Está en la página 1de 20

El arte y la matemtica han estado relacionados desde los inicios de la civilizacin. Ellos aparecen en todas las culturas.

Es una relacin profunda en donde se mezclan el sentido de la esttica, la bsqueda de un ideal de perfeccin, la exploracin del espacio tiempo y el reconocimiento de formas y patrones de repeticin. Con respecto al arte, hubo diferentes estilos y normas sobre las proporciones de las figuras talladas que siguen vigentes hasta la actualidad. Las proporciones de las cuales se cita, estn basadas en medidas matemticas y geomtricas tomando como modelo el cuerpo humano, y con esto conseguir un procedimiento que ayude a crear. La relacin entre Arte y Matemticas ha sido esencial para el desarrollo de ambas disciplinas. Los hombres del Renacimiento siguen inspirando a matemticos que estudian sus obras y las leyes que encierran. Tambin influyen en consideraciones religiosas, estticas, antropolgicas y de "modas". En la pintura medieval, las figuras eran simblicas ms que realistas y las formas planas y sin naturalidad. Por el contrario, la descripcin del mundo real se convierte en el renacimiento en el objetivo de la pintura. Es por esto que los artistas deben estudiar la naturaleza para poder representarla en sus lienzos. Debido a esto se enfrentan con el problema matemticos de representar el mundo real tridimensional en un lienzo bidimensional. Como el pintor no mira a travs del lienzo, para determinar una seccin especifica debe disponer de reglas basadas en teoremas matemticos que establezcan la forma de dibujarla. Los matemticos se han utilizado para disear las catedrales gticas, los mosaicos,

las alfombras orientales, etc. Las formas geomtricas son fundamentales para los cubistas y para los expresionistas abstractos. Otra de las relaciones entre el arte y las matemticas, se establece en estudios antropolgicos sobre cmo dibujar al hombre en un lienzo. Por ello, se dieron diferentes estudios sobre el cuerpo humano en los que se diferencia el hombre de la mujer. En la mujer la cabeza es ms larga en relacin al cuerpo que en el hombre adems sus formas estn vinculadas a cilindros y globos por el contrario en el hombre con lneas y cubos. Los primeros criterios sobre proporcin se originan en el antiguo Egipto. La escultura estaba directamente relacionada con las arquitectura, con esto las estatuas se tallan desde un cubo por pertenecer a sillares. Las proporciones eran medidas por un sistema cuadriculado en que la altura del hombre era de 18 a 24 cuadradillos segn las pocas y 14 si estaba sentado. Con este mtodo se determinaba la posicin exacta de cada parte del cuerpo. Los griegos estudiaron extensivamente el cuerpo humano, durante la poca helnica se crearon multitud de estatuas representando la figura humana. Policleto destac por sus estudios, indicando que la belleza esta directamente relacionada con las proporciones numricas del cuerpo humano. En su tratado "canon" determina relaciones matemticas entre las diferentes partes del cuerpo. Vitruvio arquitecto-ingeniero autor del tratado de arquitectura "De Architectura" donde investig la relacin entre las artes y la matemticas. Dentro del cuerpo humano estableci al ombligo ser el centro del cuerpo. Sabiendo que el hombre con los brazos extendidos tiene una anchura igual a su altura por lo que queda inscrito en un crculo y un cuadrado siendo el ombligo el centro del crculo. Se puede obtener el numero ureo de la relacin que hay entre la distancia del ombligo a la punta de la mano y la altura del hombre.

Los bordes que supuestamente definen cada ciencia son cada vez ms borrosos y el hombre requiere de poder usar todas las herramientas a su alcance, donde las etiquetas poseen cada vez menos sentido. En lugar de decir: ste es un problema para un fsico o para un ingeniero o un arquitecto o un bilogo o un matemtico, uno debera decir: tengo este problema. Cmo lo resolvemos? Pensemos juntos. Como consecuencia, el avance llega solo. O ms fcil. El texto que sigue muestra cmo los vasos comunicantes que generaron bilogos y matemticos que trabajan en la frontera del conocimiento, permitieron poner en evidencia (una vez ms) la existencia de ancestros comunes. Desde el momento en que, en el 2003, se complet el Proyecto Genoma Humano (HGP, de acuerdo con su sigla en ingls, Human Genome Project), comenz tambin la carrera por conocer e identificar a nuestros antepasados, y saber con quienes compartimos ese privilegio. El proyecto, que dur ms de trece aos, permiti identificar los (aproximadamente) entre 20.000 y 25.000 genes del genoma humano, y determinar las secuencias de los 3.000 millones de pares de bases qumicas que lo componen. Es decir, es como si uno tuviera un alfabeto que consista en nada ms que cuatro letras: A, T, C y G (las iniciales de A= Adenina, T= Timina, C= Citosina, G= Guanina). El ADN de una persona es algo as como su cdula de identidad. Ah esta escrita toda la informacin necesaria para el funcionamiento de sus clulas y sus rganos. En esencia, en una molcula de ADN est inscripto todo lo que podemos ser, nuestras particulares aptitudes y capacidades, y algunas de las enfermedades que podemos padecer. No obstante, es la combinacin de esa informacin con el aporte del ambiente lo que hace que cada uno de nosotros sea nico.

Esa doble hlice es una especie de serpentina que tiene escritas dos tiras enfrentadas de largas cadenas de esas cuatro letras. Pero, adems, posee una particularidad: si en una de las tiras, en un lugar hay una letra A, entonces en el lugar correspondiente de la otra tiene que haber una letra T, y si hay una C, entonces en la otra tiene que haber una G. Ahora bien, a qu viene todo esto que parece ms asociado a un artculo sobre biologa molecular que a algo que tenga que ver con la matemtica? En el libro Algebraic Statistics for Computacional Biology (Cambridge University Press, 2005), los autores estudiaron una situacin muy particular. Miren esta porcin de ADN:

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG

Son 42 letras, en el orden en que estn escritas. Para decirlo de otra manera, sera como una palabra de 42 letras. Esta tira del genoma fue encontrada en algn lugar del ADN de los siguientes vertebrados: hombre, chimpanc, ratn, rata, perro, pollo, rana, peces Si uno tirara un dado, que en lugar de tener las seis caras convencionales, tuviera slo cuatro lados, rotulados A, C, G, T, la probabilidad estimada de que esta secuencia de 42 letras apareciera en ese orden es de 1 dividido por 10 elevado a la 50. Es decir, la probabilidad de que esto haya ocurrido por azar es aproximadamente: 10 elevado a la -50= 0, 000000001. Para decirlo de otro modo, el nmero empezara con un cero, luego de la coma, habra cincuenta ceros, y slo entonces un nmero uno. Justamente, la probabilidad de que esto ocurra es tan baja que permite a los autores del libro conjeturar que todos ellos tuvieron un antepasado o un ancestro comn (probablemente hace unos quinientos millones de aos), que ya posea esa secuencia de 42 bases, que fue heredada intacta a todos los descendientes de las distintas ramas de vertebrados. Por lo tanto, si bien uno no puede hablar de certeza, la probabilidad de que el hombre tenga el mismo origen que un pollo o un perro, o un ratn (ni hablar de un chimpanc) es altsima.

Para comenzar, es preciso aclarar que en todos los deportes se utilizan la matemtica y sus nmeros. Desde el ftbol y otros juegos de pelota hasta deportes como natacin, etc. Se utiliza esta ciencia. En este trabajo nos referiremos a la matemtica aplicada a los principales deportes de la actualidad: El ftbol, el deporte ms practicado en el mundo. El tenis, uno de los deportes individuales ms entretenidos del mundo. El bsquet, un deporte en equipo, muy estratgico. Rugby, un deporte basado en el compaerismo entre los jugadores y de los ms tcticos del mundo. Como dijimos antes, no nos parece necesario mencionar otros deportes que no son tan practicados, sobre todo en la Argentina, como el Football (Ftbol Americano) o el Baseball, jugados en pases como Estados Unidos.

El ftbol, el deporte ms practicado en el mundo


En este deporte la matemtica es muy utilizada. Desde el nmero de jugadores por equipo hasta las reglas del descenso del ftbol de nuestro pas. A continuacin comenzaremos a describir los aspectos donde la matemtica es usada. Es necesario comenzar con lo bsico, el ftbol es un juego de equipos con 11 jugadores por bando (en cancha) y 7 suplentes. Los partidos de ftbol tienen una duracin de 90 minutos, con 2 tiempos de 45 minutos. De la matemtica dependen numerosos aspectos de este deporte. El resultado del juego es una expresin matemtica; matemtica es la determinacin de las posiciones temporales y finales de un campeonato, en la cual la suma de puntos obtenidos es la principal operacin aritmtica. Tambin es importante la diferencia entre goles obtenidos y recibidos. En la Argentina, las reglas del descenso constituyen una complicada operacin matemtica: el promedio de los puntos obtenidos en los 2 ltimos campeonatos y el que se est disputando, y ese total se divide por el nmero total de partidos disputados en los 3 certmenes. A continuacin, daremos un ejemplo de las regla del descenso en el ftbol argentino Supongamos que Talleres de Crdoba obtuvo en la temporada 2007/2008, 36 puntos en 38 partidos, en la temporada 2008/2009, 45 en 38 y finalmente en la temporada 2009/2010 50 su promedio se calcular as: (36 + 45 + 50) / 114 (cantidad de partidos en los 3 ltimos campeonatos) = 1.14912 (si llevamos esto a la realidad, el equipo se encontrara en los ltimos 5 lugares de la tabla de posiciones)

El tenis, uno de los deportes individuales ms entretenidos del mundo


En el tenis tambin se utiliza la matemtica, pero no tanto como en el ftbol. En este deporte los nmeros se tienen en cuenta ms que todos en el reglamento del partido, pero tambin, por ejemplo en el ranking de jugadores, llamado Ranking ATP. Los partidos son de 3 o 5 set, y cada uno de los sets tiene 6 juegos. Para ganar cada uno de estos juegos, tambin llamados games, es necesario convertir 4 puntos. En el Ranking ATP se suman los puntos obtenidos en cada torneo profesional en el que el jugador ha participado, desde el comienzo de su carrera. A continuacin daremos un ejemplo de la matemtica en el tenis: Supongamos que: Nadal tiene 5385 puntos (Segundo en el Ranking de ATP) Djokovic tiene 4470 puntos (Tercero en el Ranking de ATP) Davydenko tiene 3250 puntos (Cuarto en el Ranking de ATP) Los tres jugadores llegaron a la semifinal del Grand Slam de Estados Unidos (720 puntos al semifinalista) pero la final se disput entre Nadal y Davydenko (1200 puntos al finalista y 2000 al campen), y fue ganada por Davydenko, entonces, el ranking quedara as: Nadal: 5385 + 1200 = 6585 puntos Davydenko: 3250 + 2000 = 5250 puntos Djokovic: 4470 + 720 = 5190 puntos El Ranking de ATP quedara: Nadal tiene 6585 puntos (seguira estando primero) Davydenko tiene 5250 puntos (pasara a estar segundo) Djokovic tiene 5190 puntos (pasara a estar tercero) Para retornar al segundo lugar en el ranking, Djokovic necesitara: 5250 5190 = 60 puntos Si ambos jugadores clasificaran al mismo torneo del siguiente ao y: Davydenko se quedara afuera en la segunda ronda (45 puntos) y Djokovic se quedara afuera en la cuarta ronda (180 puntos), el ranking volvera a cambiar: Djokovic: 5190 + 180 = 5370 Davydenko: 5250 + 45 = 5295

Rugby, un deporte basado en el compaerismo entre los jugadores y de los ms tcticos del mundo
El uso de las matemticas en el rugby es ms parecido al del ftbol, ya que se utilizan los nmeros para mltiples aspectos: cada partido se divide en dos periodos de 40 minutos cada uno; cada equipo cuenta con 15 jugadores en el campo de juego; una sancin o las infracciones deportivas es la amonestacin que implica el retiro del jugador sancionado por el trmino de 10 minutos y la expulsin que representa la salida definitiva del jugador por el resto del partido. Una particularidad del rugby es que otorga diferente puntuacin segn la categora de la conversin lograda. El try es premiado con 5 puntos y un adicional de dos puntos ms si se logra convertir el tiro a los palos que el try tiene como premio extra. El penal y el drop son otras conversiones que otorgan 3 puntos. Como observamos la matemtica est presente de manera permanente en los deportes. En el rugby, tambin existe el scrum: Tras una falta menor (un pase adelantado o una cada involuntaria de la pelota hacia adelante, por ejemplo), o para reiniciar el juego luego de una formacin donde la pelota no sali para ninguno de los dos equipos, se realiza un scrum. El "scrum", una de las formaciones ms reconocibles del rugby, es una puja frente a frente, de un grupo de ocho jugadores de cada equipo, llamado a.C., que se presentan agachados y agarrados, para la recuperacin del baln. El grupo que haya obtenido el mismo, debe sacarlo sin tocarlo con la mano por detrs de la formacin, donde lo tomar un jugador (usualmente, pero no siempre, el "medio scrum") y continuar el juego 1 . A continuacin daremos un ejemplo de la matemtica en el scrum: Supongamos que el a.C. de Los Pumas (Argentina) tiene un peso de 875 kilogramos entre los ocho jugadores, es decir, un promedio de 109 kilogramos por jugador y el a.C. de los a.C. Blacks (Nueva Zelanda), un peso de 859 kilogramos, es decir un promedio de 107 kilogramos por jugador. Traducido a nmeros: Argentina: 875 / 8 = 109 kilogramos Nueva Zelanda: 859 / 8 = 107 kilogramos Si tenemos en cuenta el peso de cada a.C., las probabilidades de que Argentina gane el scrum sern mayores, al tener el a.C., un mayor peso que el de su rival. No obstante, la realidad del juego entre estos dos equipos indica que esa supuesta superioridad no se da en la prctica debido a otros factores (fuerza, potencia fsica, tctica, capacidad individual de cada jugador, etc.).

El bsquet, un deporte en equipo, muy estratgico


Los nmeros tambin se presentan en el bsquet, o baloncesto. Est presente, como en el rugby, en las conversiones, y en otros aspectos. El bsquet tiene 3 tipos de conversiones: el triple (tres puntos), el doble (dos puntos) y los tiros libres que, valen un punto. El tiempo de duracin de los partidos es otro aspecto en donde est presente la ciencia. Se podra decir que se utilizan fracciones, ya que el tiempo de duracin es de 4 cuartos de diez minutos cada uno. A continuacin daremos un ejemplo de probabilidad de ganar en el bsquet: Supongamos que Estados Unidos (el mejor equipo del mundo) pasa a octavos de final, luego de avanzar en la fase de grupos. Para nosotros, Estados Unidos tiene un 90 por ciento de posibilidades de ganar partidos contra cualquier equipo al que le toque jugar hasta ganar el campeonato. Para ganar el mismo es necesario ganar 4 partidos, entonces: La probabilidad de ganar el primer partido (octavos de final) es: 9/10 o 0.9 La probabilidad de ganar los dos primeros partidos (cuartos de final) es: 9/10 x 9/10 = 81/100 La probabilidad de ganar los 3 partidos (semifinal) es: 9/10 x 9/10 x 9/10 = 729/1000 La posibilidad de ganar todos los partidos y salir campen es: 9/10 x 9/10 x 9/10 x 9/10 = 6571/10000 Es decir que la probabilidad que hay de que el equipo salga campen es: 0.65 o 65 por ciento de posibilidades

Aspectos Generales
Adems se aplica la matemtica en las distancias de por ejemplo: los campos de juego, de los cuales puede obtenerse su permetro y superficie; la distancia de un penal o una barrera (ftbol) la distancia de tiro de triple (bsquet), etc.

Las Matemticas se encuentran presentes en las plantas, alzados y elementos decorativos de los edificios que nos rodean. Basta con situarnos delante de uno de ellos y contemplarlo con detenimiento, para observar que numerosas figuras geomtricas, desde las ms elementales a las ms complejas, se encuentran presentes en su diseo. Y que el orden que se refleja en su imagen arquitectnica est ntimamente relacionado con la insercin en el mismo de figuras geomtricas, y con la existencia de relaciones entre los elementos de stas, de forma
.

que la composicin arquitectnica est estrechamente ligada a las matemticas, y ms especialmente a la geometra. Por ello, comentbamos que las proporciones que tienen los elementos arquitectnicos, las relaciones de unas figuras con otras dentro del edificio y las disposiciones que rigen los cnones de la belleza de sus formas, son leyes puramente matemticas. Saber ver la arquitectura es, en cierto modo, descubrir en ella la perfeccin que le confiere su diseo geomtrico y su ordenamiento matemtico

Matemtica en la Arquitectura

No extraa a nadie el hecho de que las matemticas tengan una aplicacin directa en arquitectura. Todos nos podemos imaginar que, antes de poner manos a la obra, el arquitecto tiene que comprobar que la estructura que quiere construir es realizable teniendo en cuenta la resistencia de los materiales que emplear, las cargas que tienen que soportar y quizs tambin el coste econmico. Sin embargo parece que esta aplicacin se reduce slo a esto, al clculo de estabilidades, de tensiones, etc., pero de ninguna forma al diseo del objeto arquitectnico mismo. Pensamos, y es bien cierto, que con respecto a la creacin artstica, el arquitecto aparta de su mesa de trabajo las matemticas y deja volar la imaginacin en la bsqueda de la forma deseada. Pues bien, esto no es exactamente as. Lo que quizs resulta desconocido es que las matemticas tambin pueden ayudar, y de hecho lo hacen, si no en el mismo momento mgico de creacin artstica, s en el inmediatamente posterior. Toda creacin arquitectnica es geometra es una mxima que se

puede encontrar en los tratados de geometra descriptiva. Desde siempre, los arquitectos han aprovechado superficies de las que pueden calificarse de clsicas y las combinaban acertadamente. Y en nuestros das, tambin lo continan haciendo. Una nueva teora, la de las superficies de Bzier y sus generalizaciones, engendrada a principios de la dcada de los 60 en varias empresas automovilsticas y de construccin aeronutica, permite ayudar al arquitecto a disear superficies de manera arbitraria con sencillez y elegancia. En el Renacimiento la arquitectura usaba la simetra como principio de gua. Ms adelante Alto renacimiento o Barroco utilizaba formas curvadas y dramticamente torcidas como contextos variados tales como cuartos, columnas, escaleras y cuadrados. Al igual que evidente, la arquitectura ha intentado siempre alcanzar los extremos que no slo se relacionan con la funcin, pero tambin con la esttica, la filosofa y el significado. Y en muchos casos, los medios han sido la belleza y la estructura de las matemticas.

Geometra en Arquitectura

El crculo y el cuadrado pueden emanar de la geometra social o de la fabricacin, pero tambin son figuras abstractas, puras. Como tales, en ocasiones se les atribuye poderes estticos o simblicos. Algunos arquitectos las emplean para infundir a su obra una disciplina que es independiente de las diversas geometras de la realidad. Pero la geometra no solo comprende el cuadrado y crculo sino tambin sus derivados tridimensionales, el cubo y la esfera. Las creaciones naturales como las proporciones del cuerpo humano, las relaciones entre los planetas o los intervalos de la armona musical, obedecan a relaciones geomtricas, y que si se quera que las obras de arquitectura tuviese la misma coherencia conceptual, deban a su vez ser proyectados usando figuras perfectas y proporciones matemticas armnicas. Por otro lado a travs de la arquitectura poda conseguirse ese grado de perfeccin que las creaciones naturales tan solo insinuaban Se consideraba que el uso de la geometra era un medio que tenan los seres humanos para mejorar el imperfecto mundo en el que se encontraba.

Por lo tanto, la pureza geomtrica era la piedra de toque de la capacidad humana o la obligacin de hacer un mundo mejor. A consecuencia de todo ello, los arquitectos renacentistas hicieron un uso profuso de las figuras perfectas y de las proporciones geomtricas en sus edificios. Muchos arquitectos han ideado edificios cuyas plantas se inscriban en cuadrados perfectos. Este tipo de distribucin en planta difiere conceptualmente de la composicin de una fachada como matriz bidimensional de cuadrados, en que aqu interviene la tercera dimensin y, tal vez, la cuarta: la del tiempo. El arquitecto siempre busca ideas que le ayudan a dar una forma a su obra y una orientacin a su proyecto. Y de todas esas ideas, la geometra figura entre la ms conveniente.

La Torre Eiffel matemticamente


La Torre Eiffel, construida para conmemorar el centenario de la Revolucin Francesa, y una obra arquitectnica portentosa, sigue siendo objeto de estudios y anlisis. El profesor Patrick Weidman empez a indagar el problema cuando recibi una segunda copia de la edicin del libro "Matemticas avanzadas de Ingeniera", en 2001. La cubierta del libro tiene fotos de etapas diversas de construccin de la Torre Eiffel, y el prlogo del libro contiene una ecuacin integral no lineal -una frmula con diversas soluciones posibles- para la forma de la torre. La ecuacin fue creada por Christophe Chouard, un estudioso francs de la Torre Eiffel, quien la anunci en su sitio Web y desafi a los ingenieros y matemticos de todo el mundo a encontrar su solucin. En base a funciones matemticas conocidas, Weidman hall una solucin una parbola orientada hacia abajo-, pero no coincidente con la legendaria estructura. Despus de contactar con el experto en anlisis matemtico Losif Pinelis, y con un bigrafo de Eiffel, Henri Loyette, quien le sugiri buscar los escritos del ingeniero francs en los archivos histricos, Weidman finalmente dedujo la base para la construccin de la torre. Un factor crucial para los clculos que Eiffel tena en mente pasaba por calibrar el efecto de las fuerzas ejercidas por el viento sobre determinados puntos estructurales de la Torre. Weidman encontr una solucin exacta de la ecuacin en forma de una funcin exponencial que se ajusta rigurosamente a la forma de la mitad superior de la torre. El trazado de la forma de la torre revela dos secciones exponenciales separadas que estn interconectadas. Ya que Eiffel no pareci fiarse mucho de las estimaciones relativas a la fuerza de torsin del viento sobre la torre, opt por "sobre disear" la seccin inferior, reforzndola por razones de seguridad. El coeficiente de seguridad estructural es por tanto responsable de la segunda ecuacin exponencial que describe la mitad inferior de la torre. Weidman y Pinelis presentaron sus descubrimientos en un artculo titulado "Ecuaciones Modelo para el Perfil de la Torre Eiffel: Perspectiva histrica y nuevos resultados". Se construye con tringulos ya que el tringulo es el nico polgono indeformable. Si construimos un paralelogramo, u otro polgono de ms lados, con tiras de cartn y alfileres, obtenemos estructuras que se deforman presionando. Realizando la operacin con el tringulo, no lo modificamos: es la rigidez del tringulo la que hace que sea utilizado en muchas construcciones.

Sistema binario
El sistema binario, en matemticas e informtica, es un sistema de numeracin en el que los nmeros se representan utilizando solamente las cifras cero y uno (0 y 1). Es el que se utiliza en las computadoras, pues trabajan internamente con dos niveles de voltaje, por lo que su sistema de numeracin natural es el sistema binario. La informtica combina los aspectos tericos y prcticos de la ingeniera, electrnica, teora de la informacin, matemticas, lgica y comportamiento humano. Podemos decir que el Sistema Binario tiene su aplicacin en los programas ms utilizados en la actualidad. Ejemplo: Word, Excel, etc.

Historia del sistema binario


El antiguo matemtico indio Pingala present la primera descripcin que se conoce de un sistema de numeracin binario en el siglo tercero antes de nuestra era. En 1605 Francis Bacon habl de un sistema por el cual las letras del alfabeto podran reducirse a secuencias de dgitos binarios, las cuales podran ser codificadas como variaciones apenas visibles en la fuente de cualquier texto arbitrario. El sistema binario moderno fue documentado en su totalidad por Leibniz, en el siglo diecisiete, en su artculo "Explication de l'Arithmtique Binaire". En l se mencionan los smbolos binarios usados por matemticos chinos. Leibniz us el 0 y el 1, al igual que el sistema de numeracin binario actual. En 1854, el matemtico britnico George Boole public un artculo que marc un antes y un despus, detallando un sistema de lgica que terminara denominndose lgebra de Boole. Dicho sistema desempeara un papel fundamental en el desarrollo del sistema binario actual, particularmente en el desarrollo de circuitos electrnico

Sistema Binario
La creacin de este sistema de numeracin se debe al famoso matemtico Fracis Bacon, quien utiliz el concepto de base dos antes del descubrimiento de la electricidad. Para expresar el nmero en notacin binaria, se considera una sucesin de ceros y unos compuesta por ceros, en las posiciones libres, y unos en aquellas en las que se coloc una ficha. Vemos, as, que el binario es un sistema de numeracin posicional en base dos, es decir, que emplea slo dos smbolos (0 y 1), los cuales representan diferentes valores segn la posicin que ocupen en el nmero.

El cdigo ASCII
Para solucionar los problemas de la comunicacin que se dan entre el hombre y la mquina, se emplean cdigos. El que utiliza la computadora consiste en una serie de reglas que permite asociar una determinada secuencia de ceros y de unos a un cierto carcter. De esta forma, por ejemplo, se convino asociar la secuencia 01000001 con el carcter A. A cada secuencia de ocho nmeros en cdigo binario se le hace corresponder un carcter. Esta correspondencia se denomina codificacin ASCII. La existencia del cdigo ASCII permite el intercambio de informacin entre sistemas distintos y facilita la labor de intercambio entre el hombre y la mquina, por su funcin estandarizadora. Por cierto, en lugar de disear circuitos cada vez ms complejos para que la computadora pueda representar un conjunto de caracteres ms apropiados para el lenguaje humano, se mantiene el lenguaje binario de los ceros y los unos, que sta maneja con rapidez y eficacia. El cdigo ASCII permite la rpida decodificacin del contenido de la memoria de una computadora repleta de ceros y unos, de difcil comprensin para el hombre.

Las matemticas son hasta este momento el lenguaje ms apropiado para describir la naturaleza. La biologa es quizs una de las ciencias que ms tard en beneficiarse de una descripcin matemtica de sus resultados. Sin embargo, en la actualidad hay gran actividad de investigacin en el campo de la biologa matemtica construyendo modelos para explicar la interaccin entre poblaciones de diferentes especies, el crecimiento de clulas cancerosas y muchas otras cosas. Desde el comienzo la biologa se ha caracterizado por ser una disciplina contemplativa y descriptiva. Los avances mas profundos en la biologa se han logrado en los ltimos 70 aos debido al progreso de los mtodos de medida. La Biomatemtica, por otro lado, data de apenas principios del siglo XX. La meta bsica de la ciencia moderna es crear, en torno a los fenmenos reales, modelos que describan y predigan el comportamiento de dichos fenmenos. Esto es justo lo que la Biomatemtica hace .Lo hace creando modelos matemticos de cierto fenmeno biolgico para lograr predecir el comportamiento en un futuro. Una de las metas de la Biomatemtica es descubrir variables en los fenmenos, elaborando modelos, reglas operacionales que describan el fenmeno biolgico estudiado.

Biomatemtica
Biologa Matemtica o Biomatemtica es un rea interdisciplinaria de estudios que se enfoca en modelamiento de los procesos biolgicos utilizando tcnicas matemticas. Tiene grandes aplicaciones tericas y prcticas en la investigacin biolgica. Debido a la gran diversidad de conocimiento especfico involucrado, la investigacin biomatemtica es a menudo hecha en colaboracin entre matemticos, fsicos, bilogos, zologos, qumicos y fisilogos, entre otros cientficos.

Importancia:

El incremento explosivo de conjuntos de informacin debido a la revolucin genmica, las cuales son difciles de entender sin el uso de herramientas analticas. El reciente desarrollo de herramientas matemticas (como por ejemplo la teora del caos) ayuda para el entendimiento de mecanismos complejos y no lineales en biologa. Un incremento en la capacidad computacional que permite hacer clculos y simulaciones que no eran previamente posibles. Un incremento en el inters en la experimentacin in silico debido a las complicaciones involucradas en investigacin animal y humana.

reas de Investigacin:
A continuacin sigue una breve descripcin de algunas reas de investigacin de la biolgica: Dinmica de poblaciones: La dinmica de poblaciones ha tradicionalmente sido el campo dominante de la biologa matemtica. Trabajo en esta rea se remonta al siglo XIX. Las ecuaciones LotkaVolterra son un famoso ejemplo. Hacia finales del siglo XIX y en la primera dcada del siglo XX, la dinmica de la poblacin ha sido complementada por la teora evolutiva de juegos, desarrollada primero por John Maynard Smith. Bajo estas dinmicas, conceptos de la biologa evolucionaria pueden tomar forma determinista y matemtica. La dinmica de poblaciones est relacionada con otra rea activa de investigacin en biomatemtica: epidemiologa matemtica, el estudio de las enfermedades infecciosas afectando las poblaciones. Varios modelos de esparcimiento viral han sido propuestos y analizados, y stos proveen resultados importantes que pueden ser aplicados a polticas de salud. Modelado en biologa celular y molecular Esta rea ha recibido un incremento en interesados debido a la creciente importancia de la biologa molecular. Modelado de neuronas y la carcinognesis Mecnica de los tejidos biolgico Enzimologa terica y cintica enzimtica Modelado del cncer y simulacin Modelado del movimiento de poblaciones celulares interactivas Modelado matemtico la formacin de un tejido de granulacin Modelado matemtico de dinmica intracelular Modelado de sistemas fisiolgicos Modelado de enfermedades arteriales Modelado multi-escalar del corazn

Modelos Matemticos:
Un modelo de un sistema biolgico es convertido a sistemas de ecuaciones, aunque la palabra modelo es a menudo usada como el sistema de las ecuaciones correspondientes. La solucin de las ecuaciones, ya sea por medios analticos o numricos, describe cmo el sistema biolgico se comporta ya sea a en el tiempo o en equilibrio. Hay muchos diferentes tipos de ecuaciones y el tipo de comportamiento que puede ocurrir es dependiente tanto del modelo como de las ecuaciones utilizadas. El modelo a menudo hace suposiciones sobre el sistema. Las ecuaciones pueden tambin hacer suposiciones sobre la naturaleza de lo que puede ocurrir. En relacin a biomatemtica: o herramientas y modelos matemticos utilizados en

Ecuaciones diferenciales: Las ecuaciones de Lotka-Volterra, tambin conocidas como ecuacin predador-presa, son un par de ecuaciones diferenciales de primer orden no lineales que se usan para el modelado de dos poblaciones que interactan, una presa y un depredador.

Tales ecuaciones se definen como:

Donde y es el nmero de algn predador (por ejemplo, un lobo); x es el nmero de sus presas (por ejemplo, conejos); dy/dt y dx/dt representa el crecimiento de las dos poblaciones en el tiempo; t representa el tiempo; y , , y son parmetros que representan las interacciones de las dos especies. o

Proceso estocstico:

En estadstica, y en concreto teora de la probabilidad, un proceso aleatorio o proceso estocstico es un concepto matemtico que sirve para caracterizar; es una sucesin de variables aleatorias (estocsticas) que evolucionan en funcin de otra variable, generalmente, el tiempo. Cada una de las variables aleatorias del proceso tiene su propia funcin de distribucin de probabilidad y, entre ellas, pueden estar correlacionadas o no. Cada variable o conjunto de variables sometidas a influencias o impactos aleatorios constituye un proceso estocstico.

o o o o o o

La matemtica aplicada a la ciencia Genomas y ancestros comunes La matemtica en el deporte Matemtica aplicada a la arquitectura La matemtica aplicada a la informtica Matemtica aplicada a la biologa

2-3 4-5 6-7-8-9 10-11-12-13 14-15 16-17-18

Hoy en da, la Matemtica se usa en todo el mundo como una herramienta esencial en muchos campos, entre los que se encuentran las ciencias naturales, la ingeniera, la medicina y las ciencias sociales, e incluso disciplinas que, aparentemente, no estn vinculadas con ella, como la msica (por ejemplo, en cuestiones de resonancia armnica). La matemtica aplicada, rama de la matemtica destinada a la aplicacin de los conocimientos matemticos a otros mbitos, inspiran y hacen uso de los nuevos descubrimientos matemticos y, en ocasiones, conducen al desarrollo de nuevas disciplinas. Los matemticos tambin participan en la matemtica pura, sin tener en cuenta la aplicacin de esta ciencia, aunque las aplicaciones prcticas de la matemtica puras suelen ser descubiertas con el paso del tiempo.