniciara con algunas preguntas del tema anterior para posteriormente dar inicio con el tema de clulas procariontes mostrandolminasconalgunasestructurascelulares. 1.Lasclulaseucariontespresentanncleo? 2.Queorganizacincelularpresentanloseucariontes? 3.mencionealgunosejemplosdeclulaseucariontes?

ACTIVIDAD

DESARROLLO

3.Desarrollo

Construir su propio aprendizaje mediante la informacin adquirida tomando en cuentaprcticasdelaboratorio,visitasdecampo,trabajosmanuales.

BiologaContemporneo

FDA03

XVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Al trmino de este tema el alumno tendr la capacidad de obtener su propio conceptoydiscutirloconsuscompaerosparaenriquecersusconocimientos.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Elaboracindecuestionarios,tablascomparativas,trabajosporequiposy cuestionamientos.

Evidenciasdel Alumno

InformacinbibliograficaeInternetyapuntes.

Materialyequipo Didctico

Bolasdeunicel,exacto,pinturas,hojasblancas,pintaron,marcadores,papelbond, cintasadhesivas,pegamento,plastilinas.

Actividadesprevias paraelalumno

Investigacinbibliograficaspreviassobreeltema. Seleccindematerialesdiversosparalaelaboracindeclulaprocarionte. Sellevaranaconcursoslosmejorestrabajosanivelgrupal.

Actividadesdel maestro

El facilitador revisara que los alumnos cuenten con la informacin necesaria enfocadosaltema. Despejarlasdudasdelalumnorealizandolasactividadeseneltiempomarcado.

BiologaContemporneo

FDA03

XVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContemporneo

FDA03

XVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea.

Nivelcelular

Subtema:

Estructurayfuncinde lamembranaplasmtica.

Objetivo:

El alumno conocerlas estructuras, funciones y caractersticasprincipales de las clulasydeunamembranaplasmticaformadadelpidosyprotenas,laformaen queseencuentransituadasensusuperficieinternayexterna. Clulaygentica.

TemaIntegrador:

SECUENCIADIDCTICA3 ACTIVIDAD DESARROLLO

1.Motivacin

Elalumnoconocerlamembranaexterior,laformaenqueseencuentransituados loscarbohidratosendondeseleasignaunaaparienciacaractersticasacadatipo celular y en donde los lpidos presentan dos tipos de movimientos (mediante practicasdelaboratorio).

2.Apertura

Comointroduccinelfacilitadorpedira3alumnosdarlelecturaalainformacin investigadayposteriormenteserealizarnpreguntasdeltemacomprendido: 1.Todaslasclulasposeenunamembranaexterior? 2.Porquienes? 3.Mencionealgunasfuncionesvitalesdelamembrana?

ACTIVIDAD

DESARROLLO

3.Desarrollo

Llevaracabounasesindepreguntasguiadasporelfacilitador. Realizarunmapaconceptualdelosconceptosmsimportantescomprendidosen eltema. Dirigirlapracticaenellaboratorio. Entregar el esquema de la estructura y funcin de la membrana para que el alumnorealicesuactividad. Realizartrabajo manual.

BiologaContemporneo

FDA03

XIX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Alfinalizarestetemaelalumnotendrlacapacidaddeobtenersupropioconcepto ydiscutirloconsuscompaerosyasenriquecersusconocimientos. Losalumnosentregaransustrabajomanualyloexpondrnfrentealgrupo. Elalumnoentregaraalfaciltadorunmapaconceptualdeltema. Elalumnoentregaraelreportedelaprcticaalfinalizarlaclase.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Elaboracindecuestionarios. Dibujosdeesquemasdelamembrana. Mesaredondaparaanalizareltema. Cuestionamiento.

Evidenciasdel Alumno

InformacinbibliograficaydeInternet. Apuntes Revistas(cientficas)

Materialyequipo Didctico

Hojasblancas,pintaron,marcadores,papelbond,cintaadhesivas,bolasdeunicel, exacto,pinturas.

Actividadesprevias paraelalumno

Investigacinbibliograficapreviasobreeltema. Seleccindematerialesdiversosparalaelaboracindelaestructuradela membranayforma. Exposicindeltrabajorealizado.

Actividadesdel maestro

Elfacilitadorverificaraquelosalumnoscuentenconlainformacinnecesaria. Despejardudasdelalumnosobreeltema.

BiologaContemporneo

FDA03

XX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

E
BiologaContemporneo FDA03 XXI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

ANEXO

LCELUL
PRACTICADELABORATORIOI Consultaelcontenidonutricionaldetresalimentosquetomesregularmenteeidentificaque molculasorgnicasymineralesaportan.

PRACTICAII tema:exudadofaringeo. Materiales:portaobjetosycubreobjetos,coloranterosadevngala,microscopioptico.

METODOLOGIA: Medianteunportaobjetoyuncubreobjeto Debidamentedesinfectadostomaunamuestradetumucosabucal,extindela,colocasobreellaunas gotasdecolorante (Rosadevngala)observaalmicroscopioeidentificalacluladetumucosa.

BiologaContemporneo

FDA03

XXII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CELULASPROCARIONTES

Lasclulasprocariontesnoposeenunncleocelulardelimitadoporunamembrana. Losorganismosprocariontessonlasclulasmssimplesqueseconocen.Enestegrupo seincluyenlasalgasazulverdosasylasbacterias.

BiologaContemporneo

FDA03

XXIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Las clulas procariotasson estructuralmente simples. Conformaron a losprimeros organismos del tipo unicelular. stas tenan un ADN cerrado circular, el cul se encontraba disperso en el citoplasma ausente de ncleo. La clula no tena organelos a excepcin de ribosomas, ni estructuras especializadas. Como no poseen mitocondrias, obtienen energa del medio mediante mesosomas o invaginacionesenlamembrana.Susmayoresrepresentantessonlasbacterias.

Clulas Procariontes: Su nombre significa antes del ncleo. Son organismos muy
primitivos que consisten en clulas nicas. No estn diferenciadas en ncleo y citoplasma.

Estetipodeclulasestnrepresentadasprincipalmenteporundeterminadotipodealgas microscpicas(algasverdesyazulesCianfitas)yporlasbacterias,pertenecenalgrupo delasMoneras.ElADNdelasclulasprocariticasestconfinadoaunaomsregiones nucleares, que se denominan nucleoides, que se encuentran rodeados por citoplasma, perocarecendemembrana.Enlasbacterias,elnucleoideestaformadoporunpedazode ADN circular de aproximadamente 1 mm de largo, torcido en espiral, que constituye el materialgenticoesencial. Estas clulas son las ms primitivas de nuestro planeta, hicieron su aparicin en los ocanos hace aproximadamente 4 mil millones de aos. Elresto fsildelos organismos procariontes deesta poca forman columnas fosilizadas de aproximadamente 10 metros dealtollamadosestromatolitos(selossuelehallarenaustralia). Las ciantitas, algas verdeazules, son generalmente ms grandes que las clulas bacterianas, realizan la fotosntesis mediante vas metablicas comunes a las plantas y algas,peronoalasbacterias. Un gran nmero de clulas procariticas, estn rodeadas por paredes celulares, que carecen de celulosa, lo que las hace diferentes de las paredes celulares de las plantas superiores.Enlaparteinternadelaparedcelular,seencuentralamembranaplasmticao plasmalema, la cual puede serlisa o puede tenerinvaginaciones,llamados mesosomas, donde se llevan a cabo las reacciones de transformacin de energa (fotosntesis y respiracin). En el citoplasma, se encuentran losribosomas, donde se realizala sntesis deprotenas.Asmismo,elcitoplasmadelasclulasprocariticasmscomplejaspuede contener tambin vacuolas, vesculas (pequeas vacuolas) y depsitos de reserva de azucarescomplejosomaterialesinorgnicos.Enalgunasalgasverdeazuleslasvacuolas estnllenasconnitrgenogaseoso. MEMBRANAPLASMATICA Elcontenidodetodaslasclulasvivasestrodeadoporunamembranadelgadallamada membranaplasmtica,ocelular,quemarcaellmiteentreelcontenidocelularyelmedio
BiologaContemporneo FDA03 XXIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

externo. La membrana plasmtica es una pelcula continua formada por molculas de lpidos, protenas e hidratos de carbono en proporciones aproximadas de 40%, 50% y 10%,respectivamente.Loslpidosformanunadoblecapaylasprotenassedisponende una forma irregular y asimtrica entre ellos. Estos componentes presentan movilidad, lo queconfierealamembranaunelevadogradodefluidez(cristallquido),conunespesor entre8y10nanmetros(nm).ActacomobarreraSemipermeableySelectivaregulando lacomposicinqumicadelaclula.

UNIDAANEXOS

DI
N

BiologaContemporneo

FDA03

XXV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

RESUMEN

Enestaunidaddenivelcelularseabordaranlascaractersticasque identificanalosorganismosatravsdelosdeclulasprocariontes, estructurayfuncin. En1838,MathiasSchleidenestableciquetodoslostejidosvegetales estabanformadosporclulas. Estoshechosservirandebaseparaelestablecimientodelosque despusserialateoracelular,lacualsefortalecimas. Losprincipiosenlosquesebasaactualmentelateoracelularsonlos siguientes: 1._Todoslosorganismosestnformadosporclulas. 2._Lasclulasproceden,pordivisin,deotrasclulasyaexistentes. 3._Lasclulassonunidadesestructuralesyfuncionales. 4._Laclulaeslamnimaunidaddelamateriaviva. Todoslospostuladosdeestateorasiguenteniendolamismavalidezenla actualidad.

BiologaContemporneo

FDA03

XXVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CRITERIOSEVALUACIN UNIDADI
CRITERIOS Producto PORCENTAJE 30

Desempeo

30

Conocimiento

15

Actitud

25

Total

100%

BiologaContemporneo

FDA03

XXVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

UNIDADII
NIVELBIOQUIMICO ELCELULAR

UNIDADI
N
BiologaContemporneo FDA03 XXVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea.

Nivelbioquimico

Subtema:

Bioelementos.

Objetivo:

Elalumnoalfinaldeltemaconocercualeslacomposicinqumicadelasclulas.

TemaIntegrador:

Laqumicacomocomposicindelamateriaviva.

SECUENCIADIDCTICA4 ACTIVIDAD DESARROLLO

*Conlaproyeccindeundiagramadelosbioelementosdeunaclulaelalumno observaralosdistintoscompuestosestructuralesconstituyentes. 1.Motivacin *Atravsdelainformacinadquiridaelalumnorealizaramodeloscomparativosde lacomposicinqumicadelaclula.

2.Apertura

El alumno realizar un resumen a cerca de la informacin comprendida de la proyeccindemaneraindividual. Realizacindeuntrabajomanualporequipo.

ACTIVIDAD

DESARROLLO

E3.Desarrollo

Mediante la investigacin previa del tema, relacionar por medio de un mapa conceptuallosdiversoscriteriosdeloscompaeros.

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Alfinalizarlasesinelalumnotendrlosconocimientosadquiridosacercadelos bioelementosparapoderretroalimentarloaprendido.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Tcnicasaudiovisuales,informacinbibliograficas,trabajoporequipo, cuestionamiento,trabajoindividual,mapaconceptualyresumen.

Evidenciasdel Alumno

Informacinbibliograficas,mapaconceptualyresumen.

Materialyequipo Didctico

Proyector de diapositivas, bibliografas, papel bond, marcadores cinta canela, hojasblancas,lpices.

Actividadesprevias paraelalumno

Investigacinbibliograficas,seleccindelosmaterialesyequiposdidcticos.

Actividadesdel maestro

Revisindelmaterialbibliogrficos,asesoriaaalumnosdurantelasesin,despejar dudas.

BiologaContempornea

FDA03

XI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador NivelBioquimico Subtema: Biomoleculas

Objetivo:

Conocer la composicin qumica y funciones de las biomoleculas para la comprensindelmetabolismocelular. Compuestosorgnicoseinorgnicos.

TemaIntegrador:

SECUENCIADIDCTICA5 ACTIVIDAD DESARROLLO

1.Motivacin

1.IntegrarequiposconlatcnicadeFhillips6:6,asignandoacadaintegrandocon elnombredeunabiomolecula.(5min.) 2. En equipo aprenderse cada integrante el nombre de las biomoleculas que lo integran(5min). 3.alfinarseleccionarunrepresentantequesehayaaprendidolasbiomoleculasy lasmencioneenvozalta(10min.)

2.Apertura

1. investigacin previa del tema, mediante fichas de trabajo y anotar en el encabezadolacitabibliograficaconsultada. 2.elfacilitadorrevisarindividualmentelainformacinpararealizarunapractica.

ACTIVIDAD

DESARROLLO

3.Desarrollo

En equipos ejemplificar con un cuadro sinptico la clasificacin de las biomoleculas anotando la definicin, alimentos que la contienen, enfermedades porcarenciayfuncinorgnica. Seleccionardostrabajosdeequiposyexponerlos

BiologaContempornea

FDA03

XIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Alfinalizarlaseccinelfaciltadordarunaconclusingeneralacercadeltemaa losalumnos.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Tcnicasdeintegracindeequipos,tcnicasdidcticas(fichasdetrabajoy cuadrossinpticos).

Evidenciasdel Alumno

Fichasdetrabajo,apuntesdeinvestigacindeltema,cuadrossinpticos.

Materialyequipo Didctico

Papel bond, hojas blancas, marcadores, cinta canela, juego de geometra, cartulinas,lapiceros(negraazul),

Actividadesprevias paraelalumno

Investigacinbibliografica. Lecturayanlisisdelainformacin. Retroalimentacinporequipossobreeltema.

Actividadesdel maestro

Supervivcinyguadelasactividades. Calificar las fichas de trabajo, cuadro sinpticos y participacin (individual y equipo)delosalumnos.

BiologaContempornea

FDA03

XIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

ANEXO

MOLECULASORGANICASEINORGANICAS Enlosorganismosseencuentrancuatrotiposdiferentesdemolculasorgnicasengran cantidad:carbohidratos,lpidos,protenasynucletidos.Todasestasmolculascontienen carbono, hidrgeno yoxgeno. Adems, lasprotenas contienen nitrgeno y azufre, ylos nucletidos,ascomoalgunoslpidos,contienennitrgenoyfsforo. Se ha dicho que es suficiente reconocer cerca de 30 molculas para tener un conocimiento que permita trabajar con la bioqumica de las clulas. Dos de esas molculassonlosazcaresglucosayribosaotra,unlpidootrasveinte,losaminocidos biolgicamente importantes y cinco las bases nitrogenadas, molculas que contienen nitrgenoysonconstituyentesclavesdelosnucletidos. En esencia, la qumica de los organismos vivos es la qumica de los compuestos que contienencarbonoosea,loscompuestosorgnicos. Elcarbonoessingularmenteadecuadoparaestepapelcentral,porelhechodequeesel tomo ms liviano capaz de formar mltiples enlaces covalentes. A raz de esta capacidad, el carbono puede combinarse con otros tomos de carbono y con tomos distintos para formar una gran variedad de cadenas fuertes y estables y de compuestos conformadeanillo.Lasmolculasorgnicasderivansusconfiguracionestridimensionales primordialmentedesusesqueletosdecarbono.Sinembargo,muchasdesuspropiedades especficas dependen de grupos funcionales. Una caracterstica general de todos los compuestosorgnicosesqueliberanenergacuandoseoxidan.Entrelostiposprincipales de molculas orgnicas importantes en los sistemas vivos estn los carbohidratos, los lpidos,lasprotenasylosnucletidos. Loscarbohidratossonlafuenteprimariadeenergaqumicaparalossistemasvivos.Los ms simples son los monosacridos ("azcares simples"). Los monosacridos pueden combinarseparaformardisacridos("dosazcares")ypolisacridos(cadenasdemuchos monosacridos). Loslpidossonmolculashidrofbicasque,comoloscarbohidratos,almacenanenergay son importantes componentes estructurales. Incluyen las grasas y los aceites, los fosfolpidos,losglucolpidos,lasceras,yelcolesterolyotrosesteroides. Las protenas son molculas muy grandes compuestas de cadenas largas de aminocidos,conocidascomocadenaspolipeptdicas.Apartirdesloveinteaminocidos diferentes usados para hacer protenas se puede sintetizar una inmensa variedad de diferentes tipos de molculas protenicas, cada una de las cuales cumple una funcin altamenteespecficaenlossistemasvivos. Los nucletidos son molculas complejas formadas por un grupo fosfato, un azcar de cinco carbonos y una base nitrogenada. Son los bloques estructurales de los cidos desoxirribonucleico(DNA)yribonucleico(RNA),quetransmitenytraducenlainformacin
BiologaContempornea FDA03 XVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

gentica.Losnucletidostambindesempeanpapelescentralesenlosintercambiosde energa que acompaan a las reacciones qumicas dentro de los sistemas vivos. El principalportadordeenergaenlamayoradelasreaccionesqumicasqueocurrendentro delasclulasesunnucletidoquellevatresfosfatos,elATP

BiologaContempornea

FDA03

XVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Lamateria,inclusolaqueconstituyelosorganismosmscomplejos,estconstituidapor combinacionesdeelementos.EnlaTierra,existenunos92elementos.Muchossonmuy conocidos,comoelcarbono,queseencuentraenformapuraeneldiamanteyenel grafitoeloxgeno,abundanteenelairequerespiramoselcalcio,queutilizanmuchos organismosparaconstruirconchas,cscarasdehuevo,huesosydientes,yelhierro,que eselmetalresponsabledelcolorrojodenuestrasangre.Lapartculamspequeadeun elementoeseltomo.Lostomos,asuvez,estnconstituidosporpartculasms pequeas:protones,neutronesyelectrones. Enlaactualidad,losfsicosexplicanlaestructuradeltomopormediodelmodeloorbital. Lostomossonlaspiezasfundamentalesdetodalamateriavivaynoviva.Aunas,son muypequeosyconstituyenunespacioeminentementevaco.Loselectronessemueven alrededordelncleoaunagranvelocidadunafraccindelavelocidaddelaluzsiendola distanciaentreelelectrnyelncleo,enpromedio,unas1.000veceseldimetrodel ncleo. Enuntomo,existeunantimarelacinentreloselectronesylaenerga.Enunmodelo simplificado,ladistanciadeunelectrnalncleoestdeterminadaporlacantidadde energapotencialo"energadeposicin"queposeeelelectrn.As,loselectrones tienendiferentescantidadesdeenergadeacuerdoasuubicacinconrespectoalncleo y,asuvez,sunmeroydistribucindeterminaelcomportamientoqumicodeuntomo. Laspartculasformadaspordosomstomosseconocencomomolculasquese mantienenjuntaspormediodeenlacesqumicos.Dostiposcomunessonlosenlaces inicosylosenlacescovalentes. Lasreaccionesqumicasinvolucranelintercambiodeelectronesentrelostomosy puedenrepresentarseconecuacionesqumicas.Trestiposgeneralesdereacciones qumicasson: a. lacombinacindedosomssustanciasparaformarunasustanciadiferente, b. ladisociacindeunasustanciaendosoms,y c. elintercambiodetomosentredosomssustancias. Lassustanciasformadasportomosdedosomselementosdiferentes,enproporciones definidasyconstantes,seconocencomocompuestosqumicos. Losseresvivosestnconstituidosporlosmismoscomponentesqumicosyfsicosquelas cosassinvida,yobedecenalasmismasleyesfsicasyqumicas.Seiselementos(C,H, N,O,PyS)constituyenel99%detodalamateriaviva.Lostomosdeestoselementos sonpequeosyformanenlacescovalentesestablesyfuertes.Conexcepcindel hidrgeno,todospuedenformarenlacescovalentescondosomstomos,dandolugara lasmolculascomplejasquecaracterizanalossistemasvivos.

BiologaContempornea

FDA03

XVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Enlosseresvivoslamateriaseordenaenlosllamadosnivelesdeorganizacinbiolgica. Cadanivel,desdeelsubatmicohastaeldelabiosfera,tienepropiedadesparticulareso emergentesquesurgendelainteraccinentresuscomponentes.

BiologaContempornea

FDA03

XIX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

RESUMEN

Enlosorganismosseencuentrancuatrotiposdiferentesdemolculasorgnicasengran cantidad:carbohidratos,lpidos,protenasynucletidos.Todasestasmolculascontienen carbono, hidrgeno yoxgeno. Adems, lasprotenas contienen nitrgeno y azufre, ylos nucletidos,ascomoalgunoslpidos,contienennitrgenoyfsforo. Se ha dicho que es suficiente reconocer cerca de 30 molculas para tener un conocimiento que permita trabajar con la bioqumica de las clulas. Dos de esas molculassonlosazcaresglucosayribosaotra,unlpidootrasveinte,losaminocidos biolgicamente importantes y cinco las bases nitrogenadas, molculas que contienen nitrgenoysonconstituyentesclavesdelosnucletidos

Los elementos son,por definicin, sustancias queno pueden ser desintegradas en otras sustancias por medios qumicos ordinarios. De los 92 elementos naturales de la Tierra, slo seis constituyen aproximadamente el 99% de todos los tejidos vivos. Estos seis elementossonelcarbono,elhidrgeno,elnitrgeno,eloxgeno,elfsforoyelazufre,a loscualesselosconoceconlasiglaCHNOPS.Sinembargo,nosonloselementos ms abundantesenlasuperficiedelaTierra. Por qu, cuando la vida se organiz y evolucion, fueron estos elementos tan importantes? Una clave es que los tomos de todos estos elementos necesitan ganar electrones para completar sus niveles de energa exteriores. As, generalmente forman enlacescovalentes.Dadoqueestostomossonpequeos,loselectronescompartidosen los enlaces se mantienen prximos a los ncleos, produciendo molculas muy estables. Ms aun, con excepcin del hidrgeno, los tomos de todos estos elementos pueden formarenlacescondosomstomos,haciendoposiblelaconstitucindelasmolculas grandesycomplejasesencialesparalasestructurasyfuncionesdelossistemasvivos.

BiologaContempornea

FDA03

XX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CRITERIOSEVALUACIN UNIDADI
CRITERIOS Producto PORCENTAJE 30

Desempeo

30

Conocimiento

15

Actitud

25

Total

100%

BiologaContempornea

FDA03

XXI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

UNIDADIII
NIVELFISIOLOGICO

BiologaContempornea

FDA03

XXII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Nivelfisiolgico Subtema: Transporteactivoypasivo

Objetivo:

Al trmino de esta unidad, el alumno tendr los conocimientos y describir las funcionescelularesatravsdelanlisisdelosprocesosmetablicos. Funcionesbiolgicasdelosseresvivos.

TemaIntegrador:

SECUENCIADIDCTICA6 ACTIVIDAD DESARROLLO

1.Motivacin

1.paramotivarelintersdelalumnoseutilizaranrotafolios,maquetasyplenarias. 2.trabajandoen equipo,ycompletandoenelpizarrnuncuadro deinformacin destacandolaimportanciayfuncindeltransporteactivopasivoyposteriormente copiarenlalibreta.

2.Apertura

1.seorganizaranequiposdecincopersonas. 2.sedeberanalizareltemaencincominutos. 3. analizar cuestionarios de diez preguntas y respuestas de dicho tema y sus funciones(tiempodeduracin10min.) 4. al trmino del cuestionario nombrar a un integrante del equipo para exponer anteelgrupo.

ACTIVIDAD

DESARROLLO

3.Desarrollo

1. elaborar unamaqueta dela clula destacando cada de las partes de ellas, el cualelalumnodeberrealizarloencasaporequipo. 2. por equipo expondrn su maqueta de la clula frente a grupo en forma de plenaria(tiempo:30min.)

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Al trminodelaexposicindelosalumnos,eldocentedarunaconclusinclara deltema.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

1.formarequiposdisciplinaria 2.Exposicin 3.Elaboracindemaquetas 4.Utilizacinderotafolios

Evidenciasdel Alumno

1.Cuestionarios 2.exmenes 3.investigacin 4.trabajosdidcticos

Materialyequipo Didctico

Bolas de unicel, plastilinas, pegamento, cartulinas, lpices de colores, pintura textil,cintasdecolores,tijeras,etc.

Actividadesprevias paraelalumno

1.investigacinbibliograficasyrevistascientficasactualizadas 2.informacinvaInternet

Actividadesdel maestro

1.revisindelasinvestigaciones 2.asesorispararealizarmaquetas 3.coordinardinmicasdeexposiciones 4.evaluacindeltrabajofinalalterminodeltema

BiologaContempornea

FDA03

XI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Nivelfisiolgico Subtema: Respiracinanaerobiay anaerobia

Objetivo:

Elalumnocomprenderporquelosorganismosnecesitanenergaparamantener suestructurayrealizarsusfuncionesvitales. Funcionesbiolgicasdelosseresvivos

TemaIntegrador:

SECUENCIADIDCTICA7 ACTIVIDAD DESARROLLO

1.Motivacin

1.llevaralosalumnosalabiblioteca,paralainvestigacindedichotema,enla queresaltaranlos puntosmsimportantesdelarespiracinaerobiayanaerobia, posteriormente se recopilara toda la informacin obtenida para analizar una pequeaantologaparalasclasesposteriores.

2.Apertura

Formacin de equipos en las cuales los alumnos elaboraran un cuadro comparativo y se mostraran algunos organismos que presenten los tipos de respiracinanaerobiayaerobia.

ACTIVIDAD

DESARROLLO

3.Desarrollo

1.mediante una plenaria los alumnos expondrn frente a grupo los tipos de respiracinyqueorganismoslaspresentan. 2. elaboraran un listado de forma individual en la que ellos puedan plasmar las diferencias.

BiologaContempornea

FDA03

XIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Altrminodeltemaeldocentedarunaconclusinfinalyrevisindeloslistados laboradosdeformaindividualporelalumno.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

1.investigacinyvisitasalabiblioteca 2.exposicionesdeltema 3.anlisisporequipo

Evidenciasdel Alumno

Revisindelibretasconeltemainvestigado Revisindecuadroscomparativos.

Materialyequipo Didctico

Hojasblancas,plumones,recortes,tijeras,pegamento,bibliografas.

Actividadesprevias paraelalumno

1.seleccionarrevistaspararecortesenclases 2.bibliografas 3.libretas

Actividadesdel maestro

Facilitarlas herramientas necesarias para que el alumno pueda levar a cabo su investigacinparasuposteriorexposicin

BiologaContempornea

FDA03

XIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Nivelfisiolgico Subtema: Fotosntesis:fase luminosasfaseobscura

Objetivo:

Elalumnoidentificaralasplantasverdescomoorganismosquerealizanelproceso fotosinttico. Funcionesbiolgicasdelosseresvivos

TemaIntegrador:

SECUENCIADIDCTICA8 ACTIVIDAD DESARROLLO

1.Motivacin

1.serealizaraunavisitaguiadaalcampoparaqueelalumnoobserveytomenota delagranvariedaddeecosistemasqueexistenendeterminadomedio. 2. colectar agua de estanques, arroyo, ros, lagos y hojas de plantas seleccionadas,etc.

2.Apertura

Identificara en la bibliografa los organismos fotosintetizadotes y que importancia tienelaluzsolarenestos.

ACTIVIDAD

DESARROLLO

3.Desarrollo

Observaciones en el microscopio ptico y elaboracin de dibujos con las caractersticasdelosorganelosquellevanacabolafotosntesis

BiologaContempornea

FDA03

XVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Elalumnoentregaralasobservacionesrealizadasporescritosaldocenteparasu posteriorevaluacin

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Salidaalcampo Observacinyanlisis Visitasalaboratorios. Recoleccindemuestras

Evidenciasdel Alumno

Trabajosydibujosrealizados. Reportedelavisitaacampo

Materialyequipo Didctico

Agua de arroyo y ros, frascos, hojas blancas reciclables, navajas, microscopio ptico,portaobjetosycubreobjetos

Actividadesprevias paraelalumno

Investigacinbibliogrfica. Anlisisencasadelasplantasquenecesitanmasluzqueotras.

Actividadesdel maestro

Coordinarlasvisitasguiadas. Asesoriasenprcticasdelaboratorio. Revisindelreporte

BiologaContempornea

FDA03

XVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Nivelfisiolgico Subtema: Reproduccin.

Objetivo:

Alfinalizareltemalosalumnoscomprendernyconocernlosdiferentestiposde reproduccincelularexistentes. Lareproduccincomomediodesobrevivencia.

TemaIntegrador:

SECUENCIADIDCTICA9 ACTIVIDAD DESARROLLO

1.Motivacin

1. A travs de la observacin de un organismo vivo el alumno identificara las partesqueparticipanenlareproduccin(prcticadelaboratorio). 2. Se identificaran los procesos mediante los cuales un organismo celular se reproducen. 3.Serealizarlaprcticasobrereproduccin.

2.Apertura

El alumnoinvestigaralos diferentes tipos de reproduccin existentes en elmedio ambiente Serespondernlassiguientespreguntas: 1.Queeslareproduccin. 2.Cuantostiposexisten. 3.comosellevanacabocadaunodeellos.

ACTIVIDAD

DESARROLLO

3.Desarrollo

1.Losalumnosseintegraranenequipos. 2. A travs de la informacin consultada elaborar modelos anatmicos de los sistemasreproductores.

BiologaContempornea

FDA03

XIX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Atravsdeladiscusinporequiposerealizarunaretroalimentacindeltema,la cualestarbasadaenladiscusingrupaldeltema.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Atravsdelusodelasdiferentestcnicas:Lluviasdeideas,discusionesdirigidas, trabajoenequipos. Anlisisdelostemas,discusindecuestionarios.

Evidenciasdel Alumno

Cuestionarioqueserentregadoalfacilitador. Apuntesdeladiscusindetemas.

Materialyequipo Didctico

Proyector,rotafolio,pintarrn,marcadores,cintacanela,acetatos,papelbond.

Actividadesprevias paraelalumno

1.Elalumnorealizaralainvestigacindeltema. 2.Elalumnorealizaraelanlisisdeltema. 3.Porequipolosalumnosrealizaranladiscusindeltema.

Actividadesdel maestro

1.Guiaralosalumnosenladiscusindeltema. 2.coordinarlostrabajosrealizadosporlosequipos. 3.Aportaralosalumnosinformacindelasdudasplasmadasporellos.

BiologaContempornea

FDA03

XX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XXI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Nivelfisiolgico Subtema: Ciclocelular.

Objetivo:

Losalumnosdebernconocerlosdiferentescicloscelularesquetienenlasclulas.

TemaIntegrador:

Elciclocelularcomounafuncindelaclula.

SECUENCIADIDCTICA10 ACTIVIDAD DESARROLLO

1.Motivacin

1. A travs de la observacin de videos sobre las clulas, su reproduccin y crecimientoelalumnocomprenderlasfasesdelciclocelular(Discusingrupal). 2.identificaralasdistintasetapasqueunaclulaencrecimientovarealizando.

2.Apertura

1.Elalumnoatravsdeunarecopilacinbibliograficaidentificaracadaunodelos ciclos. 2. Por medio de una discusin grupal o en equipos el alumno corroborara los conocimientosadquiridos.

ACTIVIDAD

DESARROLLO

3.Desarrollo

1.Integracinenequipos. 2.Elaboracindemapasconceptualesdelosdistintoscicloscelulares. 3.Lostemasserndiscutidosenelaulaatravsdelaseleccindeunintegrante porequipo.

BiologaContempornea

FDA03

XXII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Conlaseleccindeunintegrantedecadaequipo,serealizarunadiscusinpara llegaraunaretroalimentacinfinaldeltema.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Atravsdelusodelasdistintastcnicasdeenseanzaselosalumnosrealizarn elanlisisdeltema.

Evidenciasdel Alumno

Debertenerelmapaconceptualentregadoalfacilitador.

Materialyequipo Didctico

Papelbond,rotafolios,marcadores,cintacanela,proyector,acetatos,etc

Actividadesprevias paraelalumno

Realizaralainvestigacinbibliograficasobreeltema. Analizarlainformacindeltemainvestigado.

Actividadesdel maestro

Coordinarladiscusindelosmapasconceptuales. Realizar una retroalimentacin para responder a las dudas que les quede a los alumnos.

BiologaContempornea

FDA03

XXIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma Yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XXIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

ANEXO

TRANSPORTEACTIVO Transporte activo, mecanismo que permite a la clula transportar sustancias disueltas a travs de su membrana desde regiones menos concentradas a otras ms concentradas.Esunprocesoquerequiereenerga.Normalmente,lassustanciasdisueltas en forma de partculas con carga elctrica llamadas iones tienden a difundirse o pasar pasivamente desde regiones de concentracin alta a otras de concentracin baja, de acuerdoconelgradientedeconcentracin.Eseprocesonaturaldedifusintiendeaque las sustancias se distribuyan de manera uniforme. Sin embargo, el transporte activo invierte esa tendencia, pues el proceso vital de una clula requiere que algunas sustancias,comonutrientesricosenenerga,mineralesodesechos,pasenatravsdela membrana en contra del gradiente de concentracin. Ese transporte es activo porque requiereenerga,yaquefuncionaencontradelafuerzadeladifusin.Eltransporteactivo permite a la clula regular y controlar el movimiento de sustancias, transportndolas al interioroalexterior. La membrana de la clula es un portero molecular muy selectivo. Contiene una capacontinuadelpidosyprotenasqueactacomounabarreraselectivapararegularla composicinqumicadelaclula.Elpasodelamayoradelassustanciasdisueltasest regulado por unas protenas especiales llamadas protenas transportadoras, que estn incrustadas en esa espesa capa. La sustancia se une al transportador en un lado de la membrana. En el transporte activo, la protena transportadora utiliza energa para bombearlasustanciaatravsdelamembranaalreadeconcentracinalta,encontra delgradientedeconcentracin.Laenergaesproporcionadaporeltrifosfatodeadenosina (ATP), la sustancia que la clula emplea como fuente de energa en casi todos los procesos,quetrasladasuenergaalaprotenatransportadora,convirtindoseellamisma en una forma de energa baja, llamada difosfato de adenosina (ADP). La protena transportadora utiliza la energa para cambiar su forma o configuracin, transportar la sustancia a travs de la membrana y liberarla en el otrolado. Algunas sustancias, como los iones de sodio y potasio, tienen sus propias protenas transportadoras y sus propios mecanismos de bombeo. Mediante el bombeo del sodio y del potasio, el potasiopasa al interiordelaclulaaltiempoqueseexpulsaelsodio.Esosbombeosseproducensobre todoenlasmembranasdelasclulasnerviosas(vaseNeurofisiologa),dondeelrpido movimientodelsodioyelpotasioatravsdelamembranadelaclulamarcaelpasode una seal nerviosa. Los bombeos de calcio son importantes en la contraccin muscular. Existen tambin protenas transportadoras menos especficas, que pueden transportar diversasclasesdeiones. Las molculas algo mayores, como las de los azcares y los aminocidos (los componentes delas protenas), son movidas por transporteactivo secundario. Losiones ms pequeos son bombeados por transporte activo primario, como se ha descrito ms arriba,paraestablecerunaconcentracinogradienteelctricoatravsdelamembrana.
BiologaContempornea FDA03 XXV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Esegradienterepresentaunadiferenciaenlosnivelesdeenergaentrelosdosladosdela membrana,quepermitealasmolculasmsgrandescruzarlamembranaencontradeun gradientedeconcentracin. El agua tambin puede moverse mediante transporte activo. Las protenas transportadoras pueden transportar activamente una sustancia como el sodio, haciendo que su concentracin sea mayor a un lado que a otro de la membrana. El agua sigue entonces el proceso natural de smosis, tratando de que la zona ms concentrada se vuelvamenosconcentrada.

ELPROCESODELARESPIRACIN Los organismos de los reinos Protistas y Mneras no tienen mecanismos respiratorios especializados, sino que realizan el intercambio de oxgeno y dixido de carbonopordifusin,atravsdelamembranacelular.Laconcentracindeoxgenoenel interiordelorganismoesmenorqueladelmedioexterior(areooacutico),mientrasque laconcentracindedixidodecarbonoesmayor.Comoresultado,eloxgenopenetraen el organismo por difusin y el dixido de carbono sale por el mismo sistema. La respiracindelasplantasylasesponjassebasaenunmecanismomuyparecido. En los organismos acuticos inferiores (ms complejos que las esponjas), hay un fluido circulatorio, de composicin similarala delagua de mar, que transportalos gases respiratoriosdesdeelexteriordelostejidosalinteriordelasclulas.Estemecanismoes necesario, ya que las clulas se encuentran alejadas del lugar donde se realiza el intercambiogaseoso.Enlosanimalessuperiores,losrganosseespecializan,aumentan lasuperficiedeexposicindelfluidocirculatorioalmedioexternoyelsistemacirculatorio transporta este medio lquido por todo el organismo. El fluido, llamado sangre, contiene pigmentos respiratorios que son molculas orgnicas de estructura compleja, formadas porunaprotenayungrupoprostticoquecontienehierro. El pigmento respiratorio ms comn es la hemoglobina, que est presente en la sangredecasitodoslosmamferos.Esunaprotenaglobulinaconungrupohemoyunion hierro. En algunos insectos, el pigmento respiratorio es la hemocianina, un compuesto similar a la hemoglobina, pero que lleva cobre en lugar de hierro. La propiedad ms importante de los pigmentos respiratorios es la afinidad que poseen por el oxgeno. La hemoglobina forma una combinacin qumica reversible con el oxgeno cuando est en contactoconunmedioricoenestegas,comoeslaatmsfera.Estecontactotienelugar en los capilares de los rganos respiratorios, las branquias y los pulmones. La hemoglobina en combinacin con el oxgeno (la oxihemoglobina) es ms cida y, en consecuencia, provoca la disociacin de los iones bicarbonato y carbonato de sodio del plasma sanguneo. Cuando la sangre oxigenada (rica en oxihemoglobina) llega a los tejidos,elbalancedeoxgenoseinvierteylahemoglobinaliberaoxgeno.Alvolversems bsica, provoca la liberacin deiones sodio que se combinan con el dixido de carbono procedente delos tejidos para formar bicarbonato de sodio. La respiracin externa es el intercambiodegasesentrelasangreyelexterior,ylarespiracininternaeselintercambio degasesentrelasangreylostejidos.VerAparatocirculatorio.
BiologaContempornea FDA03 XXVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Aerobio (delgriegoaer,airebios,vida),organismoqueslopuededesarrollarse en presencia de oxgeno atmosfrico, del que precisa para la respiracin. La atmsfera puedeserareaosubacutica,yaqueexisteairedisueltodentrodelasmasasdeagua (los peces son organismos aerobios que respiran aire disuelto). La atmsfera area contiene,almenos,20vecesmsoxgenoquelaacutica,loquecondicionaeldiseode losrganosrespiratoriosdelosanimalesdevidaareaoacutica.
La mayora de los animales y de las plantas son aerobios oxidan completamente loscombustiblesdelorganismoparadesprenderdixidodecarbonoyaguaenunproceso quesedenominarespiracin.Losorganismosquenoutilizanoxgenoparalarespiracin son denominados anaerobios, existiendo otros, como las levaduras, que se comportan comoaerobiosfacultativos,puespuedenutilizarunouotrosistemaderespiracin. La aerobiosis es independiente del carcter auttrofo o hetertrofo de los organismos.

Anaerobio , organismo que puede vivir sin oxgeno. Los organismos anaerobios disponen de un metabolismo que produce energa a partir de nutrientes que carecen de oxgeno, habitualmente a travs de procesos de fermentacin, aunque en ocasiones, como en el caso de los que habitan en las profundas grietas hidrotermales marinas, lo hacen mediante reacciones que emplean compuestos qumicos inorgnicos. Todos los anaerobios son organismos simples, como las levaduras y las bacterias aquellos organismos que mueren en presencia de oxgeno se denominan anaerobios estrictos, mientrasqueelrestoseconocenconelnombredeanaerobiosfacultativos.
RESPIRACIONAEROBIO Respiracin,procesofisiolgicoporelcuallosorganismosvivostomanoxgenodel medio circundante y desprenden dixido de carbono. El trmino respiracin se utiliza tambinparaelprocesodeliberacindeenergaporpartedelasclulas,procedentedela combustin de molculas como los hidratos de carbono y las grasas. El dixido de carbonoyelaguasonlosproductosquerindeesteproceso,llamadorespiracincelular, para distinguirlo del proceso fisiolgico global delarespiracin. La respiracin celular es similar en la mayora de los organismos, desde los unicelulares, como la ameba y el paramecio, hasta los organismos superiores (ver Metabolismo). Para ms informacin sobrelarespiracinenplantas,verFotosntesis.

FOTOSINTESIS Procesoenvirtuddelcuallosorganismosconclorofila,comolasplantasverdes,las algas yalgunas bacterias, capturanenergaen forma de luz y la transforman en energa qumica.Prcticamentetodalaenergaqueconsumelavidadelabiosferaterrestrela zonadelplanetaenlacualhayvidaprocededelafotosntesis.

BiologaContempornea

FDA03

XXVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Una ecuacin generalizada y no equilibradade lafotosntesis en presencia deluz sera: CO2+2H2A(CH2)+H2O+H2A El elemento H2A de la frmula representa un compuesto oxidable, es decir, un compuestodelcualsepuedenextraerelectronesCO2eseldixidodecarbonoCH2una generalizacin de los hidratos de carbono que incorpora el organismo vivo. En la gran mayoradelosorganismosfotosintticos,esdecir,enlasalgasylasplantasverdes,H2A esagua(H2O)peroenalgunasbacteriasfotosintticas,H2Aesanhdridosulfrico(H2S). La fotosntesis con agua es la ms importante y conocida y, por tanto, ser la que tratemoscondetalle. Lafotosntesisserealizaendosetapas:unaseriedereaccionesquedependende la luz y son independientes de la temperatura, y otra serie que dependen de la temperatura y son independientes de la luz. La velocidad de la primera etapa, llamada reaccinlumnica,aumentaconlaintensidadluminosa(dentrodeciertoslmites),perono con la temperatura. Enla segunda etapa,llamada reaccin enla oscuridad,la velocidad aumentaconlatemperatura(dentrodeciertoslmites),peronoconlaintensidadluminosa. REACCINLUMNICA La primera etapa de la fotosntesis es la absorcin de luz por los pigmentos. La clorofilaeselmsimportantedestos,yesesencialparaelproceso.Capturalaluzdelas regionesvioletayrojadelespectroylatransformaenenergaqumicamedianteunaserie dereacciones.Losdistintostiposdeclorofilayotrospigmentos,llamadoscarotenoidesy ficobilinas,absorbenlongitudesdeondaluminosasalgodistintasytransfierenlaenergaa la clorofila A, que termina el proceso de transformacin. Estos pigmentos accesorios amplanelespectrodeenergaluminosaqueaprovechalafotosntesis. La fotosntesis tiene lugar dentro de las clulas, en orgnulos llamados cloroplastos que contienenlasclorofilasyotroscompuestos,enespecialenzimas,necesariospararealizar lasdistintasreacciones.Estoscompuestosestnorganizadosenunidadesdecloroplastos llamadas tilacoides en el interior de stos, los pigmentos se disponen en subunidades llamadasfotosistemas.Cuandolospigmentosabsorbenluz,suselectronesocupanniveles energticos ms altos, y transfieren la energa a un tipo especial de clorofila llamado centrodereaccin. En la actualidad se conocen dos fotosistemas, llamados I y II. La energa luminosa es atrapada primero en el fotosistema II, y los electrones cargados de energa saltan a un receptor de electrones el hueco que dejan es reemplazado en el fotosistema II por electronesprocedentesdemolculasdeagua,reaccinquevaacompaadadeliberacin deoxgeno.Loselectronesenergticosrecorrenunacadenadetransportedeelectrones quelosconducealfotosistemaI,yenelcursodeestefenmenosegenerauntrifosfato de adenosina o ATP, rico en energa. La luz absorbida por el fotosistema I pasa a continuacinasucentrodereaccin,yloselectronesenergticossaltanasuaceptorde electrones. Otra cadena de transporte los conduce para que transfieran la energa a la coenzima dinucleotido fosfato de nicotinamida y adenina o NADP que, como consecuencia, se reduce a NADPH2. Los electrones perdidos por el fotosistema I son sustituidosporlosenviadosporlacadenadetransportedeelectronesdelfotosistemaII.
BiologaContempornea FDA03 XXVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

La reaccin en presencia deluz termina con elalmacenamiento delaenerga producida enformadeATPyNADPH2. REACCINENLAOSCURIDAD Lareaccinenlaoscuridadtienelugarenelestromao matrizdeloscloroplastos, dondelaenergaalmacenadaenformadeATPyNADPH2seusaparareducireldixido de carbono a carbono orgnico. Esta funcin se lleva a cabo mediante una serie de reaccionesllamadaciclodeCalvin,activadasporlaenergadeATPyNADPH2.Cadavez que se recorre el ciclo entra una molcula de dixido de carbono, que inicialmente se combinaconunazcardecincocarbonosllamadoribulosa1,5difosfatoparaformardos molculasdeuncompuestodetrescarbonosllamado3fosfoglicerato.Tresrecorridosdel ciclo,encadaunodeloscualesseconsumeunamolculadedixidodecarbono,dosde NADPH2ytresdeATP,rindenunamolculacontrescarbonosllamadagliceraldehdo3 fosfato dos de estas molculas se combinan para formar el azcar de seis carbonos glucosa.Encadarecorridodelciclo,seregeneralaribulosa1,5difosfato. Portanto,elefectonetodelafotosntesiseslacapturatemporaldeenergaluminosaen losenlacesqumicosdeATPyNADPH2pormediodelareaccinenpresenciadeluz,yla captura permanente de esa energa en forma de glucosa mediante la reaccin en la oscuridad.Enelcursodelareaccinenpresenciadeluzseescindelamolculadeagua paraobtenerloselectronesquetransfierenlaenergaluminosaconlaqueseformanATP y NADPH2. El dixido de carbono se reduce en el curso de la reaccin en la oscuridad paraconvertirseenbasedelamolculadeazcar.Laecuacincompletayequilibradade lafotosntesisenlaqueelaguaactacomodonantedeelectronesyenpresenciadeluz es 6CO2+12H2OC6H12O6+6O2+6H2O

REPRODUCCION Reproduccin,procesoporelcualprocreanlosorganismosoclulasdeorigen animalyvegetal.Esunadelasfuncionesesencialesdelosorganismosvivos,tan necesariaparalapreservacindelasespeciescomoloeslaalimentacinparala conservacindecadaindividuo. Encasitodoslosorganismosanimaleslareproduccinocurreduranteodespus delperiododecrecimientomximo.Enlasplantas,quecontinancreciendodurantetoda suvida,larelacinentrecrecimientoyreproduccinesmscompleja.Losorganismos vegetalestienenelcrecimientolimitadoporsuscaractersticashereditariasyporlas condicionesdelmedioenqueviven.Silaplantacreceenexceso,acausadeunas condicionesambientalesfavorables,seestimulaelprocesoreproductor,producindosela dispersinvegetal.Losfactoresambientalestambininfluyenenlareproduccindelos organismosanimales,aunqueenellos,loshormonalessonmsimportantes. REPRODUCCINASEXUAL
BiologaContempornea FDA03 XXIX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Los organismos celulares ms simples se reproducen por un proceso conocido comofisinoescisin,enelquelaclulamadresefragmentaendosomsclulashijas, perdiendo su identidad original. La divisin celular que da lugar a la proliferacin de las clulasqueconstituyenlostejidos,rganosysistemasdelosorganismospluricelularesno seconsideraunareproduccin,aunqueescasiidnticaalprocesodeescisinbinaria.En ciertos animales pluricelulares, tales como celentreos, esponjas y tunicados, la divisin celular se realiza por yemas. Estas se originan en el cuerpo del organismo madre y despus se separan para desarrollarse como nuevos organismos idnticos al primero. Esteproceso,conocidocomogemacin,esanlogoalprocesodereproduccinvegetativa delasplantas.Procesosreproductorescomoloscitados,enlosqueunnicoorganismo origina su descendencia, se denominan cientficamente reproduccin asexual. En este caso,ladescendenciaobtenidaesidnticaalorganismoquelahaoriginado. REPRODUCCINSEXUAL Ciertosorganismosunicelularessemultiplicanporconjugacin.Enesteproceso, anlogoalafecundacin,dosorganismosunicelularessimilaressefusionan,intercambian materialnuclearyseseparan.Despus,cadaunodeellossereproduceporescisin.A veces,losorganismosparticipantesnosereproducenyparecequeelprocesolos revitaliza.Laconjugacineselmtodomsprimitivodereproduccinsexualenelquese obtienenorganismosconcaractersticasgenticasderivadasdedosclulasdistintas.La mayoradelosanimalesyplantaspluricelularestienenunaformadereproduccinsexual mscomplejaenlaquesediferenciandeformaespecficalasclulasreproductoraso gametosmasculinoyfemenino.Ambasseunenparaformarunanicaclulaconocida comocigoto,quesufrirdivisionessucesivasyoriginarunorganismonuevo.Paradefinir launindelosgametosmasculinoyfemeninoseutilizaeltrminofecundacin.Enesta formadereproduccinsexual,lamitaddelosgenesdelcigoto,queportanlas caractersticashereditarias,procededeunodelosprogenitoresylaotramitaddelotro. MITOSIS

MitosisoCariocinesis,procesodedivisincelularmedianteelcualunaclulanueva adquiereunnmerodecromosomasidnticoaldesusprogenitores.Estadivisincelular implica el reparto equitativo de los materiales celulares entre las dos clulas hijas. Por tanto, la mitosis es un mecanismo que permite a la clula distribuir en las mismas cantidadeslosmaterialesduplicadosdurantelainterfase. El proceso de divisin celular mediante el cual una clula nueva adquiere un nmero de cromosomas idntico al de sus progenitores se denomina mitosis (ver Reproduccin). En la mitosis cada cromosoma se divide en dos fragmentos iguales, y cada uno emigra hacia un extremo de la clula. Trasla divisin celular, cadauna delas dos clulas resultantes tiene el mismo nmero de cromosomas y genes que la clula original(verClula:Divisincelular).Porello,cadaclulaqueseoriginaenesteproceso poseeelmismomaterialgentico.Losorganismosunicelularessimplesyalgunasformas pluricelulares se reproducen por mitosis, que es tambin el proceso por el que los organismoscomplejoscrecenysustituyeneltejidoenvejecido
BiologaContempornea FDA03 XXX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

MEIOSIS

Meiosis, doble divisin de las clulas germinalesque reduceala mitad el nmero de cromosomas y, por tanto, origina clulas haploides. La meiosis es un mecanismo adecuado para la distribucin de genes entre los gametos, de tal forma que permite su recombinacinysegregacinalazar. Los gametos se originan mediante meiosis, proceso de divisin de las clulas germinales.Lameiosissediferenciadelamitosisenqueslosetransmiteacadaclula nueva un cromosoma de cada una de las parejas de la clula original. Por esta razn, cada gameto contiene la mitad del nmero de cromosomas que tienen el resto de las clulasdelcuerpo.Cuandoenlafecundacinseunendosgametos,laclularesultante, llamada cigoto, contiene toda la dotacin doble de cromosomas. La mitad de estos cromosomasprocedendeunprogenitorylaotramitaddelotro. CICLOCELULAR Ciclo celular, secuencia de etapas o fases que atraviesa una clula entre una divisinylasiguiente. Enlosorganismosprocariotas,laduplicacindelcidodesoxirribonucleico(ADN)y su posterior distribucin o segregacin en las dos clulas hijas sucede de forma simultnea, segn un proceso continuo cuya frecuencia depende de la especie y de las condiciones ambientales. Al mismo tiempo que el ADN (que tiene forma de anillo) se replica,formndoseunanillonuevo,laclulasealargayestrechaparadividirseyformar as dos clulas hijas, en cada una de las cuales se reparte una copia del ADN. En los procariotas,portanto,sehablapropiamentedeunaescisinbinaria,procesomssimple que la mitosis, que es tpica de las clulas eucariotas. En definitiva, no se distingue un ciclocelularpropiamentedicho. Enlosorganismoseucariotas,ladivisincelularpormitosisesunprocesocomplejo que requiere no slo la replicacin del patrimonio gentico de la clula madre y su posterior distribucin a las clulas hijas, sino tambin la duplicacin de todos los componentes intracelulares que sern necesarios para la constitucin de una nueva clula. La regulacin del ciclo celular es decisiva para el desarrollo normal de los organismos pluricelulares. En la dcada de 1980, se confirm que los procesos que regulan los principales acontecimientos del ciclo celular son fundamentalmente similares entodaslasclulaseucariotas. FASESDELCICLOCELULAR

BiologaContempornea

FDA03

XXXI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

El ciclo celular representa el conjunto de las fases que una clula atraviesa desde el momentodesuformacinhastasudivisinen2clulashijas.Comprendeunainterfase, es decir un estadio en el que la clula lleva a cabo reacciones metablicas de mantenimiento, y la mitosis propiamente dicha, en la que la clula da origen a 2 clulas hijasgenticamenteidnticasalamadre. Elciclocelularestdivididoencuatrofasesprincipales.Laclularecindivididapor mitosis comienza el estadio denominado G1 (G procedente del ingls gap, que significa intervalo),dondelaclulacreceyaumentadetamao.Enlosorganismosdiploides,las clulascontienenunacantidaddiploidedecromosomas(2n),conunacopiaheredadade cadaprogenitor. Cuando la clula ha alcanzado cierto tamao entra en la fase S (sntesis),queimplicaladuplicacindelADNformndoseunacopiadecadacromosoma. Despus de atravesar la fase G2, donde la clula comprueba que se ha completado correctamente la replicacin del ADN y se produce la sntesis de los componentes necesarios para la mitosis, se inicia la llamada fase M (mitosis) que concluye con el nacimiento de las dos clulas hijas. La fase M se divide en varias etapas: durante el periodode profase,los cromosomas se condensan gracias a la mayor compactacin del ADN.DurantelametafaselascromtidashermanasproducidasporlareplicacindelADN enlafaseSsealineanenelcentrodelaclulapermaneciendoadheridasalaalturadel centrmero y de mltiples puntos a lo largo de toda su longitud. En la anafase, las cromtidashermanasseseparanysedesplazanhaciapolosopuestosdelhusomittico, con lo que una de las dos cromtidas hermanas se distribuye a cada clula hija. Finalmente, en la telofase (ltima fase de la mitosis) los cromosomas segregados se descondensanyseproduceladivisinfsicadelcitoplasmaendosclulashijas,proceso denominadocitocinesis.Despusdeladivisin,lasclulasregresanalafaseG1yelciclo celularsecompleta.

BiologaContempornea

FDA03

XXXII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Las clulas postmitticas de organismos multicelulares pueden "salir" del ciclo celularypermanecersinproliferardurantedas,semanasoenalgunoscasosdurantetoda la vida delorganismo (es el casodelas neuronas y delas clulasdel cristalino delojo). Estas clulas abandonan el ciclo celular en fase G1 y entran en una fase llamada G0 (quiescencia).LasclulasenG0queretornanalciclocelularentranenlafaseS. En la mayora de las clulas de mamfero, el ciclo celular se completa en 1030 horas:lafaseMduracomomedia30minutoslafaseG1,9horaslafaseS,10horasyla fase G2, de 2 a 5 horas. En contraposicin, en levaduras de proliferacin rpida el ciclo completoduraaproximadamente90minutos. REGULACINDELCICLOCELULAR Para todos los organismos es esencial que las diferentes fases del ciclo celular estn correctamente coordinadas, es decir, las fases deben seguir un orden estricto y cada una de ellas debe completarseantes de que seiniciela siguiente. Los errores que surgendurantelacoordinacindelprocesopuedenconduciraalteracionescromosmicas importantes,comoporejemploalaprdidadecromosomascompletosopartedeellos,o a la distribucin inadecuada del material gentico en las dos clulas hijas. Por tanto, el control del ciclo celular eucariota es muy estricto y est regulado por protenas denominadas protein cinasas (o protein quinasas), cuya funcin es la de activar determinadasprotenasporfosforilacin.Asuvez,lasconcentracionesdeestasenzimas se encuentran reguladas por otras protenas, llamadas ciclinas, que aumentan y disminuyen durante el ciclo celular. Por tanto, estos complejos proteicos se denominan proteincinasasdependientesdeciclinas(CDK)yslosonactivossiestnconstituidospor unasubunidadciclinayunasubunidadcatalticaproteincinasa,yaquelasciclinassonlas enzimas que determinan qu protenas sern fosforiladas por el complejo CDKciclina, y deestamaneraregulanelavancedelaclulaatravsdelciclocelular.LosgenesCDC fueron descubiertos por primera vez por Leland Hartwell y Paul Nurse en la dcada de 1970enlevaduras,mientrasTimothyHuntdescubrilaprimeraciclinaacomienzosdela dcada siguiente en sus trabajos desarrollados en los erizos de mar. Por estos descubrimientos fueron galardonados con el Premio Nobel de Fisiologa y Medicina en 2001. En organismos multicelulares el control preciso del ciclo celular, durante el desarrollo y el crecimiento, es decisivo para determinar el tamao y la forma de cada tejido.Lareplicacincelularseveafectadaporunaseriedesealesextracelulares,como porejemploelnmeroytipodeclulasadyacentes,yotrasdecarcterintracelularcomo elpropiotamaodelaclulaoelprograma dedesarrolloquedebacompletar.Lamayor parte delas clulas se retira del cicloen G1 y entra enelestado G0 para diferenciarse. Muchas de estas clulas diferenciadas nunca retornan al ciclo para replicarse de nuevo, conocindose con el nombre de clulas post mitticas. No obstante, algunas de estas clulas diferenciadas (como fibroblastos y linfocitos) pueden volver al ciclo y replicarse, entrandodirectamenteenlafaseS.

BiologaContempornea

FDA03

XXXIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

RESUMEN

NIVELFISIOLOGICO. Algunosinvestigadores,comoGalileo,eranexpertosenlafabricacindelentes Todoscontribuyerondealgunamaneraparaampliarlosconocimientosrelacionados Conlabiologa. Enelao1600,JansyZacharasdesarrollaronlosprimerosmicroscopios. Elestudiodelaclula,suestructurayfunciones,datadesdemediadosdelsigloXVII Cuandoseusoproprimeravezelmicroscopioptico. En1665,RobertoHookeutilizeltrminoceldaparadescribirlaestructuradelcorcho, Elcualsegnobservestformadoporvariasceldassemejantesalpanaldelasabejas. EstasobservacionesfueronrepetidasporGrezyMalpighiendiversosvegetales.Loque Realmenteseestabanobservandoeranlascavidadesconstruidasporlaparedcelulsica delcorcho. AntonioVanLeeuwenhoek(163217239),fabricantesdelentesfueelprimeroenobservar organismosunicelulares. Construyendistintoscamposcientficos,allograraumentar200veceseltamaodelas imgenes, sin embargo, ms sobresalientes fue el descubrir un gran mundo microscpicoenunasimplegotadeaguadecharco. El fsico alemn Johannes Kepler (15711630) mejor el diseo y la estructura de los microscopios al colocar con estos dos lentes, por lo que se le llama microscopio compuesto. En1800seiniciaronnuevamentelasinvestigacionesconbuenosresultados.Elmdico Francs Marie Franoise Bichat descubri 21 tipos diferentes de componentes en el cuerpohumano,alosquellamtejidos. En el ao 1802, el francs Mirbel encontr que las plantas presentaban un tejido membranosocelularcontinuo. En 1809 Jean Baptiste de Lamarck afirm que ningn cuerpo puede considerarse vivo sinoestformadoportejidoscelulares. En1831,RobertBrownreconociquecasitodaslasclulastienenunncleo. Lasclulasysuscomponentessonmuypequeosylosmicroscopiosdeluzsolopermiten diferenciarlosdetallesgeneralesdemuchaspartescelularesconlaayudadecolorantes.

LA CELULA: UNIDAD ANATOMICA, FISIOLOGICA Y DE ORIGEN DE LOS SERES VIVOS. Lasclulaseslaunidadanatmicaqueformaalosseresvivos,desdeelorganismomas pequeo, como una bacteria, hasta una ballena, todos estos estn formados de clulas. Las clulas constituyen las partes que poseen vida y adems resultan ser las unidades bsicasdelosorganismos. Lasclulaseslaunidadfisiolgica,yaquedentrodeellaserealizanprocesosmetablicos yademssenutre,respira,excretayrespondeaestmulosdelmedio.

BiologaContempornea

FDA03

XXXIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

LAMEMBRANACELULARYSUSFUNCIONES:

La membrana celular est compuesta por una doble capa de lpidos denominados fosfolpidos, dentro de los cuales se encuentran protenas y carbohidratos que pueden estar en constante movimiento, adems realiza la funcin de transporte al controlar el pasodematerialesentrelasclulasysuambiente.

ELCITOPLASMA: Ocupa el espacio que existe entre la membrana y el ncleo, en el se encuentran los organloscelulares.Esunasustanciaviscosaeincoloraposeecompuestosinorgnicos comoaguaysalesminerales,gasescomoeloxgenoyeldixidodecarbonoyelementos como hierro, cobre, sodio, calcio y cloro. Presenta tambin compuestos orgnicos como carbohidratos,lpidosyprotenas. Los azucares son el combustible que permite a la clula obtener energa, los lpidos se almacenancomotejidoadiposooaceitesylasprotenassirvenparaformarestructurasy ayudaalarealizacindelasfuncionescelulares.

RESPIRACIONCELULAR.

La respiracin es un proceso mediante el cual la clula adquiere energa para llevar a cabo susfunciones. Enla respiracinlas molculas se oxidan para liberar energa. Para que se realice la respiracin es necesario que existan compuestos energticos como la glucosa, misma que proviene de los alimentos. La respiracin es le medio por el cual el oxigenoliberalaenergaqumicadealimentostalescomolaglucosa.

CLOROPLASTOSYFOTOSINTESIS. En las clulas vegetales, la obtencin de nutrimentos se efecta por medio de la fotosntesis, este es un proceso mediante el cual los vegetales transforman, con la presenciadelaluzsolar,lassustanciasinorgnicasquetomandelmedioquetomandel medioenmateriaorgnicanutritiva. Losorganeloscelularesresponsablesderealizarlafotosntesissonloscloroplastos,que selocalizanenlasclulasdelashojasdelosvegetales. Cuandolosorganismospormediodelafotosntesissoncapacesdeelaborarsuspropios alimentos se denominan auttrofos y cuando por el contrario tienen que encontrar sus alimentosenlanaturalezasellamanhetertrofos. FASESDELAFOTOSINTESIS.
BiologaContempornea FDA03 XXXV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Parafacilitarelestudiodeesteprocesosehadivididoendosetapasofases: FASELUMINOSAOFOTOSINTETICA. Sedesarrollaenpresenciadeluz,comoocurreenlossiguientesfenmenos: 1.laplantaabsorbedelmediodixidodecarbonoyaguaqueleservirnenlaproduccin dealimentos. 2.loscloroplastoscaptanlaenergasolaratravsdelostilacoidesparaformarATP 3.laenergadelATPrompelamolculadeaguayliberaoxgeno

FASEOSCURAOQUIMIOSINTETICA. Puedepresentarseenausenciadeluzyenellaocurrelosiguiente: 1. el hidrgeno que fue obtenido del agua se une qumicamente con ayuda del ATP al dixidodecarbonoparaformarglucosa. 2.partedelaenergaquecontieneelATPsequedaenlaglucosa,porelloestealimento seconsideraenergetico. 3.seliberavapordeagua. 4.mediantereaccionesqumicasseformanalmidones,grasasyprotenas. Debemos hacer nfasis en la importancia de la fotosntesis, ya que gracias a este fenmenosemantieneelequilibriodelosecosistemas.

BiologaContempornea

FDA03

XXXVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

PRACTICA
Nombre:Fotosntesis Obj.Identificaralasplantasverdescomoorganismosquerealizanelprocesodefotosntesis MaterialyEquipo: 1campanadevidrio 1vela 1plantadehojaverdeenmaseta 1franelaobscura 1cronmetro 1cajadecerillos Procedimiento: Acomodalavelaencendidaenelinteriordelacampanadevidrio,cierralacampana,mideeltiempo que tarda en apagarse la vela y antalo. Realiza un dibujo del dispositivo en el especio correspondiente. Enciende nuevamente la vela y colcala en el interior de la campana junto a la planta de hojas verdes.Colocaeldispositivoqueacabasdearmarenunlugardonderecibamuchaluzparaacelerar lareaccin. Registraeltiempoqueduraencendidalavelaydibujaenelespeciocorrespondienteelaparatoque armaste. Colocanuevamentelavelaencendidaylaplantaenlacampanadevidrio.Cubrelacampanaconla franela,observayregistraeltiempoquetardaenapagarselavela. Anotatusobservaciones.

BiologaContempornea

FDA03

XXXVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CRITERIOSEVALUACIN UNIDADI
CRITERIOS Producto PORCENTAJE 30

Desempeo

30

Conocimiento

15

Actitud

25

Total

100%

BiologaContempornea

FDA03

XXXVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

UNIDADIV
NIVELGENETICO

BiologaContempornea

FDA03

XXXIX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Nivelgentico Subtema: Acidonucleico

Objetivo:

Elalumnodeberconocerlasfuncionesquerealizanloscidosnucleicos.

TemaIntegrador:

Laclulacomounafuncingentica.

SECUENCIADIDCTICA11 ACTIVIDAD DESARROLLO

1.Motivacin

Proyeccindedocumentos. Presentacindediagramasfuncionales.

2.Apertura

Realizar una discusin guiada por el facilitador en base a lo planteado en la motivacin. Contestarlassiguientespreguntas: 1.Quesonloscidosnucleicos. 2.Comoestnformados. 3.Cualessonsuscomponentes.

ACTIVIDAD

DESARROLLO

3.Desarrollo

1. Integracindeequipos. 2. Los alumnos realizarn investigaciones bibliograficas sobre los cidos nucleicos. 3. Elaboracin de mapas conceptuales sobre los conceptos ms importantes sobreeltema.

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Anlisisydiscusindeltemaporpartedelosalumnos. 4.Cierre Discusindelosmapasconceptuales.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Formacindeequiposydiscusindeltema. Proyeccionessobreeltema. Sesindediscusin(Preguntas).

Evidenciasdel Alumno

Cuestionariossobreeltema. Apuntesdeladiscusingrupal.

Materialyequipo Didctico

Proyecciones,papelbond,cintacanela,marcadores.

Actividadesprevias paraelalumno

Investigacindeltema. Anlisisdeltemaenformaindividualyporequipos. Realizacindemapasconceptual.

Actividadesdel maestro

Guiarladiscusinoexposicindelosmapasconceptuales. Realizarunaretroalimentacindeltemahacialosalumnos.

BiologaContempornea

FDA03

XI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea. Facilitador Subtema:

Nivelgentico

Sntesisdeprotena

Objetivo:

Elalumnoconocerlospasosbsicosenlaelaboracindeprotenas,apartirdela informacingenticadelADN. Laclulacomounafuncingenetica.

TemaIntegrador:

SECUENCIADIDCTICA12 ACTIVIDAD DESARROLLO

1.Motivacin

Los alumnos se formaran en equipos los cuales recopilaran la informacin que ellos han obtenido de sus investigaciones realizadas en la biblioteca, Internet y revistascientficas. Elaboran figuras con la utilizacin de tarjetas de colores que ellos mismos elaboraranenclases.

Conlosequiposdisciplinariosanalizaranlainformacinrelacionadaconeltemay conelcualcontestaralassiguientespreguntas: 2.Apertura 1.Queesunaprotena? 2.Queesiniciacin? 3.Queselongacin? 4.Questerminacin?

ACTIVIDAD

DESARROLLO

3.Desarrollo

El profesor coordinara a los equipos los cuales expondrn sus ideas al grupo, tendrnuntiempoparalograrquetodospuedandarsuexplicacin.

BiologaContempornea

FDA03

XIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Altrminodelasexposicionesporgrupoelprofesordarunasntesisdeltemay los alumnos en casa elaboraran maquetas donde se represente la sntesis de protena y del cual se elegir el mejor trabajo que ser colocado en el saln de clases.

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Trabajoenequipo,utilizacinderevistascientficas,bibliografasactualizadas, Internetyrealizacindemaquetas.

Evidenciasdel Alumno

Cuestionario,exposicinyparticipacin.

Materialyequipo Didctico

Bibliografaactualizada,revistascientficasymaterialdidctico,

Actividadesprevias paraelalumno

Bsquedadeinformacinenbibliotecas,vaInternetylecturaencasa.

Actividadesdel maestro

Preparacindeclasesyrevisindecuestionarios.

BiologaContempornea

FDA03

XIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

XV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

ANEXO Nucletidosycidosnucleicos La informacin que dicta las estructuras de la enorme variedad de molculas de protenas que se encuentranenlosorganismosestcodificadaenmolculasconocidascomo cidosnucleicos. La informacin contenida en los cidos nucleicos es transcripta y luego traducida a las protenas. Son las protenaslasmolculasquefinalmenteejecutarnlas"instrucciones"codificadasenloscidosnucleicos. As como las protenas estn formadas por cadenas largas de aminocidos, los cidos nucleicos estn formadosporcadenaslargasdenucletidos. Unnucletido,sinembargo,esunamolculamscomplejaqueunaminocido.Estformadoportressub unidades: un grupo fosfato, un azcar de cinco carbonos y una base nitrogenada esta ltima tiene las propiedadesdeunabasey,adems,contienenitrgeno. La sub unidad de azcar de un nucletido puede ser ribosa o bien desoxirribosa. Como puede verse, la diferenciaestructuralentreestosdosazcaresesleve. Enlaribosa,elcarbono2llevauntomodehidrgenoporencimadelplanodelanilloyungrupohidroxilo pordebajodelplanoenladesoxirribosa,elgrupohidroxilodelcarbono2estreemplazadoporuntomode hidrgeno

BiologaContempornea

FDA03

XVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Losnucletidospuedenunirseencadenaslargasporreaccionesdecondensacinqueinvolucranalos gruposhidroxilodelassubunidadesdefosfatoydeazcar.EnlafigurasemuestraunamolculadeRNA que,comoseobserva,estformadaporunasolacadenadenucletidos.LasmolculasdeDNA,en cambio,constandedoscadenasdenucletidosenrolladassobresmismas,formandounadoblehlice. Laribosaeselazcarenlosnucletidosqueformancidoribonucleico(RNA)yladesoxirribosaesel azcarenlosnucletidosqueformancidodesoxirribonucleico(DNA).Haycincobasesnitrogenadas diferentesenlosnucletidos,quesonlossillaresdeconstruccindeloscidosnucleicos.Dosdeellas,la adeninaylaguanina,seconocencomopurinas.Lasotrastres,citosina,timinayuraciloseconocencomo pirimidinas.

BiologaContempornea

FDA03

XVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Laadenina,laguaninaylacitosinaseencuentrantantoenelDNAcomoenelRNA,mientrasquelatimina se encuentra slo en el DNA y el uracilo slo en el RNA. Aunque sus componentes qumicos son muy semejantes, el DNA y el RNA desempean papeles biolgicos muy diferentes. El DNA es el constituyente primario de los cromosomas de las clulas y es el portador del mensaje gentico. La funcin del RNA es transcribir el mensaje gentico presente en el DNA y traducirlo a protenas. El descubrimiento de la estructura y funcin de estas molculas es hasta ahora, indudablemente, el mayor triunfo del enfoque molecularenelestudiodelabiologa. Los nucletidos, adems de su papel en la formacin de los cidos nucleicos, tienen una funcin independiente y vital para la vida celular. Cuando un nucletido se modifica por la unin de dos grupos fosfato, se convierte en un transportador de energa, necesario para que se produzcan numerosas reacciones qumicas celulares. La energa contenida en los glcidos de reserva como el almidn y el glucgeno,yenlos lpidos,vieneasercomoeldinerodepositadoaplazofijonoesasequiblefcilmente.La energadelaglucosaescomoeldineroenunacuentacorriente,accesible,peronotantocomopararealizar todaslasoperacionescotidianas.Laenergaenlosnucletidosmodificados,encambio,escomoeldinero debolsillo,disponibleencantidadesconvenientesyaceptadasenformageneralizada.

BiologaContempornea

FDA03

XVIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

El principal portador de energa, en casitodos los procesos biolgicos, es unamolculallamada adenosn trifosfatooATP.

La nica diferencia entre el ATP y el AMP (adenosn monofosfato) es la unin de dos grupos fosfato adicionales.Aunqueestadiferenciaenlafrmulapuedeparecerpequea,eslaclavedelfuncionamientodel ATPenlosseresvivos. Los enlaces que unen los tres grupos fosfato son relativamente dbiles, y pueden romperse con cierta facilidadporhidrlisis.LosproductosdelareaccinmscomnsonelADP adenosndifosfatoungrupo fosfatoyenerga.Estaenergaaldesprenderse,puedeserutilizadaparaproducirotrasreaccionesqumicas.

Con la adicin de una molcula de agua al ATP, un grupo fosfato se separa de la molcula. Los productos de la reaccin son el ADP, un grupo fosfato libre y energa. Alrededor de unas 7 Kcaloras de energa se liberan por cada mol de ATP hidrolizado. La reaccin puede ocurrir en sentidocontrariosiseaportanlas7Kcaloraspormolnecesarias. Sntesisdeprotenas

Lasprotenas,porsutamao,nopuedenatravesarlamembranaplasmticadelaclula, poresoesqueexisteensuinteriorunmecanismoquelasconstruye(sntesis)segnlas necesidadesquetengaenesemomentolaclula. Lasntesisdeprotenasconstaenrealidaddedosetapas:laprimeraetapa(transcripcin) ocurre dentrodel ncleo de las clulas eucariotas, aqula secuencia de nucletidos que denominamos gen (segmento de ADNque determina una protena) se transcribe en una molculadeARN.Posteriormente,enlasegundaetapa(traduccinsntesisdeprotena propiamente dicha) el ARN pasa del ncleo al citoplasma donde es traducida por los ribosomasquearmanunaprotena.

BiologaContempornea

FDA03

XIX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Esteprocesoesdefundamentalimportanciayaquebsicamentetodosloscaracteresque laclulapresenta(fenotipo)estreguladoporlasumadesusactividadesenzimticas.En pocaspalabras,todoloquelaclulaesypuederealizardependedelaaccinenzimtica especfica. Como las enzimas son protenas, la morfologa y funcionamiento celular dependen de que tipo de protenas la clula pueda armar. En el transcurso de la evolucin, todos los organismos se han asegurado que la informacin correspondiente para sintetizar sus enzimas especficas se halle presente en sus clulas y en su descendencia.QumicamenteesainformacinresideenelADNygraciasalareplicacin, latrasmisinestgarantizada. Transcripcin Para formar la hebra de ARN a partir del ADN se debe tener en cuenta que cada nucletido del ADN se ensambla con un determinado nucletido del ARN. La molcula helicoidal de ADNse desenrolla y deja accesible la hebra paralela, a partir dela cual se inicia la sntesis (armado) del ARN. La enzima (polimesara del ARN) que controla la reaccin detecta una regin de la secuencia del ADN, llamada promotor, que marca el puntodeinicio dela sntesis. La enzima seune alADNen elsitio preciso parainiciarla sntesisdeARNyseleccionaelprimernucletido,queseconvertirenelextremo5'dela cadena(verestructuradelARN).Acontinuacin,sedesplazarpidamenteporlacadena de ADN, aadiendo los nucletidos correspondientes a la cadena de ARN. Segn se forma, el ARN se va separando del ADN, comenzando por el extremo 5' no obstante, hastaquenosellegaalextremo3'noseseparalamolculadeARN.Losnucletidosse aaden uno por uno en orden complementario, de esta manera la adenina del ADN se combinaconeluracilodelARN(AU),enelmismoorden,latiminaseensamblaconla adenina(TA),ylacitosinasecombinaconlaguaninayviceversa(CG,GC).Hay porlotantocomplementariedadentreelARNyelADNdedondesecopia.Alconservarla informacinimpresa enesta parte delgenoma (dotacin gentica), el ARNse constituye en portador de las instrucciones que determinan la secuencia de aminocidos de una protena.Dichasinstrucciones,enclave,sedescifranleyendolosnucletidosdetresen tres ("tripletes"), y cada triplete de nucletido, que determina uno delos 20 aminocidos existentes,recibeelnombredecodn.Durantelatraduccin,amedidaquese"leen"los codones, se van aadiendo los aminocidos correspondientes a la protena que se est formando.

BiologaContempornea

FDA03

XX

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

A finales dela dcada del'70 ya se sospechaba que el paso de ARNprimario, o recin transcripto, a ARN mensajero (ARNm) maduro, tal como se requiere en la traduccin, exigaciertasmanipulacionesimprescindibles:adicindediferentesestructurasenambos extremos delARNymodificacinqumicadeciertosnucletidos.Sinembargo,concierta frecuencia, una vez transcripta la molcula de ARN poda sufrir cortes y empalmes disminuyendo su tamao quedando ARNm ms corto. Incluso una misma molcula de ARN,segnloscortesyempalmesquesufra,puededarlugaradiferentesARNmmaduro y por lo tanto, a diferentes tipos de protenas. Estos procesos hoy se los conoce con el nombredemaduracindelARN. Traduccin QuedaclaroqueelARNmeselquellevalainformacinquesedecodificarenlasntesis (armado)deprotenas,determinaelordenenqueseunirnlosaminocidos.Lasntesis de protenas o traduccin tiene lugar en los ribosomas del citoplasma celular. Los aminocidos son transportadospor elARNde transferencia(ARNt) especfico para cada unodeellos,ysonllevadoshastaelARNmensajero(ARNm),dndeseapareanelcodn de ste y el anticodn del ARNde transferencia, por complementariedad de bases, y de staformasesitanenlaposicinquelescorresponde.Unavezfinalizadalasntesisde una protena, el ARN mensajero queda libre y puede ser ledo de nuevo. De hecho, es muy frecuente que antes de que finalice una protena ya est comenzando otra, con lo cual,unamisma molculadeARNmensajero,estsiendoutilizadaporvariosribosomas simultneamente,estaestructuraseconoceconelnombredepolirribosoma(polisoma).

La primera etapa de la sntesis proteica comienza cuando la unidad ms pequea del ribosoma se inserta en el extremo 5' del ARNm, exponiendo el primer codn o codn iniciadoralquesiempreeselAUG(5' a 3') al primer anticodn UAC en el ARNt,porlocualelprimeraminocido es metionina modificada, la N formilmetionina que despus de elimina. A continuacin la unidad mayor del ribosoma se inserta en la ms pequea y el primer ARNt unido consuNformilmetioninasefijaenun sitio p (pptido) de la subunidad ms grande.Sehainiciadoaslaetapade iniciacin.Alcomenzarlaetapadealargamiento,elsegundocodndelARNmsecoloca frentealsitioA(aminocido).UnARNtconunanticodnparaesesegundocodnsefijaa la molcula de ARNm y, junto con elaminocido, pasa aocupar el sitio A del ribosoma. Cuando ambos sitios estn ocupados, una enzima que forma parte de la estructura ribosomal mayor establece el enlace peptdico entre los dos aminocidos, insertando el primeroenelsegundo.ElprimerARNtseliberayelsegundoARNt,queahoraestunido
BiologaContempornea FDA03 XXI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

al N formilmetionina y al segundo aminocido, pasa a la posicin P. Un tercer ARNt aminocidopasaalaposicinAfrentealtercercodndelARNmylaoperacinvuelvea repetirse. El trabajo de los ARNt consiste en tomar del citosol a los aminocidos y conducirlos al ribosoma en el orden marcado por los nucletidos del ARNm, que son los moldes del sistema.Lasntesisdelasprotenascomienzaconlauninentresdedosaminocidosy continaporelagregadodenuevosaminocidosdeaunoporvezenunoextremosde lacadena. Comosehaexplicado,laclavedelatraduccinresideenelcdigogentico,compuesto porcombinacionesdetresnucletidosconsecutivosotripletesenelARNm.Losdistintos tripletesserelacionanespecficamentecontiposdeaminocidosusadosenlasntesisde las protenas. Cada triplete constituye un codn, existen en total 64 codones (cuatro 3 nucletidos se combinan dea tres, as que:4 =64), 61 de los cuales sirven para cifrar aminocidosy3paramarcarelcesedelatraduccin. Dado que existen ms codones que tipos de aminocidos, casi todos pueden ser reconocidos por ms de un codn, por lo que algunos tripletes a como "sinnimos". Solamente el triptfano y la metionina dosde los aminocidos menos frecuentes enlas protenassoncodificados,cadauno,porunsolocodn.Generalmenteloscodonesque decodificanaunmismoaminocidoseparecenentresyesfrecuentequedifieransloen el tercer nucletido. Es importante destacar que el nmero de codones en el ARNm determinalalongituddelaprotena. Las molculas intermediarias entre los codones del ARNm y los aminocidos son los ARNt, los cuales tienen un dominio que se liga especficamente a uno de los 20 aninocidos(enelextremo3')yotroquelohace,especficamentetambin,conelcodn apropiado.Elsegundodominioconstadeunacombinacindetresnucletidosllamado anticodnqueescomplementariadeladelcodn.CadatipodeARNtllevaantepuestoel nombre del aminocido que transporta: lisinilARNt para el de la lisina, fenilalanilARNt paraeldelafenilalanina,metionilARNtparaeldelametionina,etc.PorsuladoelARNt a unido al aminocido compatible con l se designa aminoacilARNt , en el que "a" Leu lys corresponde a la sigla del aminocido. Por ejemplo, leucinilARNt , lisinilARNt , Phe Met fenilalanilARNt ,metionilARNt ,etc. Sibientericamentepuedenexistir61tiposdeARNtdiferentes,slohay31eldficitse resuelve por la capacidad que tienen algunos ARNt de reconocer ms de un codn. Lo logran porque sus anticodones suelen poseer la primera base"adaptable", es decir, que puede unirse con una base no complementaria situada enlatercera posicin del codn. As, la guanina en la primera posicin del anticodn puede aparearse tanto con una citocina (ms comunmente) o con un uracilo del codn. Similarmente, el uracilo en la primeraposicindelanticodnpuedehacerloconunaadenina,formahabitual,oconuna guanina. Por otra parte, la inosina (I), base inusual que se encuentra en la primera posicin del anticodn en varios ARNt y es capaz de aparearse con cualquier base (exceptoconunaguanina)localizadaenlaterceraposicindelcodn.

BiologaContempornea

FDA03

XXII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

TripletesqueaparecenenelARNmquecodificanalosdistintosaminocidos
AGA AGG GCA CGA GCCCGC GGA GGC UUA UUG CUA AUA CUC AGC AGU CCA UCA CCC UCC UUCCCGUCG ACA ACC GUA GUCUAA

GCGCGGAACGACUGCGAA GGGCACAUCCUGAAA

ACGUACGUGUAG

GCUCGUAAUGAUUGUGAGGGUCAUAUUCUUAAG AUGUUUCCU UCUUGGACUUAUGUUUGA ala arg asn asp cys glu gln his ile leu lys met phe pro ser trp thr tyr val stop

AlfinaldelacadenadelARNmseencuentrauncodnquesirvedesealdeterminacin delproceso.Laetapadeterminacindeterminalaconclusindelasntesisdelaprotena cuandoelsitioAdelribosomaesabordadoporestecodndeterminacindelARNmque puedeserUUA,UGAoUAG.SobreesecodndeterminacinnoseuneningnARNt.El sitio A es ocupado por un factor de terminacin llamado factores de liberacin (eRF = eucaryotic releasing factor), costituido por dos protenas que saben reconocer a los tres codones de terminacin. Cuando esto sucede, la protena terminada se libera del ltimo ARNt, que tambin se separa del ARNm, disocindose las subunidades ribosmicas.Todos estos elementos quedan libres para ser reutilizados en una nueva sntesis.

BiologaContempornea

FDA03

XXIII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

RESUMEN

Alrevelarlosnumerososmtodosmedianteloscualeslasclulasprocesan,aaden,eliminanytransfieren informacin gentica, los bilogos moleculares abrieron el camino para el desarrollo de sus propias manipulaciones genticas. En los ltimos aos, se han desarrollado tcnicas que han permitido abordar el anlisisylamanipulacindelDNAenunaformaantesinimaginada.LatecnologadelDNArecombinanteha hecho posible investigar ms a fondo la estructura y funcin de los genes, especialmente de los genes eucariticos que eran inaccesibles por otros mtodos. Estas investigaciones permanentemente generan nuevosinterroganteseinquietudes,muchosdeloscualestienenprofundasimplicanciasticas. Cuando los investigadores se enfrentaron por primera vez con el gran tamao y la complejidad del DNA, incluso el delvirus ms simple,la posibilidad de descifrarla informacin gentica codificada pareca estar msalldetodaesperanza.Sehizoevidentequeparaestudiarungenindividual,selodebaaislardelresto delgenomayaque,cadagen,representaunapequeaseccindentrodeuncromosomay,enesecontexto, nopuede serindividualizado.Paraelaislamientodeungenodefragmentosmspequeos,elDNAdebe ser fragmentado. Si bien la ruptura del DNA puede ser realizada mecnicamente, por este medio la fragmentacinseproducealazar.Laobtencindefragmentosespecficosfueposiblemedianteunmtodo desarrolladoapartirdeherramientaspropiasdeciertosorganismos. ParaavanzarhaciaunestudiomsdetalladodelDNAfuenecesariaunametodologaparaobtenergrandes cantidadesdefragmentosespecficosdeDNA.Estos fragmentospodan serDNAgenmico,cDNAoDNA obtenidosapartirdeoligonucletidossintticos. Amenudo,antesdequeundeterminadofragmentodeDNAodemRNApuedasermanipuladodecualquier modo, debe primero ser localizado. Los cromosomas, incluso los de las clulas eucariticas ms simples, contienen una enorme cantidad de DNA, por lo que localizar un segmento especfico es como tratar de encontrar la proverbial aguja en el pajar. Para localizar fragmentos especficos se utiliza la tcnica de hibridacindecidosnucleicos. ConeldesarrollodetcnicasparacortarmolculasdeDNAymultiplicarlosfragmentos,hoyesposible,en principio, determinar la secuencia de nucletidos de cualquier fragmento de cido nucleico aislado. Para secuenciar una molcula de DNA de gran tamao, como el genoma completo de un virus, es preciso analizarporcionespequeasyposteriormenteintegrarlosresultados. En los comienzos de la investigacin del DNA recombinante, los bilogos se dieron cuenta de que los segmentos de DNA que codifican ciertas protenas (particularmente las de importancia mdica o agrcola) pueden transferirse a bacterias y ser expresados. Las bacterias pueden funcionar como fbricas que suministranunafuentevirtualmenteilimitadadeprotenas.Estapropiedaddelasbacteriasfueaprovechada porloscientficosyasnacilabiotecnologa. LametodologadelDNArecombinante,permitetransferirgenestantoaclulasprocariticascomoaclulas vegetalesyaotrosorganismoseucariotas

BiologaContempornea

FDA03

XXIV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CRITERIOSEVALUACIN UNIDADI
CRITERIOS Producto PORCENTAJE 30

Desempeo

30

Conocimiento

15

Actitud

25

Total

100%

BiologaContempornea

FDA03

XXV

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

BiologaContempornea

FDA03

XXVI

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

UNIDADV
NIVELTECNOLOGICO

BiologaContempornea

FDA03

XXVII

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

BiologaContempornea.

niveltecnolgico

Subtema:

biotecnologa

Objetivo:

identificar los fundamentos y aplicaciones de la ingeniera gentica en la vida humana Ingenieragentica

TemaIntegrador:

SECUENCIADIDCTICA13 ACTIVIDAD DESARROLLO Plantear una serie de preguntas a cerca de conocimientos previos que tengan sobretecnologa,genticaybiotecnologa(seleproporcionarauncuestionario). 1.Questecnologa? 2.Quesgene? 3.QuesADN? 4.Quesuncromosoma? 5.Quesunaenzima? 6.Quesbiotecnologa?

1.Motivacin

2.Apertura

Integrarequipo,revisarelcuestionarioyelaborarunaconclusinacercadelcuestionario.

ACTIVIDAD

DESARROLLO

3.Desarrollo

+Investigacin previa del tema (introduccin de la biotecnologa y gentica +mediantefichasdetrabajo) +Realizarunglosariopreviodepalabrasacercadeltema. +Elaborarcartelesdetecnologa,biotecnologaygentica +Colocarloscartelesenunagaleradentrodelaula +explicarcadaunodeellosunrepresentantedecadaequipos

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

+Elorientadordarunaexplicacingeneralacercadeltema +Cadaalumnoelaboraraunasntesisdelaexplicacindadaenclase

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

+Tcnicasdeintegracindeequipos,tcnicasdidcticasyexpositivas. +Elaboracindefichasdetrabajo,cuestionario,glosarios,sntesisycarteles.

Evidenciasdel Alumno

+Fichasdetrabajos +Cuestionarios +Glosarios +Sntesis +carteles

Materialyequipo Didctico

Hojas blancas, ficheros elaborados, tijeras, juegos de geometras, sacapuntas, rotafolios,cintacanela,pegamento,papelbond,marcadores.

Actividadesprevias paraelalumno

Investigacinbibliograficas,fichasdetrabajos,glosarioselaborados.

Actividadesdel maestro

Asesoriasyrevisindelasactividadesarealizar

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GasteliuMartnezAlberto Eduardo.O.H.etal1990. Biologa1ED.ColeccinDGTI Pgs.1012 AudesirkTeresaHerld.A.1996. Biologa(Lavidaenlatierra) 4ta.Edicin.ED.PronticeHall.Mxico. Pg.14. HernndezHernndezP.Etal. 2000.AntologadeBiologa1 ED.CECYTE TabascoMxico. Pgs.89. ChamorroZrateM.A.1993. Biologa1ED.NuevaImagen.Mxico. Brady.Laclula.CursoprogramadodeAnatoma yfisiologa.NoriegaEditores. ErendiraAlonso.1992.Biologaparabachillerato. ED.Mc.GrawHill.Mxico.

Bibliografa

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Asignatura: Instructor: Tema:

Biologacontempornea.

Niveltecnolgico

Subtema:

DNA,recombinante

Objetivo:

ConocerlasestructurasdelDNAcomoinformacinhereditariadelaclula

TemaIntegrador:

ElADNcomomaterialhereditario

SECUENCIADIDCTICA14 ACTIVIDAD DESARROLLO

+RealizarunaexposicindediferentesmodelosdelaestructuradelDNA(galera). 1.Motivacin +Elalumnoobservaracadaunodelosmodelos.

2.Apertura

1.investigacinpreviadeltema 2.integracinenequipos

ACTIVIDAD

DESARROLLO a) Hacer un boceto o ejemplo (dibujo) de su modelo, si es posible a colores, despus analizarlo y con base a lo fundamental del proceso, decidan si pueden mejorarloparaposteriormenterealizarelmodelo.

3.Desarrollo

b)realizarunmodelodelADN C) elaborar un resumen en forma correcta del tema como apoyo para la explicacindelmodelo. d)alfinalpresentarelmodeloydarleunabreveexplicacin

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

4.Cierre

Alfinalizarlasesinelfacilitadorseleccionaraelmejormodeloyloexhibirenla bibliotecadelplantelyademssedarunaconclusindeltema

SUGERENCIASMETODOLGICAS

Mtodosytcnicas deenseanza

Tcnicasdeintegracinporequipos Tcnicasdidcticas(exposicindelmodelo) InvestigacinbibliogrficaoInternet

Evidenciasdel Alumno

ModelosdelADN Resumen Apuntes

Materialyequipo Didctico

Hojas blancas, marcadores juegos de geometras lpices, borrador, sacapuntas, cintacanela,papelbond,

Actividadesprevias paraelalumno

Investigacinbibliograficas,lecturayanlisisdelamisma.

Actividadesdel maestro

Asesoria y supervisin de las actividades que realice el alumno as como calificacindelamisma.

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

RESUMEN

RESUMENDELNIVELTECNOLOGICO UNIDADV La tecnologa incrementa las capacidades del ser humano para cambiar el ambiente, se ampliaelalcancedelossentidos,semodificanlosmaterialesysedesplazanobjetosde unlugaraotro.Lainvencindelaruedaesunclaroejemplodeello. Enelcasoparticulardelabiotecnologa,queennuestrosdasseidentificaprincipalmente porsusaplicacionesmdicasyagrcolasbasadasenelconocimientodelcdigogentico. Seguramentehasescuchadotrminoscomoingenieragentica,organismostransgenicos ygenomahumano,algunosdelosavancesmsrecientesenestareayquedifundenlos medios. Sin embargo, la biotecnologa es tan antigua como la siembra de cultivos y la elaboracindepan,quesosyvinos. A partir de la estructura de la estructura del ADN, en 1953, se establecieron las bases cientficas para conocer algunos aspectos de los seres vivos, como su constitucin genticaylascausasdealgunasenfermedadescongnitas. Amediadosdeladcadade1970sedesarrollarontcnicasquedieronlugara,loquese conoce como ingeniera gentica, entendidacomo el conjunto de tcnicas delaboratorio quepermitenmanipularlainformacingentica.Graciasalaingenieragenticaahoraes posibleintroducirgenesde unorganismo en otro, ya seadela misma especie ode otra diferente,paracrearlosorganismostransgnicos.Asnacilabiotecnologamoderna. Hacia1990lasaplicacionesbiotecnolgicasenlaagriculturacobrarongranrelevancia.El conocimiento generado en las universidades ha sido utilizado por los agricultores para mejorarsuscosechasyelvalornutritivosdelosproductos,yparaobtenerproductoscon las caractersticas deseadas de sabor, aroma, textura y color. Esto se logro al introducir genesqueproporcionanestacaractersticaenunaespeciequecarecedeellas.Deesta manera tambin se han obtenido cosechas resistentes al deterioro, a ciertas enfermedadesyalasplagas. Labiotecnologahaempezadoadesarrollarsetambinenlaganaderaalutilizaranimales ytransformarlosgenricamente.Sehanproducidoanimalestransgnicoscomocabrasy vacas, cuya leche contiene protenas humanas debido a la introduccin de genes humanos, y se han convertido en fuente importante de productos para el consumo humano. Los estudios con animales transgnicos contribuyen de manera importante a nuestra comprensin del comportamiento y la funcin de muchos genes y su manipulacin en beneficiodelserhumano,comolaprevencinycuradealgunasenfermedadesqueeran incurables tanto en personas como en animales. Un caso notable es la obtencin de organismos completos a partir de cultivos de clulas o de componentes celulares de adultos,latcnicaconocidacomoclonacin,enlaquelamanipulacingenticaserealiza enunasolaclulayseobtienenorganismosidnticosentres.
BiologaContempornea FDA03 7

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

PRACTICA Nombre:Materialgenticofemenino. Obj.Identificarlapresenciadecromosomassexualesenlamucosabucalfemenina. MaterialyEquipo: 1abatelenguas 1portaobjetos 1cubreobjetos 1microscopio 2goteros 1etiquetaadheridlede1X2cm. Lpicesdecolores Sustancias. 10mldecoloranteacetatodeorceinapreviamentefiltrado. 10mldecoloranteverdedeJanus 20mldealcoholetlico 10mldesolucindealcoholal95% 10mldesolucindealcoholal50% 2mldeaceitedeinmersin 5mldeblsamodelCanad Procedimiento: Pideaunadetuscompaerasqueselavelabocavigorosamenteconaguaparaeliminarlasclulas dedescamacin,bacteriasyresiduosdealimento. Solicita que efectu un raspado de atrs hacia delante en la parte interna de la mejilla con un extremodelabatelenguas. Limpia un portaobjetos con alcohol para eliminar la grasa y djalo secar, enseguida extiende le raspadobucaldeabajohaciaarribaenelportaobjetoscomosirealizarasunfrotis. Agregacuatrogotasde alcoholal95%,procuraque cubraperfectamentelapreparacinyespera 10minutos.Despushidratalapreparacin,aadiendocuatrogotasdealcoholal50%yaguarda5 min. Incorporaalapreparacincincogotasdeacetatode orceinaydejatranscurrir8minutosdespus deeselapsodetiempolavalapreparacinbajounchorrosuavedeaguaparaeliminarelexcesode colorante. ColocacuatrogotasdecoloranteverdedeJanus(decontraste)esperaunapardeminutosylavade nuevolapreparacinpararetirarelexcesodecolorante.Dejasecaralaire. Acomodalapreparacinenelmicroscopioyobsrvalaconelobjetodemenoraumentolocalizaun campovisualadecuado.Viertesobrelapreparacinunagotadeaceiteinmersin(100x). Parapreservarlamuestra,siestabiencoloreada,adeledosgotasdelblsamodeCanadatoda la superficie del frotis y coloca encima un cubreobjetos, presiona ligeramente sobre la superficie. Etiqutalaconelnombredelapreparacinygurdala.

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

CRITERIOSEVALUACIN UNIDADI
CRITERIOS Producto PORCENTAJE 30

Desempeo

30

Conocimiento

15

Actitud

25

Total

100%

BiologaContempornea

FDA03

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

GLOSARIO
Acido desoxirribonucleico (ADN): El portador de la informacin gentica en las clulas, compuesto por doscadenascomplementariasdenucletidosenrolladasenunadoblehlice,capazdeautorreplicarseyde dirigirlasntesisdeRNA. Acido nucleico: Macromolcula formada por nucletidos. Los tipos principales son el cido desoxirribonucleico(DNA)yelcidoribonucleico(RNA). Acido ribonucleico (RNA): Macromolcula formada por nucletidos. Los tipos principales son el cido desoxirribonucleico(DNA)yelcidoribonucleico(RNA). Biosntesis:Formacin,porpartedelosorganismosvivos,decompuestosorgnicosapartirdeelementos ocompuestossimples. Canal inico: Protena que forma un poro hidroflico a travs de la membrana por el que difunden iones especficosafavordesugradienteelectroqumico. Carbohidratos:Hidratodecarbono.Compuestoorgnicoqueconsisteenunacadenaoanillodetomosde carbonoalosqueestnunidoselhidrgenoyeloxgeno. Catalizador: Sustancia que disminuye la energa de activacin de una reaccin qumica formando una asociacintemporalconlasmolculasreactivascomoresultado,lavelocidaddelareaccinseacelera.Las enzimassoncatalizadoras. Clula:Launidadestructuraldelosorganismos,rodeadaporunamembranaycompuestaporcitoplasmay, en los eucariotas, uno o ms ncleos. En la mayora de las plantas, hongos y bacterias hay una pared celularporfueradelamembrana. Cigoto:Lacluladiploide(2n)queresultadelafusindelosgametosmasculinoyfemenino(fecundacin) un cigoto puede desarrollar un individuo diploide por divisin mittica o puede sufrir meiosis y formar individuoshaploides(n)quesedividenmitticamenteyformanunapoblacindeclulas. Citocromo:Protenasquecontienengruposhemoyparticipanenlascadenasdetransportedeelectrones intervienenenlarespiracincelularyenlafotosntesis. Clorofila:Clasedepigmentosverdesqueactancomoreceptoresdelaenergalumnicaenlafotosntesis. Cloroplasto:Organelalimitadaporunadoblemembrana:enestaorganelatienelugarlafotosntesisenlos organismoseucariotas(algasyplantas. Cdigogentico:SistemadetripletesdenucletidosenelDNAyelRNA,quellevainformacingentica determinalasecuenciadeaminocidosenlasenzimasyotrasprotenassintetizadasporelorganismo. Codn:Unidad bsica ("letra") del cdigo gentico tres nucletidos contiguos en una molcula de DNA o mRNA que llevan la informacin para un aminocido especfico o para la terminacin de la cadena polipeptdica. Coenzima:Molculaorgnicanoprotenicaquedesempeaunpapelaccesorioenlosprocesoscatalizados porenzimasyfrecuentementeactacomodadoroaceptordeunasustanciaqueintervieneenlareaccin. + NAD ,FADylacoenzimaAsoncoenzimascomunes. Cromatina: El complejo de DNA y protenas histnicas y no histnicas que componen a los cromosomas encariticossetieintensamente. Cromosoma:Laestructuraquellevalosgenes.Loscromosomaseucariticossonfilamentosobastonesde cromatina que aparecen contrados durante la mitosis y la meiosis y que en otros momentos estn contenidos en un ncleo. Los cromosomas procariticos consisten en un crculo de DNA con el que se asocianvariasprotenas.LoscromosomasviralessonmolculaslinealesocircularesdeDNAoRNA. Enzima:Molculadeprotenaglobularqueaceleraunareaccinqumicaespecfica. Fosfolipidos:Molculasorgnicassemejantesenestructuraalasgrasas,enlascualesungrupofosfato,en lugar de estar unido a un grupo cido graso lo est al tercer carbono de la molcula de glicerol como resultado, la molcula tiene una cabeza hidroflica y una cola hidrofbica. Los fosfolipidos forman la estructurabsicadelasmembranasdelasclulasydelasorganelas. Fotosntesis:Laconversindeenergaluminosaaenergaqumicaquetienelugarenloscloroplastosde las clulas eucariticas (algas y plantas) o en los tilacoides y protoplasma de las clulas procariticas. Implicatantolarecepcindelaenergalumnica,suconversinaenergaqumica(ATPyNADPH)ascomo lafijacindeldixidodecarbonoencompuestosorgnicos

Gen:LaunidaddelaherenciaenuncromosomasecuenciadenucletidosenlamolculadeDNA quedesempeaunafuncinespecfica,talcomocodificarunamolculadeRNAounpolipptido.
Genoma:Latotalidaddelmaterialgenticodeunaclulaoindividuo.Elconjuntocompletodecromosomas deunaclulaoindividuoconsusgenesasociados.
BiologaContempornea FDA03 10

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

Genotipo: La constitucin gentica de una sola clula o de un organismo con referencia a una sola caractersticaoaunconjuntodecaractersticaslasumatotaldetodoslosgenespresentesenunindividuo. Glicoproteina:Protenaconunaomscadenasdecarbohidratosunidoscovalentemente.

BiologaContempornea

FDA03

11

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

REACTIVOS
1.Eslaunidadanatmica,funcionalydeorigendelosseresvivos? a)tomo b)Molculaorgnica c)Clula 2.sonorganelosquecontienenenzimasquehidrolizanlasmolculasduranteladigestincelular? a)Lisosomas b)Ribosomas c)Mitocondrias 3.LoscidosnucleicosADN,ARNseencuentranenelncleodelaclulaysonlosportadoresde? a)Clorofila b)Informacingentica c)enzimas 4.lospastosincolorossituadosenlaspartesdelvegetaldondenollegalaluzsellaman? a)Cloroplastos b)Leucoplastos c)Cloroplastos 5.sonlosorganelosespecializadosensintetizarprotenas? a)Lisosomas b)Ribosomas 6. Enestosorganelossellevanacabolarespiracincelular? a)Cloroplastos b).Mitocondrias 7.lamembranacelularestaformadapor? a)Carbohidratosyprotenas b)Aminocidosylpidos c)Retculoendoplastos. c)Ribosomas c)Carbohidratos,lpidosyprotenas.

8.Lasclulassonmembranasinternas,organelosyncleosdefinidossellaman? a)Sexuales b)Procariontes c)Eucariontes 9.lasclulasquecarecendemembranasinternas,porloquenotienenncleoniorganelosdefinidos,se denominan? a) Procariontes b)Eucariontes c)Virus 10.En1838MatasSchleidenySchwannpropusieron? a)Teoracontemporneadelorigendelavida b)Teoracelular 11.lasprimerasformasdevidafueron? a)Clulasprocariontes b)Clulaseucariontes c)Teoradelaplasmogenia

c)Animales

12.Esuncomponenteestructuraldelaclula,tienelacapacidaddealbergaralosorganelos. a)Citoplasma b)Ncleo c)Membranacelular. 13.Enestaformadereproduccinsereducepormitadelncleo,numerodecromosomas,enlasclulas descendientes. a)Ciclocelular b)Mitosis c)Meiosis 14.Un virusconstabsicamentedematerialgentico. ADNARN SI___x________ NO___________ 15.lasclulasquepresentanmembranasinternasconorganelosyncleobiendefinidosydelimitadoscada unoporsupropiamembrana,sedenominan. a)Sexuales b)Eucariontes c)Procariontes 16. Sonlosorganelosdellevaracabolarespiracincelular. a)Cloroplastos b)Mitocondrias c)Ribosomas

17.Esunorganeloformadosporunconjuntodemembranasendondesealberganlosribosomasdurantela sntesisdeprotenas. a)Retculoendoplasmico b)Aparatodegolgi c)Vacuola

BiologaContempornea

FDA03

12

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

18.Organismounicelulareseucariontesdenutricinhetertrofa. a)Protofitos b)Algasverdeazules

c)Protozoarios

19. Organismosunicelularesprocariontesdegranimportanciaenlaagriculturaylamedicina. a)Protofitos b)Bacterias c)Protozoarios. 20.mencionealgunosorganismospertenecientesalasclulasprocariontes. a)Plantas,animales,et b)bacterias,algasverdeazules,etc.. c)Hongosyprotistas. 21.Sonloselementosqumicospresentesenlosseresvivos. a)Elementosorgnicos b)Bioelementos c)Biomolculas

22. Unamolculainorgnicadegranimportanciaparalosseresvivos,puesdurantelafotosntesisaporta carbono,paraformarcarbohidratos. a)H2O b)CO2 c)ATP 23.Mineralqueconstituyeelradicalfosfato,porloqueparticipaenreaccionesenergticas. a)Fsforo b)Calcio c)Azufre 24.sonloselementosqumicosqueformanlasmolculasdecarbohidratosylpidos. a)CHO b)CHON c)CHONSP 25.molculasorgnicas formadasporCHOPScuyafuncinenelorganismoesestructuralprincipal. a)Vitaminas b)Protenas c)Carbohidratos. 26.MolculasorgnicasformadasporCHO,cuyafuncinenelorganismoesprincipalmenteenergtica,y enocasionesestructural. a)Lpidos b)Vitaminas c)protenas 27.Molculasproteicasformadasporunaporcindeaminocidosyotracomposicindiferente. a)Protenasimple b)Vitaminas c)protenaconjugada 28. Estas molculas se llaman tambin catalizadores biolgicos por aumentar la velocidad de algunas reaccionesquesellevanacaboenlaclula. a)Vitaminasb)enzimas c)protenas 29.Molculasorgnicasmuypequeas,enformaindividualcarecendeactividadperosonnecesariaspara activarciertasenzimas. a)Protenas b)nucleoprotenas c)coenzimas

30.Laclularequieredeestasmolculasenpequeascantidadesparallevaracaboalgunasreacciones,se tratade: a)Vitaminas b)carbohidratos c)lpidos

31.LasvitaminasA,D,E,Kporsusolubilidadseubicanenelgrupo: a)Liposolubles b)hidrosolubles c)insolubles 32.Sonloscuatrobioelementosqueconstituyenlamayorpartedetodoservivo: a)C,H, O,N b)C,H,O,P c)H,O,S,K

33.Constituyeellimiteexteriordelaclulaledaformayproteccin. a)Membranacelular b)citoplasma c)ncleo

BiologaContempornea

FDA03

13

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

34. Esta compuesta por una doble capa de lpidos, denominados fosfolipidos, dentro de las cuales se encuentraprotenasycarbohidratos. a)Ncleo b)membranacelular c)cloroplastos 35.Realizalafuncindetransportealcontrolarelpasodematerialesentrelaclulaysuambiente a)Micrografa b)funcindela membranacelular c)teoracelular 36.Porquepermiteelpasodeazucaressimples,oxigeno,aguaybixidodecarbono,peroimpideelpaso deprotenasylpidos. a)Permeableosemipermeable b)nutricin c)materialgentico 37.Cualessonlostiposdetransportequerealizalamembranacelular a)Transporteactivoypasivo b)fotosntesis c)ADN 38.Eselmovimientodeingresode salidadematerialesusandoenergaenformadeATPyserealizade zonasdemenorconcentracinhacialosdemayorconcentracin. a)Transportepasivo b)transporteactivo c)osmosis 39.consistenenlaentradaosalidadematerialesdeunazonademayorconcentracinhaciaunademenor concentracinenestecasonoserequieredeenerga,pueselmovimientodependedelaenergacinticade laspartculasdelamateria. a)Difusin b)alimentacincelular c)transportepasivo 40.Mencionarloscomponentesdelasclulas: a)ncleo,mitocondria,aparatodegolgi,vacuola,centrosoma,nucleolo,retculoendoplasmicoycitoplasma b)ncleo c)clulaprocarionte 41.Esunprocesomedianteelcuallaclulaadquiereenergaparallevaracabosusfunciones a)Respiracincelular b)gluclisis c)gemacin 42.Cuantostiposderespiracinconoces: a)Activoypasivo b)aerobiayanaerobia c)mitosisymeiosis

43.Cualeslarespiracincelularquenecesitadelapresenciadeloxigenopararealizarse a) Respiracinaerbica b)biparticin c)respiracinanaerbica 44.Aquetipodeorganismosselesllamaauttrofos a)Atodaslasplantas,algasyalgunostiposdebacterias b)virus c)hongos 45.cualessonlostiposdereaccionesqueintervienenenla fotosntesis. a)reaccinluminosayobscura b)mitosisymeiosis. c)aerobiayanaerobia 46.llamadasasporquesolopuedenocurrirunaenpresenciadelaluzdelsol. a)reaccinluminosa b)mitosis c)ncleo 47.llamadasasporquepuedenllevarseacabosinluzsolar. a)materiaviva b)reaccinobscura c)acetabularias

BiologaContempornea

FDA03

14

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

48.sirveparasintetizarproductosorgnicos,ricosenenergatalescomoglucosa,dixidosdecarbonoyel agua. a)luzsolar b)protenas c)vitaminas 49.Esunprocesobiolgicomedianteelcualseproducennuevosindividuos? Muerte Reproduccin Enfermedad 50.Dequetipospuedenserlareproduccin? Sexualasexual Saprofitaanatmica Elsticafsica.

51.Lasbacterias,algas,hongos,musgosytraquefitasquetipodereproduccinrealiza? Sexual Asexual Trmica 52.Cuantostiposdereproduccinexisten? Sexual,asexual,gemacin,regeneracin,fragmentacin,esporas,etc 53.Sonparteimportanteenlareproduccinsexual? A.masculinofemenino Vaginaovario Escrototestculos 54.Cualessonlostiposdereproduccinexisteenlasclulas? Sexualasexual Meiosismitosis Ovricatesticular 55.Alcontactoentreelaparatoreproductormasculinoyfemeninoseconocecomoreproduccin? Asexual Sexual Meiotica 56.Sonsecuenciasdeetapasofasesqueatraviesaunaclulaentreunadivisinyotra? Ciclocelular Divisin Reparticin 57.Acuantosindividuosdaorigenlareproduccindelosorganismosprocariotas? 1individuo 2individuos 4individuos 58.Enlosorganismoseucariotaladivisinserealizapor? Divisinsimple Meiosis Mitosis 59.Decuantasfasesconstaelciclocelular? 2fases 4fases 7fases

60.Quefuncincumplenlasprotenasenelciclocelular? Activardeterm.Protenas Determ.elndicedeprotenasMataralasprotenas. 61.QuienesdescubrieronlosgenesCDC? HartwellNurse WhitakerNewton PascalFabre

62.Descubrilaprimeraciclinaacomienzosdeladcadatrabajosrealizadosenerizosdemar? Shekespiare T.Hunt Newton 63.Sonmolculasmuycomplejasqueproducenclulasvivasylosvirus? Ac.Nucleicos ADN ARN 64.Cualessonlasdosfuncionesbsicasdeac.Nucleico? a).Trasmitirlascaractersticashereditarias b).Dirigirlasntesisdeprotenasespecificas. 65.Cualessonlosdostiposdecidosnucleicosqueexisten? a)ADNARN ADCCDC RANDAN
BiologaContempornea FDA03 15

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

66.Atravsdequecodificanlasclulasvivaselmaterialgentico? a)ARN b)ADN 67.EnlosmamferoslascadenasdeADNseagrupanformando? ARN Cromosomas

c)FAO ADN

68.F.crack,M.WilkinsyR.Franklinrealizaronestudiosyencontraronformacionesllamadas? ARN Cromosomas 69.Sonmacromolculasformadasporaminocidos. a)Enzimas b)protenas c)Carbohidratos 70.Sonmacromolculasformadasporaminocidos. a)Enzimas b)protenas b)Carbohidratos 71.Formulaqumicadelgrupoamino a)COOH b)CH2OH c)NH2

72.CientficosquepropusieronunmodelodelaestructuradelADNen1953 a)WatsonyCrack b)LuisPasteur c)Lamarkc 73.Lainformacin,ordenylocalizacindelADNseencuentranenlosgenesde: a)tomos b)molculas c)Cromosomas 74.Amediadosdeladcadade1970sedesarrollarontcnicasquedieronlugaralaqueseconoce. a)Ing.Gentica b)Tecnologa c)Biotecnologa 75. enlos siglos XVIII y XIX se empez a estudiarla transmisin delascaractersticashereditarias y con ellaeldesarrollode: a)Tecnologa b)Biotecnologa c)biologa 76. Con la Ing. Gentica es posible introducir genes de un organismo en otro para crear los organismos transgenicossurgiendo. a)Biologamoderna b)Herencia c)Tecnologa 77.Enqueaoseaplicaronbiotecnologasenlaagriculturacobrandogranrelevancia. a)1970 b)1970 c)1953 78.Esunatcnicaenlaquelamanipulacingenticaserealiceenunasolaclulayseobtieneorganismos idnticosentres. a)Mutacin b)Genomita c)Clonacin 79.EsunsegmentodeADNquecontienelainformacinnecesariaparasintetizarunacadenapolipeptidica ounamolculadeARNr a)Gen b)cromosomas c)locus 80. es la apariencia externa de un organismo, determinado por la accin de los genes, como por el ambiente. a)Genotipo b)Fenotipo c)Gen

BiologaContempornea

FDA03

16

Co o ll eg g io od d eE st tu d ii os sC Ci i en n t f f ii c os sy yT Te ec cn ol l gi ic o sd lE Es st t ad do od d eT ab b as sc o C e i eEs u d o e t c o n o g c o sd el e a eTa a c
Organis moDescentralizado

DerechosReservados
ElDepartamentodePlanesyProgramasdeEstudiosereservanelderechoderealizarcambiosenesta Secuenciadelasasignaturas PropeduticasyoptativasdeCampoProfesional. D.R.

BiologaContempornea

FDA03

17