Está en la página 1de 21

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial.

Ctedra Jerusalinsky

2013

Biologa e Introduccin a la Biologa Celular (Cd:54)


Gua de Actividades y Ejercitacin Segunda Parte (2do cuatrimestre de 2013)

Ctedra Jerusalinsky

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

ACTIVIDADES COMPLEMENTARIAS A LOS CUADERNILLOS 11 y 12


1) Complet el siguiente esquema:

2) Marc con una letra N, los procesos o eventos celulares que tienen localizacin nuclear, y con una C, los que se localizan en el citoplasma. sntesis de ARNm sntesis de histonas. replicacin o autoduplicacin del ADN. ..trascripcin del ARNt. ...unin de las protenas ribosomales al ARNr. ..sntesis del ARNr. ..ensamble de la subunidad mayor y menor del ribosoma. ..traduccin del ARNm. ..regulacin de la expresin gnica. ..maduracin del ARNm. 3) Redact breves prrafos relacionando los siguientes trminos: a. complejos de poro nuclear translocacin energa b. nucleolo ARN ribosomal subunidades ribosomales c. cromosomas cromatina protenas estructurales 4) Indic brevemente: qu es un cariotipo cules son las caractersticas del cariotipo humano masculino y femenino una utilidad de la confeccin de cariotipos de la misma especie. una utilidad de la confeccin de cariotipos de distintas especies.

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

5) De acuerdo a la actual definicin, un gen es un segmento de ADN a partir del cual se genera un producto con funcin en la clula. Indic qu productos se pueden obtener a partir de los distintos genes, y cul es la funcin de cada uno de ellos. 6) Complet el siguiente cuadro comparativo: Genoma procarionte Caractersticas de las molculas de ADN Localizacin en la clula del ADN Presencia de secuencias no codificantes Presencias de secuencias repetidas Genoma eucarionte

7) Seal al menos cinco diferencias y cinco semejanzas entre la transcripcin en procariontes y en eucariontes. 8) Seal tres diferencias entre los ARNm eucariontes y los ARNm procariontes 9) Confeccion un cuadro comparativo entre transcripcin y traduccin considerando los siguientes tems: - tipo de proceso en cuanto a la materia y a la energa - localizacin celular en eucariontes y procariontes - sustratos - productos - enzima principal - otras enzimas involucradas - otras estructuras y/o macromolculas involucradas - molcula con funcin de molde - sentido de la lectura - fuente de energa - seal de inicio - seal de finalizacin 10) Respecto al cdigo gentico: a. Qu es? Qu significa que es universal? Qu significa que es degenerado? b. Diferenci claramente los conceptos de cdigo gentico e informacin gentica. c. Indic si las siguientes afirmaciones son verdaderas o falsas, justificando la eleccin: i) El cdigo gentico contiene la informacin para la sntesis de las protenas ii) El Proyecto Genoma Humano consiste en descifrar el cdigo gentico de la especie humana iii) Dada una secuencia de nucletidos, el cdigo gentico nos permite saber a qu secuencia de aminocidos corresponde iv) Dada una secuencia de aminocidos, el cdigo gentico nos permite saber a qu secuencia de nucletidos corresponde 11) La siguiente secuencia de nucletidos corresponde a la cadena molde de un fragmento de ADN. Supon que se trata de un gen que codifica para una protena.
3

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

1 10 20 30 TAGCCTACGTATCATCTCCCGGGTACAAAATCAC 1. a. Cul es el resultado de la transcripcin? b. Cul es el resultado de la traduccin? 2. Si se produce una sustitucin (cambio) del nucletido de la posicin 19 (cuya base nitrogenada es citosina) por un nucletido de timina, a. cul ser la consecuencia en la traduccin? b. la protena obtenida tendr la misma forma y la misma funcin? Por qu? 3. Puede ocurrir que una sustitucin de un nucletido por otro no altere la secuencia de aminocidos de la protena? Por qu? Explicar con un ejemplo. 4. Dadas las siguientes mutaciones puntuales cul ser la consecuencia en la traduccin para cada una de ellas? a. Sustitucin del nucletido de la posicin 15 (timina) por adenina. b. Sustitucin del nucletido de la posicin 8 (citosina) por guanina. c. Insercin (agregado) de un nucletido de adenina entre las posiciones 22 y 23. d. Delecin (prdida) del nucletido de guanina de la posicin 9. 5. Considerando los ejemplos de los puntos 2, 3 y 4, explicar: a. Cules son las mutaciones llamadas silenciosas? Con qu caracterstica del cdigo gentico se relacionan dichas mutaciones? b. Qu tipo de mutaciones producen un corrimiento del marco de lectura ? 12) Dada una clula cualquiera, cul sera la consecuencia si... a. ... todos los ARNt para la leucina estn alterados, de modo que no reconocen a estos aminocidos? b. ...tiene alteradas todas las aminoacil ARNt sintetasas para el aminocido glicina? c. ...ocurri un error durante la transcripcin de un ARNm de la protena J, que genera un codn stop prematuro? d. ...ocurri una mutacin en el gen de la protena J, que genera un codn stop prematuro? e. ...ocurri una mutacin en el promotor del gen de uno de los ARN ribosomales que impide su reconocimiento? 13) En las clulas eucariontes, la presencia de una envoltura nuclear que separa espacialmente los procesos de transcripcin y traduccin, tiene una consecuencia fundamental para este tipo de clulas De qu consecuencia se trata? 14) Luego de estudiar los mecanismos de regulacin de la expresin gentica en procariontes, seal cinco similitudes y cinco diferencias entre los operones lac y trp. 15) Mencionar cuatro niveles de regulacin de la expresin gentica en eucariontes, y explic brevemente un ejemplo para cada uno.

EJERCITACION TIPO MLTIPLE CHOICE CORRESPONDIENTE AL CUADERNILLO 11


1. Las importinas son protenas que: a. se sintetizan en el ncleo. b. transportan monmeros al interior del ncleo c. forman parte de la envoltura nuclear.
4

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

d.

reconocen la SLN (seal de localizacin nuclear).

2. Seal la opcin correcta: a. La heterocromatina contiene solamente secuencias altamente repetidas. b. La eucromatina contiene genes que generalmente se estn transcribiendo. c. El ADN del centrmero y los telmeros no est asociado a histonas. d. Los centrmeros corresponden a segmentos de eucromatina. 3. En el nuclolo se: a. sintetiza el ARN ribosomal b. unen las subunidades ribosomales. c. sintetizan las protenas y los ARN ribosomales d. encuentran los genes de las histonas 4. Cul de los siguientes eventos ocurren en el ncleo? a. Sntesis de protenas ribosomales. b. Traduccin del ARNm c. Duplicacin del ADN d. Unin de las subunidades ribosomales. 5. Las siguientes macromolculas y/o estructuras presentan SLN: a. Los ARN mensajeros, de transferencia y ribosomales. b. Histonas y subunidades ribosomales. c. Enzimas de la transcripcin y de la duplicacin del ADN. d. Factores que intervienen en la traduccin. 6. Las histonas son protenas que: a. se asocian indistintamente al ARN. b. poseen una seal reconocida por una importina. c. se sintetizan en los ribosomas de la membrana nuclear d. se sintetizan en todas las clulas 7. A travs del CPN (complejo de poro nuclear) sern importados al ncleo: a. ARN mensajeros. c. ARN de transferencia. b. Protenas ribosomales d. factores de traduccin.

EJERCITACION TIPO MLTIPLE CHOICE CORRESPONDIENTE AL CUADERNILLO 12


1. a. b. c. d. Respecto al genoma de una bacteria: presenta gran cantidad de secuencias repetidas presenta muchos genes repetidos. contiene genes que poseen informacin para histonas. Contiene genes en copia nica.

2. Un gen es: a. Un segmento de ARN que contiene informacin para la sntesis de una protena. b. Un segmento de ADN que contiene informacin para la sntesis de algn tipo de ARN. c. Una secuencia de nucletidos que siempre es traducida. d. Una secuencia de nucletidos que necesariamente debe ser transcripta. 3. Seale una caracterstica que le permita distinguir la transcripcin en eucariontes, de la que ocurre en bacterias:
5

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

a. requiere una ARNpolimerasa. b. utiliza ribonucletidos trifostatados. c. requiere factores basales de transcripcin. d. es selectiva y asimtrica. 4. Seale cual es la secuencia de la molcula de ARNm sintetizada a partir de la siguiente hebra codificante 5 ACCGGGTTAAA 3: a. 3 UGGCCCAAAUUU 5. c. 5 UGGCCCAAAUUU 3. b. 3 UUUAAACCCGGU 5. d. 5 ACCGGGUUAAA 3. 5. Cul de las siguientes caractersticas se encuentra solamente en un ARNm bacteriano: a. la presencia de varios codones que codifican para metionina. b. la presencia de un nico codn STOP. c. la orientacin de 5 a 3. d. la presencia de varios codones de iniciacin. 6. El proceso de splicing: a. Ocurre sobre ARNm procarionte policistrnico. b. En eucariontes da como resultado un transcripto primario. c. Permite la eliminacin de intrones y el empalme de los exones. d. Consiste en el alargamiento de la cadena de ARNm maduro por agregado de poliA 7. La transcripcin en una bacteria: a. ocurre al mismo tiempo que la traduccin. b. requiere de factores de transcripcin especficos. c. utiliza varias ARNpolimerasas. d. utiliza siempre la misma hebra como molde 8. a. b. c. d. Que el cdigo gentico sea degenerado significa que: existen varios codones de inicio cada aminocido est codificado por tres codones los aminocidos pueden estar codificados por ms de un codn el codn que indica el inicio de la traduccin tambin codifica para un aminocido

9. Respecto a la traduccin: a. tanto en procariontes como en eucariontes se inicia en el citoplasma. b. requiere solamente de la energa proveniente del ATP. c. el ARNm se lee siempre desde el extremo 3 libre hasta el primer codon STOP. d. se inicia siempre agregando el aminocido metionina en el sitio A (aminoacil). 10. En condiciones experimentales a partir de un nico ARNm bacteriano fue posible sintetizar 3 protenas distintas. Esto es debido a: a. el splicing alternativo. b. la presencia de polirribosomas. c. las mutaciones en el ADN. d. la presencia de mensajeros policistrnicos. 11. Las clulas musculares y las clulas nerviosas de un mismo individuo son iguales en cuanto a: a. los genes que se expresan b. todas las protenas que sintetizan c. la informacin gnica que poseen. d. todos los ARN mensajeros que sintetizan
6

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

12. Si se desea sintetizar el tripptido histidina-fenilanalina-lisina experimentalmente en el laboratorio, cul de las siguientes sera la secuencia de ADN necesaria para la sntesis: a. 5TACGTGAAATTTACT--3. b. 3TACGTGAAATTTACT5. c. 5ATGCACTTTAAATGA3 d. 3ATGCACTTTAAATGA5. Considere los siguientes datos: his=CAC, fen=UUU, lis=AAA, stop=UGA, met=AUG. 13. Seale la opcin correcta: a. el cdigo gentico de una bacteria ser diferente al de una clula epitelial humana. b. el cdigo gentico de una bacteria ser igual al de una clula epitelial humana. c. la informacin gentica de una clula epitelial ser diferente a la de una neurona de un mismo individuo. d. la informacin gentica de una clula epitelial ser la misma, tanto para un humano como otro organismo no humano. 14. Tanto en el proceso de transcripcin como en el de traduccin se requiere energa que: a. proviene de los propios sustratos b. se utiliza para la unin entre monmeros c. proviene exclusivamente del ATP y del GTP d. se utilizara para la formacin de enlaces peptdicos 15. Cul de las siguientes opciones acerca del opern triptofano es correcta: a. codifica para cinco protenas implicadas en la va de degradacin del triptofano. b. la protena represora se une a la regin operadora en ausencia de triptofano. c. la protena represora no se expresa constitutivamente. d. en presencia de triptofano no se transcribirn los genes del opern. 16. Seale la opcin correcta respecto a los Operones: a. Son un sistema de regulacin gnica presente en todos los tipos celulares. b. Sus genes estructurales se transcriben como un ARNm policistrnico. c. La trascripcin de los genes reguladores depende de la presencia de una protena especfica. d. Sus genes estructurales codifican para protenas implicadas en diferentes vas metablicas. 17. Cul de las siguientes opciones incluye mecanismos de regulacin exclusivos de eucariontes?: a. induccin de la expresin gnica a travs de protenas reguladoras. b. represin de la expresin gnica a travs de protenas reguladoras. c. activacin de la ARN polimerasa a travs de protenas activadoras. d. maduracin del producto de la transcripcin de un gen. 18. Los factores de transcripcin son: a. secuencias de ribonucletidos con alta afinidad por el ADN b. secuencias de desoxirribonucletidos con baja afinidad por el ADN c. protenas con alta afinidad por el ADN d. esteroides con baja afinidad por el ADN

GUA DE ACTIVIDADES Y EJERCITACIN MLTIPLE CHOICE CORRESPONDIENTE A LA UNIDAD 8


7

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

1) Con respecto a las seales qumicas: a. Busc en la bibliografa la definicin de los siguientes trminos: hormona glndula endcrina rgano blanco neurotransmisor factor de crecimiento. b. Cul es la diferencia entre una seal qumica parcrina y una endcrina? Indique ejemplos de cada una. 2) Confeccion un cuadro comparativo entre las seales hidroflicas e hidrofbicas en cuanto a: - Localizacin de los receptores. - Tipos de molculas y ejemplos. - Formas en las actan en las clulas blanco 3) Observ la figura siguiente e explic qu ocurre en cada paso; 1-.. 2-.. 3-.. 4-.. 5-..

4) a. A qu se llama cascada enzimtica? b. A qu se denomina segundo mensajero? D tres ejemplos de segundos mensajeros. c. Utilizando el ejemplo de la hormona adrenalina, detalle la secuencia de pasos que ocurren a nivel celular desde que la hormona se une a su receptor, hasta que se desencadena una respuesta en el interior celular. (puede guiarse por la siguiente imagen . Intente identificar a la hormona receptor transductor de la seal - adenilato ciclasa segundo mensajero kinasa dependiente de AMPc)

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

UNIDAD 8. EJERCITACIN TIPO MLTIPLE CHOICE.


1. Las hormonas esteroideas se unen a a. un receptor de membrana c. un receptor nuclear b. un receptor citoslico d. el ADN directamente 2. a. b. c. d. Seale la opcin correcta: los neurotransmisores son liberados en el torrente sanguneo. Las hormonas son siempre de naturaleza proteica. Algunos receptores actan como canales para hormonas. Algunos receptores tienen actividad enzimtica. c. viajan por el torrente sanguneo. d. se unen a receptores

3. Los neurotransmisores: a. estn presentes en todas las clulas. b. Son seales qumicas liberadas por las neuronas. citoplasmticos 4. a. b. c. d. 5. a. b. c. d. 6. a. b. c. d.

Una hormona es una seal: siempre hidrofbica. Que no atraviesa la membrana plasmtica. Que puede provocar diferentes respuestas en diferentes clulas. Exclusiva de las clulas animales. El AMPc : Se une a un receptor de membrana acta fosfoforilando enzimas intracelulares actua como segundo mensajero amplificando una seal es producido por una protena G La amplificacin de la seal es un fenmeno que ocurre ,entre otras cosas por: La unin de una seal liposoluble a su receptor citoplasmtico degradacin de los segundos mensajeros el cierre de canales ligando dependientes Aumento de la concentracin citoplasmtica de segundos mensajeros.

GUA DE ACTIVIDADES Y EJERCITACIN MLTIPLE CHOICE CORRESPONDIENTE A LA UNIDAD 13


1) Ciclo Celular:
9

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

a) Cules son las fases del ciclo celular eucariota y cules son los eventos ms importantes en cada una? b) Qu factores pueden modular la duracin del ciclo celular eucariota? c) A qu se llama G0 y qu clulas se encuentran en este estado? d) Mencion por lo menos tres ejemplos de tipos celulares que se encuentran en activa divisin. e) Respecto al factor promotor de la fase S (FPS): - Qu es y qu funcin cumple en el ciclo celular? - Cul es la funcin de la subunidad cataltica? - A qu se debe el nombre ciclina de la subunidad regulatoria? f) Idem e) para FPM. 2) Confeccion un cuadro comparativo entre la duplicacin del ADN en procariontes y eucariontes considerando los siguientes tems: Localizacin celular Enzima principal Sentido de la sntesis Sustratos Fuente de energa Nmero de sitios de origen de la replicacin en cada molcula de ADN Terminacin del proceso Fidelidad del proceso y existencia de mecanismos de reparacin del ADN

3) Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente: a) Las molculas resultantes de la autoduplicacin del ADN son idnticas entre s porque este proceso es semiconservativo. b) Los cromosomas homlogos son idnticos en cuanto a forma, tamao e informacin gentica que contienen. c) En una clula 2n=6 que se encuentra en G1, el nmero de molculas de ADN presentes en su ncleo es 12. d) Si una clula que se encuentra en G1 se coloca en un medio que contiene un inhibidor de la ADN polimerasa no se podr dividir. e) Si una clula que se encuentra en G1 se coloca en un medio que contiene un inhibidor de la ADN polimerasa no podr producir protenas. f) Las clulas procariontes duplican su ADN en la etapa S g) Las bacterias duplican su ADN por fisin binaria. h) De la divisin de una bacteria se obtienen siempre dos bacterias con idntica informacin gentica. 4) Observ el siguiente cariotipo humano que se encuentra en la figura de la izquierda y respond: a. Cuntos cromosomas observa en total? Por qu se agrupan de a pares? b. Corresponde a un hombre o a una mujer? Cmo lo sabe? c. La informacin de todos los cromosomas ser igual o diferente? d. Comparado con el que se encuentra en el cuadro derecho, qu diferencias encuentra? Qu consecuencias tendrn estas diferencias para el individuo poseedor de este cariotipo?

10

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

5) Complet el siguiente cuadro comparativo: MITOSIS Clulas en que se produce Variabilidad gentica Presencia de cromosomas homlogos Apareamiento de los cromosomas homlogos Cantidad de ADN en las clulas hijas respecto a la original Numero de divisiones Tipo de divisin (ecuacional o reduccional) Requiere de la duplicacin previa del ADN? 6) Complet los siguientes esquemas correspondientes a la mitosis y meiosis, sealando: Nombre de cada fase. Grado de ploida y nmero de cromosomas para cada fase Cromosomas homlogos, cromtides hermanas/ recombinantes, y eventos ms representativos de cada fase.
11

MEIOSIS

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

ESQUEMA MITOSIS Y MEIOSIS

12

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

7) Cierta especie presenta una ploida 2n=6, y sus clulas presentan en G1 una cantidad de ADN de 100 unidades arbitrarias. En base a estos datos completar los siguientes cuadros: Etapa del ciclo (clula somtica) G1 G2 Metafase En cada polo de la telofase Etapa del ciclo (clula germinal) G1 G2 Metafase I En cada polo de la telofase I Metafase II En cada polo de la telofase II N de cromosomas Cantidad de Nro de ADN cromtides por cromosoma N de molculas de ADN N de cromosomas Cantidad de Nro de ADN cromtides por cromosoma N de molculas de ADN

8) Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente: a) La segunda divisin meitica es reduccional porque da como resultado clulas haploides b) Durante la interfase pueden ocurrir mutaciones puntuales y cromosmicas. c) Durante la meiosis se separan primero las cromtidas y luego los cromosomas homlogos. d) Una clula resultante de la mitosis tiene la mitad de ADN y de cromosomas que la clula madre en G2. e) Una clula n=8 puede provenir de una clula n=8 que hizo mitosis o de una clula 2n=16 que hizo meiosis. f) La clula huevo o cigota se divide por meiosis. g) Los espermatocitos II son clulas haploides porque sufrieron primera divisin meitica h) Un ovocito I en G1 tiene la misma cantidad de ADN que una ovogonia en G1 i) La mitosis permite que todos los individuos pluricelulares se reproduzcan asexualmente. j) La meiosis ocurre solo en individuos de reproduccin sexual. 9) Para cada evento de la primera columna elegir la o las fases del ciclo celular en las que ocurre:

13

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

Sntesis de histonas Sntesis de ADN Separacin de cromtidas hermanas Mxima compactacin de la cromatina Sntesis de ARN ribosomal Concentracin alta de FPS Desintegracin de la envoltura nuclear Separacin de cromtides recombinantes Formacin del huso acromtico Descondensacin de los cromosomas Apareamiento de homlogos Separacin de cromosomas homlogos 10) Complet el siguiente cuadro: Edad de la mujer Hasta los 3 meses De gestacin Hasta el nacimiento 2 aos Pubertad 30 aos 70 aos Embarazo Clulas en el ovario Edad del hombre Hasta los 3 meses de gestacin Hasta el nacimiento 2 aos pubertad 30 aos 70 aos

G1 S G2 profase metafase anafase anafase I telofase anafase II profase I

Clulas en el testculo

11) Dada una especie 2n=4: a. esquematiza: una clula epitelial en profase la cigota en anafase una clula en profase I un ovocito I en anafase un espermatocito II en metafase un ovocito II en anafase b. Seal en cada esquema un par de cromosomas homlogos y un par de cromtidas hermanas o recombinantes (si no fuera posible, explicar por qu). c. En los casos que sea posible, indic el nombre de las clulas resultantes de la divisin correspondiente. 12) Considerando la especie humana, en donde tenemos en nuestras clulas somticas 46 cromosomas en total. Si partiramos de una cantidad de ADN de 100 unidades arbitrarias en G1. Tendramos

14

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

Etapa del ciclo (clula somtica) G1 G2 Metafase En cada polo de la telofase Etapa del ciclo (clula germinal)

N de cromosomas

Cantidad de Nro de ADN cromtides por cromosoma

N de molculas de ADN

N de cromosomas

Cantidad de ADN

Nro de cromtides por cromosoma

N de Nombre de la molculas de clula ADN germinal (masculina y femenina)

en metafase I En cada polo de la telofase I Profase II Metafase II En cada polo de la telofase II

Problemas de gentica para trabajar en Clase


1) En los ogros el color de piel verde domina sobre el color de piel azul. Teniendo en cuenta esto antes de ir a ver (nuevamente) la saga de Shrek, conteste: a) Puede una pareja de ogros azules tener un ogrito de piel verde? b) Pueden Shrek y Fiona tener un ogrito de piel azul? Justificar las respuestas con los cruzamientos correspondientes. 2) En las ratas de laboratorio el carcter cola larga domina sobre el carcter cola corta. Suponga que Ud. tiene una rata de cola larga Cmo hara para averiguar su genotipo? 3) Una mujer de grupo sanguneo A tiene un hijo de grupo B. Indicar todos los genotipos posibles de la mam, el beb y el pap. 4) a. Dadas las siguientes parejas, cul es la probabilidad de tener un hijo daltnico para cada una?
15

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

Pareja N 1 2 3

Mujer Portadora Daltnica De visin normal

Hombre De visin normal De visin normal daltnico

b. Cmo debe ser el genotipo de una pareja para que, en el caso de que tengan una hija mujer, ella sea daltnica? 6) Se realiza el cruzamiento de una planta de semillas amarillas (A) y Lisas (L), de una lnea pura, con otra de semillas verdes y rugosas. Seale si las siguientes afirmaciones son verdaderas o falsas. a. Todas las plantas de la F1 sern de semillas amarillas y lisas. b. Todas las plantas amarillas y lisas formarn solamente un tipo de gametas. c. Las plantas de la F2 tendrn solo dos fenotipos posibles: semillas amarillas y lisas, o semillas verdes y rugosas. d.Entre los individuos de la F2 habr al menos 16 genotipos diferentes posibles. 6) En la telenovela de la tarde la familia Gonzlez- IIturralde comienza a dudar de que la beb que les dieron en la maternidad, sea su legitima heredera, piensan que fue cambiada al nacer por la hija de la familia Corts . Se ordena el examen de los grupos sanguneos de las respectivas hijas y de los padres, con los siguientes resultados: Madre Padre Hija Familia Gonzles- Iturralde AB O A Familia Cortes A B O a. Es cierto que a los Gonzlez Iturralde son los verdaderos padres de la hija del matrimonio Cortes. Justifquelo mediante los cruzamientos necesarios. b. Conociendo tan solo los fenotipos de sus padres y habiendo cursado Biologa, podra la hija de los Cortes dudar de ser la hija de su padre? Como debera ser el genotipo de su padre para asegurar que la Sra Cortes no ha sido infiel?

Ejercitacin Adicional de Gentica Parte I: Problemas de Primera Ley y de Codominancia Dato: Para resolver los problema de gentica recuerde que para nuestra especie consideramos que los colores oscuros de pelo u ojos dominan sobre los colores claros. 1. En una especie de ratas existen tres alelos para el gen que determina el color de pelo: R1, R2 y R3 Considerando que la especie es diploide, cuntos genotipos posibles hay? 2. El factor Rh presenta dos alelos: Rh+ domina sobre Rh . Ana tiene sangre factor Rh+ y Juan tiene sangre factor Rh Cul es la probabilidad de que esta pareja tenga un hijo de factor Rh+? 3. Dos personas fenotpicamente normales (A_) tienen un hijo albino (aa) a. Cul es la probabilidad de que su segundo hijo manifieste ese rasgo? b. Dibujar una clula somtica de uno de los padres, indicando cromosomas homlogos y alelos (suponer 2n=4)
16

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

4. En las langostas, el color de ojos rojo domina sobre el color de ojos blanco. Se cruza una langosta macho de ojos blancos con una hembra de ojos rojos y se obtienen 309 langostas de ojos blancos y 298 de ojos rojos. a. Indicar genotipo y fenotipo de los padres y la descendencia. b. Dibujar las posibles gametas de la hembra indicando cromosomas homlogos y alelos (suponer 2n=8) 5. Indicar la respuesta correcta: Dado un individuo heterocigota para un determinado carcter, solamente se puede garantizar que el 100% de su descendencia tendr fenotipo dominante si se aparea con un individuo a) heterocigota c) homocigota dominante b) homocigota recesivo d) homocigota, dominante o recesivo 6. Un hombre de grupo sanguneo A y una mujer de grupo AB tienen un hijo de grupo B Cul es la probabilidad de que su prximo hijo sea de grupo A? 7. Indicar la respuesta correcta: Qu grupos sanguneos pueden heredar los hijos de un hombre de grupo B y una mujer de grupo A, ambos homocigotas? c) A o B solamente c) A, B o 0 b) A, B, AB o 0 d) AB solamente PARTE II: PROBLEMAS DE SEGUNDA LEY DE MENDEL. 1. Cuntas gametas diferentes puede formar... a. ...una persona que presenta un genotipo heterocigota para dos genes (AaBb) (se sabe que ambos genes se encuentran en diferentes pares de cromosomas homlogos). b. ...una persona que presenta un genotipo heterocigota para el color de pelo y homocigota recesivo para el factor Rh? c. ...una persona que presenta un genotipo homocigota para dos caracteres? 2. En una especie de aves, el pico recto domina sobre el pico curvo, y el color gris de las plumas domina sobre el marrn. Un ave macho heterocigota para ambos genes se cruza con una hembra de pico recto y plumas marrones. Algunos de sus pichones tienen pico curvo. a. De acuerdo a estos datos cul es la probabilidad de que tengan pichones de pico recto y plumas grises? Justific con el cuadro correspondiente. b. Suponiendo 2n=4, dibuj: i) una clula somtica del macho en metafase y ii) una clula sexual de la hembra en anafase I. En ambos dibujos seal un par de cromosomas homlogos, un par de cromtidas hermanas o recombinantes y los alelos para cada gen. 3. Marcos es de ojos oscuros y padece fenilcetonuria (enfermedad recesiva no ligada al sexo). Marcela, de ojos claros, es sanita. Pepe, el hijo de ambos, es de ojos claros y fenilcetonrico. a. Indicar genotipo y fenotipo de los tres integrantes de la familia b. Cul es la probabilidad de que un hermanito de Pepe sea fenilcetonrico y de ojos claros? c. Dibujar una clula de Marcos en metafase, otra en metafase I y otra en metafase II, indicando cromosomas homlogos, cromtidas hermanas y alelos (suponer 2n=4). 5. Una mujer morocha y de ojos negros y un hombre rubio y de ojos celestes tienen dos hijos: uno morocho y de ojos celestes y otro rubio y de ojos negros. a. Indicar los genotipos de los cuatro integrantes de la familia b. Cul es la probabilidad de que un tercer hijo sea morocho y de ojos negros? c. Dibujar una clula del hombre en anafase I, indicando cromosomas homlogos, cromtidas hermanas o recombinantes y alelos (suponer 2n=6).
17

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

d. Dibujar una clula de la mujer en anafase II, indicando cromosomas homlogos, cromtidas hermanas o recombinantes y alelos (suponer 2n=6). 6. Una mujer cuyo fenotipo es B, Rh+ da a luz un beb de fenotipo A, Rh-. a. Indicar todos los genotipos posibles de la mam y el hijo. b. Cmo debera ser genotpicamente el pap para asegurar que su esposa le ha sido fiel? c. Cmo debera ser genotpicamente el pap para asegurar que su esposa lo ha engaado? 7. En la zona pampeana habita una especie de ratn de campo. Supon que en dicha especie el pelaje gris domina sobre el negro, y que la cola larga domina sobre la cola corta. Un ratn gris y de cola corta y una ratona negra y de cola larga, tuvieron una camada de ratoncitos. Entre ellos haba uno con el mismo fenotipo que el pap y otro con el mismo fenotipo que la mam. En base a estos datos: a. Indic (con palabras) el genotipo de los cuatro ratones mencionados. Justific tu respuesta de la manera ms clara y completa posible. b. Cul es la probabilidad de que esta pareja de ratones tenga un descendiente heterocigota para ambas caractersticas? Para justificar tu respuesta realiz el cruzamiento correspondiente. 8. Los lemures de cola anillada son una especie de primates. Se sabe que el color de sus ojos est codificado en un gen con dos variantes: el color miel domina sobre el color negro. Por otro lado, los mechones que recubren sus orejas pueden ser largos (dominante) o cortos (recesivo). Una hembra, homocigota recesiva para ambas caractersticas, tiene, tras sucesivos apareamientos con un mismo macho, cuatro descendientes todos fenotpicamente diferentes entre s. a. Indicar los genotipos y fenotipos de los padres y de las cras. b. Cul es la probabilidad de que nazca otro hijo de ojos color negro y mechones largos? c. Suponiendo que los lemures tienen en sus clulas somticas 4 cromosomas, y que en G 1 contienen 40 unidades arbitrarias de ADN, completar la tabla:
etapa del ciclo celular G2 (interfase) Metafase mittica En cada polo de telofase II UNIDAD 13. EJERCITACION TIPO CHOICE No de cromosomas No de cromtides en la clula

Cantidad de ADN

1. Indique la opcin correcta referida al ciclo celular: a. En G1 se sintetizan las protenas histonas. b. Durante la etapa S no se realiza la transcripcin. c. La etapa G2 contiene el doble de ADN que G1. d. En G1 el ADN se encuentra fuertemente asociado a histonas. 2. Si durante la replicacin del ADN de una clula bacteriana se impide, mediante la utilizacin de un frmaco la polimerizacin, de fragmentos de ARN: a. seguir replicndose pero no podr realizar la trascripcin b. no podr replicar su ADN y por lo tanto no se dividir . c. no podr replicar su ADN pero igual se dividir. d. continuara replicndose pero lo har mas lentamente. 3. El proceso de replicacin del ADN:
18

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

a. es bidireccional en todas las clulas pero solo posee mltiples sitios de origen en eucariontes. b. es bidireccional slo en eucariontes pero posee mltiples sitios de origen solo en procariontes. c. tanto en procariontes como en eucariontes es bidireccional y posee un solo sitio de origen. d. es bidireccional slo en eucariontes y posee un solo sitio de origen en todos los tipos celulares. 5. Los fragmentos de Okasaki son secuencias de: a. ribonucletidos que permiten a la ADN pol comenzar a polimerizar el ADN. b. desoxirribonucletidos que se sintetizan en forma discontinua. c. ribonucletidos sintetizadas por la primasa. d. desoxirribonucletidos que se sintetizan en sentido 3 a 5. 6. Todo el ADN de una clula diploide esta marcado con Timina radiactiva, si se producen dos clulas hijas por mitosis, la marca aparecera: a. en todos los cromosomas de las dos clulas hijas. b. en todos los cromosomas de una de las dos clulas hijas. c. en ninguno de los cromosomas de las clulas hijas. d. en algunos cromosomas de las dos clulas hijas. 7. Ciertos frmacos que se utilizan en tratamientos contra el cncer, actan inhibiendo la polimerizacin de microtbulos durante la divisin mittica. Por lo tanto estos frmacos inhiben la: a. formacin del huso acromtico b. desorganizacin de la membrana nuclear c. condensacin de los cromosomas d. reorganizacin de la membrana nuclear 8. La primera divisin meitica es: a. ecuacional porque hay separacin de cromosomas homlogos. b. reduccional porque hay separacin de cromosomas homlogos. c. ecuacional porque hay separacin de cromtides recombinantes. d. reduccional porque hay separacin de cromtides recombinantes. 9. La meiosis se diferencia de la mitosis en que: a. en la metafase los cromosomas se ubican en la placa ecuatorial b. se forma huso acromtico c. hay apareamiento de cromosomas homlogos d. se produce separacin al azar de cromtides hermanas 10. Cual de las siguientes caractersticas corresponde al proceso de ovognesis en humanos: a. se inicia siempre en la pubertad. b. produce un total de 4 gametas por cada ovocito I. c. se inicia en la vida intrauterina. d. produce siempre un vulo por cada ovocito I. 11. Una ameba o un paramecio se reproducen asexualmente por: a. fisin binaria o divisin simple. b. mitosis. c. meiosis. d. mitosis o meiosis. 12. Los ovocitos de una nia que aun no alcanz la pubertad contienen: a. 46 cromosomas simples. c. 23 cromosomas duplicados
19

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

b. 46 cromosomas duplicados.

d. 23 cromosomas simples

13. El caballo tiene un complemento diploide de 60 cromosomas y el asno de 66. Cuantos cromosomas esperara encontrar en una mula, producto del cruzamiento de los dos anteriores: a. 63. b. 66. c. 60. d. 30 14. Si tuviera que comparar clulas del mismo individuo con respecto a su cantidad de ADN, la de mayor cantidad correspondera a: a. un hepatocito detenido en G0. c. un espermatozoide. b. un espermatocito I. d. un espermatocito II. 15. Considerando que la cantidad de ADN medida antes del perodo S es igual a 2C, seale cual de las siguientes opciones es correcta: a. en una clula somtica en metafase la cantidad de ADN seria 2C. b. en una espermtide la cantidad de ADN seria C. c. en una gameta la cantidad de ADN seria igual a 2C. d. en cada clula hija luego de la divisin mittica la cantidad de ADN seria igual a 4C. 16. Seale cual de las siguientes opciones es correcta: a. En una clula que esta realizando mitosis no se observan cromosomas homlogos. b. Las clulas sexuales no se dividen por mitosis. c. Las clulas haploides se dividen por meiosis. d. En una clula al comienzo de la meiosis II no se observan cromosomas homlogos. 17. Con respecto a la Gametognesis en la especie humana: a. la ovognesis se inicia en la pubertad. b. la espermatognesis se inicia en la pubertad. c. a partir de un nico ovocito I se producen cuatro gametas femeninas. d. por cada espermatocito II se producen cuatro gametas masculinas. 18 Si en una fotografa de una clula humana en divisin se ven 23 cromosomas con dos cromtidas c/u y en el plano ecuatorial, la clula se encuentra en: a. metafase mittica. c. metafase de meiosis II. b. metafase de meiosis I. d. profase de meiosis I. 19. Una mujer de fenotipo B (cuyos padres eran ambos de grupo AB), casada con un hombre de grupo 0, tiene 3 hijas todas fenotpicamente iguales a ella. Conteste: a. el genotipo de las hijas ser igual al de la madre. b. la madre es homocigota dominante para grupo sanguneo c. la madre es heterocigota para grupo sanguneo. d. las hijas son homocigotas para grupo sanguneo. 20. Al cruzar dos moscas verdes se obtuvieron slo 29 moscas negras de un total de 119 descendientes. Diga cual es el genotipo probable de la descendencia: a. heterocigotas. b. homocigotas recesivos. c. homocigotas dominantes y heterocigotas. d. homocigotas recesivo, homocigota dominante y heterocigota. 21. Cul de las siguientes opciones hace referencia a la diferenciacin celular: a. en todas las clulas de nuestro cuerpo se encuentra la informacin para la hemoglobina pero solo se expresa en los glbulos rojos.
20

Gua de Actividades y Ejercitacin Tipo Choice. Segundo Parcial. Ctedra Jerusalinsky

2013

b. las clulas del epitelio intestinal y las neuronas de un mismo individuo, tienen el mismo cdigo gentico. c. en los organismos eucariontes hay mucha informacin accesoria que no codifica para nada. d. en todas las clulas de un organismo pluricelular existe diferente informacin gentica. 22. Una clula del pulmn se diferencia de una clula de la piel de la misma persona en: a. la informacin contenida en sus cromosomas b. la expresin diferencial de sus genes c. el cariotipo asociado a cada una de ellas d. el nmero y tipo de genes que contienen 23. Un padre y su hijo varn, ambos daltnicos (enfermedad ligada al sexo), tendrn referido al daltonismo: a. cariotipos diferentes y el mismo genotipo. b. Igual fenotipo, genotipo y cariotipo. c. cariotipos iguales y diferente genotipo. d. cariotipos iguales y diferente fenotipo. 24. El dedo ndice corto se manifiesta como un carcter recesivo ligado al sexo. Una mujer con el dedo ndice corto y un hombre con dedo ndice normal tienen una hija con dedo ndice normal. Cul es la probabilidad de que el segundo hijo de la pareja tenga el dedo ndice normal, si resulta varn: a. . b. . c. 1. d. 0 25. Un mujer de grupo 0 y factor Rh- tiene un hijo A Rh+. Diga cual de los siguientes fenotipos podra corresponder al padre del beb: a. 0 Rh+. b. AB Rh-. c. AB Rh+. d. 0 Rh26. En el laboratorio se obtuvieron dos lneas puras de rata domstica, la primera tena pelaje marrn y bigote ralo, mientras que la otra era de pelaje blanco y bigote espeso. Al cruzarlas entre s, todos sus descendientes eran de marrones y de bigote ralo. Si se realizara el cruzamiento prueba de una rata de la F1, cul seria la probabilidad de tener un descendiente marrn y de bigote espeso?: a. 0. b. . c. 2/4. d. 1/4 27. En una especie de grillos los individuos pueden presentar patas largas (A) o cortas (a), y el color puede ser verde (B) o marrn (b). Una hembra de patas largas y color verde tuvo, con un macho de patas cortas y cuerpo marrn, una abundante descendencia. Entre tantos grillitos haba una hembra de patas cortas y color verde, y un macho de patas largas y marrn. Complete los siguientes datos. a. El genotipo materno es homocigota dominante para las dos caractersticas. b. El genotipo paterno es heterocigota. c. Todas las gametas de la madre son portadoras de un alelo recesivo para alguna de las dos caracterstica. d. Tienen de probabilidad de tener un hijo fenotpicamente igual a cada uno de los padres.

21