International Student Biotechnology Congress

3rd International Student Biotechnology Congress
In the name of God
rd
International Student Biotechnology Congress
May 6-8th 2013, Allameh-Amini Hall, University of Tehran
3isbc.ir
Organizers:
University of Tehran, Student Scientific Society of Biotechnology Alzahra University, Student Scientific Society of Biotechnology
Committee Members:
Chair: Prof. Parviz Norouzi Director: Ramin Fazel Executive Chair: Fatemeh Gheidari Scientific Chair: Dr. Mahdi Rahaie Financial Manager: Pejman Shirazian Public Relations Manager: Amir Banaei Esfahani
Sponsors:
University of Tehran Alzahra University Cinnagen Company Ministry of Science, Research and Technology National Institute of Genetic Engineering and Biotechnology Aryogen Biopharma Institute for Research in Fundamental Sciences (IPM) Sinaclon Company Faculty of New Sciences and Technologies, University of Tehran Stem Cell Technology Research Center Biotechnology Development Council
Conference Welcome Note

Research and investigation is one of the most important criteria of a society's scientific development. An academic development is followed by an appropriate training, actuating academic achievements, maintaining the youth capability, sharpness and eagerness to aim a goal in research which makes modern societies have young acumen involved in research fields. Most of worthwhile discoveries and inventions are the fruit of youth age or have its roots in it. I am honored to welcome you all to the "The 3rd International Student Biotechnology Congress" which is held by Student Scientific Society of Biotechnology at University of Tehran and Alzahra University. This conference is a worthy action which can encourages students and researchers to enter researching fields. To meet all the conditions and facilities needed for this academic investigative conference, the responsible panel particularly the director Mr.Ramin Fazel, executive chair Ms.Fatemeh Gheidari, scientific chair Dr.Mahdi Rahaie and public relations manager Mr.Amir Banaei Esfahani did lots of efforts and I would like to appreciate them due to their feasible attempts. Best regards, Parviz Norouzi Chairman of the 3rd International Student Biotechnology Congress.
Director Remarks
Reaching welfare, wealth and manufacturing is the main goal of all countries in today's world. In this area, third world countries have sufficed with using natural and nether resources. These countries are endeavoring to aim the target by extracting these resources. On the other hand, circumspect countries have imitated using developed technology instead of prospecting exhaustible resources. Using these High-Tech fields such as Biotechnology, Nanotechnology and IT is the most important device to actualize the concept of Earning money from science . Unfortunately in our country, the first have been dominated up to now and have been sustained from this point of view; therefore its the duty of scientists and researchers to actuate the second view and propel people and government toward it. Considering this point the Scientific Student Society of Biotechnology at Univarsity of Tehran and Alzahra University are on the verge of holding The 3rd International Student Biotechnology Congress and are going to step forward in making a progress in national level hoping it could gain such an aim.
Best Regards, Ramin Fazel Director of the 3rd International Student Biotechnology Congress
Scientific Committee Members:

Dr. Mehdi Alavi Dr. Sedigheh Asad Dr. Kayhan Azadmanesh Dr. Valiollah Babaeipour Dr. Behnaz Bakhshandeh Dr. Mohammad Barshan Tashnizi Dr. Shahin Bonakdar Dr. Mehdi Dastgheib Dr. Elahe Elahi Dr. Jamshid Fouladi Dr. Naser Ghaemi Dr. Zahra Hajihassan Dr. Monir Hosseinzadeh Dr. Hamidreza Javadi Dr. Mahbube Kabiri Dr. Vahid Khalaj Dr. Ali Mohammad Latifi Dr. Sayed-Amir Marashi Dr. Faramarz Mehrnejad Dr. Mohammad MirDerikvand Dr. Javad Mohammadnejad Dr. Vahid Niknam Dr. Ali Hossein Rezayan Dr. Mehdi Sadeghi Dr. Gholam reza Salehi Dr. Sorush Sardari Dr. Ehsan Seyedjafari Dr. Zarvan Shahrzad Dr. Meisam Tabatabaei Dr. Ladan Teimoori-Toolabi Dr. Masoud Tohidfar Dr. Bagher Yakhchali Dr. Mahboubeh Zarabi
Executive Committee:
Hamideh Abbasi Motahareh Agha Molaei Hossein Akhoondi Khadijeh Alishah Mosab Asadi Saba Asili Saba Aslani Farnoosh Azarian Amin Azimi Parizad Babaei Soraya Bahari Behnaz Bakhshandeh Zeinab Bakhshi Niloofar Dadkhah Mohsen Dehghani Ali Delavari Samaneh Farajzadeh Sudeh Farani Sadaf Farsinejad Armin Fazel Hamideh Fouladiha Tahereh Ghasemi Zohreh Gheisary Azadeh Hadadian Pour Mahdieh Hadi Samereh Hamedani Raheleh Hamrahi Sahar Hedayati Khah Mahshid Heidary Zhaleh Hosseini Saeedeh Hosseinian Mohadeseh Jamal Khan Ali Karimi Negin Katal Narjes Kazemi Arash Keshavarzi Afrooz Khalili Alireza Majd

Yasaman Mian Mahaleh Reihaneh Mir Hasani Pouria Mirzavand Azam Moosavi Fatemeh Motamedi Negin Motamedi Mohammad Motealehi Atena Mozafari Narjes Nakhaei Maryam Navaeian Paria Pirasteh Mohebat Pour Majidian Amir Hossein Saadati Zeinab Sadri Mohammad Reza Sadrzadeh Marzieh Sahebi Mohammad Hasan Samiee Aref Mohammad Reza Sarshar Sajad Sarvari Pejman Shirazian Fatemeh Siahvashi Salma Sohrabi Sana Pour Tabatabaei Andisheh Talaei Meisam Yousefi Roya Yousefi Rafooneh Zafari Mohammad Zim
Responsibility for materials published in this collection is solely with the authors. Be in printed in this series does not indicate that the content where approved by the scientific committee of the congress.
Contents
Oral Presentation Abstracts ............................................................................................................. 12 Medical Biotechnology ................................................................................................................ 12 Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding site of E7 gene Enhances Specic Cytotoxic T-Lymphocyte Induction and Antitumor Activity........................... 12 Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus Elicited Strong Cytokine Responses in BALB/c mice ......................................................................................... 13 DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in breast cancer patients from the south of Iran ................................................................................................ 14 Expression of the TrkC gene and a novel long non-coding RNA located in the gene in different cancerous cell lines .................................................................................................................. 15 Cautiously view point on the effect of essential oils as therapeutic materials for neurodegenerative diseases .................................................................................................... 16 Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy ........................... 17 Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute lymphoblastic leukemia in Northwest of Iran.................................................................................................. 18 Inhibition of oncogenic activity of WWP1 on breast cancer cell line with synthetic microRNA .. 19 Transcription-mediated Isothermal Amplification for Rapid Identification of Lishmania major using Sequence-based Primers................................................................................................. 20 The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells through Transduction of a Lentivirus Containing IPF-1 Gene.................................................................. 22 Crocetin attenuates spatial learning dysfunction and brain damage after chronic cerebral hypoperfusion in rats ............................................................................................................... 23 Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7 Human Breast Cancer Cells......................................................................................................................................... 24 RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells ........................... 25 Codon optimization, cloning and expression of single-chain variable fragment (scFv) antibody against CD22 in PichiaPastoris and optimization of Expression conditions ................................ 26 Agricultural Biotechnology........................................................................................................... 27 dabb1 ........................................................... 27 Transgenic expression and recovery of biologically active recombinant human insulin from Arabidopsis thaliana seeds ....................................................................................................... 28

Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in Bread Wheat ........................................................................................................................... 30 Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in Bread Wheat ........................................................................................................................... 31 ...................................... 32 Subcellular targeting of transiently expressed GFP using a plant virus based expression system in planta .................................................................................................................................. 33 Genetic diversity of dwarfing Apples (Malusdomestica) of Iran AFLP markers .......................... 34 Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici blotch of wheat ....................................................................................................................... 35 SUF4 CLF ...................................................... 37 cDNA PR10 ( zea mays) ................................................................. 38 Microbial and Industrial Biotechnology ........................................................................................ 39 Nitrate reductase purification from a moderately halophilic microorganism, Salinicoccus iraniensis ................................................................................................................................. 39 Comparison and Optimization of Expression of a Chimeric-Truncated t-PA by Pichia pastoris Strains: GS115 and KM71 ......................................................................................................... 40 Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas syringae pv. syringae using Loop and Bumper Primers ............................................................. 42 .............................. 43
Design and construction of the expression cassette for producing the Epithermal growth factor with the ability of connecting to the collagen........................................................................... 44 Wastewater Algae: A Potential Candidate for Biodiesel Production .......................................... 45 Effects of agitation on enhancement of bacterial cellulose production..................................... 46 Effect of Different Carbon Sources on Activity of Biocatalyst in Biocathode Microbial Fuel Cells (BMFCs) ................................................................................................................................... 47 A novel method for optimization of biomass lipid extraction.................................................... 48 Molecular Biotechnology ............................................................................................................. 49 In-cell western analysis, a new method of evaluating cellular protein expression and cell toxicity assays ...................................................................................................................................... 49 Preparation of recombinant single domain antibody against epidermal growth factor receptor ................................................................................................................................................ 50 ADSCs/ESCs Co-culture: a novel approach to increase the proliferation of ADSCs..................... 51 A novel cold-inducible expression system for Bacillus subtilis 1A772 ........................................ 52

Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas syringae pv. syringae using Loop and Bumper Primers ............................................................. 53 Probing the binding sites of Fediamsar and bovine serum albumin ........................................ 54 The benefits of lanthanide cofactors for the characterization and application of RNA-ligating deoxyribozymes....................................................................................................................... 55 Investigating the Effects of Interactions between Histidin and Other Amino acids on Thermostability of Methylglyoxal synthase from Thermus sp.GH5 ........................................... 56 Cell-Mediated Responses Elicited by Immunization of BALB/c Mice with Recombinant Eukaryotic Vector, pVAX1 Harboring omp28 of Brucella abortus, and Recombinant Omp28 as booster .................................................................................................................................... 57 Nono-Biotechnology .................................................................................................................... 59 phage Nanobioparticle expressing Apoptin suppress only human breast carcinoma tumor growth in vivo .......................................................................................................................... 59 Synthesis of Nanobody- Dendrimer Conjugates for Targeted Breast Cancer therapy ................ 60 Dendrosome-based delivery of siRNA against GFP gene in CHO-cell ......................................... 61 PLGA Nanoparticles Containing a Combination of Recombinant 31kda Surface Protein and Detoxified Lipopolysaccharide of Brucella abortus Significantly Stimulated a Protective Response in BALB/C Mice ........................................................................................................ 62 Design a hydrogen peroxide biosensor by use of catalase and modified electrode with magnesium oxide nanoparticles............................................................................................... 64 An assessment of CH50 activity in mice (Mus msuculus ) treated with silver nanoparticles during skin wound healing .................................................................................................................. 65 Cell supports of GNP-chitosan nanocomposite/hyaluronic acid and chondroitin sulphate systems. cell adhesion and proliferation study ......................................................................... 66 Blood Lead level measurement using two biosensors pGL3-luc/pbr and pGL3-luc/cad ............. 68 Evaluation of ESAT-6 and CFP-10 proteins expression of Mycobacterium bovis at RNA level and evokes cellular immunity in mice with proliferation lymphocyte method ................................. 69 Bioinformatics ............................................................................................................................. 71 Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its Structure ................................................................................................................................. 71 From microarray data to gene expression pattern, network and protein analysis in Mus musculus under Helicobacter pylori infection .......................................................................... 72 Preparing Draft Genome-Scale Metabolic Network of Bacillus licheniformis based on the Reconstructed Metabolic Network of Bacillus subtilis .............................................................. 73 Poster Presentation Abstracts ......................................................................................................... 74

Medical Biotechnology ................................................................................................................ 74 Investigation of mouse embryonic stem cells proliferation on surface modified of aligned and random nanofibrous PCL scaffolds ........................................................................................... 74 Stem Cells and Gene Therapy for Cartilage and Bone Repair .................................................... 76 Immunogenicity Prediction of the Chimeric Protein Consists of Shiga and Cholera Toxins B Subunits Using Bioinformatics approaches ............................................................................... 77 Immune Response to Combination of Recombinant Ag85B and Ag85C of Mycobacterium tuberculosis in C57BL/6 Mice ................................................................................................... 79 Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells in presence of Dimethyl sulfoxide ............................................................................................ 80 Homozygosity mapping in an Iranian pedigree affected with muscular dystrophy limb girdle (LGMD) reveals linkage to 2p12-14 and 10q25-26 chromosomes ............................................. 81 Targeting of the signal transducer Smo links microRNA-326 to the oncogenic Hedgehog pathway in drug resistant CD34+ CML stem/progenitor cells ................................................... 82 ..................................................................................... 83 The suitable purification method for investigation on Alpha-synuclein involved in Parkinson disease .................................................................................................................................... 84 MicroRNA Profiling as a New Approachfor Early Detection of Breast Cancer ............................ 85 Investigating the different combinations of five monoclonal antibodies in ELISA development to detect 26kDa antigen of H. Pylori ............................................................................................. 86 Inhibition of survivin restores the sensitivity of breast cancer cells to docetaxel and vinblastine ................................................................................................................................................ 87 Approaches to detect matrix metalloproteinases (MMPs) as disease biomarkers..................... 88 mRNA and microRNA Transferring by Microvesicles................................................................. 89 EGFR expressing tumor model establishment to evaluate the efficacy of mimotope vaccine .... 90 Genotype Analysis of CCR5-59353-C/T Using PCR Allele Specific Amplification in Iranian normal population ............................................................................................................................... 91 Recombinant Omp19 combined with detoxified LPS Elicited Protective Immunity against Brucella melitensis infection in BALB/c Mice ............................................................................ 92 Linkage of a locus for autosomal recessive familial spastic paraplegia to chromosome 8q24 .... 93 Comparing specific genes expression in differentiated and undifferentiated cells derived BMSCs during BMP-4 and 4mT SMF treatments .................................................................................. 94 Generation of a pLEX-lamp-darpins chimeric lentiviral vector for expression of DARPins in exosomes surface for breast cancer gene therapy.................................................................... 95 In vitro anti HIV-1 testing of (2, 3-diaryl-1, 3-thiazolidin-4-one) derivatives against HIV-1......... 96 4

The response of human breast cancer cells to the non-thermal atmospheric pressure plasma . 97 .......................................................... 98 The role of p-glycoprotein in resistance of lung cancer............................................................. 99 Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP Technique .............................................................................................................................. 101 -2 ....................................... 103 Enzybiotics and their applications in medicine ....................................................................... 104 ......................................... 105 Adapting SyberGold and Loop-mediated Isothermal Amplification for Rapid Molecular Detection of Human Influenza Virus....................................................................................... 105 MicroRNA mediated knockdown of STAT3 reduces breast cancer stem cells viability ............. 106 " " 2- .............................................................................................................................................. 108 Recombinant TraQ of Brucella melitensis Elicited Potent IFN- and IL-12 Response in BALB/c Mice ...................................................................................................................................... 109 Tri-block copolymer: An efficient membrane sealant recovers sever spinal cord injury .......... 111 The cytotoxic effects of the organophosphates chlorpyrifos on human lymphoid cells in vitro113 Induction of cardiac differentiation through overexpression of microRNA-1 in human-induced pluripotent stem cells ............................................................................................................ 114 Diagnosis of Breast cancer with saliva samples: A review ....................................................... 115 RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 116 CagA EPIYA-C ................................... 117 Cyclin D1 expression in brain tissue of a murine model of alzheimers disease ....................... 118 .................................................................. 119 Cloning and Molecular Characterization of an Immunogenic LipL41 Protein of Leptospira interrogans Serovar Icterohaemorrhagia ............................................................................... 120 Detection of Borna Disease Virus p24 RNA in peripheral blood cells of obese patients in Iran 121 Designing specific ARMS tetra-primers of C/T polymorphism in promoter region of F8 gene.. 122 Effect and mechanism of Sphingosin 1-Phosphate in malignant behavior of lymphocytic leukemia and non-smallcell lung cancer cells ....................................................................... 123 Spermicidal activity of Arum maculatum L. on human sperm ................................................. 124 Investigation of genes expression in differentiated cells derived BMSCs during BMP-4 treatments with FTIR ............................................................................................................. 125 16141 rs NPY ......... 126 5

Pluripotency features in adipose tissue-derived stem cells..................................................... 127 Agricultural Biotechnology......................................................................................................... 128 Agrobacterium rhizogenes Mediated Induction of Recombinant Tobacco Hairy Roots Expressing the Chimeric stxB-ctxB Gene .................................................................................................. 128 ............................................................................... 130
( Iris spp.) ISSR........................... 131 Iris .................................................................................. 132 Plantlet regeneration from hairy root cultures of Atropa belladonna Hamadan sp ................. 133 MTLD ................................................... 134 ................................ 135 Molecular characterization and assessment inter and intra diversity of some prunus species In Iran by AFLP marker............................................................................................................... 136 ( Solanum tuberosum L.) ................................................................................................................... 137 ....................... 138 Tissue culture and somaclonal variation in M7 rootstock ..................................................... 139 Optimization of Cronobacteriocin DGH2 a bacteriocin inhibiting Xanthomonas axonopodis pv. Citri ....................................................................................................................................... 140 Characterization of cronobacteriocin DGH2 an anticitrus canker disease bacteriocin ............. 141 Contamination of cattle slaughtered in the city KazerounE.coli O157: H7 in 2012 .................. 142 Construction of a genetic linkage map with SSR, AFLP and morphological markers to locate QTLs controlling pathotype-specific powdery mildew resistance in diploid roses ............................ 143 Assessment Of Regeneration Of Stevia Rebaudiana By Seed .................................................. 144 Marker Assisted Selection for Overexpressed Bx7 Gene (Bx7OE) Effective in Bread Wheat Quality................................................................................................................................... 145 Validation and Identification GPC-B1 Gene Effective in High-Grain Protein Content in the Wheat Cultivars and Advance lines.................................................................................................... 146 Identification and Distribution of the Photoperiod Insensitive Allele in Ppd-D1 locus in Wheat .............................................................................................................................................. 147 Application of Allele-Specific Markers for Identification of Different Sources of 1AL/1RS and 1BL/1RS WheatRye Translocations in Wheat ........................................................................ 148 Allelic Variation at the Vernalization Genes Vrn-A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Iranian Wheat Cultivars and Their Association with Growth Habit ..................................................... 149 ................................................ 150 6

Analysis of molecular methods for producing glyphosate resistance .................................... 151 Evaluation of allelic variation and assessment of quality of storage proteins in Iranian durum wheats................................................................................................................................... 152 PROLIFRATION OF MOHREKHOSH (ZHUMERIA MAJDAE Resh. f. & Wendelbo) BY SEED GERMINATION AND CALLUS INDUCTION ............................................................................... 153 Proliferation of Mouhrekhosh(Zhumeria Majde Resh.f.& wendelbo) by seed germination and callus induction...................................................................................................................... 155 Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici blotch of wheat ..................................................................................................................... 156 Identification of single nucleotide polymorphism in exon 26 of apoB gene in khazak breed chickens................................................................................................................................. 157 Prevalence of foot and mouth disease virus (FMDV) in carrier cow reffered to Khorasan Razavi industrial abattoir by Realtime quantitative PCR (q-PCR)........................................................ 158 ............................... 159 (Glycyrhiza glabra) ................................................................................................................. 159 New techniques in development of transgenic animal technology ......................................... 160 Morphological investigation of hairy roots induced in Datura metel ...................................... 161 Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas fluorescens) in increase growth parameters of maize ............................................................ 162 Divesity of iranian genotypes for seed storage proteins and storage proteins and two_dimensional protein pattern in genotypes with high and low oleic acid .......................... 163 Transcripts pattern in bread wheat under drought stress ....................................................... 164 ................................ 165 .......................................................................................................... 166 Investigation of callus induction, regeneration and BYMV virus elimination by meristem tip culture in three cultivars of Gladiolus ..................................................................................... 167 Microbial and Industrial Biotechnology ...................................................................................... 168 Optimization of algal lipid extraction for biodiesel production (hexane) ................................. 168 ............................................................................ 169 Cloning, Expression, Purification and in Silico Analysis of the Brucella Urease ........................ 170 Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells in presence of Dimethyl sulfoxide .......................................................................................... 171 PCR ....................................................... 172

Optimization of amylase and protease co-produced by Bacillus licheniformis using economical medium ................................................................................................................................. 173 Molecular detection of TEM-derived ESBLs and CTX-M gene in E. coli from fecal of canaries, lovebirds and pigeons in regions of Iran ................................................................................. 174 Survey Pathogenicity of Listeria monocytogenes and Listeria Ivanovii isolated from silage in mice ...................................................................................................................................... 175 Microbial bio-degradation of polyethylene ............................................................................ 177 Stable immobilization of Aspergillus niger phytase on perlite; activity and stability ................ 178 Multi Drug Resistance of Genomic Islands in Haemophilus influenza Isolated from Clinical Isolates of Iran ....................................................................................................................... 179 Aspergillus Niger Aspergillus Niger .......................................................................................... 180 ......................................................................... 181 In vitro proteome analysis of an Iranian strain (NIGEB-088) of Xanthomonas citri subsp. Citri 182 Using microarray data to construct network and its analysis for kidney transplantation rejection .............................................................................................................................................. 184 ........................................................ 185 Isolation of a Native Bacillus cereus Amylase Producer from Hot spring of sabalan mountain 186 Comparison of expression of single chain variable fragment of anti human CD4 receptor antibody fused to green fluorescent protein in two strains of Escherichia coli using flow cytomerty .............................................................................................................................. 187 In vitro evaluation of co-aggregation effect of probiotic lactobacilli on mutans streptococci .. 188 Microbial diversity of culturable halophilic and halotolerant bacteria from Urmia Salt lake .... 190 ........................................... 191 The Assessment of Substrate Preference of Microbial Biocatalysts in Biodesulfurization........ 192 Suitable strategies for heterologous expression and purification of membrane proteins ........ 193 Effects of phosphate limitation on Saccharomyces cerevisiae gene expression pattern and its expression network analysis .................................................................................................. 194 Antibacterial activity of methanol extract of the leaves and fruit of Chenopodium foliosum (Moench) Asch against four strains of Gram-negative pathogenic bacteria ............................ 195 Molecular cloning of Fusion of GP96gene and Kinetoplastid membrane protein-11(KMP-11) of Leishmania infantum in pET28a vector as a candidate for vaccine preparation against visceral leishmaniasis ......................................................................................................................... 196 Design of a gene construct by Intein self-splicing properties in order to EGF protein expression in E.coli .................................................................................................................................. 197 8

Antibacterial activity of Echium amoenum aqueous and ethanolic extracts............................ 198 Evaluation of Molecular Farming Industry in the Production of Recombinant ........................ 199 ................... 200 : ........................................................... 201 Quantitative competitive PCR assay for detection of Lactobacillus acidophilus in probiotic yogurts .................................................................................................................................. 202 Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas fluorescens) in increase growth parameters of maize ............................................................ 203 Design and Construction of Rotary Biological Contactor (RBC) for enhancement of microbial cellulose Production .............................................................................................................. 204 Production of truncated recombinant nmp22 protein reactive towards commercial antibody and inducing immune system for polyclonal response ........................................................... 205 The effectiveness and enzyme potential of honey for inhinition of growth on Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli .............................................................. 206 Identification of GABA production by Lactobacillus casei and Lactobacillus parcasei and characterization of their glutamate decarboxylase gene ........................................................ 207 Construction of an Eukaryotic Plasmid Encoding ESAT-6 gene of Mycobacterium Bovis as a Candidate for DNA Vaccine .................................................................................................... 208 Developing of effective enzyme based biofuel cells................................................................ 209 Molecular Biotechnology ........................................................................................................... 210 ................................. 210 GFP M13 ................ 211 Analysis of intratype E6 variants of Human papillomavirus type 31, 52 and 58 in Indian HIVpositive women with different cervical disease status: a pilot study ....................................... 212 Using a combination of mutations in photoprotein aequorin to application study .................. 213 Modification of Collagen- Chitosan Scaffold by PVA for Skin Tissue Engineering Application .. 214 Cloning and overexpression of miR-939 in HUH7 cell line ....................................................... 215 Efficient expression of laccase gene from Bacillus pumilus ..................................................... 216 The study of interaction between -Lactoglobulin with retinol at monomer and dimmer conditions by circular dichroism ............................................................................................. 217 ...................... 218 ............................................................................. 219 Translational targeting of breast cancer cells using construct containing 5UTR of bFGF ......... 221 BRCA1 ................ 222 9

Molecular aspects on the interaction of isatin-3-isonicotinylhydrazone to deoxyribonucleic acid .............................................................................................................................................. 223 .............................................................................................................................................. 224 Isolation, Cloning and Expression Verification of the Mycobacterium Bovis CFP-10 Gene in BALB/c mice........................................................................................................................... 225 Protein engineering of bacterial -xylosidase by Site-directed mutagenesis and expression in Pichia pastoris........................................................................................................................ 226 Optimization of Genomic DNA Extraction of Mistletoe (Viscum album) .................................. 227 Pluripotency features in adipose tissue-derived stem cells..................................................... 228 ND3 mitochondrial genes, a good candidate for DNA Barcoding ............................................ 229 Nono-Biotechnology .................................................................................................................. 230 Experimental Study of Nanoarchaeosomal Carrier for Paclitaxel on MCF-7 Cell Line............... 230 Application of siRNA nanoparticles in stem cells differentiation ............................................. 231 The investigation of Electron transfer mechanism of glucose oxidase at graphene and graphene oxide electrode ...................................................................................................................... 232 The use of chitosan nanoparticles as new anticancer drug carrier system .............................. 233 Viral-mediated gene delivery against cancer metastasis......................................................... 234 Metal nanoparticle production assisted by -amylase............................................................ 235 Co-delivery of shRNA and DNA by a neutral phospholipid-based bilayer nanosystem ............. 236 Transcriptional targeting of breast cancer stem cells using anti-HER2 nanobody targeted dendrimeric nanoparticles ..................................................................................................... 237 Spectroscopic studies of the interaction of a novel silver nanoparticles with bovine serum albumin ................................................................................................................................. 239 Antibacterial properties of magnetic hydrogel nanocomposite based on saleppoly (acrylic acid) .............................................................................................................................................. 240 Controlled release of defrasirox through magnetic hydrogel nanocomposite based on saleppoly (acrylic acid) ................................................................................................................... 241 RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 242 Investigation of the effects of nanoparticles ZnO on the histopathological of lung rat ............ 243 ) ( Monobromobimane ....................................................................................... 244 Fluorescence spectroscopic evaluation of Cu-diamsar-bovine serum albumin interactions .... 245
10

Study of the Forster resonance energy transfer between [Co (diNOsar)] Cl3 and bovine serum albumin ................................................................................................................................. 246 Bioinformatics ........................................................................................................................... 247 ( SNPs) ( GWAS) .............................................................................................................................................. 247 ...... 248 Evaluating relationship in cytokines level, Fibromyalgia Impact Questionnaire and Body Mass Index in women with Fibromyalgia Syndrome ........................................................................ 249 Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its Structure ............................................................................................................................... 250 Prediction and modeling of Phytasethermostable structure based on bioinformatics tool ..... 251 Determination of Listeriolysin O protein structure using Homology Modeling ........................ 252 Using percolation theory for studying Studying the relationship between robustness against mutations in metabolic networks and lifestyle of organisms .................................................. 253 Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP Technique .............................................................................................................................. 254 cDNA ....... 255 Prediction of subnuclear location of proteins using Artificial Immune System ........................ 256 Analysis Some of the Features Bioinformatics CSN3 Gene in Dairy Cattle ............................... 257 The Study of Human Glucose-6 Phosphatase Protein Structure using Homology Modeling .... 258 In silico Search and Synthesis Design of 3- (phenyl) acrylonitrile Derivatives and Evaluation Antiinflammatory Properties with Marvin Sketch Software .......................................................... 260 Bioinformatics Study Of microRNAs To Identify Genes and Cellular Pathways Associated With Medulloblastoma................................................................................................................... 261 The Identifying Of Diagnostic Markers In Prostate Cancer By The Use Of EST-SSRs ................. 262 General Biotechnology .............................................................................................................. 263 ................................................................... 263 .................................................................................................... 264 ........................................................................................... 265 .................................................................................. 266
11
Oral Presentation Abstracts

Medical Biotechnology
Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding site of E7 gene Enhances Specic Cytotoxic T -Lymphocyte Induction and Antitumor Activity
Armina Alaghebandbahrami Amir Ghaemi* *: ghaem_amir@yahoo.com Introduction:Increasing evidences has suggest that infection with high-risk human papillomavirus (HPVs) is closely associated with cervical cancer. The HPV16-E7 oncoprotein has been shown to be continuously expressed in cervical carcinoma cells, therefore it is an attractive tumor-specic antigen target for immunotherapy of patients with cervix dysplasia and cancer.For safety reasons, we design and construct a modified the E7 gene with reduced oncogenecity (HPV-16 MUT E7). golestan university of medical science golestan university of medical science
Material and Methods:The construct was synthesized and cloned in pEX cloning vector and its accuracy was confirmed by sequencing. Then the construct was transformed to competent E.coli Top10F and prepared in mini scale. After Subcloning in to pCDNA3 eukaryotic expression vector, CHO cell line were transfected with vectors expressing MUTE7 and wild E7 and characterized by SDS page and Western Blotting. Confirmed constructs were administrated in C57BL/6 tumor mice model as therapeutic vaccines and different aspects of cellular immune response were evaluated. For this purpose, MTT cell proliferation assay, LDH assay and cytokine assay were performed.
Results:The results showed that the genes of E7 wild and E7 MUT were successfully cloned and expressed compared to negative control vector. Immunization of mice with vaccine expressing the MUT E7 gene produced signi cantly stronger E7specic cytotoxic T-lymphocyte response and better tumor suppression in mice than did a wild-type E7 DNA vaccine expressing a stable E7 protein. Conclusion: Our results suggests that MUT E7 may be useful for DNA immunization and development of anti-cancer vaccines against HPV-16 mediated cancers. Keywords: cervical cancer, human Papilloma virus,oncogenicity,DNA vaccines,mutation
12

Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus Elicited Strong Cytokine Responses in BALB/c mice
Sara Aryanfar * Nima Khoramabadi Haniyeh Aghababa Majid Sohrabi Nazanin Nazanin *: sara.aryanfar@gmail.com Introduction : Brucellosis is an important zoonotic disease which is globally prevalent. Prevention of the disease in animals is based on attenuated vaccine strains which are highly pathogenic for human hosts. Immunologic evaluation of Brucella antigens has a substantial role in vaccine investigations. We report the production of recombinant 36kDa outer membrane protein Brucella abortus (Omp2b) in E. coli host and evaluation of IFN-, IL-12 and IL-4 responses in mice which were immunized with this protein. Materials and methods omp2b gene was cloned in pET28a(+) and expression of protein performed in E coli BL21(DE3). Recombinant Omp2b (rOmp2bpET28) was purified using nickel affinity chromatography. 6-8 weeks old BALB/c mice were immunized with 20g rOmp2bpET28 formulated in Freunds adjuvant, subcutaneously. Mice received a primary dose followed by two boosters with 12 days of interval. A week after last booster, mice were sacrificed and their spleen lymphocytes were cultures; all cultures were subsequently stimulated with rOmp2bpET28. Production of IL-4, IL12 and IFN- was evaluated in lymphocyte cultures by ELISA Results : Level of IL-4, IL-12 and IFN- were significantly higher in mice immunized with rOmp2bpET28. Production of IFN- was higher than that of IL-4 and IFN-/IL-4 ratio suggested that a cell-mediated response had been developed in mice receiving rOmp2bpET28. Conclusion : rOmp2bpET28 strongly stimulated the development of immune responses in BALB/c mice. The cellular-type response also makes it an appropriate antigen for further investigations of brucella vaccines. Keywords : Brucellosis, Brucella abortus, Omp2b Islamic Azad University-Karaj branch Islamic Azad University-Karaj branch Tarbiat Modares University Tarbiat Modares University Islamic Azad University-Karaj branch
13

DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in breast cancer patients from the south of Iran
Safoora Deihimi Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences Nasrollah Erfani Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences Abdol Rasoul Talei Department of Surgery, Shiraz University of Medical Sciences * Abbas Ghaderi Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences *: ghaderia@sums.ac.ir Introduction : Germline mutations in Breast Cancer gene (BRCA2) confer an estimated cumulative lifetime risk of breast cancer of 5684%. Furthermore, the cancer-founder effects of BRCA mutations have been suggested to be race and ethnic population-specific. Previous investigations of our group indicated no association of known founder mutations in BRCA genes (185delAG, 5382insC, 6174delT) with familial breast cancer in Iranian populations. As a part of a larger project searching for BRCA founder mutations in Iranians, we aimed in the present study to investigate germ-line mutations in exon 11E of BRCA2 gene in females with familial breast cancer in south of Iran. Materials and methods : DNA was extracted from peripheral blood samples of 70 affected women with familial breast cancer, and 70 age-sex matched healthy subjects. Denaturing high performance liquid chromatography (DHPLC) method, using Transgenomic WAVE 4500 system, was applied for genetic pre-screening of BRCA1 gene in order to reduce the cost and time for the analysis of this gene. Chromatograms analysis was performed with Navigator Software 2.2.0. Mutation positive amplicons had to be subsequently sequenced by direct DNA sequencing using BigDye Terminator chemistry and ABI 310 sequencer. Results : A Novel point mutation was detected in exon 11E of BRCA2 gene of patients. The frequency of G/T missence mutation (c.[5961G>T]) causing Glutamine 1987 with Histidine substitution was 12.9% of 70 breast cancer patients. The mutation was not detected in none of controls and all the patient carriers were heterozygote for the mutation. Conclusion : This study indicated identification of a novel mutation in exon 11E of BRCA2 gene, suggesting appropriate target for further investigations as a founder mutation in Iranian population. In this regard, utilizing a fast and reliable mutation pre-screening method like DHPLC can help to accelerate mutations scanning in BRCA genes of carrier females. Keywords : Breast Cancer, DHPLC, BRCA2 gene
14

Expression of the TrkC gene and a novel long non-coding RNA located in the gene in different cancerous cell lines
Sadat Dokanehiifard Tarbiat modares university Bahram* Mohammad Soltani Tarbiat modares university Fahime Hosseini Tarbiat modares university Hadi Najafi Tarbiat modares university Seyad Ali Mousavizadeh Tarbiat modares university *: soltanib@modares.ac.ir
Introduction : TrkC gene plays a critical role in proliferation, differentiation and survival of the developing neurons. There is no data about the mechanisms of different roles of TrkC gene. There are reports on Trk family expression in neoplasms as well, namely, the primitive neuroectodermal tumors of childhood, and in adult astrocyticgliomas. TrkC expression is also reported in breast cancer samples. Materials and methods : In our previous study, a novel long non-coding RNA (N-lncRNA) located in TrkC gene was identified. Here we examined 15 tumorcell lines (identified as glioma, lung, hepatoma, cervix, breast and etc), for the expression of TrkC gene as well as N-lncRNA located in it. Results : Result of our study revealed that TrkC gene and the N-lncRNA are differentially expressed in these cell lines. Keywords : TrkC, non-coding RNA, cancer
15

Cautiously view point on the effect of essential oils as therapeutic materials for neurodegenerative diseases
Masoome Khalife Farhang Dina Aliakbari Morshedi* National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology
*: morshedi@nigeb.ac.ir
Introduction: Neuronal death, mainly apoptosis, is the cause of the indication of many human neurodegenerative diseases, such as Parkinsons and Alzheimers. Recognition of the mechanisms which prevent or promote apoptosis in nerve cells come new manner for treating neurodegenerative disorders. A major component of protein plaques in synucleinopathies, especially Parkinsons disease is alpha-synuclein which its aggregation in dopaminergic cells promotes apoptosis. Nowadays, preventing protein fibrillation might be one of the main options to treat neurodegenerative diseases. Materials and Methods: In the present study the effect of several essential oils including Myrtus communis, Spearmint, Citrus sinensis, Citrus limon, Tarragon, Mentha pulegium, Thymus vulgaris and Rosmarinus officinalis on the inhibition of alpha-synuclein fibril formation was investigated. Furthermore their cell cytotoxicity on the pc12 pheochromocytoma cells was assessed using MTT, LDH, DNA fragmentation and anexin V methods . Results: The fibrillation of alpha-synuclein was monitored by the standard tests. Results indicated that adding some of these essential oils to the samples could inhibit fibril formation of alphasynuclein significantly. On the other hand some of them did not change the fibrillation process and some induced such process. For examining the prevention of apoptosis by adding these supplements to fibrils, they exposure to dopaminergic pc12 cell line. Result showed that all essential oil had destructive cytotoxicity effects even at low concentrations and it was a general phenomenon for essential oils. Conclusion: Results demonstrated that albeit some of the noted essential oils had potential to prevent fibrillation but they were highly toxic for cell which may lead to apoptosis. Due to their well inhibitory effect, essential oil must be fractioned and those fractions which can prevent fibrillation with no toxicity on cell, are introduced for further study in neurodegenerative diseases medication. Key words: Alpha-synuclein, Essential oils, Neurodegenerative diseases, Park
16

Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy
Mosleh Mohamadi Rad Hedayatollah Ghourchian Davoud Ahmadvand * Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran, Iran
*: davoud.ahmadvand@sund.ku.dk Introduction : Breast cancer is one of the problems threatening human health in the developed countries. Today, advances in molecular techniques have influenced on the field of cancer treatment. Among molecular methods, gene therapy and drug carrier nanoparticles are the most prominent threatments. Gene therapy has considerable development in recent years. Successful gene therapy depends on several factors; one of the most important is targeted delivery of therapeutic genes into cancer cells without trauma to normal cells. Therefore, in this study we decided to target the cancer cells at two levels: first, targetting at transcription level and second by use of targeted nanocarriers with antibody against human epidermal growth factor receptor 2 (HER2) which is over-expressed in breast cancer cells. In this study, we decided to synthesis PAMAM (Poly(amido amine))-PEG-Trastuzumab polyplexes containing a killer gene construct. Materials and methods : G5 PAMAM dendrimers conjugated to PEG in different ratios and TNBS assay was used for determination the number of PEG attached to each dendrimer molecule. Thiolated Trastuzumab (a monoclonal anti-HER2 antibody) was conjugated to PAMAM/PEG. Polyplexes (complexes of PAMAM and DNA) were generated at different N/P ratios. Particle size and zeta-potential of polyplexes was measured by dynamic light scattering. These polymers were used to deliver a killer gene under the control of a breast cancer specific promoter to HER2 expressing BT474 cell line and HER2 non-expressing MCF10A cell line as negative control. Transfection efficiency of different denriplexes was determined using Real Time PCR assay. Results : The conjugation of PEG and anti-HER2 antibody was confirmed by TNBS and ELLMAN assay. Different Pegylation degree and N/P ratios affect the particle size and zeta-potential. The best concentration ratio of the components (PEG and DNA constructs) was determined in order to achieve the most efficient complexes for transfection. Real Time PCR results showed that PAMAMPEG-Trastuzumab has higher transfection efficiency than PAMAM alone. Conclusion : Results of this study confirmed that Pegylation of dendrimers significantly reduced the toxicity of PAMAM dendrimers and conjugation of PAMAM-PEG to trastuzumab antibody make these polymers good candidates for targeted cancer gene therapy. Keywords : Nanocarrier. PAMAM dendrimer, trastuzumab, genethrapy
17

Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute lymphoblastic leukemia in Northwest of Iran
Hajar Nasiri Safar Farajna* Azim Rezamand Amir Monfaredan Majid Farshdosti Fateme Skandari Leyla Sahebi medical tabriz univercity medical tabriz univercity medical tabriz univercity medical tabriz univercity medical tabriz univercity medical tabriz univercity
medical tabriz univercity
*: farajnias@tbzmed.ac.ir Introduction : Acute Lymphoblastic Leukemia (ALL), the main subtype of lymphoid malignancy in children overall, almost occurs in 2-5 years old. The etiology of disease is unclear but some translocations and genetic variations are effective on occurrence and progress of this malignancy. Previous studies have shown TNF-a (-308) and LT-a (+252) polymorphisms have relationship with some diseases such as ALL, because these genetic polymorphisms lead to over expression and high plasma level of them. This study investigate the association TNF-a (-308) and LT-a(+252) polymorphisms between ALL patients and healthy individuals in northwest of Iran .
Materials and Methods DNA extracted from 5ml peripheral blood of 70 ALL patients and 130 healthy population by chloroform salting-out method for RFLP-PCR. After conventional PCR, digestion with NCOI as restriction Enzyme was done and acquired data was analyzed with SPSS ver.13
Results :The TNF-a mutant alleles (GA) in ALL and control are 11.1% to 88.9% respectively and we do not have any TNF-a (AA) homozygote in ALL group. The meaningful association of TNF-a variant is between ALL and control ( pvalue= 0.005). In contrast with TNF, we do not have any significant difference of LT variant between 2 subjected groups (pvalue =0.616)
Conclusion :Our result shows in ALL and control group from northwest of Iran with Azari ethnicity; the TNF-a variant allele has meaningful relationship between ALL and healthy people, although, there is not any significant association of LT-a variant in 2 selected groups. Keywords: ALL polymorphism, RFLP-PCR, TNF-a
18

Inhibition of oncogenic activity of WWP1 on breast cancer cell line with synthetic microRNA
Fatemeh Nematpour Mahdi Forozandeh * *: foroz@modares.ac.ir Introduction MicroRNAs (miRNA) are small RNAs that regulate gene expression. MiRNAs involve in numerous processes such as proliferation, differentiation, apoptosis, etc. These functions support a role for miRNAs in initiation and progression of malignancies. MiRNAs act as tumoursuppressor or oncogene, these miRNAs named oncomirs and classified into two groups; 1-Tumoursuppressor oncomirs, which downregulate expression of the oncogenes, 2-Oncogenic oncomirs, which downregulate expression of the tumoursuppressors. We can use this model for regulation of target tumoursuppressor or oncogene, so we designed and synthesized miRNA against one of the important oncogene in breast cancer, WWP1 (WW domain containing E3 ubiquitin ligase1), which is overexpressed in breast cancer. WWP1 promotes cell proliferation and regulates other proteins such as; TGF.B, P53, KLF2, KLF5,ErbB2,andEGFR. Material and Methods MicroRNA was designed by Invitrogen RNAi Designer, and after synthesizing, miRNA gene was ligated into a miR-155-based Block-iT Pol II miR RNAi Expression Vector (Invitrogen), and then expression level of WWP1 in WWP1-miRNA-transfected breast tumor cells (MCF7) was measured with Real-Time PCR. Furthermore cell proliferation was measured by cell counting and MTT assay. Results This synthetic miRNA reduced expression level of WWP1 up to 70% as compared with control cells after 72 hours. Also cell counting and MTT assay showed 30% reduction in cell proliferation of MCF7 cells. Conclusion In this experiment we succeed to reduce expression of WWP1 in MCF7 cells via miRNA, which led to inhibition of its function too. These data support that we can regulate expression of target gene via miRNA. So this new tool has therapeutic potential for treatment of genetically disease such as cancers. Keywords: Breast cancer, Gen silencing, MicroRNA, WWP1 Tarbiat Modares University Tarbiat Modares University
19

Transcription-mediated Isothermal Amplification for Rapid Identification of Lishmania major using Sequence-based Primers
Alireza Niazi Golestan Univercity of medical univercity
Oghol Niaz Jorjani* Golestan Univercity of medical univercity Hassan Nikbakht Sareh Zhand** Pooria Gill*** Golestan Univercity of medical univercity Golestan Univercity of medical univercity Golestan Univercity of medical univercity **: sa_zh2006@yahoo.com
*: niaz_jorjani@yahoo.com ***: pooriagill@yahoo.com
Introduction: Lishmania major is a flagellate protozoan parasite with a global expansion. This parasite is caused cutaneous lishmaniasis in human and considered as fairly prevalent infectious agent in the world. Employing advanced diagnostics for molecular identification of this microorganism has a more sensitivity and specificity in comparison to the microscopic methods. PCR is also introduced as one of the best known techniques for diagnosis of this parasite; however, the method is not widely used due to its expensive equipments and the time requested. Main aim of this research is diagnosis of L. major via employing an isothermal amplification technology so-called transcription-mediated amplification (TMA) using sequence-based primers. Materials and methods: Several specimens of cutaneous lishmaniasis were analyzed using TMA and RT-PCR in parallel. Total RNA of the specimens were isolated and used in the both assays. Sequence specific primers with T7 engineered promoter with hinge were used in the amplification process at 37 C for targeting L. major 18S rRNA. Dimethylsulfoxide enhanced T7 RNA Polymerase activity in the reaction with optimized concentration. The RNA amplicons were produced in less than 90 minutes and then identified via electrophoresed agaros gel after staining with SyberGold. RT-PCR assays were also done to be compared with TMA. Results: Specific 200-nt amplicons of RNAs were characterized in the gel electrophoregram in comparison to RNA ladder. In addition, the TMA products could be identified with SyberGold fluorescent emission while exposed with ~300 nm UV irradiation wavelength in the reaction microtubes. Conclusion: TMA technology could be applied for molecular diagnosis of L. major in parallel with the culture, microscopy, and PCR. Using a fluorescent dye e.g. SyberGold in the reaction increases the sensitivity of the method and provide a significant rapidity in molecular diagnosis of the pathogen. Obtained results are also shown a comparable specificity and sensitivity between TMA and RT-PCR. Keywords: L. major, TMA, 18S rRNA
20

Prediction of the genes involved in blood disorders during infection by Influenza virus A (H1N1) 2009
Zahra Nurolah Esmaeil Ebrahimi* *: ebrahimiet@gmail.com university of shahrekord university of shiraz
Abstract: The influenza virus belongs to the Orthomyxoviridae family virus. In 2009, a kind of this viruses appears in many areas of the word and leads to 18000 mortality. The symptoms of pandemic influenza are very different in humans, Including: the neuronal disorders that specially happen in children, Respiratory and blood disorders, that eventually lead to disability and death. In this study, Using microarray analysis, some genes involved in blood disorders, which are caused by influenza virus pandemic, was found. To do this end, microarray data of the effects of the tow mentioned viruses, pandemic and seasonal viruse, on Canis lupus (host) were obtained from NCBI (GEO= GSE17079). Then, the gene network of these genes was drawing. the results including one down regulated genes and 14 up regulated genes, Considering that Pvalue <0.05 were obtained. In contrast, down or up regulation of these genes does not happen after non-pandemic infection. All these genes play important roles in the body processes blood and Changes in their expression levels may be associated with many disorders. Results of Painter network show the relationship between these genes. The FN1, NKX2-1, SMAD6 and CSNK1D are the genes with more interactions in the network. We proposed that up and down regulation in these genes causes blood disorders in patients with pandemic virus. The genes and regulatory elements between them can play an important role in controlling gene expression and the prevention of blood disorders are caused by pandemic virus. Key words: Pandemic Influenza A (H1N1) virus, Microarray analyses, Blood disorders
21

The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells through Transduction of a Lentivirus Containing IPF-1 Gene
Saman Rahmati Saman Setoodeh Mahdi Hasanvand Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran Stem Cell Department, Stem Cell Technology Research Centre , Tehran, Iran Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran
Mohsen Karimi-Arznani Molecular Medical Department, Pasteur Institute of Iran, Tehran, Iran Mehdi Kadivar * Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran
*: m.kadivar@yahoo.com Introduction: Mesenchymal stem cells, are multifunctional cells with the ability to change and differentiate into different cell types such as Insulin-producing cells. Differentiation of mesenchymal stem cells into insulin-producing cells can be done by genetic or environmental factors. One of the most important factors which is involved in pancreas development and transcription of insulin gene is PDX-1 Transcription Factor. The purpose of this study is the differentiation of mesenchymal stem cells into insulin-producing cells. Materials and Methods: The recombinant lentivirus (made in previous study) was transduced into mesenchymal stem cells after being concentrated and titrated by ultracentrifugation and Flow cytometry respectively. The expression of pancreatic cell-specific genes, including insulin and Glut-2 were assessed by RT-PCR in differentiated cells. The differentiated cells were then detected using anti-C-peptide antibody in ELISA. Results: The titration of viral particles was calculated in transducing unit per ml (TU/ml), in terms of the number of cells at the time of transduction and the percentage of the number of GFP-positive cells. Semi-quantitative RT-PCR results showed high expression of insulin and Glut-2. Quantitative measurement of C-peptide by using anti-C-peptide indicated the existence of cells having C-peptide. Conclusion: Regarding the results obtained from current study, mesenchymal stem cells are able to differentiate into insulin-producing cells via IPF-1 genetic factors. Keywords: Mesenchymal stem cells, IPF-1 gene,Lentivirus
22

Crocetin attenuates spatial learning dysfunction and brain damage after chronic cerebral hypoperfusion in rats
Faezeh Tashakori Sabzevar* Mashhad university of medical science *: faezeh_12108@yahoo.com Introduction : Cerebral hypoperfusion is a major cause of cognitive deficits and memory impairment, in aging and in age-related neurological disorders .Alzheimer's disease (AD), vascular dementia and post-stroke hypoperfusion are the most important disorders, especially in elderly people after the age 65.The persistent decrease in cerebral blood flow is correlated with above mentioned disorders and severity of cognitive impairment. Also, the reduced cerebral blood flow (CBF) has been recently suggested as an important factor in progression of AD. Bilateral permanent occlusion of the common carotid arteries (2-VO) of rats has been widely used as a suitable model to investigate the chronic cerebral hypoperfusion. Materials and methods : our process consist of: 1.Preparation of crocetin 2.Analysis of crocetin with HPLC,TLC,spec 3.Animals (30 rats were divided into five groups: (1) sham-operated animals (nonischemic group) underwent the same surgical procedure without ligation of the common carotid arteries (n=6); (2) control group received vehicle (n=6); treatment groups (group 3-5) received crocetin 2, 4 and 8mg/ kg per day, respectively (n=6 in each group). 4.Surgery and experimental procedure with 2VO 5.Behavioral experiments(Morris water maze 6.Pathology Results : The results indicated that the escape latency time significantly decreased in crocetin treated rats, in comparison with control animals. Also, the percentage of time spent and traveled distance in target quadrant on final test trial day increased in crocetin 8 mg/kg group, compared to control group, while no difference was observed between groups in swimming speed. All behavioral results confirmed by histopathological analysis. Conclusion : In conclusion, treatment with crocetin could effectively prevent neuropathological alterations in hippocampus and thereby resulting in improvement of spatial learning memory in rats after chronic cerebral hypoperfusion. Keywords : Cerebral hypoperfusion, Crocetin, Morris water, maze, Saffron
23

Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7 Human Breast Cancer Cells
Samira Valiyari* Department of Medical Biotechnology, Pasteur Institute of Iran Saeid Yaripour Department of Drug and Food Control, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran. Fateme Zare Shahneh Immunology Research Center, Tabriz University of Medical Sciences Behzad Baradaran Immunology Research Center, Tabriz University of Medical Sciences Abbas Delazar Drug Applied Research Center, Tabriz University of Medical Sciences *: samiravaliyari@yahoo.com Introduction : Breast cancer is the most common cancer in women. Therefore, there is an urgent need to identify and develop therapeutic strategies against this deadly disease. This study is the first to investigate the cytotoxic and apoptotic effects of Scrophularia amplexicaulis in MCF-7 human breast cancer cells Materials and methods : Three extracts of Scrophularia amplexicaulis including the n-hexane, dichloromethane and methanol extracts were examined. MTT and Trypan-blue assays were performed in MCF-7 cells as well as control cell line MCF10A to analyze the cytotoxic activity of the plant. Further, the apoptosis inducing action of extracts of the plant was evaluated using cell death ELISA and TUNEL assay. Results : The results showed that dichloromethane and methanol extracts significantly inhibited cell growth and viability without inducing damage to MCF10A cells. Cell death ELISA and morphological changes of cells in TUNEL assay showed that the induction of apoptosis was the main mechanism of cell death. Conclusion : Our results strongly suggest that this plant may contain potential bioactive compound(s) for the treatment of breast cancer.
Keywords : Scrophularia amplexicaulis, cytotoxic, MCF-7 cells, apoptosis, anticancer, breast cancer
24

RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells
Meghdad Yeganeh Farnaz Akbari Kamrani Nasser Ghaemi Ehsan Seyedjafari * *: seyedjafari@ut.ac.ir University of Tehran Tehran University of Medical Sciences University of Tehran University of Tehran
Introduction : Embryonic stem cells (ES cells) are pluripotent cells capable for self-renewal and to differentiate to all cell types. Finding the molecular mechanisms responsible for these unique characteristics of ES cells is important. RNA-binding proteins play important roles in posttranscriptional gene regulation by binding to specific mRNA targets. In this study, we investigated the targets of RNA binding protein Rbm47 in mouse ES cells. Materials and methods : To this aim, we overexpressed HA epitope-tagged Rbm47 in mouse ES cells, and then RNA-binding protein immunoprecipitation (RIP) was performed. For the RNA coimmunoprecipitated with Rbm47, we did RT-PCR for Oct4, Sox2, and Nanog, which are the main pluripotency factors. Results : RT-PCR results show that Rbm47 binds to Nanog transcript in mouse ES cells and doesnt bind to Sox2 and Oct4 transcripts in these cells. Conclusion : This finding can give rise to reveal molecular mechanisms underlying pluripotency and stemness of ES cells and will be necessary for efficient application of these cells in regenerative medicine and tissue engineering. Keywords : Embryonic stem cell, RNA binding protein, Rbm47, RIP
25

Codon optimization, cloning and expression of single-chain variable fragment (scFv) antibody against CD22 in PichiaPastoris and optimization of Expression conditions
Najmeh Zarei VahidKhalaj* BehruzVaziry Pasteur Institute of Iran, Biotechnology Research Center Pasteur Institute of Iran, Biotechnology Research Center Pasteur Institute of Iran, Biotechnology Research Center
*: v_khalaj@yahoo.com Abstracts : The methylotrophic yeast Pichiapastoris has become a highly popular expression host system for the recombinant production of a wide variety of proteins such as antibody fragments. Single chain variable fragments (scFv) have many advantages over whole antibodies for use in antibody-targeted immunotherapy due to their small size. CD22, a B-cell specific surface molecule, is known to be up regulated in Non-Hodgkin's Lymphoma and other types of B-cell Lymphomas. To treat B-cell Lymphomas, multiple approaches including CD22 specific antibodies have been developed. In this project, the methylotrophic yeast Pichiapastoriswas used to produce an anti-CD22 single chain variable fragment, with the intention of conjugation to a radioisotope for therapeutic use. The scFv gene was designed and synthesized by choosing the P.pastorispreferred codons while keeping the G+C content at relatively low level. The full length gene cloned in the yeast vector, pPICZ and expressed in P.pastoris strain GS115.SDS-PAGE and western blotting analysis of culture medium from methanol-induced expression yeast clones demonstrated that the scFv was secreted into the culture medium. To improve scFv production we examined parameters such as time, pH, methanol concentration and cell density. Under optimized conditions (culture medium pH: 6-6.5, methanol concentaratin:1%, induction time: 72 h)the yield of soluble recombinant scFv was approximately 22 mg/L. The recombinant protein was purified to greater than 95% purity using Ni-NTA column chromatography. Flow cytometry, immunohistochemistry, and western blotting revealed that the purified scFv could bind strongly to the membrane of CD22-positive cells, Raji cells, but not to CD22negative cells, Jurkat cells. These results suggest that anti CD22 scFv produced in P. pastoris is active and specific toward CD22-positive cells and has potential for use in CD22-targeted immuonotherpy.
26
3rd International Student Biotechnology Congress Agricultural Biotechnology

dabb1
*Elham Ahanchian Mostafa Matlabi Mohammad rezaZamani Esmat Jourabchi Zahra moghadasJahromi National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology *ela.ahanchian@gmail.com : . Dabb1 . : A.thaliana CTAB DNA . DABf )(GCTCTAGAATGTCTTCAATCGTCGAGCAC )DABr (CGAGCTCTTATGAAGAAGACGGCACATTG Xba1 Sac1 NCBI . PCR . pJET1.2 . ) Sambrook& Russell (2001 . DNA Macrogen . : dabb1 forward reverse .DNA dabb1 PCR DABfDABr . PCR DNA 633 . pJET1.2 .PCR EcoR V . . dabb1 . . : dabb1 . : dabb1
27

Transgenic expression and recovery of biologically active recombinant human insulin from Arabidopsis thaliana seeds
BehnazHosseini* GholamrezaSharifiSirchi** Shahidbahonar university of Kerman Shahidbahonar university of Kerman
*hosseini.behnaz381@yahoo.com **:sharifi-sirchi@mail.uk.ac.ir Abstract: The increased incidence of diabetes, coupled with the introduction of alternative delivery methods that rely on higher doses, is expected to result in a substantial escalation in the demand for affordable insulin in the future. Limitations in the production capacity and economics will make it difficult for current manufacturing technologies to meet this demand. We have developed a novel expression and recovery technology for the economical manufacture of biopharmaceuticals from oilseeds. The production of therapeutic proteins in plant seed augments alternative production platforms such as microbial fermentation, cell-based systems, transgenic animals, and other recombinant plant production systems to meet increasing demands for the existing biologics, drugs under evaluation, and undiscovered therapeutics in the future. A very useful tool in these endeavors is the plant model system Arabidopsis thaliana. As a proof of concept for this technology, we have produced recombinant human insulin in the model plant species Arabidopsis thaliana. In PlantaTransformatin by Agrobactrium is a new, simple and low cost method for plant transformation. This method applies successfully in Arabidopsis taliana and great attempts are done in applying this method in other speciecs. In this research, kind of Inplanta transformation method (Floral dip) was used for transformation of Arabidopsis plant. Agrobacterium strain, C58 containing pjawhol III having insulin gene was used in this investigation. In this method, in Floral dip infiltration method flowering plant dipped in the Agrobactrium culture. Seeds From infltrated Arabidopsis plant were planted in ortder to select transformants in media containig 50 and 30 myl Kanamycin. Recombinant insulin from transgenic Arabidopsis seeds was matured in vitro using trypsin and further characterized by mass spectral analysis. Using our technology, we have demonstrated that insulin can be expressed and recovered as an active molecule at commercially relevant levels from transgenic seeds. A. thaliana plants were transformed with the plant binary expression vector pJawhol III. Plant derived insulin accumulates to significant levels in transgenic seed (0.13% total seed protein) and can be enzymatically treated in vitro to generate a product with a mass identical to that of the predicted product, DesB(30)-insulin. The biological activity of this product in vivo and in vitro was demonstrated using an insulin tolerance test in mice respectively. The study demonstrates bioequivalence of purified insulin from Arabidopsis seeds when compared with commercial insulin products in an animal model. "Demand for insulin will continue to grow as the incidence of diabetes increases worldwide and new delivery technologies, like Exubera(R) an inhaled insulin product that was recently recommended for approval by an FDA advisory committee, replace traditional injection 28

methods. These new delivery technologies require a greater supply of insulin due to the increased dosing requirement of inhaled products. We believe that plant-produced insulin will allow us to supply this expanding market and reduce capital costs by 70% and cost of goods by more than 40% compared with current production methods. Keywords: Arabidopsis Thaliana, Diabetes, Insulin, Recombinant protein, Oilseed
29

Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in Bread Wheat
Elhammehrazar* Ali izadi-darbandi Mohsen mohammadi *elhammehrazar@ymail.com Introduction: Grain hardness has an important role for discriminating marketability and commercial classes in world trade for bakery and confectionery in hexaploid wheat (Triticumaestivum L.) and controlled by Ha locus on the short arm of chromosome 5D in bread wheat. When both puroindolines are wild-type, grain texture is soft. When either of the puroindoline alleles is absent or alter by mutation, then the result is hard texture. Materials and methods : In this study validated kernel hardness and puroindoline alleles using STSPCR markers with multiplex PCR method and SNPs Markers with Temperature-switch (TS) PCR technique for the first time in Iran. Two Pina alleles (Pina-D1a, Pina-D1b) and four Pinb alleles (PinbD1a, Pinb-D1b, Pinb-D1c, Pinb-D1d) have been investigated in bread wheat with different origins and zones. To the phenotypic study, we used two measured methods for determinate as mechanical by compression testing (CT) and physical by of near infrared reflectance (NIR). Results: In general, the most frequent were Pina-D1b allele with CIMMYT origin and after that PinbD1b allele with originating from Canada and USA and the lower Pinb-D1d allele and Surprisingly Pinb-D1c allele was found in none of cultivars. We have also noticed a highly significant ) Conclusion: These methods to improve the speed and efficiency for single marker SNP genotyping are highly desirable. Our knowledge about the genetic and physical and mechanical basis of kernel hardness could provide useful information for breeders in breeding programs of bread wheat. Keywords: Bread wheat, compression test (CT), grain hardness, near infrared reflectance (NIR), puroindolines, Temprature Switch PCR University of Tehran University of Tehran Seed and Plant Improvement Institute
30

Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in Bread Wheat
ElhamMehrazar* Mohsen Mohammadi Ali Izadi-Darbandi University of Tehran Seed and Plant Improvement Institute Cereals, Research Department, Karaj University of Tehran
*elhammehrazar@ymail.com Abstract: Grain hardness has an important role for discriminating marketability and commercial classes in world trade for bakery and confectionery in hexaploid wheat (Triticumaestivum L.) and controlled by Ha locus on the short arm of chromosome 5D in bread wheat. When both puroindolines are wild-type, grain texture is soft. When either of the puroindoline alleles is absent or alter by mutation, then the result is hard texture. In this study validated kernel hardness and puroindoline alleles using STS-PCR markers with multiplex PCR method and SNPs Markers with Temperature-switch (TS) PCR technique for the first time in Iran. Two Pina alleles (Pina-D1a, PinaD1b) and four Pinb alleles (Pinb-D1a, Pinb-D1b, Pinb-D1c, Pinb-D1d) have been investigated in bread wheat with different origins and zones. To the phenotypic study, we used two measured methods for determinate as mechanical by compression testing (CT) and physical by of near infrared reflectance (NIR). In general, the most frequent were Pina-D1b allele with CIMMYT origin and after that Pinb-D1b allele with originating from Canada and USA and the lower Pinb-D1d allele and Suprisingly Pinb-D1c allele was found in none of cultivars. We have also noticed a highly significant )<0.0001( correlation CT and NIR. In this study, optimization of Temperature -switch (TS) PCR technique, a biphasic three-primer PCR system that permits amplification of the target locus in the first phase of thermal cycling before switching to the detection of the alleles is useful technique for identification grain hardness. This method to improve the speed and efficiency for single marker SNP genotyping are highly desirable. Our knowledge about the genetic and physical and mechanical basis of kernel hardness could provide useful information for breeders in breeding programs of bread wheat. Keywords: Bread wheat, Compression test (CT), grain hardness, near infrared reflectance (NIR), puroindolines, Temperature Switch PCR
31

*Zahra Mohammad zade SaeedNavabpour AhadYamchi SanazRamazanpour Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science *zahra.mohammadzade24@yahoo.com
Introduction : . . . Materials and methods : . 19-09 . N 9108 051 05 001 ( ) . : . ANR . ANDc . RCP-TRQ . TSER . Results : . Conclusion : .
32

Subcellular targeting of transiently expressed GFP using a plant virus based expression system in planta
Sayed Mohsen NassajHosseini* TarbiatModares University Masoud Shams-Bakhsh TarbiatModares University *nassaj20@gmail.com Introduction: The use of plant viral vectors for the transient expression of heterologous proteins offers a useful tool for the large-scale production of proteins. In this study, zucchini yellow mosaic virus (ZYMV) was used to express and target the GFP in planta. Materials and Methods: The GFP gene with six histidine residues and a NIa protease cleavage site was in frame inserted between the P1 and HC-Pro ORFs of the ZYMV vector. Also, chloroplast signal peptide and SEKDEL sequence were added to target GFP into chloroplast and endoplasmic reticulum, respectively. The infectious activity of the recombinant vector was assessed by using local lesion host. A single local lesion was inoculated on zucchini squash leaves and these plants were sampled 5, 10, 15 and 20 days after inoculation and analyzed by immunoassay, RT-PCR, fluorescent microscopy and confocal imaging. Results: Chlorotic local lesions developed on inoculated leaves of Chenopodium quinoa. ZYMV recombinants in the infected plants were confirmed by RT-PCR and serological assays. ZYMV expressed GFP was identified by immunoblotting. Analysis of inoculated plants by ELISA and western blot indicated that GFP was expressed in squash leaves. RT-PCR results showed that SEKDEL retention signal increased expression level of recombinant protein significantly. Conclustion: The use of plants as hosts for the overexpression of foreign proteins is still a developing field. The present study was performed in order to investigate whether GFP could be successfully targeted transiently in a plant-virus expression system. This procedure provides a convenient and fast way for production of large quantities of recombinant proteins in planta. Keywords: Zucchini yellow mosaic virus (ZYMV), Transientexpression, Recombinant protein
33

Genetic diversity of dwarfing Apples (Malusdomestica) of Iran AFLP markers
Shahrbanuoparchami*
agricultural biotechnology
mohammadhosaindaneshvar ramin university of ahvaz khalilalami said ramin university of ahvaz
seyadmojtabakhayamnequi agricultural biotechnology researche center of karaj shahlakianamiri *parchamis@yahoo.com agricultural biotechnology researche center of esfahan
Introduction: Apple (MalusdomesticaBorkh.) is one of the most important fruits of world temperate regions. This plant with several varieties which as germplasm resources have desirable and useful genes for breeding programs. The use of molecular markers as a scientific solution is provided to disolve genetic studies . Materials and methods : In this study, we evaluated genetic diversity of 46 natic Iranian apple root stock and foreign stock by AFLP markers.using 11 primer combination MseI+3 / EcoRI+3 which was detected 370 bands . Results: 370 bands between 150bp to 700 bp that ultimately 271 polymorphism bands were detected. Percentage of polymorphism and polymorphism information content (PIC) was estimated 73.31 and 55.5 respectively . Conclusion: Highest similarity was observed between genotyps of Gamy-Almasy 3 and 4 with 91% similarity coefficient and least similarity between 3 Azayesh Mashhad and B9 Karaj with 40% similarity coefficient were divided in to two main groups. The analysis showed that AFLP marker is reliable method for investigation of genetic variation on Iranian apple rootstocks population and determine the relative relationship between the genotypes of this plant. Keywords: Apple, Genetic diversity, Mulecular markers, AFLP
34

Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici blotch of wheat
SedigheRashidian* Department of Biotechnology , Science and Research Branch, Islamic Azad University, Tehran, Iran Seed and Plant Improvement Institute (SPII), Cereal Research Department, Karaj, Iran Seed and Plant Improvement Institute (SPII), Cereal Research Department, Karaj, Iran Department of plant breeding, Science and research Branch, Islamic Azad University, Tehran, Iran. Seed and Plant Improvement Institute (SPII), Cereal Research Department, Karaj, Iran
RaminRoohparvar
ManoochehrKhodarahmi
SepidehTorabi
Rahim Mehrabi
*s.rashidian60@yahoo.com Introduction: Mycosphaerella graminicola (anamorph: Zymoseptoria tritici) is the causal agent of septoria tritici blotch of wheat in regions with high rainfall during the growing season. The economic impact of STB is increasing due to the widespread cultivation of high-yielding cultivars that are generally susceptible to this pathogen. Conventional breeding for resistance against fungal pathogens, in general, and against STB, in particular, has been employed over the last decades but this approach is laborious and very time consuming. Various molecular techniques like markerassisted selection (MAS) have been developed to expedite the process of breeding for resistance against biotic stresses. MAS generally relies on the availability of molecular markers tightly linked to a particular genes of interest Materials and methods: To date, eighteen major genes for resistance to M. graminicola have been mapped and their SSR markers are identified. In the present study 21 wheat genotypes as well as the control cv. Tadinia (known to posses Stb4) were analyzed for the presence of Stb4 using the SSR marker Xgpw5211. Among all genotypes tested, two genotypes, Sep-k14 and Chamran, amplified a 170-bp DNA fragment using the primer pair Xgpw5211, which was similar to the size of Stb4 SSR allele indicating that these genotypes may carry Stb4 resistance gene. To confirm molecular data we have performed inoculation assay using two isolates that were virulent or avirulent on Stb4 containing cultivar, Tadinia. To this aim, wheat seedlings were individually inoculated at the first leaf stage by spore suspension of each isolate and plants were evaluated for their responses at 21 days post inoculation (dpi) by visual estimation of percentage of leaf necrotic areas covered with pycnidia .
35

Results: Pathogenicity assay showed that two wheat genotypes, Sep-k14 and Chamran showed phenotypic pattern similar to Tadiana. Therefore based on the phenotypic and genotypic data we conclude that Sep-k14 and Chamran may posses Stb4 . Conclusion: These genotypes can be used as resistant cultivars or sources of resistance to STB in wheat breeding programs in regions that Stb4 is effective against M. graminicola local populations. Keywords : Zymoseptoria tritici, Stb4, Tadinia
36

SUF4 CLF
Elham Shojaei *AsgharMirzaeiAsl SeyedBagher Mahmudi Bualisina university Bualisina university Institute of breeding and product of sugar beet seed Bualisina university
Sonbol Nazeri * a.mirzaie@basu.ac.ir
: . . . . . . . SUF4 CLF . PCR . SUF4 CLF .
37

cDNA PR10 )(zea mays
NilofarZandVakili *Mohammad Reza Zamani MostafaMatlabi Zahra MoghadasJahromi EsmatJourabchi National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology National institute of Genetic engineering and biotechnology *zamani@nigeb.ac.ir
Introduction : PR10 ) Pathogenesis Related(PR . PR10 A.flavus V.dahliae . cDNA PR10 (zea ) mays . Materials and methods : cDNA PR10 PR10.1-bpF2 PR10.1-XhR BpiI xhoI FJ897503 NCBI . RNA PR10 . RNX-Plus RNA cDNA . PCR PTZ557R/T . PCR . Results : cDNA RP10 RNA NaCl . RNA cDNA 497bp . PTZ57R/T . PCR BpiI xhoI . cDNA . PR10 . 4 36 104 114 115 . PR10 pTZNZ2 . . Conclusion : PR10 .
38
3rd International Student Biotechnology Congress Microbial and Industrial Biotechnology

Nitrate reductase purification from a moderately halophilic microorganism, Salinicoccus iraniensis
Sana Alavi* Mohammad Ali Amoozegar Khosro Khajeh University of Tehran University of Tehran Tarbiat Modares University
* Sana_alavi@ut.ac.ir
Introduction: Microorganism could have an important role in bioremediation due to their flexible nature. They can interact with everything toxic or non-toxic. Nitrate is a compound that is required for the plants to grow but at high concentration it could have serious problems on the ecosystems. Microorganism have the ability not only to survive in such contaminated areas but also in using this substance as an energy source. For halophilic microorganism salt is a need. So that would be interesting to see how these organisms use this kind of salt which could be toxic at high levels to grow. Also, it makes them good candidates as useful tools for bioremediation. Salinicoccus iraniensis, a novel moderately halophilic, Gram-positive bacterium, was isolated from textile industry wastewater in Qom, Iran. The Strain was strictly aerobic, non-motile, non-sporulating and oxidase and catalase positive. Nitrate reduction for this organism is positive. Materials and methods: In this report, the enzyme proposed to have a role in nitrate reduction has been purified. The enzyme activity was measured spectrophotometrically at 340nm by following the oxidation of NADH. Nitrate reductase mixture consisted of 470l TrisHCl buffer )pH 8( contained 5 mM nitrate, 25l of cell extract and 5l NADH )10mM( as described by Barbier et al. with some modification. Different techniques were used for purification: Batch precipitation by hydroxyapatite, Q-Sepharose, Phenyl- Sepharose and gel filtration column chromatography. Results: The purified enzyme was consisted of 3 subunits and we suppose that we have lost another subunit of this enzyme which was previously reported after gel filtration. Conclusion: This enzyme was purified previously but we suppose that we have lost another subunit of this enzyme which was reported after gel filtration.the molecular weight of the subunits differ from what has been reported. Keywords: Nitrate, Purification, Halophile 39

Comparison and Optimization of Expression of a Chimeric-Truncated t-PA by Pichia pastoris Strains: GS115 and KM71
Farnaz Ghasemian* Mahsa Mohseni Amirhossein Saadatirad Parastoo ramazani * farnaz.ghasemian@gmail.com Introduction: Human tissue plasminogen activator (t-PA) is one of the pharmaceutical products to treat occult coronary diseases; different generations of this thrombolytic agent have been modified through its development to reduce the premier form disadvantages such as rapid clearance from plasma and low level of specificity towards the fibrin and also fibrin binding. T-PA contains five structural domains; replacement of some amino acids which interacts with Plasminogen Activator Inhibitor (PAI) molecule by acidic amino acids has shown a significant increase in its plasma half-life and a novel chimeric t-PA was designed based on improved properties of Desmodus Rotundus plasminogen activator while conserving the basic structure of human t-PA to reduce antiplasmin and fibrinogen consumption and bleeding risk. Materials and methods : The recombinant plasmids were Escherichia coli strain Top10 F P. pastoris GS115 and KM71 strains (Invitrogen USA)and the expression vector was pPICZaA (Invitrogen USA).All plasmid sub-cloning experiments were performed with E. coli Top10 F with plasmid pPICZaA (Invitrogen). The growth media was buffered complex medium (BMGY; Invitrogen USA) containing glycerol (before induction) and the buffered methanol-complex medium (BMMY; Invitrogen USA) was used as an induction medium. Results : In this paper truncated t-PA gene was cloned into pPICZaA expression vector containing alcohol oxidase 1 (AOX1) promoter, the methylotrophic yeast, Pichia pastoris GS115 and KM71 strains were used to generate the t-PA recombinant protein, and expression of functional proteins processed successfully by methanol induction. The highest amidolytic unit for GS115 and KM71 transformants was 697IU/ml in day 5 and 938IU/ml in day 7, respectively. The recombinant yeast product purified by the metal-chelating resin (Ni-NTA), the purity was over 85%. Additionally, we compared our achieved yields of secreted t-PA in these two strains by process optimizing (temperature, pH, and methanol variations). Conclusion : In our experiments we could clearly show the efficiency of P.pastoris (GS115 and KM71strains) to produce active chimeric truncated t-PA. The yeast, P.pastoris expression system can eliminate problems associated with mammalian cell cultures. Shiraz University Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences Institute pasteur of Iran National Institute of Genetic Engineering and Biotechnology
40

Keywords : Pichia pastoris, GS115 and KM71 strains, tissue plasminogen activator (t-PA), Desmodus Rotundus
41

Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas syringae pv. syringae using Loop and Bumper Primers
Reza Goudarzi* Azad University of Damghan
* popo_delucia@yahoo.com Introduction : Rapid detection of pathogenic microorganisms is important for determination of plant health conditions. Pseudomonas syringae pv. syringae is one of the most important bacterial agents of stone fruits, all over the world. Traditional diagnostics such as bacterial cultivation, biochemical tests, and serological methods have been developed for detection of this pathogen. As molecular tests, some kinds of PCR protocols were analyzed; however this instrument-based technique restricted its use in the field. Alternatively, there are various technologies with no needs to thermocyclers for nucleic-acid amplification and those would be employed for molecular diagnosis of nucleic acids (DNA/RNA) in isothermal condition. Materials and methods : We introduce here a novel technology for rapid molecular diagnosis of Pseudomonas syringae pv. syringae via isothermal amplification of its DNA. This isothermal amplification technology employed two types of primers that those be named as loop and bumper primers for specific targeting of the conserved domain of syrD; moreover using Bst DNA polymerase with both polymerization and strand-displacement activities enhanced the reaction in a unique isothermal condition. Also, for diminishing melting point of DNA template, betain was used and set the polymerization efficiently. Results: Isothermal amplification of DNA by loop and bumper primers produced two kinds of products. The main product was named cauliflower-like DNAs due to their ladder-shaped behavior in the agarose gel electrophoregram. The byproduct was turbidity due to chelating magnesium ions with released pyrophosphates from the deoxynucleotides (dNTPs) in the polymerization process. Results showed the specificity and sensitivity of the isothermal amplification are higher than the conventional PCR. Conclusion : The technology needs no specialized Lab. instrument and performance for molecular identification of Pseudomonas syringae pv. syringae. Rapidity of the diagnostic test would be useful for rapid control the pathogen in the agriculture. Hence, it would be expected that the in-field molecular diagnosis of this pathogen be possible via employing such isothermal amplification technology Keywords : Pseudomonas syringae pv. Syringae; Isothermal amplification; Molecular diagnosis; Loop and bumper primers
42

*Hamed Norouzi Taheri Mojtaba Mohseni Javad Hamedi Abolghasem Rouhi *: hamed.nt68@yahoo.com : . . : 8 5 10 . )(SCA . . . ) (cross-streak method . . . 44 : . 4 )(MN1,MN3,MN41,MN44 . . MN1,MN3 . : . : University of Mazandaran University of Mazandaran University of Tehran Caspian Sea Ecology Research center
43

Design and construction of the expression cassette for producing the Epithermal growth factor with the ability of connecting to the collagen
Nogol Omoomi Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran national cell bank pasteur institute of Iran Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran
Asghar Parsaei
Mohamad Ali Shokrgozar* Zahra Nourmohammadi * mashokrgozar@pasteur.ac.ir
Introduction: Wound healing is a biological process which is important for all living animals, especially human being. Peptide factors are involved in this process, the most noticeable epidermal growth factor (EGF). Growth factors usually have a very short half-life. One of the most effective ways of increasing the stability of these factors is adding the ability of binding to the extracellular matrix. As far as collagen is the most abundant protein in the extracellular matrix, producing a kind of epidermal growth factor with the ability of connecting to the collagen, sounds a worthy goal with a clinical use prospect. Using Elastin Like Polypeptide (ELP), has been found useful in order to reduce costs and facilitating the purification (Which includes a high percentage of cost of production). Using the property of intein protein (autocatalytic), has also eliminated the need of necessary proteases in the process of separating the recombinant protein from ELP. By using these proteins properties and without the need of chromatography columns, a system has been designed to produce and purify the recombinant proteins and this system resulted the production of a kind of hEGF With high ability of connecting to the collagen. Materials and methods: pET-15b vector was used in the gene construction design, which includes an ampicillin resistance gene. Three fragments of ELP, Intein and EGF was inserted into vector by some specific restriction enzymes respectively. Therefore, at each step, the fragments and vector has been digested by their specific enzymes and have changed from linear form to the circular form by the binding process and then has been transformed to E.coli TOP10F by calcium chloride biochemical method. Results: For the confirmation of the fragment insertion in each step, the Colony PCR process was implemented. Finally, the insertion confirmation of each three fragments directly into the vector was checked by the sequencing, and by SDS-PAGE technique the expression of EGF was verified. Conclusion: Achieving this technology, results the production and purification of other recombinant proteins which spends the least facilities and costs. Keywords: Epithermal growth factor,EGF,Intein,collagen,ELP 44

Wastewater Algae: A Potential Candidate for Biodiesel Production
Roya Parichehreh Reza Gheshlaghi* Mahmood Akhavan Mahdavi Neda Jahanshahi * gheshlaghi@um.ac.ir Chemical Engineering Department, Faculty Engineering, Ferdowsi University of Mashhad Chemical Engineering Department, Faculty Engineering, Ferdowsi University of Mashhad Chemical Engineering Department, Faculty Engineering, Ferdowsi University of Mashhad Chemical Engineering Department, Faculty Engineering, Ferdowsi University of Mashhad of of of of
Introduction: In this study, municipal wastewater extracted from aerobic and anaerobic ponds of Parkandabad wastewater treatment plant were used for cultivation of valuable microalgae that can be used for biodiesel production. During algal growth, dominant species of algae were determined. The main objectives of the work were to investigate algal growth curve, lipid content and biomass and lipid productivities for the two samples. Materials and methods: BG11 culture media was selected. The fluorescent lamps were used as the light source and intensity was adjusted to 3500~4000 lux. Flow rate of CO2 and air were maintained at 60 cm3/min and 1000 cm3/min, respectively. Temperature was adjusted to 27C and pH of the medium was measured daily with a pH meter. At the end of the experiment cell concentration, biomass and lipid content of samples were measured. Results: Fig. 1 shows growth curve for both samples. Fig.1. Comparison of growth curve for two samples Fig. 2 presents variation in pH of the culture medium for both samples. Fig. 2. Comparison of pH values of two samples The wet, dry and lipid weight of algal biomass are shown in Table 1. Table 1. Wet, dry and lipid weight of two samples Lipid weight (g) Dry biomass weight (g) Wet biomass weight (g) Samples 0.006 0.016 0.177 Aerobic 0.005 0.025 0.317 Anaerobic Table 2 presents both lipid content and productivities of two samples. Table 2. Lipid content and productivities of two samples Lipid productivity (mglipid .L-1.day-1) Biomass productivity (gbiomass .L-1.day-1) Lipid content (gbiomass-1 .% glipid) Samples 7.5 0.0199 37.5 Aerobic 5.6 0.0278 20 Anaerobic Finally, dominant algae species were determined in wastewater samples. They were Chlorella sp. and Scenedesmus sp. according to Fig. 3. Fig. 3. The dominant algae species of samples at exponential phase Conclusion: From the above findings it can be concluded that Chlorella sp. and Scenedesmus sp. were dominant species of algae in the wastewater. This study also indicated that lipid contents of aerobic and anaerobic samples were high, so wastewater can be efficiently utilize as a suitable source of biodiesel production. Keywords: Microalgae, wastewater, aerobic, anaerobic, lipid content, biodiesel 45

Effects of agitation on enhancement of bacterial cellulose production
Motahareh Rouhi* Valiollah Babaeipour Ali Soleimani * r.motahareh@yahoo.com Abstract: Bacterial cellulose ( BC ) consists of pure cellulose but plant cellulose contains both hemicellulose and lignin. Thus, BC has unique properties such as high water retention value, degree of crystallinity and tensile strength. These unique properties make it possible to be used for many industry application in paper, textile, and food industries, and as a biomaterial in cosmetics and medicine. BC has been produced traditionally by a batch static culture but has a low productivity. Therefore, a continuous culture is required in order to increase its production. The present study effects of agitation on enhancement of bacterial cellulose production. Smaller crystallite size of microfibrils produced in agitated culture. During agitation, cells are stacked together in organized groups around the outer surface of the cellulose sphere. Scanning electron microscopy revealed that there was almost no difference between reticulated structures of bacterial fibrils produced in agitated culture and in static culture. Nevertheless, bacterial cellulose produced in agitated culture exhibited microstructural changes, namely, a low degree of polymerization and low crystallinity index. The bacterial cellulose produced in agitated culture had a low er Youngs modulus of sheet, higher water holding capacity and a higher suspension viscosity in the disintegrated form than produced in static culture. Totally static condition is Simple and did not need high technology but the time consuming Fermentation condition cannot be controlled or monitored. It is not applicable for large-scale production. The agitated condition is Applicable for large-scale production, overcome many limitations in static culture including diffusion, controllability and scaleup but its Product is not in pellicle form but its formed reticulated cellulose slurry. There are some problems with culture instability which demonstrate by loss of ability to make cellulose. To summarize, in this article we want to have a compare between these two methods to make bacterial cellulose Keywords : Agitation- Bacterial Cellulose (BC)- Static Production- Fermentation Malek Ashtar University of technology Malek Ashtar University of technology Malek Ashtar University of technology
46

Effect of Different Carbon Sources on Activity of Biocatalyst in Biocathode Microbial Fuel Cells (BMFCs)
Minoo Soltani* Reza Gheshlaghi Ferdowsi university of Mashhad Assistant Professor- Department of Chemical Engineering- Faculty of Engineering- Ferdowsi university of Mashhad Assistant Professor- Department of Chemical Engineering- Faculty of Engineering- Ferdowsi university of Mashhad
Mahmood Akhavan Mahdavi
* msoltani1383@gmail.com Introduction: Application of microorganisms in cathode chamber of Microbial Fuel Cell, as biological catalyst, has been proposed in recent years, which results in cost reduction, an increase in sustainability and removal of unwanted components. Material and Methods: A cylindrical double-chamber MFC was made of acrylic. The total volume of each compartment was 150mL, separated by a 35.3 cm2 cation exchange membrane; Carbon Felt was used as electrode material in both chambers with a diameter. Anaerobic wastewater and sludge were used as microbial community and carbon source in anode chamber while aerobic wastewater used as catholyte solution. They were both well-buffered with PBS. Acetate used as substrate in anode chamber, while the substrate was varied between acetate and bicarbonate in cathode chamber. Results and Discussion: The highest power density and lowest internal resistance were reached when sodium bicarbonate was added to cathode chamber while there was no significant change in those parameters in term of using acetate. It might be due to the existence of those bacteria which play the key role in electron transferring from electrode to final TEA in cathode. Therefore bicarbonate can significantly be a superior substrate for improvement of the catalytic activity of bacteria and consequently increased reduction rate of oxygen. Besides, in term of using bicarbonate, the higher activity of biocatalysts for electron transferring from cathode to oxygen, the more current would be produced, so the %CE of cell would be higher. The lower COD removal could be explained by the higher electrochemical activity of exoelectrogen microorganisms in anode chamber in the presence of more terminal electron acceptor in cathode compartment. So the other anaerobic microorganisms would not be able to consume organic compounds in anode chamber. Conclusion: As it is clear, biocathode microbial fuel cells have great potential for industrial applications in coming future. However more optimization should be taken into consideration to enhance power output. Keywords: Biocathode, Power Density, CE, COD removal 47

A novel method for optimization of biomass lipid extraction
Mehrab Valizadeh Derakhshan Bahram Nasernejad* Mitra Dadvar Mohammad Hamidi Zirasefi Amirkabir University of Technology (Tehran Polytechnic) Amirkabir University of Technology (Tehran Polytechnic) Amirkabir University of Technology (Tehran Polytechnic) Amirkabir University of Technology (Tehran Polytechnic)
* banana@aut.ac.ir Introduction : Extraction is one of the fundamental processing steps used for recovering oil from iomass for the production of biodiesel. Various methods are available for the extraction of algal oil, such as mechanical, enzymatic, chemical extraction through different organic solvents and supercritical extraction. Solvent extraction is a common and an efficient technique for oil extraction which involves the transfer of lipids from a solid material to a liquid solven. Materials and methods: In this study, optimization methodology was established by defining two variables by which an aliquot including three solvents with wide variety of proportions are being changed simultaneously to maximize the fatty acid extraction. The applied experimental method was soxhlet and algal sp. Chlorella vulgaris was chosen to our investigation. Results showed that hexane:acetone:methanol by 16:4:5 volumetric proportions respectively obtained maximum fatty acid extraction of 14.85wt.% over full factorial design. In this novel method, hexane vol. / (methanol vol. + acetone vol.) was defined as Impolar per Polar Ratio (IPR) and Methanol vol. / (methanol vol. + acetone vol.) was set to be Polarity Index (PI) ranging 0.286 to 2.00 and 0 to .6 respectively. Results: Results was further discussed using Response Surface Methodology (RSM) and it was showed that, IPR passes over a maximum value from about 1.4 to 1.7, also the optimum extraction wt.% increases by increasing PI reaching to 14.93% at PI and IPR of 0.551 and 1.750 respectively which corresponds to hexane:acetone:methanol of 16:4:5. Kinetic formula proposed by further analysis was shown in eq.1. Ext. wt.% = +3.16 + 3.7 * PI +13.4 * IPR -.95 * PI * IPR -4.4 *IPR2 (eq.1) Conclusion: The Model F-value of 78.40 implies the model is significant. There is only a 0.01% chance that a "Model F-Value" this large could occur due to noise. The values of of Prob > F below 0.0500 indicated that the model terms were significant. The value of the coefficient of the multiple determination (R2 = 0.9515) could also explain the significance of the model. As the kinetic forlmula is also indicates, the triplicate extraction has dramatically affected by chloroform changes (IPR) yet the trend changes after an optimum amount. Keywords: Optimization, Biomass, Polarity, Soxhlet.
48
3rd International Student Biotechnology Congress Molecular Biotechnology

In-cell western analysis, a new method of evaluating cellular protein expression and cell toxicity assays
Amir Afkhami 1 Department of Pharmacology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran. 2 Institute of Biotechnology, Ferdowsi University of Mashhad Department of Pharmacology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad Department of Biology, Science and Research Branch, Islamic Azad University
Maryam Dabbaghi*
Khadije Hashemi
maryam.dabbaghi@yahoo.com
Introduction : To date, several methods have been used to measure cellular protein expression on cells, tissues or their protein extracts. Herein , a new method has been presented to evaluate cellular protein expression in the cultured cells. Materials and methods : As an experimental model of cell toxicity, cultured rat basal forebrain neurons, separated from the base of fetal rats anterior brain, receive d increasing doses of glutamate. Specific antibody against endoplasmic reticulum stress gene, Grp58 as a marker of cell injury, combined with the secondary antibody conjugated to infrared dyes were used to evaluate the protein expression of Grp58. Resulted values were normalized against beta-tubulin isotype III (as a cell structural protein) using the corresponding primary and secondary antibodies on a different infrared channel. Results : We have shown the high sensitivity of this method for the quantitative and semiquantitative protein expression measurements, while, reducing the amounts of basic fluorescence interferences of plates and cellular auto fluorescence. Using lasers and fluorescence detectors with two separate 700 and 800 nm channels, we will be able to investigate the expression of two distinct proteins and to normalize the protein levels of interested gene with a house keeping cellular protein, simultaneously. Conclusion : Considering the widespread use of protein expression investigations in intracellular signaling and also in cellular toxicological and pharmacological researches, this method can be used as a more reliable, sensitive and accurate technique compared to older methods of cellular proteomics. Keywords : Protein expression, Cell toxicity, Grp58 49

Preparation of recombinant single domain antibody against epidermal growth factor receptor
Shiva Ahdi Khosroshahi Safar Farajnia* Mahdi Giarmand
*
Islamic Azad university, Ahar Branch Biotechnology Research Center Islamic Azad university, Ahar Branch
farajnias@tbzmed.ac.ir
Introduction: EGFR is a cell-surface receptor which plays an important role in cell growth, multiplication and differentiation. High level expression of EGFR is associated with carcinogenesis and it is upregulated in more than 70% of head and neck cancers. It has shown that targeting of EGFR by monoclonal antibodies can block EGFR downstream signaling pathway resulting in inhibition of uncontrolled cell proliferation. Fragment antibodies have the advantage of high penetration rate in tumors due to their smaller sizes. The aim of this study was to prepare a single-domain antibody against extracellular domain of EGFR for potential use in targeting of cancers with high EGFR expression. Material and method: The gene encoding for heavy chain variable-region (VH domain) of c225 antiEGFR monoclonal antibody was amplified by PCR and cloned into the pGEMT-Easy vector. Then, the insert was subcloned into the PET22b expression vector after confirmation by sequencing. The expression construct was transformed to E. coli BL21, cultured in Lb broth and the protein expression was induced by IPTG. Ni-NTA affinity chromatography was used for purification of recombinant protein and the expression and quality of purified protein was analysed by SDS-PAGE. The reactivity of purified recombinant protein with EGFR was analysed by ELISA and western blotting using A431 carcinoma cell line. Results and discussion: PCR amplification of VH domain resulted in a specific product which appeared as a bound 360bp in agarose gel. Sequencing of cloned PCR product was confirmed the integrity of the sequence. Expression of the recombinant single domain antibody resulted in high level expression of the recombinant antibody which appeared as a 13 kDa protein in SDS-PAGE analysis of bacterial lysate. Analysis of reactivity to A431 carcinoma cells by ELISA indicates that prepared anti EGFR-sdAb are able to bind the EGFR on A431cells. Also the specific reactivity of sdAb on A431 Cells was confirmed by Western blot. Conclusion: The results of this study indicated that sdAb can identify and bind to EGFR of A431 carcinoma cells. This recombinant fragment antibody would be potentially used for targeting of cancer cells with high EGFR expression. Keywords: single domain antibody, EGFR, recombinant expression
50

ADSCs/ESCs Co-culture: a novel approach to increase the proliferation of ADSCs
Leila Bahmani* Department of Medical Biotechnology, national institute of genetic engineering and biotechnology Department of Medical Biotechnology, national institute of genetic engineering and biotechnology Department of Medical Biotechnology, national institute of genetic engineering and biotechnology
Arash Javeri Arash Javeri
Masoumeh Fakhrtaha
leila.bahmani6508@yahoo.com
Introduction : A large number of studies have been recently performed to investigate reciprocal effects of adjacent cells. Some of these experiments could prove the positive effect of co-culture of differentiated/stem cells on induction of stem cell differentiation or improvement and maintenance of cell function and differentiated state. The aim of the present study was to evaluate the proliferation of adipose tissue-derived stem cells (ADSCs) following co-culture with embryonic stem (ES) cells. Materials and methods : ADSCs were isolated from the inguinal adipose tissue of mice. The cells were then expanded until achieving third passage. For co-culture system establishment, three passaged ADSCs were first cultivated in 6 well culture plates. ES colonies formed on mitotically inactivated MEFs, were next trypsinized and subcultured in appropriate porous membranes (inserts) which then were placed on top of the adhesive ADSCs. Results : Microscopic observation revealed that ES cells could form several colonies with different sizes on inserts. After 2 days of co-culture, when culture inserts were removed, an apparent color difference was observed in expansion medium of co-cultured ADSCs compared to the medium of control ADSCs without co-culture. The medium of Co-cultured ADSCs was more acidic than that of control group. We guessed that increase in proliferation of co-cultured ADSCs under influence of being co-cultured with ES cells, could be a wise reason for this observation. So we investigated PCNA expression by revers transcription-PCR (RT-PCR) and real time-PCR. PCNA is a nuclear antigen which acts as co-factor of DNA polymerase. So we used this gene as a marker of proliferation. RT-PCR results showed that PCNA was strongly expressed in both co-cultured and control ADSCs. But, Q-PCR results revealed the up regulation of PCNA in co-cultured group. Conclusion We proved that co-culture acts as mitogenic factors and as proved before, pre-treatment of ADSCs with these factors including bFGF and EGF, promoted differentiation potential of ADSCs. Keywords: co-culture, adipose-derived stem cell, embryonic stem cell
51

A novel cold-inducible expression system for Bacillus subtilis 1A772
Shirin Ghahremani* Khosro Khajeh Ali Hatef Salmanian Mehrnoosh Fathi
*
Tarbiat modares University Tarbiat modares University National Institute of Genetic Engineering and Biotechnology Tarbiat Modares University
swgh68@yahoo.com
Introduction : There are substantial research efforts ongoing for the development of a novel heterologous gene expression system with superior growth and protein production characteristics. Production of heterologous proteins at high levels by bacteria is commonly achieved using E. coli as the host. However, Bacillus subtilis 1A772 is an alternative host for expression of heterologous secretory proteins. Materials and methods : Production of recombinant proteins at low temperatures by using the des promoter is one strategy to prevent formation of protein aggregates and the use of an expensive inducer such as IPTG. We report on the construction of expression vector containing the coldinducible des promoter of Bacillus subtilis1A772, where one allows extracellular synthesis of recombinant proteins Results : Production of recombinant proteins started within the first 30 min after temperature downshock to 25 o C and continued for about 5 h. Conclusion : . In this study gene coding for the -amylase has been cloned and expressed in Bacillus1A772 using PAL vector under heat-inducible promoter. Subsequently, the secretion will be discussed based on the enzyme activity. Keywords : Bacillus, Expression system, Cold inducible.
52

Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas syringae pv. syringae using Loop and Bumper Primers
Reza Goudarzi Pooria Gill* Mansoureh Keshavarzi Sareh Zhand
*
Department of Biotechnology, Damghan Branch of Islamic Azad University, Damghan Department of Nanotechnology, Faculty of Advanced Medical Technologies, Gorgan, Iran Seed and Plant Improvement Institute, Karaj Department of Biotechnology, Faculty of Advanced Medical Technologies, Gorgan, Iran
pooriagill@yahoo.com
Introduction: Rapid detection of pathogenic microorganisms is important for determination of plant health conditions. Pseudomonas syringae pv. syringae is one of the most important bacterial agents of stone fruits, all over the world. Traditional diagnostics such as bacterial cultivation, biochemical tests, and serological methods have been developed for detection of this pathogen. As molecular tests, some kinds of PCR protocols were analyzed; however this instrument-based technique restricted its use in the field. Alternatively, there are various technologies with no needs to thermocyclers for nucleic-acid amplification and those would be employed for molecular diagnosis of nucleic acids (DNA/RNA) in isothermal condition. Materials and Methods: We introduce here a novel technology for rapid molecular diagnosis of Pseudomonas syringae pv. syringae via isothermal amplification of its DNA. This isothermal amplification technology employed two types of primers that those be named as loop and bumper primers for specific targeting of the conserved domain of syrD; moreover using Bst DNA polymerase with both polymerization and strand-displacement activities enhanced the reaction in a unique isothermal condition. Also, for diminishing melting point of DNA template, betain was used and set the polymerization efficiently. Results: Isothermal amplification of DNA by loop and bumper primers produced two kinds of products. The main product was named cauliflower-like DNAs due to their ladder-shaped behavior in the agarose gel electrophoregram. The byproduct was turbidity due to chelating magnesium ions with released pyrophosphates from the deoxynucleotides (dNTPs) in the polymerization process. Results showed the specificity and sensitivity of the isothermal amplification are higher than the conventional PCR. Conclusion: The technology needs no specialized Lab. instrument and performance for molecular identification of Pseudomonas syringae pv. syringae. Rapidity of the diagnostic test would be useful for rapid control the pathogen in the agriculture. Hence, it would be expected that the in-field molecular diagnosis of this pathogen be possible via employing such isothermal amplification technology. Keywords: Pseudomonas syringae pv. Syringae, Isothermal amplification, Molecular diagnosis 53

Probing the binding sites of Fediamsar and bovine serum albumin
Zari Hooshyar* Bahman Vasheghani Farahani Ghasem Rezanejade Bardajee
*
Imam Khomine international University Imam Khomine international University Imam Khomine international University
zhooshyar@gmail.com
Introduction : The interaction of compounds with potential use as pharmaceutical with a carrier protein as serum albumin is of great importance in their biodistribution. Albumin offers different sites for binding metallic compounds. Using spectrophotometric techniques, the interaction between Fe-diamsar and bovine serum albumin (BSA) was evaluated. In particular, it was possible to calculate an apparent binding constant (Kb) between 4.40 103 and 4.32 103 for the main interaction site of the protein. Materials and methods : Fe-diamsar was synthesized according to our prievies works. The complex titration experiments for BSA have been performed by maintaining the metal complex concentration fixed to )2 ml, 30 M( and varying the BSA concentration from 0 to 15 M. Results : The fluorescence spectra of BSA in the absence of Fe-diamsar in pH 7.40 tris buffer are measured and given in Fig. 1. Adding Fe-diamsar to BSA leads to a significant diminution of the fluorescence signal, but no other spectroscopic changes. The results indicate that the binding of complex to BSA quenches the intrinsic fluorescence of the single tryptophan in BSA. The fluorescence intensities at different concentrations of metal complexes were analyzed by using the Scatchards equation to calculate the binding constants. All experiments are measured at 300, 309 and 312 K. The binding constants and numbers are shown in Table 1. It can be seen that the binding constant decreased with the increase of temperature, which coincides with the static type of quenching mechanism. Conclusion : The interaction between the Fe-diamsar with a carrier protein as BSA is an interesting model to evaluate an important path for distribution and/or elimination of a compound with potential use as pharmaceutical. Keywords : Biological activity, Fe-diamsar, bovine serum albumin
54

The benefits of lanthanide cofactors for the characterization and application of RNA-ligating deoxyribozymes
Fatemeh Javadi-Zarnaghi Claudia Hbartner*
*
Max Planck Institute for Biophysical Chemistry Max Planck Institute for Biophysical Chemistry
choebar@mpibpc.mpg.de
Introduction : Deoxyribozymes are artificial single stranded DNA molecules that are identified by in vitro selection and serve as useful tools for practical applications. Beneficially they require only metal ions as cofactors for their catalytic activity and can easily be isolated and reused for multiple reactions. Little is known about the function and structure of deoxyribozymes. Materials and methods : We have developed methods for high throughput investigation of nucleotide and chemical functional group requirements of deoxyribozymes i.e. Combinatorial Mutation Interference Analysis (CoMA)1, and DNA-Nucleotide Analogue Interference Mapping (dNAIM)2. Results : We applied these methods to study deoxyribozymes that catalyze the synthesis of 2, 5- branched RNA. The 2,5'-branched RNA product resembles the core of the lariat RNA, an important intermediate during mRNA splicing. We employed preparative scale in vitro synthesis of 2,5 branched-RNA to study RNA-RNA and RNA-protein complex formation required for splicing reaction. Along our biochemical studies of these RNA-ligating deoxyribozymes, we found impressive rate acceleration upon addition of micromolar concentrations of lanthanide ions for some of these DNA-catalysts. The lanthanide-dependent acceleration reflects the presence of specific lanthanide binding sites in the active DNA structure, which enabled investigations by sensitized luminescence spectroscopy of DNA-bound Tb3+. In a specific application of RNA-ligating deoxyribozymes, the donor RNA can be replaced with guanosine triphosphate (GTP). Also in this case, the presence of Tb3+ proofed beneficial and resulted in an improved approach for site-specific post-synthetic labeling of RNA, which is demonstrated for functional RNAs such as riboswitches and snRNAs. Conclusion : In summary, we developed methods for functional studies of deoxyribozymes and we harnessed new insights from these investigations to improve practical applications of DNA enzymes. References 1 Wachowius, F.; Javadi-Zarnaghi, F.; Hbartner, C. Angew. Chem. Int. Ed. 2010, 49, 8504. 2 Wachowius, F.; Hbartner, C. J. Am. Chem. Soc. 2011, 133, 14888. Keywords : deoxyribozyme, DNA catalyzis, RNA ligation, RNA labeling
55

Investigating the Effects of Interactions between Histidin and Other Amino acids on Thermostability of Methylglyoxal synthase from Thermus sp.GH5
Khosro Khaje* Mahdie Hadi Reihaneh sadat Mirhassani Mona Atabakhshi Malihe Mohamadi
*
Tarbiat Modares University University of Tehran University of Tehran Tarbiat Modares University Tarbiat Modares University
khajeh@modares.ac.ir
Introduction : Methylglyoxal synthase (MGS, EC4.2.3.3) is a homohexameric enzyme that catalyzes the conversion of dihydroxyacetone phosphate (DHAP) to methylglyoxal and phosphate in the first step of the methylglyoxal bypass of the glycolysis pathway. The thermophilic type of MGS was first isolated and expressed from Thermus sp.GH5 (TMGS). According to previous researches, His-His and His-Arg interactions have been shown to form like-charged contact pairs. Therefore, they are suspected to cause an increase in the total stability of the enzyme. There are three histidines in the structure of TMGS. Among them according to the crystallographic structure of TMGS, Arg22 and His23 are in a suitable distance to interact. So we investigated the effect of replacing Arg22 with His and Ala. The thermostability of these mutated enzymes was then compared with the native TMGS. Materials and methods : Two modified enzymes were produced with site directed mutagenesis (SDM), in turn replacing Arg22 with His and Ala. After sequencing expression and purification, thermal stability measurements were performed on all three variants at temperature ranging from 75 to 90C. Also the effects of the mutation on the structure of the proteins were investigated by fluorescence spectroscopy. Results : In all varients there were no significant differences between the kinetic constants of the native and mutated enzymes. However the R22H variant expressed increased thermostability in high temperatures compared to the native form. R22A came in last, with the lowest resistance at high temperatures. Also, in comparison with the native form, the intrinsic fluorescence intensity of the R22H and R22A variants were increased and decreased respectively. Conclusion : In this study, we analyzed the impact of His-His interaction on TMGS thermostability by replacing histidine with other amino acids in a certain loop. It was demonstrated that removing likecharged pairs, by replacing Arg22 with Ala, resulted in a dramatic decrease in thermostability, while replacing Arg22 with His caused improvement in these pairs and significant increase in thermostability. These changes can be justified by the increased rigidity in the R22H variant in comparison with the other forms. Therefore, it can be proposed that like-charged interactions can have an important role in structural rigidity and hence, improve thermostability. Keywords : Methylglyoxal synthase, Thermostability, Site directed mutagenesi 56

Cell-Mediated Responses Elicited by Immunization of BALB/c Mice with Recombinant Eukaryotic Vector, pVAX1 Harboring omp28 of Brucella abortus, and Recombinant Omp28 as booster
Fatemeh Makvand Agharahimi Nima Khoramabadi Bahman Tabaraie Naser Harzandi Haniyeh Mehdi Nejati Jalil Fallah Mehrabadi Amir Bakhtiari
*
Islamic Azad University-Karaj branch Islamic Azad University-Karaj branch Pasteur Institute of Iran Islamic Azad University-Karaj branch
Aghababa
Tarbiat Modares University Pasteur Institute of Iran Tarbiat Modares University Islamic Azad University-Karaj branch
f.makvandi1987@yahoo.com
Introduction : Brucella abortus is a zoonotic pathogen causing brucellosis in cattle and human. Conventional vaccine strain, S19, may interfere with serodiagnosis of the disease. Vaccine strains are highly pathogenic for human hosts and there is no vaccine for prevention of the human brucellosis. New vaccines and immunization strategies are to be developed to overcome this word wide prevalent zoonosis. Omp28 is a surface protein of the Brucella cell and is able to elicit immune responses against this intracellular pathogen; using a DNA vaccine strategy may result to increased cell-mediated responses. Administration of recombinant Omp28 is supposed to increase cellmediated immunity. Materials and methods : omp28 gene was cloned in pVAX1 and pET28a(+) separately. Recombinant pVAX1 (pVAX1-omp28( were produced in E. coli DH5 and purified by Giga EndoFree Plasmid Purification kit. Recombinant Omp28 (Omp28pET28) was expressed in E. coli BL21 and purified by nickel affinity chromatography. Separate groups of BALB/c mice were immunized with either of pVAX1-omp28 or Omp28pET28. One group of mice immunized with DNA vaccine received the same plasmid as booster while the other group which received pVAX1-omp28, boosted with Omp28pET28. 9 day post-immunization mice were bled and sera were collected. Mice were sacrificed and spleen lymphocytes were cultured and subsequently stimulated with rOmp28pET28. Serum level of IgG1 and IgG2, Levels of IFN-, IL-12 and IL-4 in stimulated cell cultures were evaluated by ELISA. Results : Although all immunized mice developed significant immune responses, those immunized with both pVAX1-omp28 and boosted with rOmp28pET28 showed markedly higher levels of 57

cytokines especially IL-12 and IFN- and also serum IgG2a. Ratio of IgG2a/IgG1 was suggestively higher for the latter mice. Conclusion : To eliminate the pathogen, there is a need for development of cellular responses against Brucella in infected host .Our results suggest that pVAX1-omp28 DNA vaccine and the protein booster strategy potently can elicit efficient responses and they can be applied in future vaccine investigations against Brucellae. Keywords: Omp28, pVAX1, Brucella abortus
58
3rd International Student Biotechnology Congress Nono-Biotechnology

phage Nanobioparticle expressing Apoptin suppress only human brea st carcinoma tumor growth in vivo
Narmin Ghaderi* Alireza Shoae hasani Khosro Esazade Amineh Ghaderi *: narminghaderi@yahoo.com Abstract:Phage therapy is a novel field of cancer therapy and phage nanobioparticles (NBPs) such as phage could be modified to deliver and express genetic cassettes into eukaryotic cells safely in contrast with animal viruses. Apoptin, a protein from chicken anemia virus (CAV) has the ability to specifically induce apoptosis only in cancerous cells. We presented a safe method of anti breast tumor therapy via the apoptin expressing NBPs. Here, we constructed a ZAP-CMV-apoptin recombinant NBP and investigated the effectiveness of its apoptotic activity on BT-474, MDA-MB361, SKBR-3, UACC-812 and ZR-75 her2 overexpressing carcinoma cell lines for further clinical trials. Transfection with NBPs carrying ZAP-CMV-apoptin significantly inhibited growth of all the breast carcinoma cell lines in vitro, but had no effect on normal cells. Also nude mice model implanted BT474 human breast tumor was successfully responded to the systemic and local injection of untargeted recombinant NBP construct. The results presented here reveal important features of nanobioparticles to serve as safe delivery and expression platform for human cancer therapy. Key words :Bacterial virus, Delivery, Gene expression, Malignant, Vector Islamic Azad University of Lahidjan Tehran University Islamic Azad University of Lahidjan Islamic Azad University of North Tehran Branch
59

Synthesis of Nanobody- Dendrimer Conjugates for Targeted Breast Cancer therapy
Farnoush Jafari Medical Biotechnology Department,Faculty of Medical Science, Tarbiat Modares University of Tehran Medical Biotechnology Department,Faculty of Medical Science, Tarbiat Modares University of Tehran
Fatemeh Rahbarizadeh*
*: rahbarif@modares.ac.ir Introduction : Cancer gene therapy by systemic gene delivery would be a most attractive way for treatment of cancer. Non-viral gene delivery systems, such as cationic lipids, liposomes, emulsions, and cationic polymers, have received much attention recently due to rising concerns on the safety of using viral vectors in in-vivo gene therapy. One such material is polyamidoamine dendrimer (PAMAM), which has been extensively studied for its role in transfection. However, their high toxicity limits their application. A common method of reducing the toxicity of these carriers is covering their surface charge by hydrophilic polymers such as polyethylene glycol (PEG). For increasing specificity of polyplexes, targeted transfer of these carriers was used. In this method targeting molecules attached to polyplexes, recognize specific cell surface receptors, which will guide the polyplexes to specific tissues. Nanobodies are the smallest antigen-binding domain of heavy chain camelid antibodies that can be used as targeting moiety in polyplexes to target tumor cell surface antigens. Materials and methods : Different molar ratio of PEG to PAMAM dendrimer were used in order to achieve the best ratio of PEG for the most transfection efficiency and the least cytotoxicity. Conjugation of PEG to PAMAM was confirmed by TNBS assay by determining primary amines. Conjugation of nanobody to PAMAM-PEG was determined also by ELLMAN assay. Then these polymers were used to deliver a killer gene to HER2 expressing breast cancer cell lines such as BT474 and SKBR3 and HER2 non-expressing MCF10A cell line as negative control. Results : Results of this study confirmed the efficiency of targeted dendriplexes in gene delivery and their potency for targeted gene delivery in to the cells. Both TNBS assay and ELLMAN assay results confimed the conjugation of PEG and nanobody to PAMAM dendrimers, respectively. Conclusion : Nanobody-conjugated nanoparticles were shown to discriminate between Her2+ and Her2 cells, and thus have the potential to be used in active targeted gene delivery. Keywords : Nanobody, PAMAM Dendrimer, HER2
60

Dendrosome-based delivery of siRNA against GFP gene in CHO-cell
Marziyhe Karimi * Reyhaneh Ramazani Tarbiat modares university Tarbiat modares university
*: m.karimi@modaress.ac.ir Introduction : Introduction: Lipofectamine 2000 has been used successfully to transfect short interfering RNAs (siRNA) into mammalian cells for RNA interference (RNAi) studies but Experiments showed that liofectamin has toxic effects on target cells which necessitates using a safer career such as dendrosome. dendrosomes are neutral, biodegradable, covalent or selfassembled,hyperbranched, spheroidal nano-particles with size ranging from 15 to 100nm that provides an efficient mean for gene delivery into various kinds of cells such as CHO cells . In this experiment, We've used dendrosome As a safe carrier to transfect short interfering RNAs (siRNA) into cho cells that have stable expression of GFP. Materials and methods : Methods: study was conducted on cho cells. Under sterile conditions 4mL of the culture medium )DMEM( and 10% FBS was pipetted into a 25cm flask )37 C(. After 72 hours , Cells were cultured in a plates 12 wells. and After 24 hours , Dendrosome si RNA and lipofectamin siRNA Complexes were prepared and added to each well.At time intervals of 24 and 48 and 72 hours,we measured the amount of GFP expression by fluorescent microscope. Results : Results: The results indicate that siRNA is transferred into cho cell and Expression levels of GFP are decreased. Conclusion : Conclusions: dendrosomes is neutral, biodegradable, covalent or selfassembled,hyperbranched, spheroidal nano-particles that can be a good alternative to other carriers such as Lipofectamin in the gene delivery. Keywords : KEYWORDS: Lipofectamine 2000, short interfering RNAs, dendrosomes
61

PLGA Nanoparticles Containing a Combination of Recombinant 31kda Surface Protein and Detoxified Lipopolysaccharide of Brucella abortus Significantly Stimulated a Protective Response in BALB/C Mice
Nima Khoramabadi
*
Tarbiat Modares University Tarbiat Modares University Teheran University of Medical Sciences Tarbiat Modares University Teheran University of Medical Sciences Amirkabir University of Technology
Ashraf Mohabati Mobarez Fatemeh Atyabi Haniyeh Aghababa Mehdi Esfandyari-Manesh
Mehrdad Behmanesh Bahman Tabaraie Mehdi Nejati *: nimakhoramabadi@modares.ac.ir
Tarbiat Modares University Pasteur Institute of Iran Pasteur Institute of Iran
Introduction : Brucellosis is a zoonosis which is prevalent worldwide. Brucella vaccine strains are very pathogenic for human hosts and there is no approved vaccine for prevention of human brucellosis. The major antigen of Brucelaea is outer polysaccharide chain in LPS which is a Tindependent antigen. 31kDa cell surface protein of B. abortus (BCSP31) is able to stimulate the cellmediated responses. When combined with BCSP31, it is expected that a T-lymphocyte dependent response will be elicited against the polysaccharide antigen. An effective delivery system may significantly increase the efficiency of immune responses. PLGA nanoparticles are biocompatible and are phagocytosed by macrophages, which are the main Brucellae host cells. The latter is expected to increase the immune response against the pathogen. Materials and methods : Recombinant BCSP31 (rBCSP31) was produced in a pET28a(+)-E coli BL21 expression system and purified by Ni-affinity chromatography. Lipopolysaccharide from B. abortus extracted and purified through Westphal procedure, then detoxified by NaOH (d-LPS). A combination of rBCSP31 and d-LPS were used to prepare nanoparticles using PLGA (50:50) by a water-in-oil water system. Separate groups of BALB/c mice were immunized by rBCSP31, d-LPS, combination of rBCSP31 and d-LPS, and PLGA nanoparticles containing rBCSP31 and d-LPS. After three doses, levels of serum IgG1, IgG2a, and IL-4, IL-12, and IFN- from lymphocyte cultures were evaluated. Mice from the same groups were also challenged with pathogenic B. abortus and recovery of the bacteria from spleen was assessed.
62

Results : Mice immunized with PLGA nanoparticles containing a combination of rBCSP31 and d-LPS showed significant elevation IgG2a/IgG1 ratio against d-LPS (main antigen). They also showed significantly higher levels of IL-12 and IFN- in response to d-LPS. A significant higher spleen clearance occurred in mice immunized with PLGA nanoparticles. Conclusion : Our data shows that combination of the d-LPS with rBCSP31 effectively increased the immune response to the polysaccharide antigen; this effect was efficiently increased by using PLGA delivery system. Results showed that cell-mediated immunity was significantly elicited against d-LPS when combined with rBCSP31 and entrapped in PLGA particles. Results from challenge experiments also support the immunoassay findings. Category : Either Oral OR Poster Keywords : Brucella, Brucellosis, B. abortus, lipopolysaccharide, PLGA, 31kDa cell surface protein, BCSP31
63

Design a hydrogen peroxide biosensor by use of catalase and modified electrode with magnesium oxide nanoparticles
Masoud Negahdary* Young Researchers & Elite Club, Marvdasht Branch, Islamic Azad University, Marvdasht, Faculty of Advanced Medical Technology, Golestan University of Medical Sciences,
Batool Yousefi-Telori
*: masoud.negahdary@hotmail.com Abstract: In this study was used of combination of biology, electrochemistry and nanotechnology in designing biosensors to detect hydrogen peroxide (H2O2) by using of modified carbon paste electrode (CPE) with magnesium oxide nanoparticles (Mgo Nps) and catalase enzyme (CAT).the synthesized magnesium oxide nanoparticles were studied by UV-VIS(Ultraviolet/Visible), XRD (x-ray diffraction) and (transmission electron microscope) TEM techniques. All Electrochemical studies were performed by cyclic voltammetry (CV). Results showed that a clear pair redox peaks obtained from CPE/ Mgo Nps/CAT complex with 1002 formal potential(E0). The existence of Fe (III/II) structure in catalase enzyme was an important factor that allowed to this enzyme participate in iron redox reactions and these reactions lead to the design a biosensors for detect hydrogen peroxide (H2O2). Designed biosensor could able to detect hydrogen peroxide in range of 50 to 190 M. Designed biosensor have good stability and could maintained 92% of its initial activity after the specified time period Keywords : bioelectrochemistry, magnesium oxide nanoparticles, catalase enzyme
64

An assessment of CH50 activity in mice (Mus msuculus ) treated with silver nanoparticles during skin wound healing
Samira Rahnama university of shahrekord *: Ssamira_rahnama@yahoo.com Introduction : The complement system, composed of hemolytic and bactericidal proteins, is known to have a profound inflammatory response. Furthermore, the complement cascade plays an important role in the lysis of foreign organisms and host defense. The complement proteins are synthesized in the liver. Recent evidence suggests that silver nanoparticles (Ag-NPs) have potent anti-inflammatory effects and accelerate wound healing. Therefore, herein we clarified 50% hemolytic complement (CH50) activity in mice Mus musculus during skin wound when treated with Ag-NPs. Materials and methods : A group of 50 BALB/c mice of about 8 weeks )weighting 24.23.0 g( were randomly divided into two groups: Ag-NPs and control group, each with 25 mice. A volume of 50 microliters from the nanosilver solution (10ppm) was applied to the wound bed in the Ag-NPs group while in the control group the wound area was washed by distilled water every day. Samplings from the blood of both groups were conducted on days 2, 7 and 14 of the experiment. The blood was obtained from both groups. The serum CH50 activity was assayed by an appropriate method. Results : The CH50 activity was increased in both experimental groups during 7 days. After this time, the CH50 activity in control group was decreased till 14 days but in Ag-NPs group was increased. All data was significant in 0.01 level statistically (p value<0.01). Conclusion : Based on our results, all mice models have no defect in complement system and Ag-NPs can activate complement system in classical pathway as an accelerator. Keywords : CH50, Mice, Ag nanoparticle, Complement
65

Cell supports of GNP-chitosan nanocomposite/hyaluronic acid chondroitin sulphate systems. cell adhesion and proliferation study
Mohamada Reza Ramezani Tarbiat Modares University Elahe Roshani Hossein Naderi-Manesh* Majid Taghdir *: naderman@modares.ac.ir Introduction : Chitosan (CHI)is a cationic linear polysaccharide . Indeed, this polysaccharide is a biocompatible , bioresorbable and bioactive biopolymer. The physico-chemical study of its interactions with the most important components of living matter appeared to be an essential point for the interpretation of the biological responses induced by the presence of chitosan in living media. With unique chemical and physical properties, gold nanoparticles (GNPs) have shown widespread use in fundamental research, particularly in biological and sensing applications. Incorporation of GNPs into polymer matrices has attracted increasing interest in improving the stability and biocompatibility of GNPs and enhancing their capability for immobilization due to the superior properties of the formed nanocomposites to both the polymer matrices and the nanoparticles. One such natural polymer is chitosan that offers distinctive advantages such as good biocompatibility, nontoxicity, remarkable affinity to proteins, and excellent gel-forming ability. Glycosaminoglycans (GAGs) are anionic polysaccha- rides (chondroitin 4-sulphate, chondroitin 6sulphate and hyaluronic acid) which are natural components of the extracellular matrix. The structural similarities between CHI, chondroitin 4- sulphate (CHOS) and hyaluronate (HA)is appreciated. Materials and methods : Gold nanoparticles were prepared using chitosan as reducing/stabilizing reagent. the GNPs-embedded chitosan nanocomposites gel (GNPs-CHIT gel) prepared by dissolving a certain amount of chitosan solution with GNP-CHIT solution in glass reactor containing ammonia 1%. GNP-Chitosan-hyaluronic acid chondroitin sulphate were prepared as follows: 50 mL of 1% GNP-CHI solution in aqueous HCl (pH 5.5) were added to 50 mL of 1% HA-CHOS aqueous solution with magnetic stirring. The morphology of films and sponges was determined by Scanning Electron Microscopy SEM Results : In the case of CHOS the strong SO3- groups by themselves will bring about complexation withthe NH3+ groups of CHI no matter how low the pH. On the other hand, it has been shown that the weak polyacid HA, also reacts with CHI forming a polyelectrolyte complex at very low pH. Tarbiat Modares University Tarbiat Modares University Tarbiat Modares University
and
66

Conclusion : It has been stated that the protonated amino groups of CHI are responsible for the bioadhesive character of the polymer . Therefore, this property is bound to be strongly affected when materials are prepared with GNP-chitosan-glycosaminoglycans. Keywords : Scanning Electron Microscopy, Glycosaminoglycans, GNP-CHIT nanocomposite, chondroitin sulphate, hyaluronic acid.
67

Blood Lead level measurement using two biosensors pGL3-luc/pbr and pGL3luc/cad
Neda Saeb Nia* Tarbiat Modares University *: nsaebnia@yahoo.com Introduction : The bacteria which changed genetically to generate a measurable signal when they detect a physical or chemical element in the environment called Bacterial Biosensors. These sensors are made of two parts: a promoter (that detect the aim element) and a reporter gene (that is attached to the promoter and generate a signal). Lead is a harmful element in the air which 90% of it enters to the body by breathing. Lead in body may cause genetic changes or alteration in hereditary elements. Materials and methods : In this research we use two biosensors to detect lead in the blood; One of them is made by pbr operon promoter and regulatory gene pbrR from pMOL30 plasmid belongs to Ralstonia metallidurans and the other by cadA operon promoter and regulatory gene cadC from pI258 plasmid belongs to Staphylococcus aureus. In these biosensors the firefly luciferase gene is the reporter gene and the E.coli DH5 is the host. Blood samples were collected from volunteers that were not at direct exposure of lead and then the plasma was separated. To disabling the complement system proteins which prevent bacteria growth, the plasma samples were heated at 56C for 30min. Different lead concentrations were made in plasma samples to drawing the standard curves for biosensors activity. Lead level of blood samples was measured using pGL3luc/pbr and pGL3-luc/cad biosensors. The Luminometer was used to measure the luciferase gene activity. For measuring lead levels of blood, 25 blood samples were collected from police officers working in the center of Tehran city as ones who are at direct exposure of lead, and 25 blood samples were collected from the police officers working in the offices as controls. Finally lead levels of blood samples were determined using two biosensors. Results : Two biosensors pGL3-luc/pbr and pGL3-luc/cad worked properly in the plasma. We could determine the blood lead levels considering the standard curves of biosensors activity. Conclusion : pGL3-luc/pbr and pGL3-luc/cad biosensors can determine lead levels in the plasma. Therefore these biosensors can be used instead of time consuming and costing chemical methods. Keywords : Biosensor, pGL3-luc/pbr biosensor, pGL3-luc/cad biosensor, air pollution, leads.
68

Evaluation of ESAT-6 and CFP-10 proteins expression of Mycobacterium bovis at RNA level and evokes cellular immunity in mice with proliferation lymphocyte method
Azam Torabi Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad.
Fatemeh Vahedi*
Iran Department of Biotechnology, Razi Vaccine and Serum Research Institute, Mashhad, Iran.
Mojtabat Tahmoorespour
Department of Animal Science, College of Agriculture, Ferdowsi University of Mashhad.
Nader Mosavari
Department of PPD production, Razi Vaccine and Serum Research Institute, Karaj, Iran Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad. *: vahedif@yahoo.com
Mohammar Reza Nassiry
Background:Mycobacterium Bovis (M. bovis) is a pathogenic agent for many domesticated and wild animals in particular bovidae, cervidae and occasionally carnivores and human. In addition, more than % of human tuberculosis is caused by M. bovis. Bovine tuberculosis, caused by M. bovis is a major problem for the cattle industry and is also a concern for human health. An effective vaccination strategy would make a valuable contribution to the control of tuberculosis in cattle. The CFP- and ESAT- proteins of M. Bovis are important structural and functional proteins which are present in virulent strains of M. Bovis. They have been aimed as targets to induce cellular immunity and vaccine candidates. Here, we investigate expression of these after injection of their encoding plasmids constructed with pcDNA. + vector in mice. Methods : In the study, the whole genome of the bacterium M. Bovis extracted then by using specific primers, CFP- and ESAT- genes were amplified during PCR. Treated PCR products with restriction enzymes were inserted to pcDNA. (+) eukaryotic expression vector. Recombinant plasmids were replicated in E. coli and were purified, then injected intramuscularly to BALB/c mice. Twenty days
69

after injection, the expressions of CFP- and ESAT- genes were assessed at RNA level by RT-PCR. MTT assay was used in order to measure lymphocyte proliferation stimulated by bovine (protein purified derivatives) PPD. Results and Discussion :It was demonstrated that the eukaryotic expressions vector pcDNA. +CFP and pcDNA. +ESAT- were successfully constructed, confirmed by restriction enzymes digestion, PCR and sequence analysis. The lymphocytes of mice received plasmids encoding CFP- and ESAT-, proliferated more in comparison to lymphocytes of mice received PPD. These results reveal the potency of CFP- and ESAT- to induce lymphocyte proliferation and immune responses. Keywords: DNA vaccines, bovine tuberculosis, pcDNA . +CFP-, pcDNA. +ESAT-, lymphocyte proliferation, PPD
70
3rd International Student Biotechnology Congress Bioinformatics

Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its Structure
Farnaz Ghasemian* Shiraz university *: farnaz.ghasemian@gmail.com Introduction: Survivin is a protein composed of 142 amino acids which is encoded by the BIRC5 gene in humans. This protein inhibits the programmed cell death (apoptosis) and also controls the cell cycle. Survivin is expressed highly in most human tumours, but is undetectable in most terminally differentiated normal tissues, making it an attractive protein in the study of cancer pathophysiology, drug discovery, and medical diagnosis. Among the studies related to the effect of Survivin inhibitory mutations in cancer cells, more attention has been on T34A mutation. Thus, in this study the effect of this mutation on the structure and function of the protein using molecular dynamic simulation in a 25-ns time scale was investigated.
Materials and Methods: At first, complete wild structure of protein was modeled using MODELLER 9.9 software. Also, for making the mutant model of protein, threonine 34 was changed to alanine using Swiss PDB Viewer software. Then, using GROMACS 4.5.4 package and Amber force-field, molecular dynamics simulation was done, and at the end, equilibrium structures of models were analized in order to investigate structural changes related to the protein function. Results: The results of modeling and molecular dynamics simulation of this protein in wild-type and mutant forms show that T34A mutation may disturb the interaction between Survivin and HBXIP (a cofactor for Survivin that is involved in antiapoptotic activity of Survivin) and also XPO 1 (a protein which mediates nuclear export of Survivin). On the other hand, this mutation may facilitate and support the interaction between Survivin and Smac/DIABLO (a protein that inhibits Survivin antiapoptotic activity), Borealin and INCENP (two subunits of CPC which are required for correct control of the cell cycle), and also histone H3 (a necessary protein for accurate chromosomal segregation during the control of the cell cycle). Conclusion: Overall, our study may provide the structural basis for functional changes of Survivin, as was experimentally observed for this mutation. Keywords: Molecular Dynamics Simulation,Survivin,Mutation
71

From microarray data to gene expression pattern, network and protein analysis in Mus musculus under Helicobacter pylori infection
Niusha khazaie Abdulshakour Mohammadnia Moein Yaqubi Hossein Fallahi* *: h.fallahi@razi.ac.ir Introduction: Helicobacter pylori is gram-negative bacteria that is responsible for many diseases including: peptic ulceration, gastric adenocarcinoma, and. Mouse )Mus musculus( is the most important mammalian model organism. Methods: 63 Microarray datasets of BALBc infected with Helicobacter pylori SS1 obtained from Stanford Microarray Database (SMD) that was used in this study. Visual Basic codes, Microsoft Excel and XlSTAT.Add-Ins are applied for data manipulation, normalization and PCA (principle component analysis) respectively. Gene Cluster 3.0, JavaTreeView and Cytoscape are used for clustering, visualization of its result and network analysis respectively. Protein structure prediction and necessary information achieved from Uniprot, KEGG, BioGRID3.2, Robeta (full-chain protein structure prediction server) and SAM_T08. Results: Near 23000 genes were analyzed and Gene expression patterns, cluster and network of genes with much more change in expression prepared. 1700030c12Rik is up regulated gene and Tm4sf3 (Tspan8) is down regulated gene with unknown functions, their 3D protein structure were predicted. Network for genes with available protein interactions data constructed for Slc25a4, Eef1a, Sympk, and Nmi, that Eef1a1 locates in interesting position in our network. Conclusion: Applying this approach to microarray data from Mus musculus infected by Helicobacter pylori shows interesting result including new genes and network analysis. Keywords: gene expression,helicobacter pylori,network,protein structure prediction razi university NIGEB NIGEB razi university
72

Preparing Draft Genome-Scale Metabolic Network of Bacillus licheniformis based on the Reconstructed Metabolic Network of Bacillus subtilis
Rasoul Saghalieni Sayed-Amir Marashi Seyed Safa-Ali Fatemi* Mehdi Sadeghi *: sfatemi@nigeb.ac.ir National Institute of Genetic Engineering and Biotechnology Department of Biotechnology, College of Science, University of Tehran National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology
Introduction : Bacillus licheniformis is widely used in industry. Genome annotation availability and a reconstructed genome-scale metabolic network model for a related species provide requirements for generating a metabolic model for Bacillus licheniformis. Materials and methods : In this study, primary information for generating a genome-scale metabolic network of B. licheniformis ATCC 14580 is provided. Strong similarity between B. subtilis and B. licheniformis makes it possible to use the common genes between these two species. For finding similarities we used MAUVE, a multiple sequence alignment software tool. E-value for assuming orthologous-relation between genes was set to zero. Despite the similarities between these bacteria they also have metabolic differences. For obtaining information of these pathways, KEGG and TIGR were used. Results : B.licheniformis genes were divided into six different groups based on having orthologs in B. subtilis, the usage of their orthologs in B.subtilis model and existence of related reactions in KEGG. The first group contains those genes for which all variables are positive. Group 2 are genes which have ortholog(s) in B.subtilis and have been used in B.subtilis model but are not linked with any reaction in KEGG (165 genes). Group 3 are genes which have orthologs in B. subtilis model and although this orthologs have not been used in B.subtilis model but have been linked to some reaction in KEGG (231 genes). The fourth group is those genes that neither had been used for B.subtilis reconstruction nor have any related reactions in KEGG, despite having orthologous genes (1326 genes). And finally some genes do not have any orthologs in B.subtilis. From these, some genes are related to at least one reaction in KEGG (294 genes).The set of these genes are listed in group 5 and those genes which do not have any orthologs in B.subtilis and are not related to any reactions in KEGG are listed as group 6. Conclusion : In total, we presented a list of 1005 genes which can be used for model reconstruction. By using this list, it will be possible to extract information about the existing reactions and metabolites in B.licheniformis in order to reconstruct a quality-assured genome-scale metabolic network model for Bacillus licheniformis. Keywords : Bacillus licheniformis; Genome-scale model; Reconstruction; metabolic model
73
Poster Presentation Abstracts

Medical Biotechnology
Investigation of mouse embryonic stem cells proliferation on surface modified of aligned and random nanofibrous PCL scaffolds
Department of Biology, School of Basic Science, Science and Research Branch, Islamic Azad University Stem Cell Biology Department, Stem Cell Technology Research Center Department of Genetics, Faculty of Basic Science, Tarbiat Modarres Department of Hematology, Faculty of Medical Science, Tarbiat Modares University
Naghmeh Abbasi Sara Soudi Seyed Javad Mowla Nasim Hayati-Roodbari Masoud Soleimani* * soleim_m@modares.ac.ir
Abstract:: The development of three-dimensional (3D) biomaterial scaffold with surface properties in combining with mouse embryonic stem cells (mESCs) provide desirable alternative for replacement of damaged and diseased tissue. Nanofibrous scaffolds serve as suitable environment for cells attachment and proliferation due to similarity to physical dimension of natural extracellular matrix. In order to, the properties of plasma treated poly- - caprolactone nanofiber scaffolds (pPCL) with untreated PCL scaffolds were compared, and then p-PCL scaffolds were evaluated for mESCs culture. Materials and Methods: Aligned and random poly- - caprolactone (PCL) nanofibrus scaffolds were fabricated by electrospining process and their surface was modified with O2 plasma treatment to enhance the mESCs proliferation, adhesion and interaction with nanofibrous scaffold and their chemical and mechanical characterizations was performed by using SEM, contact angle and tensile test. Cell adhesion, morphology was considered and approved using scanning electron microscopy (SEM) 3 days after culture. Results: The proliferation of mESCs was evaluated by using MTT assay on day 1, 3, 5 after cell culture. Results showed that the cells grown on plasma treated PCL nanofibrous scaffolds were significantly higher than those of untreated scaffolds. Furthermore, the proliferation of mESCs on aligned nanofiber was significantly more ,when compared to random nanofibrous scaffolds. Conclusions: This study showed that plasma treating of scaffolds is more suitable substrate for adherence and growth of mESCs on aligned and random PCL nanofibrous scaffold compared with untreated ones. In addition, aligned nanofibrous scaffolds highly supported the proliferation of mESCs.
74

Keywords: tissue engineering, poly caprolactone, nanofibrous, surface modification ,mouse embryonic stem cells
75

Stem Cells and Gene Therapy for Cartilage and Bone Repair
Sara Abdijahed Shirin Farivar shahidbeheshti university shahidbeheshti university
*saraabdijahed@yahoo.com
Abstract: Cartilage and bone defects represent a common problem in orthopaedic practice. A bone graft has been the gold standard treatment for repairing bone defects. However, due to bone grafts associated donor site morbidity several alternative bone substitutes options have been made available but with their added expense and limited osteoinductive properties they are not ideal. Therefore, research has begun in tissue engineering to investigate stem cells, which are one of the bodys own mechanisms used to repair bone. Stem cells have shown to be excellent carriers for gene transfer having the capability to be transduced. Gene transfer could enable growth factors and bone morphogentic proteins to enhance bone repair. Usually, in focal cartilage defects without a stable brocartilaginous repair tissue formed, surgeons try to promote a natural brocartilaginous response by using marrow stimulating techniques, such as microfracture, abrasion arthroplasty, and Pridie drilling, with the aim of reducing swelling and pain and improving joint function of the patients. These procedures have demonstrated to be clinically useful and are usually considered as rst-line treatment for focal cartilage defects. However, brocartilage presents inferior mechanical and biochemical properties compared to normal hyaline articular cartilage, characterized by poor organization, signicant amounts of collagen type I, and an increased susceptibility to injury which ultimately leads to premature osteoarthritis (OA). Therefore, the aim of future therapeutic strategies for articular cartilage, regeneration is to obtain a hyaline-like cartilage repair tissue by transplantation of tissues or cells. Further studies are required to clarify the role of gene therapy and stem cells for management of cartilage and bone defects. Keywords: StemCell, Gene Therapy, Cartilage defect,bone defect
76

Immunogenicity Prediction of the Chimeric Protein Consists of Shiga and Cholera Toxins B-Subunits Using Bioinformatics approaches
Asal Akhavian Tehrani Jafar Amani Roohallah Kazemi Mahyat Jafari Amir Mousavi Ali Hatef Salmanian* * salman@nigeb.ac.ir
National Institute Biotechnology National Institute Biotechnology
of
Genetic
Engineering
and
Baqiyatallah Medical Science University of Genetic Engineering and
Applied Microbiology Research Center, Baqiyatallah Medical Science University National Institute Biotechnology National Institute Biotechnology of of Genetic Genetic Engineering Engineering and and
Introduction: Every year, many people and domestic animals die of diarrheal diseases all over the world. Up to now, these diseases remain as a leading cause of death in developing countries. Bacterial toxins have a major role in these diseases and among them cholera toxin (Ctx) produced by Vibrio cholerae and shiga toxin (Stx) produced by entrohemorrhagic E.coli (EHEC) are more severe. Both of these components belong to AB5 toxin family. The B subunits form a homopentamer and attach to host cells surface receptor; the A subunit passes through the doughnut-shaped pentamer, enters the host cell and causes it to death by stopping protein production. Plants are attractive bioreactors for the production of recombinant proteins, such as immunogenes. Furthermore, they can be a suitable candidate for edible vaccine production. Here we focus on in silico study of immunogenic content of the chimeric structure which consists of B subunits of these two important molecules in order to find out the probable potential of this edible subunit vaccine candidate to provide protection against both bacteria. Method:The sequence of both fragments obtained from genbank. The genes were attached together by different DNA linkers in order to separate both immunogens effectively. Different features of these chimeric constructs and their deduced protein were analyzed, using bioinformatics tools. The best construct with the best DNA, RNA and protein stability and structure was selected. To analyze the whole protein antigenicity index, Vaxijen server was used. Conformational and sequential epitopes were predicted using BcePred and DiscoTope5 servers to figure out how this structure is appropriate for stimulating the immune system as an edible vaccine. Result:The results showed that the chimeric construct, CTXB-DDDDK-STXB, had the best structure. It was found that the DNA linker DDDDK had no antigenisity itself and could separate two parts completely, so the immune system could recognize both of them as immunogens as well. The connection of these fragments did not have a bad effect on their antigenicity index and the whole antigenicity of the chimeric protein was above the threshold. 77

Conclusion:The chimeric construct CtxB-StxB is a probable immunogen and has the potential to undergo experimental studies to be produced in plant tissues and be examined as an edible vaccine candidate. Keywords:immunogenicity prediction, StxB ,CtxB, edible vaccine
78

Immune Response to Combination of Recombinant Ag85B and Ag85C of Mycobacterium tuberculosis in C57BL/6 Mice
Haniyeh Aghababa Tarbiat Modares University Ashraf Mohabati Mobarez Tarbiat Modares University Nima Khoramabadi Mehrdad Behmanesh Mehdi Nejati *: h.aghababa620@gmail.com Tarbiat Modares University Tarbiat Modares University Pasteur Institute of Iran
Introduction : Tuberculosis (TB) is still a leading infectious disease causing death. Replacement of conventional BCG with more efficient vaccines is based on identification of antigens which are able to elicit effective responses against M. tuberculosis, an intracellular pathogen. Mycolyl transferase complex of the bacterium is comprised of three enzymes, Ag85A, Ag85B, and Ag85C. These are secreted into the cell exterior and immune responses can be developed in host against these proteins. This study aims to produce recombinant Ag85B and Ag85C and evaluate the immune responses in C57BL/6 mice . Materials and methods : Recombinant Ag85B and Ag85C were separately cloned in pET32a(+)
(rAg85BpET32 and rAg85CpET32 respectively) and expressed in E. coli Rosetta gamiTM(DE3) pLysS host. Purification of the recombinant proteins performed through a nickel affinity chromatography. C57BL/6 mice were immunized with each of the proteins along with a combination of both in separate groups subcutaneously. 20g of rAg85BpET32 and rAg85CpET32 was formulated in Freunds adjuvant. Combined antigen was comprised of 10g from each protein in a 20g dose. Mice were immunized three times with 12day intervals. 9 day post immunization mice were bled to collect serum samples. Mice were sacrificed and spleen lymphocytes were cultured; all groups were stimulated with rAg85BpET32 and rAg85CpET32 separately. Level of IgG1 and IgG2a in sera and level of IL-4, IFN-, IL-12 and TNF- in lymphocyte cultures were evaluated. .
Results : Specific IgG1 and IgG2a levels directed to each of rAg85BpET32 and rAg85CpET32 were high but they were significantly higher in mice received a combination of both recombinant proteins. IgG2a/IgG1 ratio also showed a cell-mediated type of response. Both proteins stimulated the production of high levels of cytokines, but again the results showed significantly higher cytokine responses, especially for IFN- and IL-12 in lymphocyte cultures from mice immunized with both antigens . Conclusion : Our results show that both rAg85BpET32 and rAg85CpET32 are able to elicit efficient immune responses in mouse model; interestingly, when two proteins are combined, specific immune responses to each of them is significantly increased. Our results suggest that both recombinant proteins can be used in vaccine investigations against TB and if they are combined, the resultant immune responses are significantly stronger . Keywords : Ag85B, Ag85C, Mycobacterium tuberculosis 79

Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells in presence of Dimethyl sulfoxide
zahra sadat aghili* sayyed hamid zarkesh- Esfahani *: z.s.aghili@gmail.com esfahan university University of Isfahan Isfahan University of Medical Sciences
Introduction: recombinant human Growth Hormone (rhGH) is a small, single chain peptide of 191 residues. rhGH is necessary for normal linear growth, but it is also affects many aspects of metabolism, so that is has been described as being anabolic, lipolytic, and diabetogenic. In contrast to bacteria or yeasts, mammalian cells are more advantageous for producing recombinant proteins since correctly folded and biologically active proteins are produced through the secretory pathway. The enhancement of recombinant protein expression of a transfected cell line is essential for the development of an efficient large-scale bioprocess. The productivity of mammalian cells is low in comparison with that of prokaryotic cells. Many stimulating chemicals were added in the culture to overcome this drawback such as Dimethyl sulfoxide (DMSO). DMSO stimulated stable transformed Chinese hamster ovary (CHO) cells to synthesize different recombinant proteins and repress their proliferation rate. The expressions of rhGH were increased after adding DMSO. The purpose of this study is Enhancement of human Growth Hormone Synthesis by DMSO Addition to Serum-Free CHO Cell Culture . Materials and methods : The rCHO cells producing rhGH were used in this study. The CHO cells were established by transfection of a vector containing human growth hormone gene under control of the CMV promoter. Cells were inoculated in 25 cm2 T-flasks at a density of 2.5105 cells per T-flask. The CHO cell growth medium was used to increase cell density. after 2 days the growth medium was removed and The T-flasks were then filled with the serum free medium for rhGH production and incubated under different concentrations of DMSO (0.5-2%) and then cell morphology, viability and rhGH production was assessed using flow cytometry, ELISA, western blotting and dot blotting . Results : In this study, DMSO (1%) was demonstrated to elevate the expression of rhGH in the stable transfected CHO cells . Conclusion : we have demonstrated that DMSO could easily enhance production of recombinant protein by CHO cells . Keywords : CHO cells, Serum Free Medium, protein production, ELISA, western blotting
80

Homozygosity mapping in an Iranian pedigree affected with muscular dystrophy limb girdle (LGMD) reveals linkage to 2p12-14 and 10q25-26 chromosomes
Afagh Alavi Elahe Elahi* Maryam Malakooti Nejad School of Biology, College of Science, University of Tehran School of Biology, College of Science, University of Tehran Science and Research Branch, Islamic Azad University
*: elahe.elahi@gmail.com
Introduction: Homozygosity mapping is a powerful and efficient gene mapping method applicable to rare recessive disorders in inbred populations. Limb girdle muscular dystrophy (LGMD) is clinically and genetically heterogeneous group of disorders affecting the voluntary muscles, mainly around the pelvic (hip) and shoulder regions. LGMD itself comprises various forms that vary in age of onset, severity, and mode of inheritance. Mutations in different genes can cause different types of LGMD. To date, at least 15 different genes have been identified as causative of the LGMD and are working on locating others. Because, there are many genes for this group of disorders, mutation screening of all these genes is difficult and costly. Materials and methods: So, we isolated DNA according to standard phenol-chloroform methods. Then, genome-wide SNP genotyping was carried out on DNA samples of 5 individuals of an Iranian LGMD family using HumanCNV370-Quadv3_C BeadChips and the iScan reader. Subsequently, homozygous regions common to affected individuals with a minimum physical length of 1 Mb were sought. Candidate genes in linked regions are amplified by PCR and subsequently sequenced. Results: Disease status in the family linked to two homozygous regions on chromosomes 2 and 10. The regions were not homozygous in any of the unaffected individuals. The dysferlin (DYSF) gene associated with LGMD type 2B laid within the linked region on chromosomes 2. This gene is a large gene and has 55 exons. So, it is first candidate gene and now being screened for mutations using PCR. If, we could not find any mutation in DYSF, other linked genes need to be screened. Conclusion: The specific function of dysferlin protein is not well understood. It is believed to be involved in repairing damage to muscle cells and the maturation of new muscle fibers (regeneration). Interestingly, mutations in the gene have since been identified to cause another form of muscular dystrophy called Myoshi myopathy. It is anticipated that different changes in the identical gene may lead to different forms of muscular dystrophy. Keywords : Homozygosity mapping, muscular dystrophy limb girdle, dysferlin
81

Targeting of the signal transducer Smo links microRNA-326 to the oncogenic Hedgehog pathway in drug resistant CD34+ CML stem/progenitor cells
Sadegh Babashah* Majid Sadeghizadeh Masoud Soleimani Sahar Babashah *: sadegh.babashah@gmail.com Tarbiat Modares University Tarbiat Modares University Tarbiat Modares University Islamic Azad University of Pharmaceutical Sciences
Introduction : Aberrant expression and function of microRNAs in leukemia have added a new layer of complexity to the understanding of development and progression of the disease state. However, their targeting of specific signaling pathways responsible for the maintenance and survival properties of leukemic stem cell (LSC) still remains to be further clarified. Hedgehog signaling, a highly conserved developmental pathway, has been proven as a functional pathway for LSCs, and loss of this pathway impairs the development of BCR-ABL-induced chronic myeloid leukemia (CML) and depletes CML stem cells. It seems that microRNA targeting of this pathway could be of benefit for eradicating CD34+ CML stem cells that represent a potential source of relapse in patients suffering CML . Materials and methods : CD34+ CML cells were isolated by using MACS immunomagnetic separation system from bone marrow of CML patients in blast crisis phase and subsequently transduced with recombinant lentiviruses expressing microRNA-326 at a MOI of approximately 10. For rescue experiments, the Smo expression plasmid pcDNA3-Smo lacking the miR-326 binding site was used. For luciferase reporter assay, wild-type or mutated 3UTR sequences of Smo were individually cloned into pMIR-REPORT vector. Expression levels of target genes were evaluated by real-time PCR and western blot analysis. Induction of apoptosis was measured by flowcytometry . Results : Here, we revealed that upregulation of the Hedgehog Smo signal transducer was associated with reduced expression of miR-326 in the CD34+ cells from a group of patients with CML at diagnosis. Additionally, overexpression of miR-326 led to downregulation of Smo, resulted in decreased cell proliferation and elevated rate of apoptosis in CML CD34+ cells. Interestingly, restoration of Smo expression levels reversed the effect of miR-326 and rescued K562 cells from the antiproliferative effects of this miRNA. Thus, Smo appears to be an essential target of miR-326 during the pathogenesis of CML . Conclusion : These findings lead us to suggest that downregulation of miR-326 may be a possible mechanism for unrestricted activation of Smo signal transducer of the oncogenic Hedgehog pathway in CML; therefore, the restoration of miR-326 expression could be of benefit in eradicating CD34+ CML stem/progenitor cells that represent a potential source of relapse in patients suffering CML . Keywords : CML stem cells, Hedgehog pathway, Apoptosis, MicroRNA-326, Recombinant lentiviruses
82

MS.c Student of Animal Genetics and Breeding, Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran Ph.D Student of Animal Genetics and Breeding, Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran MS.c Student of Animal Genetics and Breeding, Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran MS.c Student of Animal Genetics and Breeding, Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran MS.c Student of Microbial Biotechnology,Faculty of Science, Ferdowsi University of Mashhad, Mashhad, Iran
*Hossein Barzegar
Morteza Mahdavi
Hamid Goli
Maryam Moshiry
Hadi Sardarabadi
*hosseinbarzegar66@gmail.com
: . . : . - . . ) Site directed mutagenesis (SDM . . DNA shuffling errorprone PCR . . display technology Phage display Ribosomal display : mRNA display Bacterial display Yeast display Yeast display - . . . . . . : 83

The suitable purification method for investigation on Alpha-synuclein involved in Parkinson disease
Jafar Fallahi Dina Morshedi* Farhang Aliakbari * morshedi@nigeb.ac.ir
National Institute Biotechnology National Institute Biotechnology National Institute Biotechnology
of of of
Genetic Engineering Genetic Engineering Genetic Engineering
and and and
Abstract: In neurodegenerative diseases such as Alzheimer and Parkinson diseases, specific peptides and proteins aggregate to abnormal and amyloidal fibrils which form widely in the brain. Nowadays it is believed that these structures are toxic and play a key role in such diseases and there are a lot of attend are carried out to inhibit such aggregation world wide. Despite wide study which has been done on aggregation, many aspects of this process are still unknown. One of the most important methods to study such diseases and their treatment is investigation of the protein which involved in aggregation in vitro, the study of proteins that are produced as recombinant. After expression the recombinant proteins purified with different methods such as ultrafilteration, precipitation by ammonium soulphat and chromatography columns. Therefore, the purification is a process that has reduces efficiency, time consuming and extensive. Alpha synuclein express in brain dopaminergic cells, which is a monomeric and with different factors out of normally phase and exchange aggregates that called Lowy body that is sign Parkinson disease. Material and method: research on amyloid inhibition and cytotoxicity effects is very important. In this work for study fibrillation activity and cytotoxicity of alpha synuclein protein, first it express in BL21 than purified with a simple and very efficient method. Then the specific metal ions were added to the protein extracts then by the temperature and ions chelating coagulated very proteins of bacterial that precipitated by centrifuge and alpha synuclein remind in supernatant that purified to 75%. In the final stage of several chemicals solvent used that the best result was for isopropanol(20%v/v) that was suitable for ThT, AFM and CD tests. Conclusion: In addition alpha synuclin purified to 90% also removed DNA and RNA contaminations that effect on fibrillation. The advantages of this method are low cost, easy and high speed in purification with high efficiency.
84

MicroRNA Profiling as a New Approachfor Early Detection of Breast Cancer
Sadaf Farsinejad Department of Life Science Engineering, Faculty of New Science and Technology, University of Tehran, Tehran Department of Life Science Engineering, Faculty of New Science and Technology, University of Tehran, Tehran
Mahdi Rahaie*
:* mrahaie@ut.ac.ir
Abstract: Cancer (known medically as a malignantneoplasm) is a broad group of various diseases, all
involving unregulated cell growth. Generally, cancer is responsible for about 13% of all human deaths all around the world. Considering the fact that the disease prediagnosis may influence the type and duration of treatment and the patient's survival, therefore early detection of the disease and Population-wide screening is of utmost importance. Detection of specific biomarkers can inform the patient at early stages of the cancer and make it easier to control the disease. These biomarkers can also indicate disease progress or therapeutic effects of drugs. These biomarkers include different molecules such as specific mRNAs, transcription factors, cell surface receptors, enzyme and proteins and recently miRNAs molecules. Cancer biomarkers can be used for precise evaluation and management of different stages of disease and more importantly, with the advent of new therapeutic agents, suitable markers can be used to determine which tumor responds to which treatment.Here we discuss miRNAs involving in breast cancer which is proved to be up or downregulated in related specimens and weaddress briefly the regulatory mechanism of miRNA, the expression of miRNAs in tumor genesis/suppression and their potential useas biomarkers for early diagnosis andprognosis of breast cancer. In addition, we discuss and compare use of the FormalinFixed, Paraffin-Embedded (FFPE(tissue as a source for miRNA discoverywith the circulating miRNAs in blood for early breast cancer detection. we provide a perspective forthe potential use of miRNAs in breast cancer management in the near future, particularly inimproving the early diagnosis, prognosis and treatment. Keywords: Breast Cancer, Early Detection, miRNA, Biomarker
85

Investigating the different combinations of five monoclonal antibodies in ELISA development to detect 26kDa antigen of H. Pylori
Hossein Ghahremani Hossein Amini Najafabadi Shohre Farshad Maliheh Paknejad* *: Paknejadma@tums.ac.ir Tehran university of medical sciences Tehran university of medical sciences Alborzi Clinical Microbiology Research Center, Namazi Hospital, Shiraz Tehran university of medical sciences
Introduction : Helicobacter pylori that play a main role at incidence of peptic ulcers, gastric cancer, and a number of diseases in inner and outer of gastrointestinal tract infect more than 80% of population of developing country, therefore design and local validation of laboratory methods to diagnosis of H. Pylori infection has a significant importance. The aim of this study was to investigate the combination of produced monoclonal antibodies (MAbs) in ELISA development to detection of 26kDa antigen of H. pylori . Materials and methods : Five produced MAbs secretory hybridomas were revived, cultivated and their MAbs were purified and conjugated to biotin. Whole cell extract of H. Pylori was used as antigen and different combinations of purified MAbs as capture with biotin conjugated forms of them as label for design of the sandwich ELISA to detect 26kDa antigen of H. Pylori were investigated and the best one was chosen . Results : The best combination between five MAbs (A-hel26 A, A-hel26 B, A-hel26 C, A-hel26 D, and A-hel26 E) and their biotinylated forms (A-hel26 A, A-hel26 B, A-hel26 C, A-hel26 D, and A-hel26 E(, was A-hel26 E as capture antibody and A-hel26 E as conjugated one. . Conclusion : The findings indicate that the novel sandwich ELISA developed based on A-hel26 E and biotinylated A-hel26 A-hel26 Emonoclonal antibody to detect stool antigen would be useful as a noninvasive method of diagnosing H. pylori infection in stool samples . Keywords : 26kDa antigen, H. pylori., MAbs, Sandwich ELISA
86

Inhibition of survivin restores the sensitivity of breast cancer cells to docetaxel and vinblastine
Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences Proteomics laboratory, Department of Clinical Biochemistry, Faculty of Medicine Tabriz University of Medical Sciences Research Centre for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences
Parisa Ghanbari
Nasser Samadi*
Maryam Tabasinezhad
Mahsa Mohseni
Bahman Usefi Mohammad Reza Rashidi *: drnsamadi@yahoo.com
Introduction : Chemotherapy is the most common approach for treatment of breast cancer, the second cause of death in women worldwide. Combination therapy is considered a viable strategy to overcome the resistance to chemotherapeutic agents. Survivin as a member of inhibitor of apoptosis protein (IAP) family is involved in resistance to various drugs. Thus, inhibition of survivin is likely to sensitize cancer cells to chemotherapeutics. In this study, we investigated the role of survivin in resistance of MDA-MB-231 breast cancer cells to docetaxel, vinblastine and their combinations. Then, an inhibitor of survivin was used to enhance the sensitivity of cells to chemotherapies . Materials and methods : MTT assay was used to study the anti-proliferative activity of the agents. The rate of apoptosis was assessed using DAPI staining. Survivin expression was investigated by Realtime PCR and confirmed by Western blot . Results : Our findings showed an IC50 of 70 nM and 8 M for docetaxel and vinblastine after 48 h, respectively. In 48 h, DAPI staining showed about 14-20% and 35-62% apoptotic cells upon treatment with 5-100 nM docetaxel and 5-50 M of vinblastine, respectively. Survivin mRNA was upregulated by approximately 6 and 9-fold in the cells treated with 50 nM and 10 M of docetaxel and vinblastine, respectively (P<0.05). .) Conclusion : Combination therapy leads to significant down-regulation of survivin. Furthermore combination therapy with Deguelin, a survivin inhibitor exerted a considerable enhancement in efficacy of docetaxel and vinblastine. Survivin down-regulation may thus be considered as a potential strategy to increase the efficacy of chemotherapeutics in cancer patients . Keywords : Chemoresistance, deguelin, docetaxel, MDA-MB-231, vinblastine 87

Approaches to detect matrix metalloproteinases (MMPs) as disease biomarkers
Zohre Gheisary Department of Life Science Engineering, Faculty of New Science and Technology, University of Tehran, Tehran Department of Life Science Engineering, Faculty of New Science and Technology, University of Tehran, Tehran
,Mahdi Rahaie
*:mrahaie@ut.ac.ir
Abstracts: Extracellular matrix (ECM) macromolecules are important for creating the cellular environments required during development and morphogenesis. Extracellular enzymes play a crucial role in the interaction between cells and their environment. Matrix metalloproteinases (MMPs), collectively called matrixins,are a family of secreted and membrane bound zinc-dependent proteolytic enzymes that participate in ECM degradation.Their targets include otherproteinases, proteinase inhibitors, clotting factors, chemotactic molecules, latent growth factors, growth factor binding proteins, cell surface receptors, cell-cell adhesion molecules, and virtually all structural extracellular matrix proteinssuch as collagen and proteoglycans ..Under normal physiological conditions, the activities of MMPs are precisely regulated at the level of transcription, activation of the precursor zymogens, interaction with specific ECM components, and inhibition by endogenous inhibitors.MMPs comprise a large family of extracellular enzymesthat share common structural features, particularly thoseregions involved in the regulation of proteolytic activity. On the basis of substrate specificity and homology,MMPs can be divided into 6 groups: collagenases, gelatinases, stromelysins, matrilysins, membrane-type MMPs (MT-MMPs), and other MMPs. These proteinases play a central role in many biological processes, such as embryogenesis, normal tissue remodeling, wound healing, and angiogenesis, and a loss of activity control may result in diseases such as atheroma, arthritis, cancer, and tissue ulceration. MMPs are good potential diagnostic indicators of the disease, this review will discuss about different MMPs detection methods and their advantages and disadvantages. Most of the data on the expression profiles of proteins and molecules in various diseases have been obtained through enzyme immunoassay and mass spectrometry. Using these methods to MMPs detection is very complicated and is not sensitive enough for detection individual proteins. Thus analitycal tools such as ELIZA, zymography and optical tools include FRET, near-IR )infrared( optical imaging, uorescence, and surface plasmon resonance spectroscopy, the use of active-site probes followed by enzymatic digestion of the captured MMPs, and LC-MS/MS analysis of the digested MMPs need to be developed. Keywords:MMP , disease , zymography, mass spectrometry, ELIZA, FRET
88

mRNA and microRNA Transferring by Microvesicles
Fatemeh Hamidi Department of Biotechnology, College of Science, University of Tehran
Azade hadadianpoor Department of Biotechnology, College of Science, University of Tehran Behnaz bakhshandeh* Department of Biotechnology, College of Science, University of Tehran
*: bb_behnaz@yahoo.com
Abstract : Micro RNA (miRNA) are small non-coding RNAs with 19-24 nucleotide long that mostly are transferred by microvesicles (MVs) because of providing an envelope for degraded repression by RNAases. MVs are fragments of plasma membrane ranging from 50 nm to 1000 nm present in various biological fluids and their function and composition are based on their source cells. Cells can communicate with each other by secreting microvesicles containing miRNAs. For example, highly expressed miRNAs in MVs secreted by mesenchymal stem cells take apart in multiorgan development, cell survival, cell differentiation and immune system regulation. These miRNAs, can change gene expression in target cells and play an important role in many cancers. Their function depends on their destination to work as a tumor suppressor gene or oncogenesis ones. Therefore, paracrine signaling through miRNA-containing MVs function essentially in modulation of cell fates. miRNAs present in MVs have various roles in viral infections, cell migration, inflammations, metabolic disease, nervous signaling, cardiovascular disease and immune responses. One of their most remarkable roles is application of MVs containing tumor suppressor miRNAs in tumor bearing patients. In addition, recent studies have showed that each type of cancer has its own pattern for carrying miRNAs by MVs. Based on these information, we can find specific signature for cancer patients that may be helpful for diagnostic or prognostic purpose. According to these fundamental impacts of miRNAs in humans life, they can be used vastly in medical biotechnology.
. : , , RNA RNA , . . . . , , , . , . .
Keywords: microvesicles, microRNA, cancer therapy, development, cell signaling
89
EGFR expressing tumor model establishment to evaluate the efficacy of mimotope vaccine
Seyed-Mojtaba Hazavee Davoud Ahmadvand Masoud Javanmardi *: da@farma.ku.dk
*
University of Iran School of Allied Medical Sciences, Tehran University of Medical Sciences TMU
Introduction : Introduction: cancer prevention and treatment is one of the main challenges in the field of medical sciences. Whereas prevention is more important than treatment; today many different strategies has been developed to design cancer vaccine. One of the most promising approaches is mimotope induced immune responce strategy; in which peptide mimotope is used instead of whole protein. On the other hand, since phage particles are highly immunogenic; within cancer research have been widely used for the vaccination against tumors. The peptide mimotope displayed on the surface of phages can strongly induce immune response against tumor. EGFR (Epidermal Growth Factor Receptor) is a remarkable target in the field of cancer research since its overexpression has been reported in many cancer types. Additionally LL/2 cell line is widely used to establish and study the EGFR positive tumor model . Materials and methods : Methods: We constructed recombinant M13 nanophage particles displaying tandem triplet repeat of EGFR- peptide mimotope. The mimotope coding gene was cloned into the phagemid vector. TG1 strain of E.Coli was transformed by triplet tandem mimotope gene containing phagemid vector. Recombinant nanophage particles displaying peptide mimotope were amplified, purified and tittered. To study the effect of phage-mimotope vaccine in animal tumor model, LL/2 cells were injected subcutaneously to C57 mice(1 million cell/mice). After tumor establishment, phage vaccine was injected and tumor volume was monitored by digital caliper over a period of 30 days . Results : Results: phage particles containing EGFR mimotope was constructed successfully. The specic antibody against the phage-peptide was induced in the immunized mice compared with that the control group. Tumor progress was restricted in the test group compared to control group . Conclusion : Conclusion: recombinant phage-mimotope vaccine displaying tandem repeat of EGFR mimotope maybe a promising approach to cure cancer . Keywords : EGFR, mimotope, phage particle
90

Genotype Analysis of CCR5-59353-C/T Using PCR Allele Specific Amplification in Iranian normal population
Asieh Hosseini* Zohreh Sharifi
Department of Genetics, Ahar branch, Islamic Azad university, Ahar, Iran Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine, Tehran, Iran Department of Genetics & biotechnology, Varamin-Pishva branch, Islamic Azad University, Varamin, Iran
Fahimeh Baghbani_Arani
*: hosseini2013@yahoo.com Introduction : Chemokines and chemokine receptors control immune cells migration (such as monocytes, macrophages and immature dendritic cells) during infections. The CCR5 chemokine receptor is expressed on several cells of the immune system and is the most important coreceptor during natural infection to HIV. Recent data suggest that certain polymorphisms of CCR5 gene promoter prevent of HIV transmission and delay disease progression. Hence, this study aimed to investigate genotypes CCR5-59353 in Iranian normal population . Materials and methods : A total of 100 Iranian healthy blood donors (61 males 39 females; mean age 36 1.82 years( without any known history of infections were selected for this study. Genomic DNA was extracted from blood buffy coat layer using the salting out method. Positive sample controls of known CCR5 genotypes were used to set-up PCR tests. The single nucleotide polymorphism (SNP) in regulatory region of CCR5 gene (at position 59353 C/T) was tested using sequence specific primers by polymerase chain reaction allele- specific amplification (PCR-ASA) method. The genotypes were subjected to statistical analysis by Chi-square test . Results : In all individuals that were randomly selected, CCR5-59353 genotypes were distributed as follows: 5% (CC), 91% (CT), and 4% (TT). There were no significant difference between mutant CC and TT with heterozygous genotypes in tested population . Conclusion : The results indicate that CCR5-59353 (CC and TT) mutant homozygous genotypes exists in Iranian individuals at a low frequency, but these studies on more number of samples from other regions country must be performed . Keywords : Chemokine receptor; CCR5; Polymorphism
91

Recombinant Omp19 combined with detoxified LPS Elicited Protective Immunity against Brucella melitensis infection in BALB/c Mice
Maryam Sadat Hosseiny* Islamic Azad University-Karaj branch Nima Khoramabadi Haniyeh Aghababa Amir Bakhtiari Majid Sohrabi
*: maryamhosseiny19@yahoo.com
Islamic Azad University-Karaj branch Tarbiat Modares University Islamic Azad University-Karaj branch Tarbiat Modares University
Introduction : Elimination of Brucella melitensis from infected host depends on cellular-type immune responses. Major antigens of the pathogen are lipopolysaccharide and cell surface proteins. An immunodominant protein antigen of the Brucella is Omp19, an outer membrane lipoprotein. Outer polysaccharide portions of Brucella LPS are the most important antigens but they are T-cell independent. Combination of polysaccharide antigens with proteins may result to T-cell responses. Here we aimed the survey of protective response to combination of B. melitensis detoxified lipopolysaccharide (d-LPS) and recombinant Omp19 (rOmp19) in BALB/c mice . Materials and methods : Omp19 was cloned in pET28a(+) system and produced in E. coli BL21 (rOmp19pET28). Female BALB/c mice aged Six to eight weeks were immunized with a combination of 20g of rOmp19pET28 and 10g of d-LPS formulated in Freunds adjuvant subcutaneously. Mice received two booster doses with 14 days of interval. Non-immune mice received PBS subcutaneously. Control mice received a single dose of B. melitensis Rev-1 (106 CFU) intraperitoneally. Cytokine responses including IL-4, IL-12 and IFN- were evaluated in spleen lymphocyte cultures from mice which were performed one week after the last booster. One month after the last immunization, mice were from the same groups were challenged with 105 CFU of B. melitensis 16M intraperitoneally. Two weeks later mice were sacrificed and recovery of Brucella from spleen suspension was assessed by culture. . Results : Mice received the combined antigen developed a strong cytokine response to the polysaccharide portion of LPS as it was compared with that of mice immunized just with d-LPS. Protective immune response elicited by rOmp19 combined with d-LPS was 2.03 log unit of protection; it was lower than 5.12, conferred by Rev1 . Conclusion : Combination of rOmp19 with d-LPS of Brucella melitensis elicits protective immune responses in mice. Although the responses were by far, lower than those elicited by Rev1, our results suggest that this combination is an efficient candidate for further vaccine investigations . Keywords : Brucellosis, Brucella melitensis, Omp19, detoxified lipopolysaccharide
92

Linkage of a locus for autosomal recessive familial spastic paraplegia to chromosome 8q24
Elham Jaberi Farzad Sina University of Tehran Department of Neurology, Tehran University of Medical Sciences
Gholamali Shahidi Department of Neurology, Tehran University of Medical Sciences Elahe Elahi* elham_j1981@yahoo.com *: College of Science, University of Tehran
Introduction : Hereditary spastic paraplegia (HSP) is characterized by insidiously progressive lowerextremity weakness and spasticity. HSP is classified as "uncomplicated" or "pure" if neurologic impairment is limited to progressive lower-extremity spastic weakness, hypertonic urinary bladder disturbance, mild diminution of lower-extremity vibration sensation and, occasionally, joint position sensation. HSP being a group of genetic disorders, they follow general inheritance rules and can be inherited in an autosomal dominant, autosomal recessive or x-linked recessive manner. The mode of inheritance involved has a direct impact on the chances of inheriting the disorder. This neuronal degeneration is thought to be caused by mutations at specific genes. Genetic mapping has identified at least 52 different HSP loci, designated SPG (Spastic Paraplegia) 1 through 52. We studied An Iranian family with autosomal recessive HSP with three affected and 4 unaffected siblings of two consangeous parents . Materials and methods : The authors investigated 3 affected and 6 healthy individuals from a consangeous Iranian family with recessive HSP. Clinical, neurophysiologic, and neuroradiologic studies were undertaken. Genetic linkage analyses were carried out with polymorphic DNA markers. The candidate gene within the linked region was sequenced in order to verify the observation . Results : Homozygousity mapping showed linkage to 8q24. As a result the first candidate gene for screening was SPG8 also known as KIAA0196 because this gene is located in the linked region and is one of HSP related genes. The KIAA019 contains 29 exons. Precise screenings of all 29 exons of the gene with their boundaries were carried out using sequencing but all patients were negative for SPG8 mutations . Conclusion : In conclusion, these data confirm the presence of another SPG gene on chromosome 8q24 related to autosomal recessive HSP . Keywords : Hereditary Spastic Paraplegia, Spastic Paraplegia, Homozygousity mapping, linkage analyses, polymorphic DNA markers
93

Comparing specific genes expression in differentiated and undifferentiated cells derived BMSCs during BMP-4 and 4mT SMF treatments
Fatemeh Javani Jouni Tarbiat Modares University Parviz Abdolmaleki* Tarbiat Modares University
Mansoureh Movahedin Tarbiat Modares University Mehrdad Behmanesh Tarbiat Modares University
*: parviz@modares.ac.ir Introduction : Bone morphogenetic protein (BMP)-4 has a crucial role on Primodial Germ cells (PGCs) development in vivo which can promote stem cell differentiation to PG-like cells. Also, static magnetic field (SMF) can effect on the rate of differentiation of bone marrow stem cells to rat primordial germ cells. In this study, we investigate the profiling of specific gene expression performed on Bone Mesenchymal Stem Cells (BMSCs) induced to differentiate by BMP-4 and SMF to identify genes which change in expression correlates with up regulation of germ cell genes. This method could leads to a possible cell based therapy for infertility treatment and avoiding tumorogenic effects of BMSCs. Materials and methods : Passage4 rat BMSCs were characterized by CD90, CD29, CD11b and CD45 markers and osteo-adipogenic differentiation. The cells were simultaneously treated BMP4 and 4mT SMF (24 and 48h). Expression of Fragilis and Mvh genes were analyzed by qPCR in BMSCs derived PGCs. Results : CD90+, CD29+, CD11b- and CD45- BMSCs were able to differentiate to osteo-adipogenic lineages. QPCR results indicated that there was significant up regulation )p0.05( in expression of Mvh and Fragilis with BMSCs. Conclusion : The outcomes of this study showed that treatment with BMP4 and 4mT SMF had a positive effect on early germ cell induction and caused up regulation in some of specific genes expression in BMSCs derived Keywords : Primordial germ cells; BMP4; Static Magnetic Field, Bone marrow stem cell
94

Generation of a pLEX-lamp-darpins chimeric lentiviral vector for expression of DARPins in exosomes surface for breast cancer gene therapy
Shabanali khodashenas limoni Mehdi foruozande moghadam* seyed Mohammad Moazzeni
*: foroz@modares.ac.ir
tarbiat modares university tarbiat modares university tarbiat modares university
Introduction : For cancer drug targeting, efficient, specific and no immunogenic carrier must be developed . Exosome nanoparticles are small (30 to 100 nm) membrane-bound particles that are released from normal, diseased, and neoplastic cells and are present in biological fluids. Exosomes contain a variety of molecules including signal peptides, mRNA, microRNA, and lipids. Exosomes function is export these molecules to recipient cell. Today exosome is the best choice for cancer drug targeting .expression of ligand in surface of nanocarier was done for targeting .For exosome drug targeting ,Lysosomal associated membrane protein, lamp,which express in exosome membrane is the best choice for anchor of peptides which can attach to specific receptor on surface of desired target cells. Human epidermal growth factor receptor 2(Her2) overexpress in breast cancer, can be targeted by specific ligand such as DARPins (designed ankyrin repeat proteins). we design a lentiviral vector, carries a chimeric gene that express lamp2-darpins in exosome membrane for attecment to her2 in surface of cancer cells . Materials and methods : We extract RNA from mouse skeletal muscle ,CDNA was produced by RTPCR using random hexamer. Lamp2b CDNA generated by specific primer .two restriction site was introduced between signal sequence and mature protein sequence, by using SOEing PCR technique and four primers. then this fragment was inserted to plex-msc lentiviral vector. this construct was cloned in stbl4 strain of E.coli by electroporation. Darpins gene was design from its protein sequence and optimized for expression in mouse cells and synthesized ,then inserted to plex lamp therefore chimeric vector plex-lamp- darnins was made.this constract cloned to E.coli and positive clone confirmed by clony PCR . Results : Lamp2b cDNA electrophoresis showed 1248bp fragment.after insertion of lamp2 in plex vector and electroporation ,positive clone from clony PCR selected , cultured, and which purified plasmid was Sequenced and blasted in ncbi data bank .insertion of darpins in plex-lamp was confirmed by electrophoresis and sequencing . Conclusion : We make a lentiviral vector ,contain plex-lamp chimeric gene that over express in mouse cells control by CMV promoter . Keywords : her2+ breast canser ,darpins ,lamp2b,lentiviral vector
95

In vitro anti HIV-1 testing of (2, 3-diaryl-1, 3-thiazolidin-4-one) derivatives against HIV-1
Mohammad-Shafee Mayar shafi.mayar@yahoo.com NARI
Introduction : Reverse Transcriptase (RT) is the prime target for the development of drugs for HIV/AIDS therapy. Drugs that inhibit this enzyme are divided in to two classes: nucleoside reverse transcriptase inhibitors (NRTI) and non-nucleoside reverse transcriptase inhibitor (NNRTI). NNRTI is a group of drug that induces allosteric changes in HIV-1 RT, thus rendering the enzyme inactive. However, the long term usage of NNRTIs in HIV/AIDS patients leads to the development of virus drug resistance. Therefore it is essential to look for novel NNRTIs with potent anti HIV-1 activity . Materials and methods : In this study, we tested 75 compounds (2, 3-diaryl-1, 3-thiazolidin-4-one derivatives) for assessing its anti HIV-1 activity. To define the cytotoxic concentrations (CC50) of compounds MTT assay were performed, followed by Luciferase-based Assay to determine the inhibitory concentration (IC50 .) Results : Eventually, we showed that four compounds found to have less cytotoxicity and potent anti HIV-1 activity . Conclusion : Then the activity of the compounds pursued in Neverapine Resistance HIV-1 strains and found that they have convenient activity against Neverapine resistance HIV-1 starins . Keywords : Thiozolidin compounds,Anti HIV-1 Activity, Neverapine Resistance HIV-1.
96

The response of human breast cancer cells to the non-thermal atmospheric pressure plasma
Shahriar Mirpour* Hamid Reza Ghomi Somaye Pirouzmand Laser and plasma institute of Shahid Beheshti university Laser and plasma institute of Shahid Beheshti university Department of Nanobiotechnology, Faculty of Biological Sciences, Tarbiat Modares University Department of Nanobiotechnology, Faculty of Biological Sciences, Tarbiat Modares University
Maryam Nikkhah
*: s.mirpour@yahoo.com
Introduction : Plasma is known as ionized medium which contains electron, ion and neutral species. The plasma can be generated in atmospheric pressure with non-thermal characterization. Recently, this type of plasma is evolved in many biomedical applications such as microbiology, dermatology and cell science. The aim of this study is to evaluate the effect of non-thermal atmospheric pressure plasma jet on human breast cancer cells Materials and methods : The MCF-7 cancer cell line were used as the target cells for the treatment. The prepared samples were exposed to plasma during 30, 60, 120 and 300 seconds and the viability of the cells is determined by MTT assay. In addition, to determine the efficacy of the plasma treatment to other traditional cancer therapy techniques, the results were compared with group of cells which treated by Doxorubicin as a common chemotherapy drug Results : The results showed that the plasma affects the cancer cells dramatically and reduces the viability of the cells. It can be obtained from the results the Non-thermal atmospheric pressure jet treatment successfully enhanced the reduction of the breast cancer cells viability more than the cells treated by chemotherapy drug . Conclusion : This study will be important for clinical use of non-thermal plasma for treatment of breast cancer in future Keywords : non-thermal atmospheric pressure plasma, human breast cancer cell, treatment
97

Vahideh miri MahammadGhasem Golmohammadi Asadollah Asadi Mohsen Sagha mohaghegh ardabili Ardabil University of Medical Sciences mohaghegh ardabili Ardabil University of Medical Sciences
*:vahidehmiri90@yahoo.com
: . CNS . CNS . . : . EGF bFGF .
: . : :
98

The role of p-glycoprotein in resistance of lung cancer
Department of Medical Biotechnology, Faculty of Advanced Medical Science, Tabriz University of Medical Sciences, Tabriz, Iran Department of Medical Biotechnology, Faculty of Advanced Medical Science, Tabriz University of Medical Sciences, Tabriz, Iran Department of Biochemistry and Clinical Laboratories, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran Department of Medical Biotechnology, Faculty of Advanced Medical Science, Tabriz University of Medical Sciences, Tabriz, Iran Department of Medical Biotechnology, Faculty of Advanced Medical Science, Tabriz University of Medical Sciences, Tabriz, Iran Research center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz, Iran *:drnsamadi@yahoo.com
Mahsa Mohseni
Nasser Samadi*
Bahman Yousefi
Parisa Ghanbari
Maryam Tabasinezhad
Hossein Nazemiyeh
Introduction : Introduction: Lung cancer is one of the most common carcinomas and is the leading cause of cancer death in both males and females. Among treatment strategies chemotherapy plays a very important role in the treatment of patients. However, cancer cells are able to become concurrently resistant to various drugs, a trait known as multi-drug resistance (MDR) that reduce the efficacy of chemotherapy. MDR-1 is a gene which encodes a 170-kDa P-glycoprotein, a transmembrane ATP-dependent drug efflux pump. Over expression of these pumps produce a major mechanism for resistance of cancer cells against the chemotherapy. To overcome the high prevalence of MDR, ABC transporter inhibitors including verapamil have been developed to increase the intracellular concentration of chemotherapeutic drugs. In this study, we investigated the alteration in the efficacy of docetaxel in induction of apoptosis when it is combined with docetaxel. We also studied the role of P-glycoprotein in chemo-resistance of lung cancer cell line, H1299, against docetaxel alone and in combination with vinblastine when it is inhibited by verapamil . Materials and methods : MTT assay was used to measure proliferation of the cells. The rate of apoptosis was assessed using DAPI staining. P-glycoprotein gene expression was investigated in two different levels, gene level by Real-time PCR and protein level by Western blot analysis both after single and combination therapy . Results : Applying Vinblastine showed an IC50 of 30 nM after 48 h incubation in non-small lung carcinoma, H1299 cell line. Viability of cells decreased from 50% with Docetaxel alone to 8% in
99

combination of Docetaxel and Vinblastine. Combination therapy of Vinblastine and Docetaxel also showed a marked decrease in MDR-1 gene expression (p < 0.05 .) Conclusion : Our results showed a significant increase in the efficacy of vinblastine in induction of apoptosis when it is combined with docetaxel. We also showed the critical role of MDR-1 expression in alteration of the resistance to the chemotherapeutic agents. Our findings predict that identifying the tumors with high levels of MDR-1 expression and then inhibiting this activity could provide an important adjuvant for improving the efficacy of combined therapy of vinblastine and docetaxel in treatment of cancer patients . Keywords : Chemotherapy, Multi-drug resistance (MDR), Verapamil, Vinblastine, Docetaxel
100

Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP Technique
fateme Mortazavi* university of Tehran
Ghassem Amoabediny university of Tehran Faramarz Mehrnejad university of Tehran Ali Hossein Rezayan Morteza Hosseini *:fatimamortazavi@gmail.com university of Tehran university of Tehran
Introduction : Ankylosing spondylitis is a form of ongoing joint inflammation disease (chronic inflammatory arthritis) that primarily affects the spine. This condition is characterized by back pain and stiffness. Over time, back movement gradually becomes limited as the bones of the vertebrae fuse together. The earliest symptoms of ankylosing spondylitis result from inflammation of the joints between the ilia and the sacrum. In the most advanced cases, this inflammation can lead to new bone formation on the spine, causing the spine to fuse in a fixed, immobile position, sometimes creating a forward-stooped. There is substantial evidence strongly favoring a direct role for HLA-B27 gene in genetic susceptibility to Ankylosing spondylitis (AS).HLA-B27 is a serologic specificity that encompasses 25 different alleles that encode 23 different proteins: HLA-B*2701 to HLA-B*2723 . Materials and methods : These alleles are also called subtypes of HLA-B27 with a considerable geographic and ethnic difference in distribution. These subtypes are distinguished from changes mostly in exons 2 and 3, which encode the alpha 1 and alpha 2 domains of the B27 molecule. The sequences of these subtypes HLA-B*2701, HLA-B*2702, HLA-B-2704, HLA-B27052,HLA-B-2706, HLAB*2707, HLA-B*2712 got from The National Center for Biotechnology Information advances science and health. In silico AFLP analysis was performed on coding sequences by CLC Genomics Workbench 5.1 software . Results : Digestion of sequences was done via BglII, PstI, KpnI restriction enzymes and the profile of restricted fragments was constructed. Also phylogenetic tree constructed by the Maximum Likelihood method and the Neighbor join in algorithm. Profile showed that the smallest fragment had 16bp in HLA-B*2712 allele and the largest fragment observed in HLA-B*2707 allele. Also Phylogenetic tree constructed by the Maximum Likelihood method and the Neighbor join in algorithm, grouped all studied species into 3 clusters . Conclusion : The HLA-B*2701 and HLA-B*2712 was shown more similarity to each other and grouped in one cluster. The second cluster involve The HLA-B*2705 and HLA-B*2707 which have high similarity and grouped in second cluster .
101

Keywords : Ankylosing spondylitis, HLA-B27 various alleles, in silico AFLP (amplified fragment length polymorphism)
102

-2
Elham mousavi Parichehr Yaghmaei Science and Research Branch,Islamic Azad University Biochemistry Department,Science and Research Branch,Islamic Azad University,Tehran,Iran Mediconal Chemistry Department,Islamic Azad University of Pharmaceutical Sciences,Tehran,Iran physiology and Pharmacology Department,Pasteur Institute of Iran,Tehran,from
Ali Almasi rad
*Mona Salimi *:salimi_mona@yahoo.com
: 5 3 . . . . . . . " -2 " . : : 100-0.1 . . : . : :
103

Enzybiotics and their applications in medicine
Samaneh Naderi* Massoud Saidijam Hamedan university of medical science, Faculty of medicine Hamedan university of medical science, Faculty of medicine
*: samaneh.naderi86@gmail.com
Introduction: Over the last decade,a dramatic increase in the prevalence of antibiotic resistance in several medically signicant bacterial species has been seen.This unfavorable situation is further aggravated by a shortage of new classes of antibiotics with novel modes of action that are essential to inhibit the spread of antibiotic-resistant pathogens,in fact,some infectious disease experts have expressed concerns that we are returning to the pre-antibiotic era!Therefore,there is an urgent need to develop novel antibacterial agents to eliminate multidrug-resistant bacteria, a very interesting class of novel antibacterials are enzybiotics.These antibacterial agents have important characteristics like:Novel mode of antibacterial action,different from those typical of antibiotics,capacity to kill antibiotic-resistant bacteria,and the low probability of developing bacterial resistance.They divide in three main groups:Bacteriophages (lysins),bacteria themselves (bacteriocins and autolysins),lysozymes, including hen egg white lysozyme and human lysozyme.Lysins or endolysins are double-stranded DNA bacteriophageencoded enzymes which cleave covalent bonds in peptidoglycan and are naturally produced in phage-infected bacterial cells during the course of lytic cycle.A unique medi cal application of lysins may be the specic elimination of pathogenic bacterial species(e.g., S. aureus )colonizing mucous membranes without adversely affecting normal microora.Such bacteria can,in some clinical settings,be a starting point for infections.Lysins appear to be better decolonizing agents than antibiotics owing to their speciesspecic and rapid antibacterial activity,capacity for killing antibiotic-resistant bacteria, and lower risk of developing resistance.Another class of lytic enzymes that are encoded by bacteria,are autolysins and bacteriocins involved in different essential processes of bacterial cells,including:cell growth and division,cell wall turnover,bacterial protein secretion, peptidoglycan maturation. Conclusion: Enzybiotics constitute highly effective antibacterial agents and the most important features of enzybiotics are their novel mode of action and the capability to kill antibiotic - resistant bacteria, also for some lytic enzymes, the risk of developing resistance is relatively lower than for traditional antibiotics. It is of importance to know that the potential medical applications of enzybiotics include different forms of prophylaxis and treatment of bacterial infections. Keywords: Enzybiotics, antibiotic resistance, signicant bacterial species, novelty
104

*Fatemeh alsadat Nezam kheirabadi Asqar Abdoli Hamidreza Rahmatollahi Peyvand Biglari Maryam saleh Ali Torabi Masoumeh Tavasoti kheiri Seyed Masoud Hosseini Abbas Jamali *:fs.nezam@yahoo.com : . NP . . : 6-7 BALB/c 3 ( .)PBS 2 RST NP .. 2 . H1N1/PR8 2 . : NP . : . . . : DNA Shahid beheshti university / Pasteur institute pasteur institute pasteur institute Pasteure institute Pasteur institute pasteur institute Pasteur institute shahid beheshti university pasteur institute
Adapting SyberGold and Loop-mediated Isothermal Amplification for Rapid Molecular Detection of Human Influenza Virus
Hassan Nikbakht *Pooria Gill Golestan University of Medical Sciences Golestan University of Medical Sciences
105

Alijan Tabarraei Alireza Niazi** Sareh Zhand*** * pooriagill@yahoo.com ** niaz.alireza@gmail.com *** sa_zh2006@yahoo.com Golestan University of Medical Sciences Golestan University of Medical Sciences Golestan University of Medical Sciences
Abstract:Introduction: Influenza A viruses are important viral pathogens in health morbidity and mortality all over the world. Global epidemics of influenza have repeatedly occurred and in addition to the significant financial burden, many people have died due it. Because of the highly contagious nature of influenza A viruses, the disease could be spread rapidly. Rapid identification of the virus is therefore critical for the control of influenza. Several molecular technologies have been introduced for diagnosis of human influenza virus that the most of them are PCR-based diagnostics. Here, we introduced an isothermal technology that the amplification process has been minimized significantly for rapid molecular detection of this virus. Materials and methods: Viral RNA was converted to cDNA using reverse transcription in 40 minutes via one-step kit. Bst DNA polymerase, betain, and targeting bumper and internal-loop primers for Mgene sequence were employed in the reaction at 65 C within 60 minutes. SyberGold fluorescent probe was added to the reaction in test microtube for identifying cauliflower-like amplicons from the virus cDNA. Results: Repetitive cauliflower-like DNAs with ladder-shaped behavior were characterized in agarose gel electrophoregram after staining with SyberGold. The main product was also detected via SyberGold interaction in test microtube, when exposed on UV irradiation with an emitted light. This modification reduced the test time to one hour. Conclusion: Loop-mediated isothermal amplification adapted with SyberGold probe decreased the time needed for molecular detection of the human influenza virus cDNA nearly 4-time faster than that in the conventional PCR reactions. It seems utilizing this assay can be applied for rapid diagnostics of other microorganisms, too. Keywords: Loop-mediated amplification, SyberGold, Human influenza virus
MicroRNA mediated knockdown of STAT3 reduces breast cancer stem cells viability
106

Sara Noorani Tarbiat Modares University *: sara.noorani@modares.ac.ir
Introduction : Breast cancer is the most frequent malignancy among women worldwide. Breast tumors consist of cell populations which are heterogeneous and differ by their relative states of differentiation. Only small portion of tumor cells, the cancer stem cell (CSC), are able to form secondary tumor. Cancer stem cells are functionally and structurally distinct from the other cells within a tumor mass. In human breast cancer, a population of cells with CD24 /low /CD44 +/ESA+ phenotype are highly enriched for cancer-initiating cells. Cancer therapeutics in current use decrease tumor size, but since cancer stem cells are insensitive to chemotherapy and radiation treatment, these treatments are unlikely to result in long-term remission unless the CSCs are also targeted. A member of the signal transducer and activator of transcription family, Stat3, has the potential to mediate cell survival, growth and differentiation. In more than 50% of breast cancers STAT3 is constitutively activated. Since STAT3 target genes regulate many cellular processes such as proliferation and apoptosis, the constitutively activated Stat3 promotes cell proliferation and inhibits apoptosis. As a result it plays an important role in breast cancer development, progression and tumorigenesis . Materials and methods : Our study was designed to investigate the potential use of RNA interference to block Stat3 expression and activation, as well as the subsequent effect on human breast cancer stem cell growth and viability. Since MDA-MB231 is enriched in breast cancer stem cell we use this cell line as the source of cancer stem cell . Results : Our findings show that knockdown of STAT3 expression by designed microRNA reduced cell proliferation and growth. The MTT test results showed about 50% decrease in cell viability in MDAMB 231 cell line treated with STAT3 microRNA . Conclusion : STAT3 activation is required for stem cell self-renewal and maintenance of cancer stem cell proliferation and its inhibition reduce these cell population . Category : Poster Keywords : microRNA, CSC, STAT3, Cell viability
107

2- " "
Shaghayegh norouzi Saeid Ayerian Mohamad Nabiuni Mona Salimi *: salimi_mona@yahoo.com department of cellular and mulecular biology, kharazmi university department of cellular and molecular biology, kharazmi university department of cellular and molecular biology, kharazmi university physiology and pharmacology, pasteur institue of iran, tehran, iran
: . . . . 2- . . 2- . : " " . 106 / 6 16 . %12 . 4 1 . : : . . : 2-
108
Recombinant TraQ of Brucella melitensis Elicited Potent IFN- and IL-12 Response in BALB/c Mice
Parsa Parsian
*
Islamic Azad University-Karaj branch Islamic Azad University-Karaj branch Tarbiat Modares University Semnan University of Medical Sciences Tarbiat Modares University Islamic Azad University-Karaj branch Islamic Azad University-Karaj branch
Nima Khoramabadi Haniyeh Aghababa Shiva Mirkalantari Majid Sohrabi Arman Zakerzadeh Fatemeh Makvand Agharahimi *: p.parsian@ymail.com
Introduction : The word wide prevalent zoonotic disease, brucellosis is still challenging to researchers. Seeking for new vaccines which are efficient enough to prevent the disease and lacking adverse effects of conventional attenuated vaccine strains, enforces the investigation of immunogenic components. Major antigen of smooth Brucellae is LPS but other components of outer membrane of the cell participate in developing immune responses against the pathogen. Cellmediated immune responses are the effective one for elimination of the intracellular pathogens. Our aims were to produce recombinant TraQ of Brucella melitensis in E. coli host and evaluation of cytokine responses in mouse model. Materials and methods : Brucella melitensis TraQ was cloned in pET28a(+) and expressed in E. coli BL21 host. Recombinant TraQ (rTraQpET28) was purified by Ni-NTA affinity chromatography. 10g of purified rTraQpET28 formulated in Freunds adjuvant was administered to BALB/c mice subcutaneously. Mice received a total of three doses with 12 days of interval. One week after the last booster mice were sacrificed and spleen lymphocytes were cultured; they were subsequently stimulated with rTraQpET28. Productions of IL-4, IL-12 and IFN- in stimulated cultures were evaluated by ELISA. Results : Levels of IL-4, IL-12 and IFN- were significantly high in mice which were immunized with rTraQpET28. Ratio of IFN-/IL-4 showed a cell-mediated response profile to rTraQpET28. Conclusion : rTraQpET28 of Brucella melitensis elicited a significant level of IFN- and IL-12 which are important cytokines in host response to infection with this pathogen. IFN-/IL-4 ratio also showed a preferred immune response. Based on these results, it can be suggested that our recombinant protein, rTraQpET28, is a suitable antigen for further vaccine investigations. 109
110

Tri-block copolymer: An efficient membrane sealant recovers sever spinal cord injury
Laboratory of membrane Biophysics and Macromolecules, Institute of Biochemistry and Biophysics, University of Tehran, Tehran, Iran Department of Resin and Additives, Institute for Color Science and Technology, Tehran, Iran, Biomaterials Research Centre (BRC), University of Tehran, Tehran, Iran Laboratory of membrane Biophysics and Macromolecules, Institute of Biochemistry and Biophysics, University of Tehran, Tehran, Iran, Biomaterials Research Centre (BRC), University of Tehran, Tehran, Ir
Iman Rad
Farhood Najafi
Hamid Mobasheri
*: imanrad@ut.ac.ir
Introduction : In-vivo application of tri-block copolymer after secondary stage of spinal cord injury (SCI) re-established integrity, rapid recovery of nerve impulse conduction in neurons mediating the long tract reflexes. Rupture of neuronal membranes following spinal cord injury, causes Ca2+ influx into cells in primary stage. Consequent biological events including inflammation, necrosis, release of free radicals and apoptosis are considered as secondary stage of injury. Membrane injuries lead to biochemical arrest and necrosis. Assembly of membrane is maintained by weak forces such as Van der Waals, hydrogen bonding and hydrophobic interactions. There are continuous nano-pore formation occurring in membranes with lifetime of about nanoseconds while, mechanical injury cause permanent disruptions . Materials and methods : Surfactants or water-soluble tri-block copolymers such as poloxamers and poloxamines are known as efficient membrane sealant. They are formed of a hydrophobic core and two hydrophilic chains made of poly(ethylene glycol)-block-poly(propylene glycol)-blockpoly(ethylene glycol) chemically uncharged structure represented as (EO)x(PO)y(EO)x. These molecules mediate reintegration of disrupted membranes by keeping the water molecules away and reorganise disoriented lipid molecules forming insulations at the vicinity of cell cytoskeleton. Concentrations of tri-block copolymer prepared at higher than CMC level, are prone to be applied on injured spinal cord to find the most effective dose of administered polymerosome . Results : In this study a novel amphiphilic biodegradable tri-block copolymer made of PEG and poly (fumaric acid-co-sebacoyl chloride) (PEG-co-P(FA/SC)-co-PEG) was used to reinforce reassembly of membrane following intentional severe spinal cord injury (SCI) formed in rat. Therapeutic ability of copolymer was tested on isolated spinal cord in double sucrose gap chamber (ex-vivo condition) using spinal cord evoked potential (SCEP) and spectrometric lactate dehydrogenase (LDH) release assay techniques. The amplitude of SCEP peaks significantly declined and LDH release significantly increased following mechanical injury (p-value of 0.0013 and 0.0341, respectively). Treatment with 0.5 mg/ml (w/v) of uniformly miscellaneous tri-block polymersomes rapidly recovered the damage, sealed the interrupted membrane and re-established nerve conductivity in spinal cord .
111

Conclusion : The novel copolymer used in this study only interacted with the disrupted areas of neural membrane and can be considered as an efficient membrane repairing agent applicable in SCI . Keywords : membrane sealant, tri-block copolymers, polymersomes, spinal cord injury (SCI), spinal cord evoked potential (SCEP) and lactate dehydrogenase (LDH) release assay.
112

The cytotoxic effects of the organophosphates chlorpyrifos on human lymphoid cells in vitro
Mahban Rahimifard Fatemeh Riyahi-Asl Hanieh Karimi Mona Navaei-Nigjeh Mohammad Abdollahi* Faculty of Pharmacy, and Pharmaceutical Sciences Research Centre, Tehran University of Medical Sciences Farzanegan 1st high school, Tehran, Iran Farzanegan 1st high school, Tehran, Iran Faculty of Pharmacy, and Pharmaceutical Sciences Research Centre, Tehran University of Medical Sciences Faculty of Pharmacy, and Pharmaceutical Sciences Research Centre, Tehran University of Medical Sciences
*: mahban.rahimifard@gmail.com
Introduction : Organophosphate pesticides have the highest usage among different types of insecticide and they are the most harmful kinds. Therefore, in this present study, the toxic effects of chlorpyrifos on human lymphoid cells were evaluated . Materials and methods : Lymphoid cells were isolated from peripheral blood by using ficoll method and then lymphocytes were counted and divided into several tubes containing 7x105 cells in each. Logarithmic doses of chlorpyrifos (from 2 nM to 20 mM) were added to lymphocytes separately and incubated for 48 hours and then viability of cells was determined by using MTT methods . Results : By increase concentrations of chlorpyrifos, a reduction in viability of isolated cells were observed significantly and the LC50 study was done to determine the toxicity of chlorpyrifos on human lymphoid cells and a 48h LC50 of 5mM was found . Conclusion : Results suggest that pesticides can decrease viability of blood cells and increase oxidative stress in them even in low concentration . Keywords : chlorpyrifos, human lymphoid cells, oxidative stress
113

Induction of cardiac differentiation through overexpression of microRNA-1 in human-induced pluripotent stem cells
Mahsa Rasekhi Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran Nanobiotechnology research center, Baqiyatallah University of Medical Sciences, Tehran, Iran genetic department,faculty of biology,tarbiat modares university,tehran,iran Department of Hematology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
Ali Salimi
Majid Sadeghizadeh Masoud Soleimani*
*: soleim_m@modares.ac.ir
Introduction : Although there has been substantial progress regarding the cardiac diseases therapy, worldwide the leading cause of morbidity is cardiovascular disease. Cell therapy is a very active and innovative area of cardiovascular research. In general, human embryonic stem cells )hESCs) have the capacity to self renew and to differentiate to specialized cell-types with multiple clinical therapeutic applications but the two most important issues associated with them are immune rejection and medical ethics. In recent years, induced pluripotent stem cells (iPSCs) were generated from somatic cells, these cells are similar to ESCs in some features but they are capable to overcome hurdles associated with ESCs. MicroRNAs are known as key regulators in embryonic cell development, cellfate decisions from pluripotent ESCs and are becoming increasingly recognized as important regulators of heart function so they can be used for induction of IPSCs to cardiomyocyes . Materials and methods : In this study, at first the gene of related microRNA cloned in lentiviral vector. This vector was used for production of virus by packaging cell line 293t. Then, ips cells infected with viruses expressing the miRNA1-2 and the amount of expression assessed by real time RT-PCR analysis. This study shows that miR1-2 can promote differentiation of IPSCs into cardiac lineage . Results : The real time RT-PCR analysis showed the up regulation of cardiac markers including Flk1, Gata4, aMHC, cTnT. The results confirmed that the over expression of microRNA1-2 induced the differentiation of iPSCs . Conclusion : Our studies on the transducted iPSCs suggest their potential for cardiac tissue engineering and biomedical applications. This method could be used as a therapeutic strategy for cardiac patients . Keywords : induced pluripotent stem cells (iPSCs) microRNA
114

Diagnosis of Breast cancer with saliva samples: A review
Fatemeh Soleymani Talented Unit, Medical Education Development Center, Mashhad University of Medical scineces
soleymanif891@gmail.com
Introduction : Nowadays, breast cancer is one of the most common cancers in the world and death causes of women in our country. Approximately, 1 woman in every 10 will develop breast cancer in her lifetime. However, early detection can reduce its mortality rate. One of the markers that can be use for breast cancer detection is c-erbB-2, which was recognized in breast tumors biopsies in the past. But, now, we know this oncogene produce a special protein that can be detected in sera and saliva. Nowadays, saliva as an easily accessible fluid of our body, which can be sampled with non-invasive methods is considered for diagnosis of diseases (specially cancers) and following responses to treatment . Materials and methods : Previous studies showed, there is a basal amount of c-erbB-2 in womens saliva. Streckfus pointed that this amount in patients with breast cancer is significantly higher than healthy people or patients with benign tumors. Lenora also indicated that cerbB-2 protein expression in saliva can be a very useful diagnostic tool for measuring patient response to chemotherapy and/or surgical treatment of their disease . Results : . The remarkable point about c-erbb-2 is that the amount of it is not dependent to Tobacco usage, menopausal status, estrogen usage, systemic diseases, prescription medication, race or age. So, it can be used in different people . Conclusion : According to this review, the role of dentist who can get samples from saliva of high risk group in routine dental management is indicated . Keywords : Breast cancer , c-erbB-2, saliva
115

RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy
Farzaneh Sadeghi Mohammad KhalajKondori *:khalaj@tabrizu.ac.ir Tabriz university Tabriz university
Introduction : Therapeutics based on RNA interference (RNAi) hold great promise for managing cancer and treating it. RNAi is the process of suppressing the expression of a protein by using double stranded RNA (dsRNA). It appears to be a valuable tool to tackle the growing problems in cancer related diseases as it can inhibit the production of over-expressed genes . Materials and methods : we survey the literature that have been published to date and touch on the most recent developments of the subject . Results : The Fusion oncogenes have been attributed to causing the pathogenicity of several types of cancer and create the challenge to target them therapeutically. Growing resistance to current treatments calls for the development of improved therapy. Thus, an alternative is the use of RNA interference (RNAi) as a gene therapy model. Here, we discuss recent developments using RNAi to target the fusion oncoprotein in the prevalent cancers, such as prostate cancer, acute promyelocytic leukemia (APL), acute lymphoblastic leukemia (ALL) and Chronic Myeloid Leukemia (CML). Furthermore, we indicate how the targeting siRNAs were both potent and highly specific and significantly inhibited tumor growth . Conclusion : SiRNA has been demonstrated to result in efficient knockdown of gene expression targeting the breakpoint of fusion oncogenes. Delivery of specific siRNA may represent a promising treatment strategy for drug-resistant patients. Keywords : SiRNA, fusion oncogene, cancer therapy
116

CagA EPIYA-C
Somaye sarrami* Mohagheghe Ardabili Saeid latifi_navid Mohagheghe Ardabili Saber Zahri MohagheArdabili
Parichehr Maleki Mohagheardabili *:somayesarrami@yahoo.com
: . CagA CagA . : : 180 . DNA cagA cagA PCR +CagA ' 3 PCR . Multiple Linear logistic regression . : 180 121 +CagA CagA PCR 76, EPIYA/-A/-B/-C14/8 EPIYA/-A/-B/-C/-C 4/1 EPIYA/-A/-B1/6 EPIYA/-A/-B/-C/-C/-C CagA (. (P> 0.05 : CagA . CagA : ,
117

Cyclin D1 expression in brain tissue of a murine model of alzheimers disease
Maryam shabani Amir Afkhami Goli *:shabani.vet@gmail.com ferdowsi university ferdowsi university
Introduction : In recent years, limited epidemiological studies have indicated that cancer survivors have a decreased risk of Alzheimers disease and that people with Alzheimers disease have lower rates of cancer. Herein, we aimed to describe the probable molecular mechanism of this interaction using a murine model of AD. Alzheimers disease )AD( is a progressive and fatal senile neurodegenerative disorder, characterized by irreversible cognitive decline, memory impairment and behavioral changes. These clinical features are accompanied by specific pathological features in the brain. Cyclin D1 is one of the main cell cycle regulator proteins which its gene amplification was characterized in several malignancies. Materials and methods : Total RNAs from brain tissues were analyzed, about the quantity of samples using nanodrop. The quality of samples also were analyzed, using electrophoresis on agaros 2%. The quantity of cDNA were measured, after reverse transcriptation. In order to evaluate the spatial learning, after fibrillar -amilloid implantation in CA1 region of mice hippocampus , the morris water maze test were performed 7 days after surgery for the 4 consecutive days. Results : Stereotactic implantation of fibrillar -amyloid peptide )A( into the CA1 region of hippocampus caused a marked decline in learning abilities of mice as revealed by an increase in Morris Water Maze latency time, performed 7 days post-surgery for another 4 consecutive days. Total RNA extraction followed by conventional and real-time RT-PCR has revealed a marked downregulation of cyclin D1 expression level compared to control littermates. Conclusion : This emphasizes a new feasible mechanism of interaction between AD and cancer occurrence and might suggest new pharmaceutical research approaches implying the pathological phenomenon occurring due AD pathogenesis to better control the cancerous conditions. Category : Either Oral OR Poste Keywords : Alzheimer Disease, Cancer, Cyclin D1, Cell cycle
118

*Farzaneh shahabi Asadollah Asadi Saber Zahri *:shahabi_farzaneh@yahoo.com mohaghegh ardebili mohaghegh ardebili mohaghegh ardebili
: . . : 73 CO2 %5 DMEM (FBS) %11 . 42 7 12 . ( ) 3,5,10Mm 42 . : . : . . :
119

Cloning and Molecular Characterization of an Immunogenic LipL41 Protein of Leptospira interrogans Serovar Icterohaemorrhagia
maryam sadat soltani* pejvak khaki Soheila Moradibidhendi mohamadhassan shahhosseini Reza pilechian langrodi *:m.soltani62@yahoo.com Introduction : Leptospirosis is widespread zoonosis that impact on the animals and human health. The disease caused by Leptospira spp. LipL41 is the immunodominant antigen recognized during the humoral immune response to leptospirosis.The cloned gene could be further used for expression of recombinant protein for serodiagnosis.The LipL41 protein could be a useful diagnostic tool for the detection of leptospirosis .The aim of this study was Cloning and Molecular Characterization of an Immunogenic LipL41 Protein of Leptospira interrogans Serovar Icterohaemorrhagiae . Materials and methods : Leptospira interrogans serovar L.icterohaemorrhagiae (RTCC2812), was used in this study which obtained from the microbial culture collection of Leptospira Reference Laboratory, Department of Microbiology, Razi Vaccine and Serum Research Institute, Karaj, Iran. The bacteria were inoculated into selective culture medium EMJH.The specific primers for proliferation of lipl41 gene were designed. The specificity and sensitivities of PCR was evaluated. PCR products of pathogenic serovar Icterohaemorrhagiae was ligated in pTZ57R/T vector and transformed in competent E.coli Top10 cells.The extracted recombinant plasmid was sequenced. Homological analysis was performed by BLAST and phylogenetic analysis against the lipl41 nucleotide sequence database on the GenBank was done with Neighbor-Joining (NJ) optimality criteria of MEGA4 software and MegAlign program . Results : PCR amplification of the lipl41gene using the designed primers resulted in an 1065bp ligB gene product. The sequence was deposited in the GenBank database.The percentage identity and divergence among different leptospiral serovars was deduced using the Blast programme.DNA sequence analysis revealed that serovar Icterohaemorrhagiae (RTCC2812), was most closely related to Leptospira interrogans, serovar Icterohaemorrhagiae (GQ502197))in GenBank with (99.4%).The serovars Icterohaemorrhagiae (DQ132992)was more distantly related (98% .) Conclusion : The results showed that the lipl41 gene was highly conserved among pathogenic Leptospira serovars (>90% idenditity). In conclusion, the protein expressed by lipl41 gene may be used in diagnostic methods like ELISA and also can be a good candidate for recombinant vaccine against leptospirosis . Keywords : leptospirosis,lipl41,cloning, Icterohaemorrhagiae Science and Research Branch,Islamic Azad university,Tehran,Iran Razi Vaccine & Serum Research Institute,karaj,iran Razi Vaccine & Serum Research Institute,karaj,iran Science and Research Branch,Islamic Azad university,Tehran,Iran Razi Vaccine & Serum Research Institute,karaj,iran
120

Detection of Borna Disease Virus p24 RNA in peripheral blood cells of obese patients in Iran
Rozhan Sonboli Fatemeh Roodbari Mojtaba Mohseni Mazandaran University Mazandaran University Mazandaran University
m.mohseni@umz.ac
Introduction : Worldwide prevalence of obesity trends the attention toward the multiple etiologies of it, one of the most overlooked factor is infectious microbes, and among them viruses are the most noticeable.BDV is a nonsegmented, single-stranded RNA virus, causes sporadic neurological disease usually in horses and sheep as its natural hosts .theses animals develop a persistent infection of the CNS with viral antigen expression in all brain regions and disseminated nonpurulent meningoencephalitis. although BDV is considered as a nonhuman virus, recently Serological and molecular evidences investigate possible association of BDV, with specific psychiatric diseases in humans .But the point that we choosed it as a etiology of obesity is that BDV was identified as a causes of rapid increase of body weight with development of an obesity syndrome without obvious neurological signs in Experimental intracerebrally infected Lewis rats, this overweighting followed by increase in serum cholesterol and triglycerides in Lewis rat .in this study we investigated the prevalence of virus used human obese subjects to discuss the possibility of adiposity promoting potential of BDV in human . Materials and methods : The conserved p24 RNA of BDV has been investigated in the peripheral blood of a number of obese patients in contrast with a number of normal people as control group from a laboratory in IRAN (Babolsar). The volunteer patients were selected and classified by their BMI in kg/m2 into these groups, overweight, obese (class I, II, III) .also we measured their triglyceride and cholesterol .The presence of p24 RNA transcript of virus was detected by nested RT PCR analysis and electrophoresis . Results : In this study, BDV RNA was identified in the PBMC of some of these obese patients with meaningful and higher prevalence in contract with normal people. by nested RT-PCR. Consequently we found a significant longitudinal association of positive virus RNA status with weight gain and plasma Cholesterol and triglyceride increase in human Conclusion : these studies illustrate that the adiposity-promoting effect of BDV occurs in Human being . Keywords : Bornea disease virus, Obesity, Obesity syndrome. Nested Nested RT PCR
121

Designing specific ARMS tetra-primers of C/T polymorphism in promoter region of F8 gene
Zahra soroush* Sadegh vallian burojeni z.soroosh@yahoo.com university of isfahan university of isfahan
Introduction : Hemophilia A is an X-linked, recessive, bleeding disorder caused by heterogenous mutation in the factor VIII gene .At present the NCBI database contains more than 1400 different SNPs for the factor VIII gene but most of these polymorphisms lack frequency and population characteristics so detection of genotyping and frequency of these SNP markers by ARMS-PCR is useful. Tetra-primer ARMS-PCR is a rapid, low cost and simple method for SNP genotyping, it employs two primer pairs to amplifies, the two different alleles of the SNP in a single PCR reaction. Other method for snp genotyping is RFLP-PCR based on enzymatic digestion. In this study, we use bioinformatic tools and oligo software for designing specific Tetra- primers for C/T SNP (Rs28370188)in promoter of F8 gene. this primers are used for genotyping of this SNP in iranian population . Materials and methods: For rs28370188, we designed inner forward and inner reverse allele specific primers with the 3 base of each primer matching one of the SNP allele bases.Also, an extra mismatch was designed at the third nucleotide of the 3 terminus for increasing sensitivity of ARMS PCR. 2 outer primers designed that producing a nonallele-specific control amplicon. Oligo7 software used for primer designing. Primers were designed to have a Tm 58 60C and a length ranging from 23-26 bp. Blast analysis was appropriate for the specificity of primers designed. . Results : The 2 allele specific amplicons have different lengths and can be easily separated by gel electrophoresis. Multiplex T-ARMS PCR was set up and result of gel electrophoresis was according to our expect . Conclusion : Multiplex T-ARMS PCR for genotyping is a simple and accurate method that requires only a single PCR reaction and it does not require post-PCR treatment or expensive instrumentation, but RLFP requires restrction endonuclease digestion of pcr product . Keywords : hemophilia A ,FVIII, ARMS-PCR, C/T SNP polymorphism
122

Effect and mechanism of Sphingosin 1-Phosphate in malignant behavior of lymphocytic leukemia and non-smallcell lung cancer cells
Maryam Tabasinezhad Pastur
tabasinezhad.m@gmail.com Introduction : chronic lymphocytic leukemia is one of the most common leukemia especially in elderly people with a high prevalence of resistance to chemotherapeutics. Lung cancer is also the first leading cause of death related to cancer in both males and females. Sphingosine 1-phosphate (S1P), a bioactive lipid molecule regulates cell growth and survival through G-protein couple receptors (GPCRs) which are named S1P1-S1P5 receptors. Deregulation of production or degradation of this molecule involves in tumor progressions, metastasis and chemoresistance. Pertussis toxin (PTX) is capable to inhibit main S1P receptors. Aim of this study was to investigate the impact of S1P on malignant behavior of SKW3 leukemia cells and H1299 non-small-cell lung cancer cells. We also studied the role of survivin, a key protein in cell survival, in signaling mechanism of S1P in induction of tumorgenesis . Materials and methods : The effects of S1P on proliferation, invasion and migration of tumor cells were assessed with MTT assay, soft-agar colony forming assay and trans-well migration assay respectively. We also investigated the role of S1P on the expression of survivin in both gene and protein levels through Real-time PCR and western-blotting . Results : our findings revealed that very low concentrations of S1P enhance cell proliferation and migration of the cells in both cell lines in a PTX-dependent manner. S1P also enabled to increase colony formation in H1299 cells but not in SKW3 cells through S1P receptors. We also showed the effects of S1P in inducing proliferation, migration and colony formation of tumor cells are S1P receptor-dependent and survivin has a role in S1P tumorogenic functions . Conclusion : Our results confirm the key role of S1P in malignant behavior of cancer cells through S1P receptors in survivin signaling manner. Importance of S1P in cell survival and tumor malignancy make this molecule as a target to design novel anticancer drugs in future . Keywords : S1P, proliferation, invasion, survivin, migration
123

Spermicidal activity of Arum maculatum L. on human sperm
Samane Tavakoli* Ali Deljou Iraj Amiri Marzieh Ghorbani bu ali sina university hamedan bu ali sina university hamedan medical university advisor
* alideljou@yahoo.com Abstract: Objective: To evaluate the spermicidal activity of Arum maculatum L. on human spermatozoa. Materials and Methods: Different doses(2.5, 5, 10, 20, 40, 80, 160 mg|ml) of hydroetanolic extract of Arum maculatum L. were added to an amount of fresh semen, containing 50106 cells in a 1:1 volumic ratio. Motility and viability of cells and sperm revival tests were carried out. Results: The sperm immobilization effects of the extract appeared immediately in a does-dependent manner and 100% of the sperms became immotile at a concentration of 160 mg/ml and higher .After washing the sperms, motility of the sperms were not returned.The tail coiling of treated cells were not observed. Conclusion: These results may open the way for the use of Arum maculatum L. as a spermicidal product.
124

Investigation of genes expression in differentiated cells derived BMSCs during BMP-4 treatments with FTIR
Jaber zafari Fatemeh javani jouni Rezvan Zendehdel* Malihe Soodi Parviz Abdolmaleki Tarbiat modares university Tarbiat modares university Shahid beheshti university Tarbiat modares university Tarbiat modares university
*: zendehdel76@yahoo.com Introduction : Bone marrow is the flexible tissue found in the interior of bones that can differentiate to every cell. Monitoring of the stem cell differentiation needs careful and complex laboratory methods. We propose an FTIR method to monitor gene expression in the differentiation of bone marrow stem cells . Materials and methods : : Bone marrow stem cells (BMSCs) extracted of some rat were passaged in MEM medium containing 20% fetal bovine serum )FBS( and 25 ng/ml BMP4. BMSCs were differentiating to Primordial Germ cells (PGCs) by Bone Morphogenic Protein (BMP). Differentiation of stem cells was assessed in three steps where FT-IR spectroscopy of cells was performed to the cells after 24, 48, 72 and 96 hours of differentiation induction. Expression of Oct-4 and Mvh genes were analyzed by (quantitative real time polymerase chain reaction) QPCR in BMSCs and BMSCs derived PGCs . Results : The FTIR normalized spectrum of BMSCS cells in stepwise differentiation showed alterations in different spectral areas. Results showed the variation in the protein amide bands and nucleic acid region indifferent step of differentiation. Also, QPCR results indicated that there was significant up regulation )p0.05( in expression of Mvh with BMSCs. A significant down regulation (p Conclusion : FTIR spectrum of stem cell could be highlighted the changes of cellular nucleic acids and proteins in differentiation step to step.The results showed, FTIR spectroscopy forwarded to PLS models, is a suitable tool for evaluating the expression of different genes in stem cell differentiation Keywords : bone marrow stem cell, FTIR spectroscopy, primordial germ cell, QPCR
125

rs16141 NPY
*Mina Zafarpiran Mehrdad Behmanesh Mohammada Ali Broumand
*: olduz_mz@yahoo.com
Tarbiat modares university Tarbiat modares university Tehran university of medical science
: - . . . NYP NPY . ... . Y ... . : 200 200 DNA rs16141 SNP HRM . : ( )p0.05 rs16141 . NPY :
126

Pluripotency features in adipose tissue-derived stem cells
Zahra zamanzadeh national institut of genetic and biotechnology
za.zamanzadeh90@yahoo.com
Introduction : Adipose tissue contains a population of stem cells that can be easily harvested from the patients by a simple, minimally invasive method, and they can be easily cultured. Previous studies have confirmed a strong phenotypic resemblance between Adipose tissue-derived stem cells (ADSCs) and bone marrow mesenchymal stem cells (BM-MSCs). Also, some investigators have demonstrated that BM-MSCs and ADSCs express various genes shared by embryonic stem cells, such as Oct4, UTF-1 and Nodal . Materials and methods : In the present study, we evaluated the expression of pluripotency markers in the freshly isolated and cultured ADSCs. For this purpose, human ADSCs were isolated from adipose tissue obtained by abdominal reduction surgery. The expression of OCT4 and Sox2 proteins in the primary cultures of the ADSCs was also detected by immunocytochemistry . Results : Freshly isolated stromal vascular fraction (SVF) cells and cultured ADSCs expressed mesenchymal stem cell markers, CD73, CD90 and CD105. SVF cells and primary cultures of the ADSCs expressed OCT4A, Nanog, Sox2, Klf4 and c-Myc mRNAs. During sequential passages the expression of pluripotency markers disappeared. This implies that some degrees of differentiation can occur during sequential passages of the ADSCs . Conclusion : In conclusion, these findings show that human adipose tissue contains a population of stem cells with molecular resemblance to embryonic stem cells . Keywords : Adipose tissue, stem cell, OCT4
127
3rd International Student Biotechnology Congress Agricultural Biotechnology

Agrobacterium rhizogenes Mediated Induction of Recombinant Tobacco Hairy Roots Expressing the Chimeric stxB-ctxB Gene
Asal Akhavian Tehrani Roohallah Kazemi Mahyat Jafari Amani Jafar Amir Mousavi Ali Hatef Salmanian* * salman@nigeb.ac.ir National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology Applied Microbiology Research Center, Baqiyatallah Medical Science University National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology
Introduction: Sporadic or epidemic diarrheal diseases remain as a major global health problem for human and domestic animals. Among the causative agents, the toxin producing enteric bacteria play a major role in these diseases. Among these toxins, cholera toxin )ctx( produced by Vibrio cholerae causative agent of watery diarrhea and shiga toxin )stx( produced by entrohemorrhagic E.coli )EHEC( that can lead to bloody and non-bloody diarrhea, hemorrhagic colitis and hemolytic-uremic syndrome )HUS( are referred as severe components that cause enteric infections in the population of developing countries. These toxins belong to AB5 family in which the B subunit, as a nontoxic homopentamer, is responsible for toxin binding to host cells surface and facilitating the entrance of enzymatic part of the toxin. Previous studies indicated that immunity to B subunit could protect cells against the holotoxin. Therefore, B subunit, because of its nontoxicity, repetitive structure and exposure, could be a good component of a candidate vaccine. Successful oral administration of B subunits suggested that they could participate in edible vaccines and stimulate the immune system against these bacteria. To produce recombinant immunogenes as an edible vaccine candidate for animal models, plants hairy roots are attractive bioreactors. Here we induced tobacco transgenic hairy roots using Agrobacterium rhizogenes in order to produce the chimeric protein StxB-CtxB. Material and methods: The chimeric fragment, composed of stxB and ctxB genes which were attached together by a DNA linker, was subcloned in pBI121, a binary vector for Agrobacterium. The recombinant construct was transformed into A. rhizogenes strain 15834 using freeze-thaw method. The sterile tobacco leaves, from seedling grown in vitro, were wounded and co-cultivated with the recombinant bacteria. Cocultivation )25C, 3 days( was performed with kanamycin selection )the binary vector carries the nptII gene under the control of the nos promoter) in MS solid media. Explants were decontaminated by washing in liquid medium in presence of antibiotics (cefotaxim 300 mgL-1). After appearance of hairy roots, different root lines were transferred into separate new MS media containing antibiotics for selection (cefotaxim 300 mgL-1 and Kanamycin 50 mgL-1). After three times subcultures )21 days( the root lines were transferred into broth media with shaking )25C and 140rpm agitation). Presence of the chimeric stxB-ctxB gene and transformation of the hairy roots were confirmed through molecular analyses (PCR) on the extracted genomic DNA by using specific sets of primers for the chimeric gene and rolB gene of Ri-plasmid of A. rhizogenes respectively. Results: Transgenic roots grew well in selective media with high efficiency. The desired bands, rolB gene from 128

A. rhizogenes and stxB-ctxB, were amplified with PCR and analyzed by Agarose gel electrophoresis that certified the transformation of the roots. Conclusion: Hairy roots are perfect bioreactors to produce recombinant protein. Since they can also be used as feed for livestock, they have the potential to produce immunogenes and be used as an edible vaccine, especially against diarrheal diseases Keywords: Tobacco hairy root, StxB, CtxB, Edible immunogen
129

Ali Alizade Tilaki *Mostafa Matlabi Mohammad Reza Zamani Zahra Moghadasi Jahromi Esmat Jourabchi National institute of genetic engineering and biotechnology National institute of genetic engineering and biotechnology National institute of genetic engineering and biotechnology National institute of genetic engineering and biotechnology National institute of genetic engineering and biotechnology
*motalebi@nigeb.ac.ir
: . . Pathogenesis Related . . . DNA : Nicotiana tabacum CTAB . ap24N-F ap24N-R BpiI XhoI NCBI . PCR . pJET1.2 . Sambrook Russell . DNA Macrogen . : DNA PCR . DNA ( 621 ) . pJET1.2 . PCR . . 24 45 200 . pJAA-1 . . : . :
130

) (Iris spp. ISSR
Zeinab Atari Mahmoud Shor Mahmoud Ghorbanzade Saeed Malek shafarodi *z_65_attari@yahoo.com Ferdowsi university of Mashhad Ferdowsi university of Mashhad Ferdowsi university of Mashhad Zade Ferdowsi university of Mashhad
: . . . ISSR I.loczyi I.spuria I.kopetdaghensis I.songarica I.fosteriana . 16 5 (GA)8C (CT)8RG HVH(TCC)5 (TG)8G (AC)8yG . I.songarica I.fosteriana . . : ISSR
131

Iris
Zeinab Atari Mahmoud Shor Ferdowsi university of Mashhad Ferdowsi university of Mashhad *z_65_attari@yahoo.com
: Iris 300 . Iris . 5 4-5 . 10 . . . Iris . . . :
132

Plantlet regeneration from hairy root cultures of Atropa belladonna Hamadan sp
Fereshte Bagheri Khosro Piri* * khpiri@gmail.com bu ali sina university bu ali sina university
Abstract: Pieces of leaves,shoots and roots of Atropa Belladonna were infected with wild- type strain,AR 15834, of Agrobacterium rhizogenesis. After (1-2 weeks) the inoculation, adventitious roots and/or adventitious buds appeared on the inoculated sites.when hairy roots was caltured in 1 /2MS medium under certain dark condition, plants regenerated on the hairy roots,callus. Spontaneous plantlet regeneration was observed in hairy root culture after 4-5 sub-culturing passages in 1 /2 MS medium.Hairy root tissues and regenerated plant material contained Ri-T-DNA. transform roots was able to regenerate genetically stable as transgenics. This property of rapid growth and high plantlet regeneration frequency allows propagation of plants. invitro transformation and regeneration from hairy roots facilities application of biotechnology to plants medicine species.
Keywords: Atropa belladonna, hairy root, regeneration
133

MTLD
Kolsoum beyranvand *Hassan Rahnama Haghighat Vakilian * hrahnama@abrii.ac.ir )Agricultural Biotechnology Research Institute of Iran(ABRII )Agricultural Biotechnology Research Institute of Iran(ABRII )Agricultural Biotechnology Research Institute of Iran(ABRII
: . : Rd29A CaMV35s MTLD . . MTLD ( Rd12, Rd8 ( Rd29A s12,35s52 (35 (CaMV35s MS ,0 400 ,300 ,200 ,100 MS . : 35s Rd Rd s 35 . : MTLD Rd29s CaMV35s . :
134

*Nasibeh Chenarani Sanaz Ramazanpour Hasan Soltanlo Ahad Yamchi Shaban Kia Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science Gorgan university of agricultural and natural resources science
* nasibe_chenarani@yahoo.com
: septoria tritici . . : () ( ) . . -80 . RNA . cDNA Real time-PCR Primer3 . : . . . . : . :
135

Molecular characterization and assessment inter and intra diversity of some prunus species In Iran by AFLP marker
Zahra Dehghani* sayyed mojtaba khayam nekoei Jahangir Heydarnejad Karimi Ali Imani * zahra_dehghan2008@yahoo.com graduated from shahid bahonar university of kerman department of new thechnology of president department of plant phatolojy of shahid bahonar university, kerman department of horticulture, seed and plant improvement kampus mahdasht Rd karaj
Introduction : In this study investigated available diversity among and inter four species of wild almond A. eleagnifolia A. scoparia Spach, A. hauskenchtii, A. corducrom Bornm, and one species of peach with use of AFLP marker. Materials and methods : Leaf sample from 61 genotipe of 4 wild almond species and 8 genotipe from prunus persica that collected from 4 different erea of iran assessed with 10 AFLP primer marker. Results : At least 10 primer combination creat 510 band in studid population, from this number 476 band was polymorph. Conclusion : molecular variance for investigating variation among and intera study species show height amount variation intera species. UPGMA clustering based on jacard similarity coefficient creat two major group and one independent group. Although the genetic structure obtained by AFLP was totally in accordance with those expressed by the traditional classification, some inagreement were found with iran flora. Keywords : wild almond, AFLP, Genetic diversity, UPGMA
136

) (Solanum tuberosum L.
Ehsan Enayat Manesh *Majid Masoumian Babak Latif Hossien Afshari * masoumian200@yahoo.com Islamic Azad University - Damghan Branch Iranian Research Organization for Science and Technology. Tarbiat Modares University Islamic Azad University - Damghan Branch
: . : -2 ( iP)2 ) (BAP ) (CCC ) (GA3 . : . MS 30 . )(LUX 4000-3000 . MS 4 3 2 iP (12 10 7.5 5 BAP (2.5 )5 1000 750 500 CCC (250 )12.5 )1250 GA3 4 3 2 (1 )5 90 . 6 . : GA3 .- BAP mg.l-1 5 CCC mg.l-1 500 iP 2 mg.l-1 2-1 . . : BAP CCC . . . :
137

Ehsan Enayat Manesh *Majid Masoumian Babak Latif Hossein Afshari * masoumian200@yahoo.com Islamic azad university damghan branch Iranian Research Organization for Science & Technology Tarbiat Modares University islamic azad university damghan branch
: . . : ) (NAA ) (GA3 ) (BAP ) (CCC . : MS NAA ( 0.03 0.12 0.09 0.06 0.15 ) 1.2 0.9 0.6 GA3 ( 0.3 1.5 ) 2.0 1.5 1.0 BAP ( 0.5 2.5 ) 75 50 CCC ( 25 100 125 ) 30 . ) ( LUX 4500-3000 5 . : NAA . 0.5 BAP . 1 BAP . CCC . CCC . : GA3 NAA BAP . . . :
138

Tissue culture and somaclonal variation in M7 rootstock
*Shokoofeh Fazeli Farah Farahani Masoud Sheidai Zahra Nourmohammadi shahid beheshti university azad university shahid beheshti author * hengameh.fazeli@gmail.com
rootstock : . . M7 rootstock ISSR_PCR . M7 SP: 2iP + IBA, SB: BAP + IBA, DP: 2iP + IBA, DB: BAP + IBA ISSR reticulation . STRUCTURE . M7 ( )mg/l BA, 2mg/l 2iP2 ( )mg/l IBA 0.1 . reticulation . M7 SP SB STRUCTURE . breeding . M7,tissue culture, STRUCTURE :
139

Optimization of Cronobacteriocin Xanthomonas axonopodis pv. Citri
Dariush Gholami* Saeed Aminzade Seyed-Mahdi Alavi Nasrin Kazemi pour Jafarn Valizadeh NIGEB NIGEB NIGEB NIGEB NIGEB
DGH2
bacteriocin
inhibiting
* gholamid@yahoo.com
Abstract: Introduction Citrus canker disease is created by the bacterium Xanthomonas citri subsp.citri (xcici) (1). Efforts to eradicate this disease have been inconclusive so far and are Forced to use chemical pesticides and antibiotics to control disease (2). However, the effect of antibiotics used to treat bacterial infections and agricultural purposes in the selection of antibiotic-resistant microorganisms is important This can affect human health and plant (3). Cronobacteriocin DGH2 a bacteriocin secreted by indigenous bacteria Cronobacter sp. DGH1 that inhibits citrus canker disease bacteria. Materials and Methods For maximum productivity, it comes to the bacteriocin, It is necessary to optimize the production of the bacteriocin. For this purpose, optimization of This bacteriocin production by its bacteria producer, using Taguchi Orthogonal array experiments were performed the nine factors that define each factor were carried out at three levels. Finally, optimum conditions for bacteriocin production and optimal conditions for the growth of the bacteria was determined. For statistical data analysis above, the software Minitab 16 Statistical Software and IBM SPSS Statistics 21 was used. Results After preferred sources were found to produce a bacteriocin secreted by the bacterium Cronobacter sp.DGH1, Analysis of variance of means table the factors examined, Above results indicate that the variable temperature, disodium hydrogen phosphate and peptone there are other significant factors. The p-value is less than 0.05. so it is significant at 95% level. the data analysis shows that peptone has the greatest effect on bacteriocin production and Ammonium nitrate is less important than other factors. Keywords: Xanthomonas citri subsp.citri, Cronobacteriocin DGH2, bacteriocin, Taguchi Orthogonal array
140

Characterization of cronobacteriocin DGH2 an anticitrus canker disease bacteriocin
Dariush Gholami* Saeed Aminzade Seyed-Mahdi Alavi Nasrin Kazemi pour Jafarn Valizadeh * gholamid@yahoo.com NIGEB NIGEB NIGEB NIGEB NIGEB
Abstract: introduction Citrus canker, caused by Xanthomonas axonopodis pv.Citri. is one of the most devastating citrus diseases in the world. In this reason it is necessary to study about inhibition of this disaster .Cronobacter sp. DGH1 is a producer of a bacteriocin that is released extracellularly. Cronobacteriocin DGH2 is a new bacitracin, which is the rst report on b acitracin active against Xanthomonas axonopodispv. Citri. Material and methods Bacteriocin enzyme identification test Culture supernatant was incubated at 37C for 1h in the presence of various enzymes (proteinase K, trypsin, papain, pepsin) at a final concentration of 1 mg ml and 10 ml of each supernatant was spotted onto soft agar inoculated with 250 l of 0.5 MAC Farland pre-cultivated target strains. The plates transferred at 32C and inhibition zones were recorded. Bacteriocin temperature identification test thermal diagnostic test for Cronobacter sp. DGH1 bacterial supernatant in the range of different temperatures was performed. Thus, after the bacterial supernatant obtained, the amount of 50l into single vials. each vial was place in Hotplate with temperatures of 35, 45, 55, 75 and 100 C for half an hour. 10 l of each vial placed on the plates that were inoculated with pathogenic bacteria. And was incubated at 32 C, formation of halo was investigated after 24 hours. Result and discussion As shown in Table 5, after treatment by proteolytic enzymes such as proteinase-K, trypsin, pepsin and papain the antibacterial activity of secreted component by Cronobacter sp. DGH1 was abolished. This result showed that this component is a proteinaceous molecule, and probably a bacteriocin .Halo formation of the bacterial supernatant in the temperature range of 25, 45, 55, 75 and 100 C was investigated. the zone formation at 25, 45 and 55 C did not change. However, at 75 and 100 C temperatures halo was low (fig. 2 B). it can be concluded From this experiment that the antibacterial activity is the factor that has a protein structure .
Keywords: Cronobacter sp. DGH1, Bacteriocin, Xanthomonas axonopodis pv.Citri., Cronobacteriocin DGH2
141

Contamination of cattle slaughtered in the city KazerounE.coli O157: H7 in 2012
Ali ghorbanirnjbary* Nazanin ghorbanirnjbary Young Researchers Club, Kazerun Branch, Islamic Azad University, Kazerun Young Researchers Club, Kazerun Branch, Islamic Azad University, Kazerun Departement of Surgery, faculty of specialized veterinary scince, islamicazad university, kazerun Khormshahar marine science,technology university, Iran.
Saravarzandian
Zahra ghorbanirnjbary
*dr_alighorbani87@yahoo.com
Introduction: E. coli O157:H7 is a rod-shaped, gram negative bacterium. It is an enterohemorrhagic strain of the common E. coli bacterium and infection by the O157:H7 strain is commonly associated with hemorrhagic colitis. E. coli O157:H7 is recognized by its somatic (cell wall) antigen (O157) and its flagella antigen (H7). In addition, E. coli O157:H7 is known to produce Shiga-like toxins, which cause severe symptoms. While most patients can recover from the infection, up to 15% of the patients may develop hemolytic uremic syndrome, a type of kidney failure that could be fatal. Infection of E. coli O157:H7 usually results from consumption of poorly prepared food including undercooked meat (particularly ground beef), untreated water or raw unpasteurized milk. Materials and methods: In this study, we investigated the prevalence of E. coli O157:H7 in meat samples of bovine in kazeroun, Iran. This Descriptive - analytical and descriptive study, which was conducted from April 2011 to February 2012. A total of 200 bovine carcasses were sampled by surface section of neck meat taken immediately after slaughter analyzed using microbiological examinations. Suspected colonies to E. coli O157:H7 were confirmed by a specific polymerase chain reaction method (PCR). Results: The results showed that the contamination rate of samples to E. coli were 596(29.5%) and 3 samples (1.5%) were identified as E. coli O157:H7, using polymerase chain reaction. Seasonal distribution showed that the highest prevalence of E. coli and E. coli O157:H7 occurred in summer samples (P<0.05). Conclusion: These results indicate that bovine can be a reservoir for E. coli O157:H7 and bovine meat may serve as a vehicle for the pathogen transmission to human. Keywords:E.coli O157:H7, Zoonoses, PCR, Kazeroun
142

Construction of a genetic linkage map with SSR, AFLP and morphological markers to locate QTLs controlling pathotype-specific powdery mildew resistance in diploid roses
Hossein Hosseini Moghaddam* Leen Leus Jan De Riek Johan Van Huylenbroeck Erik Van Bockstaele * hhm548@yahoo.com Gonbad Kavous University ILVO Institute ILVO Institute ILVO Institute ILVO Institute
Abstract: Disease resistance is a sought-after trait in plant breeding programmes. One strategy to make resistance more durable is to increase the number of resistance genes, thereby increasing the number of pathotypes withstood. One of the most important diseases on roses is powdery mildew (Podosphaera pannosa). Recent studies show that pathotypes of powdery mildew and different types of resistances in roses exist. The results of this study aim to contribute to powdery mildew resistance in roses by the development of pathotype-specific markers on a genetic map. A diploid rose population (90 genotypes) derived from a cross between R. wichurana and Rosa Yesterday was used to construct a genetic linkage map encompassing 20 AFLP primer combinations, 43 SSR, and 2 morphological markers. By applying the F1 pseudo test cross population strategy, 2 parental linkage maps were constructed )parent Yesterday 536 cM; parent R. wichurana 526 cM). Both parental maps consisted of 7 linkage groups with an average length of 70 cM (Kosambi) corresponding to the 7 haploid rose chromosomes. These new maps were used to identify QTLs controlling disease resistance. The offspring population was screened for resistance to 2 powdery mildew pathotypes, R-E and R-P. QTLs for controlling pathotype-specific disease resistance were mapped by applying Kruskal-Wallis rank-sum tests and simple interval mapping. With 2 pathotypes analysed, 9 QTL loci were detected on linkage groups 2, 3, 5 and 6, explaining 1573% of the phenotypic variance for pathotype-specific disease response. The genetic maps developed here will be useful for future rose breeding, pathotype-specific resistance research and development of a consensus map for roses. Keywords: Disease resistance, Molecular markers, QTL mapping
143

Assessment Of Regeneration Of Stevia Rebaudiana By Seed
Kourosh keighobadi* Maryam Golabadi Forogh mortazaeinezhad Khorasgan (Isfahan) Branch , Islamic Azad University , Isfahan , Iran Khorasgan (Isfahan) Branch , Islamic Azad University , Isfahan , Iran Khorasgan (Isfahan) Branch , Islamic Azad University , Isfahan , Iran
* kouroshkeighobadi@yahoo.com
Introduction: The leaves of stevia are the source of the diterpene glycosides, vis. Stevioside and rebaudioside. It is recommended for diabetes and has been used by humans with no side effects.The seeds of stevia show a very low and poor germination percentage. Materials and methods: The main objectives of this present study were to optimize of combination and concentration of growth regulators for directly regeneration through seeds implanting in MS medium. Implanting of seed explants was done on MS medium, fortified with Indolasetic Acid (IAA)( 1.5 to 4 mg/l) or 6-Benzyladenine ( BA) ( 1.5 to 5 mg/l) or Indolebutyric acid (IBA)(3 to 3.5 mg/l) or Kinetin (KIN)( 0.5 to 2 mg/l) or Naphthalen Acetic Acid (NAA)( 0.5 to 1.5 mg/l) or 2,4Dichlorophenoxyacetic Acid (2,4-D) ( 0.5 to 1 mg/l) used singly and in combination. Results : Of the 16 combinations growth regulators tried, 4 of them proved to be better than others and one of them with combination of BAP+IAA +2,4-D(5+4+1 mg/l)have showed best response of regeneration. Conclusion: Germination of seed is poor and this study describes that can used as an explants onto medium for efficient regeneration protocol for commercially important medicinal plant Stevia Rebaudiana Bertoni. Keywords: Regeneration, Stevia, Medium, Stevioside, Rebaudioside
144

Marker Assisted Selection for Overexpressed Bx7 Gene (Bx7OE) Effective in Bread Wheat Quality
Elham mehrazar* Ali izadi-darbandi Mohsen mohammadi *elhammehrazar@ymail.com University of Tehran University of Tehran Seed and Plant Improvement Institute
Introduction: To study the importance of wheat quality and increase of wheat production is need identified effective genetical factors to improve bread wheat quality and was used their. It has been shown that the allelic variation of high and low molecular weight glutenin subunits (HMW/LMW-GS) is both associated with the rheological properties of wheat flour. High elasticity is an important criteria in bread dough, that has been influenced by LMW-GS components and stability has been influenced by HMW-GS components. Over-expression of the high molecular weight glutenin subunit (HMW-GS) Bx7 that is locate on Glu-B1 locus is highly associated with dough strength of wheat (Triticumaestivum L.) flour. Materials and methods : In this study, we investigated 7 and 7OE alleles that were shown to be the most effective alleles for increasing gluten quality using PCR based DNA markers in 30 wheat advance lines and commercial cultivars with different originated from Iran, CIMMYT, Canada and Australia. Results: 7OE alleles associated with dough strength of wheat (Triticumaestivum L.) flour. 7, 7+8 and 7+9 alleles show the highest allelic frequency in the Iranian cultivars and the effect of 7OE, 7OE+8 and 7OE+9 alleles in bread making quality are higher thus in this study discussed about validation and identification of 7OE allele using allele-specific markers because detection of glutenin subunits using SDS-PAGE electrophoresis system has numerous problems. The results showed that genotypes such as WS-87-16, Tobary-66, Glenlea, Norstar, AC-Vista and Laura show presence of 563-bp band and have 7OE allele with good quality. Result showed that 7OE allele was found in none of Iranian wheat advance lines. Conclusion: The objective of this study is the uses of very useful tools for identify factors and efficient alleles to improve wheat quality breeding in the wheat breeding programmes. Keywords: Marker Assisted Selection, Bread Making Quality, Wheat, STS Marker, Bx7OE
145

Validation and Identification GPC-B1 Gene Effective in High-Grain Protein Content in the Wheat Cultivars and Advance lines
Elhammehrazar * Ali izadi-darbandi Mohsen mohammadi *elham.mehrazar@yahoo.com university of tehran university of tehran Seed and Plant Improvement Institute
Introduction: Grain protein concentration (GPC) is one of the most important factors influencing pasta-making quality. Grain protein content (GPC) is important for human nutrition and has a strong influence on pasta and bread quality. A quantitative trait locus, derived from a Triticumturgidum ssp. dicoccoides accession, with an average increase in GPC of 14 percent. A potential approach to increase GPC in wheat is to exploit the high GPC genes from wheat wild relatives. Wild emmer, Triticumturgidum L. ssp. dicoccoides, contains higher GPC )170273 g kg1( than most of the bread wheat cultivars )110170 g kg1(. Materials and methods: In this study, we investigated GPC-B1 alleles that were shown to be the most effective alleles for increasing gluten quality using PCR based DNA markers in 40 wheat advance lines and commercial cultivars different originated from Iran, CIMMYT, USA. Variation for GPC that is located on the distal of the short arm of wheat chromosomes 6B. DNA markers for GPC gene products bands with sizes 122 and 126-bp. Amplification products were separated on a 6% polyacrylamide gel. Result showed that GPC-B1 allele was found in none of Iranian and CIMMYT wheat advance lines. Results: The results showed that genotypes such as Anza, Kern, YecoraRojo, ND-683, Longdon (durum) and Glupro with origin from American show presence of 122-bp band and have GPC-B1 allele with good quality and high grain protein content. Therefore using of the marker assisted selection to improve wheat quality and increase grain protein content. Conclusion: The objective of this study is the uses of very useful tools for identify factors and efficient alleles to improve wheat quality breeding in the wheat breeding programmes. Keywords: Marker Assisted Selection, Bread Making Quality, Wheat, Grain Protein Content
146

Identification and Distribution of the Photoperiod Insensitive Allele in PpdD1 locus in Wheat
Elhammehrazar * mohsenmohammadi *emehrazar@ymail.com university of tehran Seed and Plant Improvement Institute
Introduction: Flowering time in bread wheat (Triticumaestivum L.) is controlled by vernalization and photoperiod response, and earliness per se genes. Photoperiod response is of great importance for optimal adaptation of bread wheat cultivars to specific environments. Photoperiod insensitive wheat cultivar immediately switches to reproductive growth with a rise in temperature in the spring, whereas a photoperiod sensitive cultivar continues its vegetative phase until the day length sufficiently increases to satisfy its photoperiod requirement. Photoperiod response in wheat is mainly controlled by the genes Ppd-D1 (Ppd1), Ppd-B1 (Ppd2) and Ppd-A1 (Ppd3) located on the short arms of chromosomes 2D, 2B and 2A, respectively. The dominant alleles Ppd-D1a, Ppd-B1a and Ppd-A1a confer photoperiod insensitivity, whereas the recessive alleles Ppd-D1b, Ppd-B1b and PpdA1b confer photoperiod sensitivity. The Ppd-D1a allele for photoperiod insensitivity is generally considered the most potent, followed by Ppd-B1a and Ppd-A1a. Materials and methods: In this study, Iranian and CIMMYT wheat cultivars were characterized with allele specific molecular markers for the Ppd-D1 photoperiod alleles because The Ppd-D1a allele is the most potent in the photoperiod insensitivity. Allelic variation in genes of affecting maturity and flowering time has not been validating in Iranian genotypes. Results: Results of the primers of the photoperiod with a combined forward and two different reverse showed that 3 genotypes carrying the dominant Ppd-D1a alleles confer day length insensitivity whereas the presence of recessive alleles in other genotypes results in day length sensitivity and durum genotypes there are not this alleles. Results showed that genotypes carrying the dominant Ppd-D1a alleles confer day length insensitivity had CIMMYT origin and the most of Iranian genotypes confer day length sensitivity and this results are consistent with results Asian wheat. Photoperiod response is associate with adaptation and grain yied in wheat and improved varieties with high yield potential confer day length insensitivity. Conclusion: The current information is important for understanding the broad adaptation of improved Iranian wheat cultivars. Keywords: Ppd genes, Photoperiod, Adaptation, Flowering, Wheat, DNA Markers
147

Application of Allele-Specific Markers for Identification of Different Sources of 1AL/1RS and 1BL/1RS WheatRye Translocations in Wheat
Elhammehrazar* Ali izadidarbandi Mohsen mohammadi *mehrazar.elham@yahoo.com university of tehran university of tehran Seed and Plant Improvement Institute
Introduction : Marker assisted selection are valuable tools for breeding programs because they can be provided information about bread making quality in the first stage of breeding programs and prevent of the spread lines have poor quality. One of the effective factors in the quality identified the wheatrye translocation in high quality wheat. The 1RS transferred to wheat are form 1AL/1RS, 1BL/1RS and 1DL/1RS and 1RS is on the short arm of rye chromosome 1R. The 1BL/1RS translocation has been widely used in bread wheat breeding programs. Its presence is associated with a serious quality defect, including low sedimentation volume, dough stickiness and reduced dough strength, which disqualifies it from breeding programs developing high quality wheats. The negative effect of the 1RS/1BL translocation on bread-making quality is probably related to the negative effect of the secalins and to the reduction of the number of the gluten-encoding loci and the resulting lower amount of gluten. Materials and methods: The use of marker assisted selection (MAS) are useful for identified wheatrye translocation and in contrast, detection of 1RS in wheat-rye translocation using SDS-PAGE electrophoresis system has numerous problems. In this study, using allele-specific markers validation detects the presence or absence 1AL/1RS and 1BL/1RS alleles of wheat-rye translocation for a number of F2 generation progeny and commercial cultivars. Results: Result showed that 1AL/1RS and 1BL/1RS alleles were found in none of F2 generation progeny and have good quality and are selected for the next generation. The study showed that among commercial varieties, some of the cultivars such as Atrak, kavkaz have 1BL/1RS allele and other cultivars have 1AL/1RS allele and are associated with a quality defect. Conclusion: The purpose of this study is the use of very useful tools for identify factors that to improve wheat quality breeding. Keywords: 1BL/1RS, 1AL/1RS, Marker Assisted Selection (MAS), Wheatrye translocation, Wheat
148

Allelic Variation at the Vernalization Genes Vrn-A1, Vrn-B1, Vrn-D1, and VrnB3 in Iranian Wheat Cultivars and Their Association with Growth Habit
Elhammehrazar* Mohsen mohammadi *elham.mehrazar1987@yahoo.com university of tehran Seed and Plant Improvement Institute
Introduction: Vernalization and photoperiod response genes play a major role in determining the flowering times of wheat (Triticumaestivum L.). The objective of this study was to investigate the effect of Vrn genes on flowering and maturity times wheat cultivars. Winter cultivars carried recessive alleles of all four vernalization loci, whereas spring genotypes contained at least one dominant Vrn allele. In this study, Iranian and CIMMYT wheat cultivars were characterized with eight molecular markers for the vernalization genes Vrn-A1, Vrn-B1, Vrn-D1 located on the long arms of group 5 chromosomes and Vrn-B3 located on the long arms of group 7 chromosomes. Materials and methods: The amplified PCR fragments were separated on a 1.5-2% agarose gel. Allelic variation in genes of affecting flowering time has not been validate in Iranian genotypes. Results: Results showed that the dominant Vrn-B1 allele showed the highest frequency in the wheat cultivars, followed the dominant Vrn-D1, Vrn-A1 and Vrn-B3 alleles have the highest frequency. The genotype carrying alleles at Vrn-A1b, Vrn-B1 and Vrn-D1 flowered and matured the earliest, and had the lowest grain yield. Allelic variation in the dominant Vrn alleles caused differences of flowering time in the wheat vernalization. Therefore genotypes carrying dominant Vrn-A1 alleles had flowered the earliest while genotypes carrying dominant Vrn-B1 and Vrn-D1 alleles had delayed flowering. The genotype carrying alleles at Vrn-A1, Vrn-B1 flowered and matured the earliest, and had the highest grain protein content but the lowest grain yield. Spring habit Vrn-A1a allele was found in 3 cultivars either alone or with spring habit Vrn-B1 and Vrn-D1 alleles. One wheat cultivars had the dominant Vrn-A1b allele, whereas none of the cultivars had Vrn-A1c. Spring habit Vrn-B1, Vrn-D1 and Vrn-B3 were the most frequent allele in 15, 12 and 2 cultivars either alone or with other alleles. Two genotypes were winter, whereas other genotypes were spring. Conclusion: information is important for breeders in order to the development of early maturity cultivars with high yield potential, different combinations of Vrn alleles and creat cultivars with high allelic variation in wheat breeding programs. Keywords: Vernalization, Vrn genes, growth habit, Wheat, DNA markers
149

*Mona Moghadami Ramin Hosseini International University of Imam Khomeyni International University of Imam Khomeyni *mona_mo81@yahoo.com
: . . : () () . 120 NaCl . . : () () . . : () () . . :
150

Analysis of molecular methods for producing glyphosate resistance
Sedighe Nasreramzi* Mohammad Mahdi Sohani * kiana.ramsey@gmail.com guilan guilan
Abstract: Developed by the Monsanto Company and introduced to world agriculture in 1974, glyphosate has become the worlds most important herbicide. Glyphosate is the herbicidal active ingredient in Roundup and many other herbicide brands that control a broad spectrum of plant species. It is the only herbicide that targets 5-enolpyruvylshikimate- 3-phosphate synthase (EPSPS) and its enzyme found only in plants and certain bacteria. Because of this, it has an excellent toxicological and environmental profile. However, it also destroys crop species on application, and thus its traditional use has been in non-crop and orchard production systems. The ability to transform plants using molecular biology has allowed the transfer of a glyphosate-insensitive gene into crop species, so allowing glyphosate use in crop and signaling a new era in weed management. Today, glyphosate resistance has been introduced into several major crop species and is being grown on an increasing number of hectares of crops.
Keywords: Transgenic crop Weed
151

Evaluation of allelic variation and assessment of quality of storage proteins in Iranian durum wheats
Masume Rajabi Hashjin* Mustafa Agahee Sarbarze Mohammad Hussein Fotokian Shahed university Seed and Plant Improvement Institute Shahed university
* masume.rajaby@yahoo.com
Abstract: Genetic variations of cultivars are very interesting in reducing genetic vulnerability and lead to stable control of production. Proline and glutamine-rich wheat seed endosperm proteins are collectively referred to as prolamins. HMW-GS are major determinants of gluten elasticity. The inheritance of glutenin subunits follows Mendelian genetics with multiple alleles in each locus. Identification of the banding patterns of glutenin subunits could be used as an estimate for screening high quality wheat germplasm. In this study 116 Iranian pure lines of Triticum turgidum originating from different geographical areas of Iran and six countries, Portuguese, Italy, Yugoslavia, Bulgaria, Iraq and Afghanistan, were evaluated for variation in high molecular weight glutenin subunit (HMW-GS) composition. by means of a two-step 1D-SDS-PAGE procedure, we identified the allelic variations in high molecular-weight glutenin subunits. Three alleles were present at the Glu-A1 locus and 8 alleles at Glu-B1. We identified 16 allelic compositions also. In pure lines of durum wheat, the null allele (Glu-A1c) was observed more frequently than the Glu-A1a and Glu-A1b alleles. Two alleles, namely Glu-B1i (subunit 17+18) and Glu-B1e (subunit 20) represented the more frequent alleles at Glu-B1 locus. The tested genotypes were classified in nine groups according to the linkage distance analysis. We computed the genetic variations in Glu-A1 and Glu-B1 loci following Nei (1978) method. The genetic variability in Glu-A1and Glu-B1 locus Were respectively, 0/42 and 0/81. HMW glutenin Glu-1 quality scores, are in the range between 2 and 6. Keywords: SDS-PAGE, Glutenin, Genetic diversity, Durum wheat, Quality
152

PROLIFRATION OF MOHREKHOSH (ZHUMERIA MAJDAE Resh. f. & Wendelbo) BY SEED GERMINATION AND CALLUS INDUCTION
Parastoo Ramazani Forough Sanjarian* Farzaneh Sabouni * f_sanjarian@yahoo.com National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology
Abstract: Mohrekhosh(Zhumeria majdae Resh. f. & Wendelbo), is a medicinal plant, which has been used extensively in the traditional medicine of southern provinces of Iran and the Persian Gulf littoral states. Essential oil of this plant contains terpenes and flavonoids, which have analgesics, antioxidant, anti-bacterial, and anti-inflammatory effects. This plant has been introduced by Norwegian researcher, Majdae Zhumer in 1967 and identified as a new genus of Lamiaceae family, genus Zhumeria. Now a day, it has been introduced as endangered species. Thus culture and proliferation of Z. majdae is considered as a critical point of recent herbal medicinal biotechnology researches. Callus production methods for medicinal plants are useful methods in genetic conservation and propagation of these plants to produce more secondary metabolites, biomass production, and providing research areas for biotechnology and pharmaceutical sector. For achieving this goal, the seeds of the plant were collected from native habitats. Four different methods were used for sterilizing and breaking dormancy of the seeds, and then they were cultured in MS and MS medium. To break the dormancy of the seeds, the best method was breaking the outer shell of the seeds in the MS medium. For callus induction different tissues were used on MS medium with different concentrations of auxins and cytokines and their combinations. Analysis was done in completely randomized design (CRD) with three replicates. Results revealed that the best callus induction was achieved when we used the lowest concentration of NAA and BAP. The biomass and the rate of callus induction with various concentrations of the hormones were analyzed by spss program. Keywords: Mohrekhosh, germination, Callus, hormon
153
154

Proliferation of Mouhrekhosh(Zhumeria Majde Resh.f.& wendelbo) by seed germination and callus induction
Parastoo Ramazani Forough Sanjarian* Farzaneh Sabouni * f_sanjarian@yahoo.com National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology
Introduction: Mohrekhosh (Zhumeria majdae Resh. f. & Wendelbo), is a medicinal plant, which has been used extensively in the traditional medicine of southern provinces of Iran and the Persian Gulf littoral states. Essential oil of this plant contains terpenes and flavonoids, which have analgesics, anti-oxidant, anti-bacterial, and anti-inflammatory effects. This plant has been introduced by Norwegian researcher, Majdae Zhumer in 1967 and identified as a new genus of Lamiaceae family, genus Zhumeria. Now a day, it has been introduced as endangered species. Thus culture and proliferation of Z. majdae is considered as a critical point of recent herbal medicinal biotechnology researches. Callus production methods for medicinal plants are useful methods in genetic conservation and propagation of these plants to produce more secondary metabolites, biomass production, and providing research areas for biotechnology and pharmaceutical sector Materials and methods: For achieving this goal, the seeds of the plant were collected from native habitats. Four different methods were used for sterilizing and breaking dormancy of the seeds, and then they were cultured in MS and MS medium. To break the dormancy of the seeds, the best method was breaking the outer shell of the seeds in the MS medium. For callus induction different tissues were used on MS medium with different concentrations of auxins and cytokines and their combinations. Analysis was done in completely randomized design (CRD) with three replicates Results: Results revealed that the best callus induction was achieved when we used the lowest concentration of NAA and BAP Conclusion: The biomass and the rate of callus induction with various concentrations of the hormones were analyzed by spss program Keywords: Mohrekhosh proliferation germination Callus hormone
155

Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici blotch of wheat
Sedighe Rashidian* Ramin Roohparvar Manoochehr Khodarahmi Sepideh Torabi Rahim Mehrabi * s.rashidian60@yahoo.com Department of Biotechnology , Science and Research Branch, Islamic Azad University, Tehran, Iran Seed and Plant Improvement Institute (SPII), Cereal Research Department, Karaj, Iran Seed and Plant Improvement Institute (SPII), Cereal Research Department, Karaj, Iran Department of plant breeding, Science and research Branch, Islamic Azad University, Tehran, Iran. Seed and Plant Improvement Institute (SPII), Cereal Research Department, Karaj, Iran
Abstract: Mycosphaerella graminicola (anamorph: Zymoseptoria tritici) is the causal agent of septoria tritici blotch of wheat in regions with high rainfall during the growing season. The economic impact of STB is increasing due to the widespread cultivation of high-yielding cultivars that are generally susceptible to this pathogen. In Europe, annual losses from STB are estimated to be 400 million dollars, and similar loss estimates for the United States are more than $275 million dollars per year. The use of fungicides to control STB is expensive, not entirely reliable and not effective for long term due to high evolutionary rate of the pathogen populations that is exemplified by the rapid speared of QoI fungicide resistance just a few years after their introductions into wheat agricultural system. Conventional breeding for resistance against fungal pathogens, in general, and against STB, in particular, has been employed over the last decades but this approach is laborious and very time consuming. Various molecular techniques like marker-assisted selection (MAS) have been developed to expedite the process of breeding for resistance against biotic stresses. MAS generally relies on the availability of molecular markers tightly linked to a particular genes of interest. To date, eighteen major genes for resistance to M. graminicola have been mapped and their SSR markers are identified. In the present study 21 wheat genotypes as well as the control cv. Tadinia (known to posses Stb4) were analyzed for the presence of Stb4 using the SSR marker Xgpw5211. Among all genotypes tested, two genotypes, Sep-k14 and Chamran, amplified a 170-bp DNA fragment using the primer pair Xgpw5211, which was similar to the size of Stb4 SSR allele indicating that these genotypes may carry Stb4 resistance gene. To confirm molecular data we have performed inoculation assay using two isolates that were virulent or avirulent on Stb4 containing cultivar, Tadinia. To this aim, wheat seedlings were individually inoculated at the first leaf stage by spore suspension of each isolate and plants were evaluated for their responses at 21 days post inoculation (dpi) by visual estimation of percentage of leaf necrotic areas covered with pycnidia. Pathogenicity assay showed that two wheat genotypes, Sep-k14 and Chamran showed phenotypic pattern similar to Tadiana. Therefore based on the phenotypic and genotypic data we conclude that Sep-k14 and Chamran may posses Stb4. These genotypes can be used as resistant cultivars or sources of resistance to STB in wheat breeding programs in regions that Stb4 is effective against M. graminicola local populations. Keywords: Zymoseptoria tritici, septoria tritici blotch, Stb4, Tadinia.
156

Identification of single nucleotide polymorphism in exon 26 of apoB gene in khazak breed chickens
Phd Student,Department animal science, Faculty of Agriculture,ferdowsi university, mashhad Department of Animal Science, Faculty of Agriculture, Shabestar Branch, Islamic Azad University(IAU),Tabriz Phd Student,Department of Animal Science, Faculty of Agriculture, Science and Research Branch, Islamic Azad University(IAU), Tehran Phd Student,Department animal science, Faculty of Agriculture,ferdowsi university, mashhad
Zahra Roudbari* Hamid Reza Seyedabadi Amin Shahabi Azam Torabi *rodbari.zahra@gmail.com
Abstract : ApoB gene in poultry is located on chromosome 3 and the length is 34 kb and also contains 30 exons and 29 introns. apoB gene coding 4631 amino acids with Molecular weight of 524 kD in poultry and Isoelectric point is 8.49. Expression levels in laying hens are more than Meat hens. in this study, sixty sample selected of laying hens native khazak breed to the region of Sistan and Baluchestan and DNA genomic was extracted from follicle end feather. polymerase chain reaction was performed for the amplification of fragment 779 bp of exon 26 of the apoB gene. part of the apoB gene were genotyping by PCR-RFLP method and restriction enzyme AcyI. digestion products were separated by electrophoresis on two percent agarose gel and stained with ethidium bromide. Data analysis was performed with PopGene32 software. A mutation was identified on fragment 779 bp at position exon 26 in chromosome 3. AA, AB and BB Genotypes were detected in this population, respectively with frequency of 16.7, 28.3 and 55 percent. the frequency of A allele and B allele was estimated, respectively 0.3083 and 0.6917 percent . The B allele was more frequent than B allele and BB genotype was more frequent than other genotypes in this population. Chi square)2( test and G test showed Hardy- Weinberg equilibrium in the population and this polymorphism was approved using sequencing method with ABI sequencing system .Thus, according to the results observed and the important role of this gene in egg production, this gene appears to be an important candidate gene in native chickens used in breeding program. Keywords: polymorphism, apoB gene, khazak chickens
157

Prevalence of foot and mouth disease virus (FMDV) in carrier cow reffered to Khorasan Razavi industrial abattoir by Realtime quantitative PCR (q-PCR)
Fatma Sadrnia* mashhad * sadrniafatima@yahoo.com
Introduction: Foot-and-mouth disease is associated with an aphthovirus (familyPicornaviridae) which occurs as seven major serotypes: A, 0, C, Southern African Territories (SAT) 1, SAT 2, SAT3 and Asia 1. However, there are a number of immunologically and serologically distinct subtypes with different degrees of virulence, especially within the A and 0 types. As there is no cross-immunity between serotypes, immunity to one serotype does not confer protection against the others, This presents difficulties to vaccination programs. Determination of animals which carry the virus and show no clinical signs are of a great importance in FMD eradication and control Materials and methods : In this study 106 tonsils and soft palates specimen of cow referred to Mashhad industrial abattoir were obtained. The samples were immediately transported on ice to the central laboratory of veterinary organization of Khorasan Razavi province. After RNA extraction using QIAgen RNeasy Mini kit.), qPCR were Results : The results show that 46 out of 106 samples were positive for the presence of FMD virus. This is equivalent of 43% of the samples. According to these results, special attention and future studies should be taken in consideration in vaccination, control and eradication of FMD programe in Iran. Conclusion : The results show that 46 out of 106 samples were positive for the presence of FMD virus. This is equivalent of 43% of the samples. According to these results, special attention and future studies should be taken in consideration in vaccination, control and eradication of FMD programe in Iran. Keywords : (FMDV) in carrier cow reffered to Khorasan Razavi industrial abattoir by Realtime quantitativePCR (q-PCR)
158

)(Glycyrhiza glabra
*Khadijeh Sepahvand Asghar Mirzai Asl Khosro Piri * sepahvandk@yahoo.com boalisina university boalisina university boalisina university
: . . . . . . A4, AR15834 MSU, D7, A7, AR158 . 4-3 . AR15834 42 . 30/5 28 28 36 33/3 . AR15834 D7 . :
159

New techniques in development of transgenic animal technology
Talieh Malek Shahabi*
Shirin Farivar
shahid beheshti university shahid beheshti university
*talie_1117@yahoo.com
Introduction: Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by various methods so that these genes can be inherited and expressed by offspring. Studies in this area will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. Material & methods: A variety of transgenic technologies are available. This article reviews developed animal transgenic technologies, especially some of them that use stem cells. For example, spermatogonial stem cell technique, primordial germ cell technique, embryonic stem cell gene targeting, induced pluripotent stem cell technique and so on. Result & Conclusion : These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields. Also we should pay attention there is some limiting factors in the production of transgenic animals. Firstly, the transgenic technique is imperfect, resulting in low success rates and survival rates of transgenic animals. Secondly, the integration efficiency of extrinsic genes at the target site is low and unstable, and what affects the intrinsic gene, damages the hosts genome, or activates the closed gene in normal conditions to express and subsequently produces abnormalities in animals is unclear. Therefore, it is necessary for researchers to utilize comprehensive basic transgenic theories and technical procedures to refine these methods. Keywords: spermatogonial stem cell, primordial germ cell, embryonic stem cell, pluripotent stem cell
160

Morphological investigation of hairy roots induced in Datura metel
Zahra Shakeran* Mehrnaz Keyhanfar * shakeran123@yahoo.com University of Isfahan University of Isfahan
Introduction: Although some plant's derived substances can be chemically synthesized, most of the valuable plant's secondary metabolites with pharmaceutical effects are still extracted from the plants. For instance, tropane alkaloids, one of the most important groups of secondary metabolites, are obtained from plants extracts. Hyoscyamine, scopolamine and cocaine are examples of tropane alkaloids with medicinal effects, obtained from certain species of solanaceae family. Tropane alkaloids have diverse applications in medicine. For example, these agents can be used for calming the symptomes of Parkinson's disease, treatment of Alzheimer and senile dementia and ataxias disease. In addition, they are antispasmodic and anti stomachs acid. Nowadays, the different biotechnological methods are applied to produce these alkaloids. Establishment of hairy roots system, induced by Agrobacterium rhizogenes, is a methods to increase the production of tropane alkaloids. Hairy roots with genetic stability and high-speed growth rate could constantly produce the valuable secondary metabolites. In this study, the morphological characteristics of hairy roots induced in Datura metel were investigated. Materials and methods : The seeds of D. metel were cultured in solid murashig and skoog medium (pH 5.8) and after germination and production of seedlings, roots were cut and 5-7 mm explants were made. Explants were infected by two strains of A. rhizogenes, AR15834 or ARA4. The root explants placed back on solid 1/2 MS medium culture plate for co-cultivation with agrobacterium. After 24h, in order to elimination of bacteria, these explants transferred into MS medium supplemented with cefotaxime. Induction of hairy roots were morphologically and molecular, using PCR technique, were evaluated. Results : The hairy roots were appeared 15 days after infection. Molecular and morphological investigation showed that strains AR15834 and ARA4 of A. rhizogenes produced 93.5% and 93% hairy roots respectively. Conclusion: In conclusion, the strains AR15834 and ARA4 of A. rhizogenes are able to induce hairy roots in Datura metel. Keywords : DATURA METEL, tropane alkaloids, Agrobacterium rhizogenes, hairy root, PCR technique
161

Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas fluorescens) in increase growth parameters of maize
Shayan Shariati * Hossein Ali Alikhani * shayan_shariati@ut.ac.ir university of Tehran university of Tehran
Introduction : The high cost of fertilizer production and environmental pollution caused by the use of these fertilizers makes necessary to use other sources especially bio fertilizers. Soil biotechnology has opened up new possibilities concerning the application of beneficial bacteria in the soil for the promotion of plant growth. Materials and methods: The aim of this study was to evaluate the survival of Pseudomonas fluorescence as a phosphate solubilizing bacteria on different organic and inorganic carriers, including Vermicompost, perlite, Rock phosphate, bentonite and three formulations of these materials and their impact on growth indicators of maize. In this study, the mentioned carriers were inoculated with Pseudomonas fluorescence, inoculants were held for 180 days and the bacterial population was measured through CFU method. Then inoculants were used for greenhouse culture of maize through soil inoculation method.The experiment was conducted based on completely randomized block design with 40 units. After 60 days of plant growth, some growth parameters of maize including phosphorus in the soil and shoots and zinc in shoots were measured. Statistical and Data Analysis were done using SAS 9.2 software and comparison of means was conducted using Duncan's multiple range test at five percent level Results : The results showed that although Triple superphosphate treatments was better in the mentioned factors, in many cases the two top inoculants ie vermicompost and vermicompost+ perlite + bentonite treatments were not significantly different from Triple superphosphate treatment (p>0.05) . Some factors including chlorophyll, phosphorus of soil and shoot of two top inoculants were higher than simple superphosphate treatment. In some factors are also significantly different (p Conclusion : According to the results can be expressed the use of Pseudomonas fluorescens bacteria as a phosphorous solubilizing bacteria with vermicompost as a carrier matter and a plant growth stimulating matter in manufacturing phosphorus bio-fertilizer caused to increase plant growth indicators and phosphorous in shoot of maize. This would herald a new day in the blossoming of soil biotechnology, bio-fertilizer production and fertilizer consumption reduction. Keywords : Biofertilizer, Carrier, Maize, Pseudomonas fluorescence, Vermicompost
162

Divesity of iranian genotypes for seed storage proteins and storage proteins and two_dimensional protein pattern in genotypes with high and low oleic acid
Nasibeh Shaygan* Sattar Tahmasebi Enferadi* Zohreh Rabiee Alireza Ghanbari Mohammad Zaeefizadeh Mohammad Hosein Fotokian * university shahed institute of genetic engineering and biotecnology institute of genetic engineering and biotecnology university shahed institute of genetic engineering and biotecnology university shahed
nasibeh_shaygan@yahoo.com, tahmasebi@nigeb.ac.ir Abstract: Herbal hereditary reservoirs have special importance in plant breeding and preserving them in national and international viewpoint. Iran includes various olive genotypes that recognizing such genetic variation can accelerate sustainable genetic development of the olive species. Therefore the action in need is to recognize, evaluate and collect native olive genotypes as well as introducing adapted species to different climates of Iran. The current study has performed to investigate genetic diversity of 23 Iranian olive genotypes, through the analysis of morphologic traits (according to IOC protocol), and electrophoresis patterns of seed storage proteins. The fatty acid profiles of olive drupes were detected by GC and the protein profile of two genotypes possessing the highest and the lowest oleic acid content were analyzed through 2D electrophoresis, as well. Cluster analysis of morphological traits regrouped olive genotypes into three sub-clusters included one, ten and twelve genotypes in each cluster. Fifteen reproducible bands have been detected on SDS-PAGE in which six were repeated in all genotypes; however the other nine bands showed intra-species polymorphism. 261 and 275 spots were identified on 2D electrophoresis by Melani software; fatty acid desaturase 2 (FAD2) and lipoxygenase (LOX) have been characterized as the distinguishable spots (at identical MW and Pi). The comparison of phenotypic and proteome clusters did show significant differences between genotype regrouping that implies the inefficiency of phenotypic traits in olive genotype identification. Keywords: Oleic acid, Olive, Genotypes
163

Transcripts pattern in bread wheat under drought stress
Mona Soltani* Amir Mohammad Naji Alaeddin Kordenaieej Hossien Torabi *mona_soltani67@yahoo.com shahed university shahed university shahed university shahed university
Abstract: Drought is an important environmental factor limiting the productivity of wheat and other crops world-wide. Plants have developed different strategies to cope with this stress, involving changes in the pattern of gene expression due to activation of stress-specific genes and to a general reprogramming of genetic activity in the cell. A simple method for profiling differential gene expression is cDNA-amplified fragment length polymorphism (cDNA-AFLP). The technique of cDNAAFLP is a powerful tool for analyzing gene expression related to environmental stresses. CDNAamplified fragment length polymorphism (AFLP) was used to analyze differentially expressed genes in wheat varieties Tabassi, a drought-stress tolerant genotype and Taifun, a drought-stress sensitive genotype, under drought stress and normal condition. Using 32 AFLP primer combinations, a total of 3300 transcript derived fragments (TDFs) were detected. Over 61% of gene expression was not affected by drought stress in the two wheat genotypes. 1268 TDFs differentially expressed under stress and control conditions. Some genes showed genotype-specific patterns of up- or downregulation in response to drought. More than 15% was regulated by drought stress in both genotypes, and less than 12% was specifically regulated in Tabassi or Taifun. 70 transcript-derived fragments was specifically expressed in Tabassi under drought stress, which can be considered as candidate genes for drought tolerance.
Keywords: Drought stress, cDNA-AFLP, wheat, transcript pattern
164

Samane Tavakoli *Ali Deljou Iraj Amiri bu ali sina university bu ali sina university medical university hamedan * alideljou@yahoo.com
: . . . . . : 600 300150 70 . ( 105 ) . . . . .SPSS : 75 150 600 . . 16 12 : . :
165

Samane Tavakoli *Ali Deljou Iraj Amiri Seyed Amir Ghiasian Bu ali sina university Bu ali sina university medical university Advisor * alideljou@yahoo.com
: . - ( ) . ) (Arum maculatum L. . 600 300 150 75 . SDA . ( ) . . 600 14 13 . . . :
166

Investigation of callus induction, regeneration and BYMV virus elimination by meristem tip culture in three cultivars of Gladiolus
Maryam Vahedi * Siamak Kalantari* Samaneh Yazdian* University of Tehran University of Tehran University of Tehran
* mary.vahedi@gmail.com, kalantaris@ut.ac.ir, vahedi213@gmail.com
Introduction: Gladiolus (Iridaceae) is a bulbous ornamental plant and has a great commercial importance in cut flower industry all over the world as well as in Iran due to its magnificent and colorful spikes. it propagates through the formation of daughter corms from the mother corm. Application of meristem tip culture for production of Gladiolus virus-free plants has been emphasized because of slow multiplication rate of corms and virus diseases as a major source of economic loss in the production. In this study callus induction and regeneration with the role of meristem tip size on percentage of BYMV elimination was examined . Materials and methods: Apical buds of Gladiolus corm were used for meristem tip excision. Fifty explants (five in each plate) were placed on solidified culture MS medium supplemented with Kin (0.5 mg.L-1) and 2,4-D (2 mg.L-1) for callus induction. in this medium subculturing performed three time and forth time performed in medium supplemented with TDZ (1 mg.L-1) and NAA (2 mg.L-1). After four subculturing (three weeks interval), the cultures were analyzed and then transferred to MS medium supplemented with BA (2mg.L-1) For shoot induction. finally Meristem tip cultures were analyzed with DAS-ELIZA for investigation virus elimination culture in three cultivars of Gladiolus . Results: The highest frequency of callus induction achieved from white cultivar in 1mm meristem tip size on MS medium supplemented with NAA (2 mg.L-1 ) and TDZ (1 mg.L-1) .In regeneration white cultivur showed miximum percentage in 1 mm meristem tip size in MS medium containing BA (1 mg.L-1 ( but no samples of red and pink cultivar remained for ELIZA test, they werent alive after four and two subculturing respectively. Frequency of elimination BYMV virus achieved (82.14%) in 0.5 mm size of meristem tip and (76.66%) in 1 mm size of meristem tip of white cultivar . Conclusion: From the results presented we may conclude that the best meristem tip size to eliminate BYMV virus from Gladiolus would seem to be to culture small meristems (0.5 mm) on medium . Keywords: callus induction, regeneration, BYMV virus elimination, DAS-ELIZA, Gladiolus
167
3rd International Student Biotechnology Congress Microbial and Industrial Biotechnology

Optimization of algal lipid extraction for biodiesel production (hexane)
Farzin Abbaspour Daryush Arabian* Mehrab Valizadeh Derakhshan Rasool Khalilzadeh Reza valizadeh Sahand University of Technology Malek Ashtar University of Technology Amir Kabir University of Technology Malek Ashtar University of Technology Amir Kabir University of Technology
* daryush_arabian@yahoo.com
Introduction : In this study, optimization methodology was established by defining two variables by which, an aliquot including three solvents with wide variety of proportions are being changed simultaneously to maximize the fatty acid extraction. Materials and methods : The applied experimental method was soxhlet and algal sp. Chlorella vulgaris was chosen to our investigation. Results : Results showed that hexane:acetone:methanol by 16:4:5 volumetric proportions respectively obtained maximum fatty acid extraction of 14.85wt.% over full factorial design. In this novel method, hexane vol. / (methanol vol. + acetone vol.) was defined as Impolar per Polar Ratio (IPR) and Methanol vol. / (methanol vol. + acetone vol.) was set to be Polarity Index (PI) ranging 0.286 to 2.00 and 0 to .6 respectively. Steps followed in the course of the experiments showed in Fig.1 according to soxhlet standard method. Conclusion : Results was discussed using Response Surface Methodology (RSM) and was ploted using Design-Expert 7.1.6 software package and shown in Fig.2. As can be clearly seen, IPR passes over a maximum value from about 1.4 to 1.7, also the optimum extraction wt.% increases by increasing PI reaching to 14.93% at PI and IPR of 0.551 and 1.750 respectively which corresponds to hexane:acetone:methanol of 16:4:5. Kinetic formula proposed by further analysis was shown in eq.1. Ext. wt.% = +3.16 + 3.7 * PI +13.4 * IPR -.95 * PI * IPR -4.4 *IPR2 (eq.1) The Model F-value of 78.40 implies the model is significant. There is only a 0.01% chance that a "Model F-Value" this large could occur due to noise.The values of Prob >F below 0.0500 indicated that the model terms were significant. The value of the coefficient of the multiple determination (R2 = 0.9515) could also explain the significance of the model. As the kinetic forlmula is also indicates, the triplicate extraction has dramatically affected by chloroform changes (IPR) yet the trend changes after an optimum amount Keywords : Hexane, Biodiesel, Fatty acid, Polarity, Soxhlet, Solvent Extraction
168

*Tahere abdoli jomor *Gholamhossein Ebrahimipour *Mohsen Shahriari Moghadam Maryam Sadeghi Shahid Beheshti University Shahid Beheshti University Shahid Beheshti University Shahid Beheshti University
* ta.abdoli@gmail.com, G-Ebrahimi@cc.sbu.ac.ir, mohsen.mshahriari@gmail.com
Introduction: . . . Materials and methods: . . Results: . %90 7 . . .

Conclusion: . .
Alcanivorax Keywords:
169

Cloning, Expression, Purification and in Silico Analysis of the Brucella Urease
Morteza Abkar Abbas Sahebghadam Lotfi* Jafar Amani Gholam Reza Nikbakht Brujeni Mehdi Kamali Tarbiat modares university NIGEB Baqiyatallah Medical Science University University of Tehran Baqiyatallah Medical Science University
* lotfi-ab@nigeb.ac.ir
Introduction : Brucellosis is a world wide spread zoonotic disease that is transmitted from domestic animals to humans. It is mostly caused by brucella (B), gram-negative, facultative intracellular bacterium. The most common route of brucella infection is through the gastrointestinal tract. The ability of a pathogen to resist killing in the acidic environment of the stomach increases the likelihood of intestinal colonization and invasion. The low pH of the gastric juices has been suggested to play a key role in the prevention of brucella infection, while proton pump inhibitors, antacids, and other drugs that decrease gastric acidity have been implicated in food-borne brucellosis. Urease enzyme activity is involved in the survival of bacteria in their transit through the acid contents of the stomach in a number of bacterial pathogens, such as Brucella spp. This enzyme has 3 subunits (alpha, beta and gamma) in Brucella genus. It has been shown that its alpha subunit is highly conserved among B. abortus, B. melitensis and B. suis (with 99% identity). Materials and methods : In this study, the Urease coding gene of Brucella spp was inserted in pET28a (+) plasmid with extra His-tag sequence. The integrity of the constructed plasmid was confirmed by colony PCR and digestion using specific restriction enzymes and sequencing.Additionally, in silico analysis was done on this protein. The structure prediction, examination of protein stability, primary sequence analysis, B cell and T cell epitope prediction of the construct were performed by bioinformatics tools. Results : Uraese was expressed after induction by IPTG in Escherichia coli BL21 (DE3). Recombinant Urease was purified by affinity chromatography through Ni-agarose.The results showed that this virulence factor has proper stability and immunogenicity. Many linear and discontinuous B-cell epitopes, MHC class I and II binding peptides were predicted on the protein structure. Conclusion : Since the mucosal surfaces of the body are the main routs of Brucella infection, mucosal-administered vaccines are preferred for coping with this pathogen. According to the results, application of this protein as a component of mucosal vaccine is suggested. Keywords : Brucellosis, Urease, Mucosal Vaccine
170

Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells in presence of Dimethyl sulfoxide
zahra sadat Aghili* sayyed hamid zarkesh-esfahani * zs_aghili@yahoo.com University of esfshsn University of esfahan and Isfahan University of Medical Sciences
Introduction : recombinant human Growth Hormone (rhGH) is a small, single chain peptide of 191 residues. rhGH is necessary for normal linear growth, but it is also affects many aspects of metabolism, so that is has been described as being anabolic, lipolytic, and diabetogenic. In contrast to bacteria or yeasts, mammalian cells are more advantageous for producing recombinant proteins since correctly folded and biologically active proteins are produced through the secretory pathway. The enhancement of recombinant protein expression of a transfected cell line is essential for the development of an efficient large-scale bioprocess. The productivity of mammalian cells is low in comparison with that of prokaryotic cells. Many stimulating chemicals were added in the culture to overcome this drawback such as Dimethyl sulfoxide (DMSO). DMSO stimulated stable transformed Chinese hamster ovary (CHO) cells to synthesize different recombinant proteins and repress their proliferation rate. The expressions of rhGH were increased after adding DMSO. The purpose of this study is Enhancement of human Growth Hormone Synthesis by DMSO Addition to Serum-Free CHO Cell Culture. Materials and methods : The rCHO cells producing rhGH were used in this study. The CHO cells were established by transfection of a vector containing human growth hormone gene under control of the CMV promoter. Cells were inoculated in 25 cm2 T-flasks at a density of 2.5105 cells per T-flask. The CHO cell growth medium was used to increase cell density. after 2 days the growth medium was removed and The T-flasks were then filled with the serum free medium for rhGH production and incubated under different concentrations of DMSO (0.5-2%) and then cell morphology, viability and rhGH production was assessed using flow cytometry, ELISA, western blotting and dot blotting. Results : Result and conclusion: In this study, DMSO (1%) was demonstrated to elevate the expression of rhGH in the stable transfected CHO cells. Conclusion : we have demonstrated that DMSO could easily enhance production of recombinant protein by CHO cells. Keywords : CHO cells, Serum Free Medium, protein production, ELISA, western blotting
171

PCR
*Mohammad Reza Ahsani Mehrdad Shamsaddini Bafti Amin Shahabi Department of animal science, Shahid Bahonar University of Kerman Razi vaccine and serum research institute of Kerman, Kerman Razi vaccine and serum research institute of Kerman, Kerman
* ahsani2001@gmail.com
Introduction: DNA PCR . PCR ( ) DNA . Materials and Methods: PCR C B A D ( ) DNA PCR . Results: PCR DNA 196 324 655 . PCR . Conclusion: PCR DNA . PCR PCR DNA PCR . PCR . . . PCR PCR . PCR PCR . Keywords: Clostridium perfringens, Direct PCR, DNA extraction
172

Optimization of amylase and protease co-produced by Bacillus licheniformis using economical medium
Elham Asghari Adib* Parvin Shariati* Mahvash Khodabande National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology
* beloved.vampirezero@gmail.com, shariati@nigeb.ac.ir
Introduction: In a world in which enzymes are on the wanted list of many industries, having the ability to co-produce two of the most needed enzymes, protease and amylase, using native strains and optimizing their activities by using complex economical medium can have a tremendous impact on our industry. Proteases account for 50-60% of the enzyme market, being utilized in pharmaceutical, food, and detergent industries. Amylases are needed in fermentation, textile, paper, detergent and sugar industries. Few reports describe the production and characterization of protease and amylase co-produced by the same strain. The contents of synthetic media are very expensive and if they can be replaced with more economically viable ones, such as agricultural byproducts, then industrial demands can be met at low costs. Materials and methods: In this study, Bacillus licheniformis GLU 113 (Accession No.: FN678352), a native strain isolated from an industrial site in Iran, was chosen for the production of both amylase and protease. Various types of complex materials such as whey powder, wheat bran, corn steep liquor, yogurt water, were used as carbon and nitrogen sources. This attempt can reduce the expenses, while yielding two valuable enzymes, protease and amylase. Optimization of enzyme production was carried out using Taguchi statistical method and one factor at a time technique was used to specify important factors. Results: The activities of these two enzymes were considerably enhanced using wheat bran and yogurt water. Protease activity rose from about 38 to about 600 U/ml while amylase activity increased from 2 to about 34 U/ml at the 30th hour of incubation. Conclusion: In conclusion, this study demonstrated that B. licheniformis GLU 113, native to Iran, was capable of co-production of two industrially important enzymes, protease and amylase. Maximum production of these enzymes was achieved when using a cost-effective medium that consisted of the agricultural by-products; wheat bran and yoghurt water. The results of this investigation are of great economic significance to the Iranian industry in the long run. Keywords: Amylase Protease Co-production Bacillus licheniformis Optimization Economical medium
173

Molecular detection of TEM-derived ESBLs and CTX-M gene in E. coli from fecal of canaries, lovebirds and pigeons in regions of Iran
Sara Barati* Morteza Azhdary Mamoreh university of shahrekord azad university of shahrekord
* sarabarati52@yahoo.com
Materials & Methods: Altogether 463 samples of bird faeces (180 canaries and 83 lovebirds,200 pigeons) were collected in spring of 2012 with sterile cotton swabs from different areas of Arak and Shahrekord and Ghaemshahr, under standardized procedures. The swabs were placed directly into TSB (Merck, Germany) and in laboratory streaked onto MacConkey agar (Merck, Germany) plates and incubated at 37C for up to 24 h. Suspect colonies screened by the MRVP tests. Isolates of E. coli were tested for detection of CTX-M gene and TEM gene by PCR. Results: The overall prevalence of E. coli in faeces was 62% (288 out of 463). TEM and CTX-M gene was not found in any samples. Conclusion: Birds or animals could serve as reservoirs of resistant bacteria and genetic determinants of antimicrobial resistance. Birds are colonized with various strains of E. coli are pathogenic for humans. Fecal strains of E. coli resistant to antibiotics have been found at various prevalences in bird populations. Our study suggests E. coli isolated from birds faeces is not source of CTX-M betalactamase and TEM beta-lactamase gene in the regions. Keywords: Escherichia coli- PCR-canaries-lovebirds
174

Survey Pathogenicity of Listeria monocytogenes and Listeria Ivanovii isolated from silage in mice
Sara Barati Morteza Azhdary Mamoreh university of shahrekord azad university of shahrekord
* morteza.vet15@yahoo.com
Objective: Listeria is a danger diseases that causes by using of not pasteurization foods. Two species, listeria ivanovii and listeria monocytogenes are importance pathogen. From public health point of view detecting and removing of this bacteria from foods distribution ways is important. This study is performed in order to investigation of pathogenesis of listeria ivanovii and listeria monocytogenes from silage, in the rats. Material and methods: After samples collecting Microbiology and chemicals tests performed for detecting this bacteria. 35 rats divided into 4 tests groups and 2 groups divided into positive control of bacteria and the last group was related to negative control. The bacteria was injected 0/1 cc to test groups. Results: one isolate of listeria ivanovii, 3 isolates of listeria monocytogenes were detected. All of the samples were pathogen. The bacteria were observed in different organ and Pathological changes in the liver, spleen. Conclusion: This bacteria in foods of animals can be a serious threat for general health and it is nessecery to pay attention to health of foods. Keywords: Listeria Ivanovii, listeria monocytogenes, Palkam Agar
175
176

Microbial bio-degradation of polyethylene
Krishnendu Bera* Hamideh Vaghari* Department of Biotechnology, Institute of Genetic Engineering, Kolkata-128, India Department of Chemical Engineering, Sahand University of Technology, Tabriz
* krishnendu39@gmail.com, vaghari_h@yahoo.com
Introduction : Biodegradation: Biodegradation is a process being broken down of products into innocuous sub-products, like CO2 & water, by the action of living things(microbes). Non-degradable polyethylene: Polyethylene consists of a very large number of macro-molecules, with a high molar mass. Because of this composition it's strong, tough & water-wettable. It's a combination of these characteristics that make it resistant to microbes. Factors affecting biodegradability: 1. Size, molecular weight & density of the polyethylene. 2. Availability of functional groups which increase the hydrophilicity and help in attachment of microbes. 3. Amount of crystalline & amorphous regions. 4. Structural complexity such as linearity of branching in polymer. 5. Molecular composition and blending. Materials and methods : Isolation of microorganisms from soil samples from different dumping regions by serial dilution method & cultured in nutrient media. The LDPE was collected and was measured 25 X 1 cm2 in area with 30mm thick. The initial weight of LDPE pieces were noted down. The LDPE pieces were sterilized by placing them in a desiccator along with 2ml formaldehyde for about 10hours. Then the pieces were treated with UV, heat for several hours to loose its tensile strength. Then tween-20, the synthetic surfactant was added to these pieces of LDPE to make those hydrophilic. Then the pieces of LDPEs were exposed to the microbes isolated from the soil samples from 80 days & during this subcultures done. After 20, 40, 60 & 80 days of treatment the weight of LDPEs taken. Results : The change of the average weight loss of LDPEs occurs during this microbes treatment. A 5% of weight loss in 40 days treatment and 9% of weight loss after 80 days treatment. Conclusion : We are further going to screening the microbes by 16s-RNA sequencing. Our work is going on & we are hoping for better result to stop pollution by degrading the polyethylene. Keywords : Biodegradation, LDPE, surfactant, hydrophilicity.
177

Stable immobilization of Aspergillus niger phytase on perlite; activity and stability
Mohammadtaghi Borjian Borujeni* Seyyed Omid Ranaei Siadat Shirin Yousefian Sohrab Moradi shahid Beheshti University shahid Beheshti University shahid Beheshti University shahid Beheshti University
* mtborjian@gmail.com
Introduction : Perlites (amorphous aluminum silicates) are an inert siliceous volcanic rock, with 2 to 5% of combined water that can be expanded up to 10-20 times its original volume when heated quickly at 760-1100C. Enzyme immobilization on a solid support has been proposed for simplicity, low cost and preservation of the enzyme/substrate specificity and also is a technique that has been demonstrated to prevent downstream contamination of the product and make enzymes more reusable. In this study, activity and thermostability of the immobilized enzyme were compared with soluble enzyme. Materials and methods : The surface of perlite were activated by 3-aminopropyltriethoxysilane and covalently bonded with A. niger phytase via glutaraldehyde. Enzyme activity has been assayed via Ammonium Hepta molibdate method by spectrophotometric technique. Results : Characterization of immobilized Enzyme on perlite, showed A. niger phytase can retain more than 95% of its activity after 5 times washing with deionized water. Thermal stability of the of immobilized A. niger phytase at different temperatures showed a slight decrease in A. niger activity at 80C in compared with non-immobilized phytase. Conclusion : In previous research, perlite was introduced as a cheap and plentiful substitution for monogastric animals mineral diet. Also it has been shown that perlite has great potential for immobilization of enzyme to increase enzyme stability. In this study we have shown that immobilized A. niger phytase on perlite with a high stability against washing, have a great potential to use as dietary supplement for monogastric animals in the industry. Keywords : Immobilization, perlite, phytase, A. niger
178

Multi Drug Resistance of Genomic Islands in Haemophilus influenza Isolated from Clinical Isolates of Iran
Mojgan Boroumand Seyed Davar Siadat* Shiva irani Saied Bouzari Zeinab Samari science and research branch of islamic azad uneversity Pasture Institute science and research branch of islamic azad uneversity Pasture Institute science and research branch of islamic azad uneversity
* d.siadat@gmail.com
Introduction : Haemophilus influenza is a gram negative rod-shaped bacterium that is classified the unencapsulated and the encapsulated. In special cases, large exogenous segments (10-200 kb) in bacterial genomes form genomic islands and one of the attributed functions to these genomic islands are antibiotic resistances. Materials and methods : The antibiogram tests were done by antibiotic resistances attributed to the integrons that consist of Amoxicillin (A), Ciprofloxacin (CIP), Ceftriaxone (CRO), Clindamycin (CD), Azithromycin (ATH), Chloramphenicol (C), Tetracycline (TE), Trimethoprim (TM) and Sulfamethoxazol (SXT). The 20mers primers were designed by gene bank data and they amplified a 594bp segment. Results : As total 20 number of H. influenza 95% to A, TE and C were resistant phenotypically and they have been exhibited as multi drug resistance. 63% of this 95% was recognized genotypically, having integrase gene attributed to genomic islands. Conclusion : Findings of this study, confirm Genomic Islands as an efficient strategy in order to gain of antibiotic resistance genes. Variations between phenotypical & genotypical results become justification because of different pathway for resistance engendering. Keywords : Haemophilus influenza, Genomic Islands, Multi Drug Resistance
179

Aspergillus Niger Aspergillus Niger
*Mohamad Dadgar Islamic azad univercity khorasgan branch-Isfahan- Iran
* dadgar.mohamadz@yahoo.com
.. , Introduction: . . Materials and methods: g/l140 :g/l NH4No3 - 1g/lNH2PO4- 0.25 0.05 - Mgso4.7H2o- 3g/l Cacl2 - 0.0006g/l Cuso4.5H2o 0.00025g/l Znso4.7H2o 0.00013g/l Feso4 30 rpm100 . 3 Aspergillus Niger Aspergillus Niger NRRL599 . pH 6.2-5 mg/kg 40 Aspergillus niger NRRL567 . . %60.2%8.1,%12.1, %8.2 . 4 4 Results: . .. g 30 . .. g/100g 44.9 g/l25 %v/v 3, g/l25 %v/v 3 144 . ,%70 28 ,pH 8 3,10 ml 72 . Keywords: Aspergillus Niger
180

Shahrzad Dehghani Far Mehrnaz Keyhanfar
Giti Emtiazi
univercity of Isfahan univercity of Isfahan univercity of Isfahan sh_dfar@yahoo.com
. 1925 . . 10 40 . . . . . . - . . 25 R 2 . 13 . . . . .
181

In vitro proteome analysis of an Iranian strain (NIGEB-088) of Xanthomonas citri subsp. Citri
Mahsa Eghbali* Dr Seyed Mehdi Alavi Dr Kambiz Akbari NIGEB NIGEB NIGEB
* mahsaeghbali2010@yahoo.com
Abstract: One of the most destructive diseases of citrus is canker that it is the most important factors in reducing plant production and currently seen in more than 30 countries with tropical and subtropical weather. Plant pathogenic bacteria of the genus Xanthomonas causes a range of diseases especially canker in crop plants. Three species of this bacteria that cause Asian canker are Xc-A with broad host range, A* and Aw strains with host range restricted to the Mexican lime (Citrus aurantifolia) and alemow (C. macrophylla) respectively. In Iran, alemow cultured extensively and A* strain is more important because of most economic losses. The most important aim of past and current research in molecular plant pathology is the recognition of bacterial virulence factors. The cytosolic, membrane and especially secretory proteins (Secretom) are essential factors that play a major role in the pathogenesis. So it seems that the evaluation of the proteins which contribute to the mechanism of pathogenicity of bacteria can be a way to control and eradicate this disease and proteomics as a useful method can be used to study and analysis of proteom. In this research, Iranian strain (NIGEB-088A*) of Xanthomonas was chosen to study of proteome. We develop a system for study of proteins involved in virulence in laboratory conditions with similar situations of plant. Therefore, Proteom of bacteria was studied under controlled conditions. For this reason Protein extraction was performed and Two-dimensional electrophoresis was carried out and results analyzed by using MELANI software. Keywords: MELANI, Xanthomonas, Secretom
182
183

Using microarray data to construct network and its analysis for kidney transplantation rejection
Sajad Esmaili Moein Yaqubi Shakour Mohammadnia Hossein Fallahi* Guilan NIGEB NIGEB razi university
* h.fallahi@razi.ac.ir
Introduction: One of the common problems with kidney transplantation is rejection of the tissue by the acceptor. Immune system of acceptor person expresses some proteins that consider donor kidney as a foreign agent and reject it. Microarray experiments can be used to monitor expression level of genes in cells. Application of this method to patients, researchers are able to recognize those genes that underwent any changes in their expression after transplantation process, that this change may be lead to rejection of kidney. Methods: In this study, mRNA expression pattern of the rejected kidney were followed. After analyzing near 23000 genes, expression pattern of them were obtained and classified in discrete groups include up and down regulated genes. Primary raw data obtained from SMD (Stanford Microarray Database). Different softwares were used in this study such as Microsoft Excel, XLSTAT.Add-Ins, Gene Cluster V.3, JavaTreeView, and Cytoscape. Many database and servers were used in this study include: GeneCards, BioGRID3.2, KEGG, Robeta (full-chain protein structure prediction server) and SAM-T08. Results: Network for genes with dramatically change in expression was constructed and it seems UBC and STAT1 genes have crucial role in network. Some of unknown genes for example GAGE12E and TMC8 were reported in this work. 3D structures were predicted for TMC8 (up regulated) and IQCK (down regulated) genes that their functions were unknown. Conclusion: Normalization, clustering and expression network analysis show good result and prove our approach in microarray data analysis. Keywords: gene expression, kidney transplantation rejection, network, protein structure
prediction
184

*Sajad Firuzyar Mojtaba Mohseni Ommeleila Nazari university of mazandaran university of mazandaran university of mazandaran
* firuzyar.sajad@yahoo.com
: . . - . : M9 28 2 c30 rpm180 . 48 . . . . pH . . MF2 38 Results: pH 5-10 . . : . :
185

Isolation of a Native Bacillus cereus Amylase Producer from Hot spring of sabalan mountain
Maryam Hosseini* Saber Zahri Saeed Latifi Navid university of mohaghegh ardabili university of mohaghegh ardabili university of mohaghegh ardabili
* bahar.rezvani90@yahoo.com
Abstract: Among various extracellular enzymes, -amylase is a commercially valuable enzyme which randomly cleaves the 1,4- -D-glucosidic linkages between adjacent glucose units in the linear amylose chain. An -amylase producing Basillus strain was isolated from hot springs of Sabalan mountain .The 16S rDNA was amplified and sequenced using universal primers and the isolate was characterized as B. cereus. The enzyme was purified to homogeneity by 55% ammonium sulphate precipitation, gel filtration and anion exchange chromatography recovery. The molecular weight of the enzyme was estimated to be 64 kDa by sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDSPAGE) and gel filtration. The enzyme was highly active over a wide range of pH from 9 to 11. The optimum temperature of the purified enzyme was70C. The amylase gene, which encodes the -amylase from B.cereus, was isolated and its DNA sequence was determined. Keywords: alpha amylase, purification, Bacillus cereus
186

Comparison of expression of single chain variable fragment of anti human CD4 receptor antibody fused to green fluorescent protein in two strains of Escherichia coli using flow cytomerty
Maryam Jamshidifar* Sayyed Hamid Zarkesh Esfahani Kamran Ghaedi Mehrnaz Keyhanfar university of Isfahan university of Isfahan university of Isfahan university of Isfahan
* jamshidifar_m@yahoo.com
Introduction : Antibodies are powerful tools to study protein function and localization and interaction. These molecules are also widely used for diagnostic and therapeutic purposes. Antibodies are usually conjugated to fluorescent molecules for research and diagnostic purposes which are termed fluobody. In this study, an anti-human CD4 single-chain antibody fragment (scFV) was cloned and genetically linked to the C terminus of the enhanced green fluorescent protein (EGFP) at cDNA level to generate an EGFP/scFV fusion protein. Different sets of expression vectors were constructed that permitted the efficient fusion and expression of CD4 scFV to EGFP. The effects of different strains of E.coli were also assessed in expression of the fusion protein and fluorescent emission of EGFP. Materials and methods : Different vectors including pAB1 and pCANTAB5E were used to clone the CD4 scFV EGFP. Escherichia coli strains, HB2151 and Origami, were transformed by these vectors and the level of expression was assessed using flow cytometry, fluorescent microscopy, SDS PAGE, dot blot and western bloting. Results : Several constructs of fluobody containing EGFP and CD4 scFV were cloned and expressed in different strains of E.coli. In HB2151 strain and in pCANTAB5E vector, expression of fluobody was higher than Origami strain and pAB1 vector. Conclusion : The present recombinant floubody is a bifunctional antibody which retains both antigen binding activity and its fluorescence simultaneously. Thus suitable strain such as HB2151 for high production of this fluobody seems to be required for appropriate purification of this fluobody for therapeutic and diagnostic applications. Keywords : Fluobody, green fluorescent protein, single-chain antibody fragment (scFv), Escherichia coli.
187

In vitro evaluation of co-aggregation effect of probiotic lactobacilli on mutans streptococci
Nayere Jebali* Mohammad Rabbani Mehrnaz Keyhanfar University of Isfahan University of Isfahan University of Isfahan
* n.jebali63@yahoo.com
Introduction: Co-aggregation ability of probiotic bacteria has a key role in their interference with oral biofilm and dental plaque. Species of Lactobacillus are able to co-aggregating with cariogenic bacteria (S.mutans, S.sobrinus). The aim of this study is investigating ability of probiotic lactobacilli on co-aggregation with cariogenic bacteria. Materials and methods: In this study, four strains of lactobacilli (L.casei, L.paracasei, L.reuteri, L.plantarum) as probiotics and two strains of Streptococcus (S.mutans, S.sobrinus) were used as caries pathogens. Their adherence and biofilm formation were initially investigated by microtitre plate assay and then assessed with spectrophotometry technique the co-aggregation was evaluated. Results: S.mutans and S.sobrinus showed strong and intermediate adherence respectively. All tested lactobacilli were significantly co-aggregation showed with pathogens. Conclusion: Our results demonstrate that according to co-aggregation feature of probiotics, they can be used for reduction the colonization of Streptococcus and number of these bacteria in biofilm and dental plaque. Therefore based on findings, probiotics may be used as effective agents against dental caries. Keywords: probiotic, cariogenic bacteria, co-aggregation, dental plaque
188
189

Microbial diversity of culturable halophilic and halotolerant bacteria from Urmia Salt lake
Fereshteh jookar kasha* Parviz Owlia Mohammad Ali Amoozegar Department of Biology, Shahed University, Tehran-Qom Express Way, Opposite Imam Khomeini's Shrine, Tehran-3319118651, Iran Department of Biology, Shahed University, Tehran-Qom Express Way, Opposite Imam Khomeini's Shrine, Tehran-3319118651, Iran Extremophiles Laboratory, Department of Microbiology, College of Science, University of Tehran, Tehran, Iran
* fereshtehjookar@yahoo.com
Introduction : Hypersaline waters, with salinities at or near saturation are extreme environments. They often maintain remarkably high cell densities and are biologically very productive ecosystems. Lake Urmia in the northwestern of Iran is one of the largest hypersaline lakes in the world and the largest lake in the Middle East. Halophilic bacteria have a worldwide distribution and have been isolated from a wide variety of habitats, including areas of high salt concentrations, e.g. saline lakes, saline desert soils, salterns, salt marshes, salt mines, salted hides or foods. Materials and methods : Diversity of halophilic bacterial from Urmia salt lake was investigated by the polymerase chain reaction(PCR) amplification and culture methods. As total, 11 water samples and 30 soil samples were taken from 41 sites in Urmia salt Lake in September 2011. Bacterial isolates were taken from the samples by using the conventional culture-dependent method and investigated by using phylogenetic analysis based on 16S rRNA gene sequence comparisons. Results : In total, 323 halophilies, including moderately halophilic bacteria and halotolerant bacteria were isolated from soil salt,water and sediment samples collected northwestern Urmia lake . Of these, 56 bacterial isolates were selected for sequencing and phylogenetic analysis, based on their growth characteristics and colony morphology. Conclusion : Results showed that 56 isolates represented 44 species, belonged to 18 genera of 17 families in three phyla (Actinobacteria 1.78%, Firmicutes 21.42%, Proteobacteria 75%). Keywords : Urmia Salt Lake, Microbial diversity, 16S rRNA gene, halophilic bacteria
190

*Hoda Khesali Amir Kabir University of Technology
* h.khesali@aut.ac.ir
: )(E.C 3.1.1 () . )(E.C 3.1.1.3 . ( ) . . . . : 7 . 24 48 K298 . 5 U mol1 . : . . : : - -
191

The Assessment of Substrate Preference of Microbial Biocatalysts in Biodesulfurization
Somayeh khosravinia* Mahmoud Akhavan-Mahdavi Ferdowsi University of Mashhad Ferdowsi University of Mashhad
* khosravinia2008@yahoo.com
Introduction : Desulfurizing bacteria can be classified in three categories based on the substrate preference. The first group of bacteria desulfurizes DBT and alkylated derivatives organosulfur compounds with more activity in comparison to BTs compounds, such as Rhodococcus erythropolis IGTS8 (Gallagher et al. 1993).The second ones prefer desulfurization of BT family sulfurous compounds to DBT family, Gordonia sp. 213E (Gilbert et al. 1998) and third group includes a few bacteria that can desulfurize both DBTs and BTs, Rhodococcus sp. KT462 (Tanaka et al. 2002). In this investigation, substrate range of desulfurizing bacteria isolated up to now as a microbial biocatalyst are analyzed and made an effort to give some rational reasons to justify differences of their substrate preference and desulfurization capability. Materials and methods : In order to design of the gene construct, a PET26 vector has been applied which encompasses a Kananmycine resistence gene. Three fragments of ELP, Intein and EGF should be inserted in the vector by some specific restriction enzymes respectively. So in each step, the fragment and vector has digested by its specific enzyme and has changed from linear form to the circular form and then has transformed to E.coli TOP10F by Calcium chloride biochemical method. Results : For each step, Colony PCR has implemented for confirmation of the fragment insertion. Conclusion : Finally, sequencing has confirmed the insertion of all fragments directly and SDS-PAGE has verified expression of EGF. Keywords : Intein-Epidermal Growth Factor-PET26-self splicing
192

Suitable strategies for heterologous expression and purification of membrane proteins
Baharak Mahyad* Valliolah Babaiepoor Ali Asghar Deldar S. Khanchezar Majid Mogbeli
Tehran University Malek-e-Ashtar university Malek-e-Ashtar University Malek-e-Ashtar university Islamic Azad University of Damghan
* Baharakmahyad@yahoo.com
Introduction: Although membrane proteins represent 1% of total cellular proteins, they are target of 50% of drugs. This group of proteins, which have hydrophobic structure, appeals scientists interest because of their structural and functional advantages and also their importance in cellular process. Materials and methods: Membrane proteins have critical role in treatment of several diseases like cystic fibrosis, epilepsy, cancer, heart attack, hypertension and Alzheimer disease. Study of these diseases is limited by shortage of information about structure of membrane proteins. Production and purification of membrane proteins is the major problem in these studies Results: In addition, trans-membrane proteins contain several alpha helix structures and their hydrophobic nature makes it impossible to use ordinary methods for these researches. Conclusion : Furthermore, study of membrane proteins needs huge amount of pure protein. Heterologous expression of membrane proteins is a suitable method to produce them. This article focuses on difficulties of heterologous expression and purification of membrane proteins and introduces some solutions to improve this method. Keywords: words: Membrane protein, alpha helix, heterologous expression
193

Effects of phosphate limitation on Saccharomyces cerevisiae gene expression pattern and its expression network analysis
Mohammadshahir mohammadnia Mehrdad Azizian Moein Yaqubi Shakour Mohammadnia Hossein Fallahi* shahroud university( azad) shahroud university( azad) NIGEB NIGEB Razi university(Dr)
* h.fallahi@razi.ac.ir
Introduction: Saccharomyces cerevisiae is simple eukaryotic model organism that used by many researchers in last decades. Several databases store microarray data from different labs and groups. Data accumulation, allow much more analysis using statistical methods in in silico. In recent years widespread usage of microarray data and bioinformatics tools shows its high ability to detection cellular condition according to expression values. Methods: Microsoft Excel and XLSTAT.Add-Ins are used for normalization and PCA (Principle component analysis) respectively. Gene Cluster 3.0 and JavaTreeView used for clustering and visualization of its result. Network constructed by Cytoscape and complementally data gained from yeast genome database, KEGG, Uniprot, BioGRID3.2. VB macro codes used several times in this study for managing data. Expression networks for up and down regulated genes were constructed. Results: Important nodes and edges for each network (up and down regulated genes networks) identified and combined for making final network that show down regulated genes are ribosomal proteins, so these down regulation results in decreasing protein production, cell growth and proliferation and in other hand genes that were up regulated in our network including: AHP1, CTT1, GRE1, SIP18 and, these genes induced by phosphate limitation stress and other streses.TKL2 is one the up regulated genes in response to this stress that involved in pentose phosphate pathway. Conclusion: This method perfectly show phosphate limitation affect protein synthesis, cell growth, and over expression of stresses induced genes. Keywords: gene expression network, phosphate limitation, Saccharomyces cerevisiae
194

Antibacterial activity of methanol extract of the leaves and fruit of Chenopodium foliosum (Moench) Asch against four strains of Gram-negative pathogenic bacteria
Somayeh Moradi* Ali Deljou Khosro Piri Bu Ali Sina, Hamedan Bu Ali Sina, Hamedan Bu Ali Sina, Hamedan
* smy.mrd85@gmail.com
Abstract: The main objective of this study was to evaluate antibacterial activity of methanol extracts of the leaves of Chenopodium foliosum (Moench) Asch is against against some pathogenic bacteria. Chenopodium foliosum (Moench) Asch) is grasses and annuals of the chenopodiaceae family. Methanol extracts of the leaves aof the plant were taken after collection and drying. Antibacterial properties of the extracts was determined using disk diffusion. Results showed that the extract had a positive effect on the bacteria used and bacteria is a function of concentration of Venice. That had the greatest effect on used bacteria had more effective on the bacteria Proteus vulgaris. Results show that Chenopodium foliosum (Moench) Asch has significant antibacterial compounds Keywords: Antibacterial, Chenopodium foliosum (Moench) Asch,Extract
195

Molecular cloning of Fusion of GP96gene and Kinetoplastid membrane protein-11(KMP-11) of Leishmania infantum in pET28a vector as a candidate for vaccine preparation against visceral leishmaniasis
Vahid Nasiri* Abdolhossein Dalimi Fatemeh Ghafarifa Azam Bolhassani Department of Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Hepatitis & AIDS, Pasteur Institute of Iran, Tehran, Iran
* v.nasiri@modares.ac.ir
Introduction : The protozoan parasites of the genus Leishmania are the causative agents of the various clinical diseases. Causative agent of visceral leishmaniasis in Iran is Leishmania infantum and currently Visceral Leishmaniasis is seen as endemic disease in some areas of Iran. Because of the importance of this disease creating new drugs or vaccines for this disease is necessary. Materials and methods : Kmp-II gene from L. infantum (MCAN/IR/07/Moheb-gh) DNA and NT-Gp96 from pBluescript plasmid amplified by PCR and the purified PCR products were cloned into the pJET1.2/blunt plasmid vector and then subcloned into puc18 plasmid vector. The KMP- gene was fused with GP96 (immunologic adjuvant) and this combination cloned in puc18. This fusion then subcloned into pET28a vector. Results : KMP-11and NT-Gp96 genes were cloned successfully into the pJET1.2/blunt and puc18 cloning vectors. KMP-GP96 Fusion cloned successfully into pET28a.all cloned genes confirmed by enzymes digestions. Conclusion : KMP- (Kinetoplastid membrane protein- ) exists in all species of kinetoplastid family and is fully protective and the protein that products by this gene can induction very high cellular immune response. It has been frequently reported that gp96 acts as a strong biologic adjuvant.In conclusion we successfully cloned all construct including fusion of two genes in pET28a vector for future use as vaccine. Keywords : KMP- , GP96, Leishmania infantum, vaccine
196

Design of a gene construct by Intein self-splicing properties in order to EGF protein expression in E.coli
Asghar parsaei Nogol omoumi Mohammad Ali shokr gozar* Zahra nourmohammadi Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran National cell bank pasteur institute of Iran Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran
* mashokrgozar@yahoo.com
Introduction : Main axis of tissue engineering is reconstruction of damaged tissues. Growth factors are among of essential parts of this technology. So EGF(Epidermal Growth Factor)applies for production of connective and epithelium tissues and also artificial derm. Intein protein by selfsplicing properties has eliminated the necessity of proteases for purification of recombinant proteins and it has led to a significant cost reduction in comparison to absorption chromatography. By use of this method, we are able to produce and purify recombinant proteins such as EGF without chromatography columns. Achievement to this technology can caused to production and purification of other recombinant proteins by minimum equipment and cost. Materials and methods : In order to design of the gene construct, a PET26 vector has been applied which encompasses a Kananmycine resistence gene. Three fragments of ELP, Intein and EGF should be inserted in the vector by some specific restriction enzymes respectively. So in each step, the fragment and vector has digested by its specific enzyme and has changed from linear form to the circular form and then has transformed to E.coli TOP10F by Calcium chloride biochemical method. Results : For each step, Colony PCR has implemented for confirmation of the fragment insertion. Conclusion : Finally, sequencing has confirmed the insertion of all fragments directly and SDS-PAGE has verified expression of EGF. Keywords : Intein-Epidermal Growth Factor-PET26-self splicing
197

Antibacterial activity of Echium amoenum aqueous and ethanolic extracts
Parastoo Sabaeifard* Bahare Attaran Samin Malekmarzban Sogol Yarahmadi Alzahra University Alzahra University Zoha Educational Complex Zoha Educational Complex
* sabaei60@yahoo.com
Introduction : Because of inappropriate use of antibiotics all over the word, microorganisms become more and more resistant to these compounds, so finding new antimicrobial agents is of particular importance. Echium amoenum (Borage) is one of the medicinal plants which has long been used as a tonic, tranquillizer, diaphoretic, a remedy for cough, sore throat and pneumonia in traditional medicine of Iran. According to these applications it is acceptable to account Echium amoenum as a proper candidate in search for finding new antimicrobial agents. Materials and methods : To investigate the antimicrobial activity, the aqueous and ethanolic extracts of Echium amoenum were prepared in distilled water and absolute ethanol, respectively. The extracts were sterilized by filtration and then their antibacterial activity against Staphylococcus aureus ATCC 1112, Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 was evaluated through Agar Disk Diffusion (CLSI M2-A9) and Microdilution methods (CLSI M7-A7). On next steps, extracts dry weight, MIC, MBC and synergistic effects with 9 different antibiotics have been estimated. Results : Results show that the aqueous extract is not effective against P. aeruginosa in concentration of 45.4 mg/ml, but it is able to inhibit the two other bacteria (inhibition zone diameter: 30mm). Among the 9 different tested antibiotics, Ampicillin shows synergistic effect with the aqueous extract against S. aureus (P value: 0.038). Also, the MIC and MBC of the aqueous extract were estimated more than 11.47 mg/ml. In case of ethanolic extract, no antibacterial effect has been seen against the pre-mentioned microorganisms in concentration of 11.7 mg/ml. Conclusion : Due to bacterial resistance to many of common chemical antimicrobial drugs, herbal drugs with antimicrobial effects are of interest. The results of this study shows that the Echium amoenum aqueous extract has remarkable antimicrobial activity against tested microorganisms which could be suggested to be studied more to find the effective compound(s). Keywords : Echium amoenum , Antibacterial, Aqueous and ethanolic extracts.
198

Evaluation of Molecular Farming Industry in the Production of Recombinant
Amin Sadeghi Alikelayeh* Seyed Kamal Kazemitabar Roja Gholinezhad Simin Azoush
University of Zabol Sari agriculture and natural resourses University Payamnour sari University Sari agriculture and natural resourses University
* aminsadeghi2012@gmail.com
Introduction: Biodrugs and proteins produced by the plant are called molecular farming. Transgenic plants to produce cheap and useful and interesting Bioreactors are considered as active recombinant macromolecules such as blood components, vaccines, growth factors, antibodies and enzymes Materials and methods: Insulin is a polypept ide with 51 amino acids, containing two distinct chains ), (. Preproinsulin is as a raw material in the production of proinsulin. Proinsulin is main use for the treatment of diabetes. At first step of proinsulin production we need to ligation enzymes, expression vectors, restriction enzymes, PCR, gene cloning, lettuce, agrobacterium and antibiotic. Results: Traditional production systems are drawbacks for recombinant pharmaceutical proteins from Fer mentation microbial, insect and mammalian cell culture and transgenic animal use, in terms of cost, production levels, production safety and product integrity [5]. Research is underway to examine the possibility that replacing the plant system instead of other systems. Conclusion: Traditional production systems are drawbacks for recombinant pharmaceutical proteins from Fer mentation microbial, insect and mammalian cell culture and transgenic animal use, in terms of cost, production levels, production safety and product integrity [5]. Research is underway to examine the possibility that replacing the plant system instead of other systems. Keywords: Molecular farming, Recombinant protein, Insulin
199

*Maryam Sadeghi Haddad *Gholamhossein Ebrahimipour *Mohsen Shahriari Moghadam Tahere abdoli Shahid Beheshti University Shahid Beheshti University Shahid Beheshti University Shahid Beheshti University
* sadeghi.zavareh@gmail.com, G-Ebrahimi@cc.sbu.ac.ir, mohsen.mshahriari@gmail.com
: . . . : . . : ( ) ( )... 10 . : . . . :
200

:
Mohaddeseh Salehghamari *Mojtaba Mohseni mohammad javad Chaichi university of Mazandaran university of Mazandaran university of Mazandaran
* m.mohseni@umz.ac.ir
: . . . . : 22 . . luxA . luxA . luxA . S 16 rDNA . : . 16SrDNA %99 . . . : S rDNA 16 . 900 S rDNA 16 .

: luxA
201

Quantitative competitive PCR assay for detection of Lactobacillus acidophilus in probiotic yogurts
Monir-Sadat Shakeri* Fakhri Shahidi Ali Mortazavi Ahmadreza Bahrami Mohamadreza Nassiry Department of Food Science and Technology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran Department of Food Science and Technology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran Department of Food Science and Technology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran Cellular and Molecular Research Group, Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran. Department of Animal Science, Excellence Center for Animal Science, Ferdowsi University of Mashhad, Mashhad, Iran.
* shakerim89@gmail.com
Introduction: Reliable determination of probiotic bacteria in functional foods is very important. In recent years, a range of PCR-based assays has been developed for identification and enumeration of bacteria in foods including competitive PCR. It involves the co-amplification of a target DNA sample with known amounts of a competitor DNA. This technique is both reliable and simple to perform. Materials and Methods: In this work, a 227-bp fragment of the 16s rDNA gene of Lactobacillus acidophilus was chosen as a target for PCR amplification. For construction of the competitor a 150 bp fragment was designed to contain target-related primers binding sequences at ends encompassing a phage sequence. This fragment was generated by amplification of the phage DNA with hybrid primers in which the 5 ends of phage-related primers contained a target-related primer sequence. The PCR products were cloned into a plasmid. The plasmids were purified and used as competitor. This competitor DNA was serially diluted and co-amplified by PCR with total DNA from yogurt sample. The PCR products generated were separated on a 2% agarose gel containing ethidium bromide, and photographed to determine of intensities of bands. Results: PCR amplification of the phage DNA using hybrid primers produced the expected size (150 bp) which was then cloned successfully into the plasmid. Co-amplification of DNA from yogurt, with dilutions of the competitor resulted in a linear relationship with a high correlation (R2 =0.97). Conclusion: Our results indicated that the target and competitor DNAs were amplified with an appropriate equivalent efficiency and this competitor can be used for counting of Lactobacillus acidophilus in dairy products. Keywords: competitive PCR, Lactobacillus acidophilus, yogurt
202

Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas fluorescens) in increase growth parameters of maize
Shayan Shariati* Hossein Ali Alikhani university of Tehran university of Tehran
* shayan_shariati@ut.ac.ir
Introduction : The high cost of fertilizer production and environmental pollution caused by the use of these fertilizers makes necessary to use other sources especially bio fertilizers. Soil biotechnology has opened up new possibilities concerning the application of beneficial bacteria in the soil for the promotion of plant growth. Materials and methods : The aim of this study was to evaluate the survival of Pseudomonas fluorescence as a phosphate solubilizing bacteria on different organic and inorganic carriers, including Vermicompost, perlite, Rock phosphate, bentonite and three formulations of these materials and their impact on growth indicators of maize. In this study, the mentioned carriers were inoculated with Pseudomonas fluorescence, inoculants were held for 180 days and the bacterial population were measured through CFU method. Then inoculants were used for greenhouse culture of maize through soil inoculation method.The experiment was conducted based on completely randomized block design with 40 units. After 60 days of plant growth, some growth parameters of maize including phosphorus in the soil and shoots and zinc in shoots were measured. Statistical and Data Analysis were done using SAS 9.2 software and comparison of means was conducted using Duncan's multiple range test at five percent level Results : The results showed that although Triple superphosphate treatments was better in the mentioned factors, in many cases the two top inoculants ie vermicompost and vermicompost+ perlite + bentonite treatments were not significantly different from Triple superphosphate treatment (p>0.05) . Some factors including chlorophyll, phosphorus of soil and shoot of two top inoculants were higher than simple superphosphate treatment. In some factors are also significantly different (p<0.05) Conclusion : According to the results can be expressed the use of Pseudomonas fluorescens bacteria as a phosphorous solubilizing bacteria with vermicompost as a carrier matter and a plant growth stimulating matter in manufacturing phosphorus bio-fertilizer caused to increase plant growth indicators and phosphorous in shoot of maize. This would herald a new day in the blossoming of soil biotechnology, bio-fertilizer production and fertilizer consumption reduction. Keywords : Biofertilizer, Carrier, Maize, Pseudomonas fluorescence, Vermicompost
203

Design and Construction of Rotary Biological Contactor (RBC) for enhancement of microbial cellulose Production
Ali Soleimani * Valiollah Babaeipour Motahareh Rouhi Malek Ashtar University of technology Malek Ashtar University of technology Malek Ashtar University of technology
* s.ali4017@gmail.com
Abstract: Production of microbial cellulose is receiving great attention since microbial cellulose is comparable to the synthetic cellulose, source of medium is abundant and cellulose has wide applications. Furthermore, the use of trays for static fermentation in traditional method is not economical, laborious and the up-scale process for high yield productivity is limited. This study aims to develop a practical methodology for enhanced production of microbial cellulose by designing a Rotary Biological Contactor (RBC) using A. xylinum. One of the major factors that determine the success of fermentation process is aeration during fermentation. Therefore, RBC widely used in wastewater treatment in order to exposing the bacteria to oxygen for better aeration. This reactor consists of an array of discs that is mounted to a shaft. The shaft is connected to a driven motor so that the rotation of the shaft together with the discs is achievable and controllable. The discs on the shaft are positioned in a horizontally set through that contains a biological medium in which at least a portion of the contained discs are being submerged. In the preliminary study of discs selection, discs made from stainless steel gave the highest result compared to others. To study effect of rotation speed in RBC, fermentation in prepared sucrose medium had been carried out at the rotational speeds of 7, 9 and 11 rpm. It was found that rotational speed gives significant effect towards microbial cellulose production where fermentation in RBC using 7 rpm gave the highest microbial cellulose production of 149.12gram per liter substrate. RBC could give better aeration process compared to static fermentation. However, too much Dissolved Oxygen resulted from too high rotational speed resulted in decrease of microbial cellulose production in RBC as this affected the stability of the culture. Hence, it can be concluded that fermentation using RBC did not depend solely on dissolved oxygen in the medium as the rotation of discs permitted direct exposure to air for A.xylinum during the fermentation process. Keywords : Rotary Biological Contactor (RBC)- Microbial cellulose- Fermentation- A. xylinum
204

Production of truncated recombinant nmp22 protein reactive towards commercial antibody and inducing immune system for polyclonal response
Sepideh Sookhtehzari Masoud Javanmardi Mohammad Javad Rasaee* TMU TMU TMU
* rasaee_mj@yahoo.com
Introduction : Introduction: Bladder cancer is the most common malignancy of the urinary tract. The early diagnosis of bladder cancer is central to its effective treatment. Nuclear matrix protein 22 (NMP22) is a part of the internal structural framework of the cell nucleus.NMP22 is shed into the urine and has a 20 to 80-times higher concentration in the urine of the patients with bladder cancer compared to noncancerous controls. In this study we have produced truncated recombinant NMP22 consisting immunodominant epitopes in order to develope immune response in animal model to improve the specificity and efficacy of detection. Materials and methods : Materials and method: NMP22 sequence was obtained from Genbank, based on literature available . Immunodominant epitopes which are located between residues 1 to 300 was reverse translated and optimized for expression in E.Coli cells using Genescript software. The resulting sequence was then synthesized, cloned into pGS21a vector which contains hexa His fusion tag and was expressed in BL21(DE3) cells. The expressed protein was observed by SDS-PAGE electrophoresis and Western blotting was performed in order to confirm expression by using HRPconjugated anti-His antibody then the protein was purified using Nickel column purification system. ELISA was done to evaluate the reactivity of commercial anti-NMP22 antibody towards truncated protein. Then the antigen was injected and polyclonal antibody response was observed . Results : Result: SDS-PAGE results showed that the truncated NMP22 was successfully expressed in BL21 cells, the corresponding 61KDa protein was clearly visible in samples obtained from induced BL21(DE3)/pGS21a-tNMP22 while it was absent in samples from non-induced and plasmid free negative control bacteria.The expression of truncated NMP22 was confirmed by western blotting using anti- His antibody on nitrocellulose membrane. ELISA result showed the specific reactivity of commercial NMP22 antibody towards truncated NMP22 compared to negative controls . Finally the antigen was used to produce polyclonal antibody response. Conclusion : Conclusion: In conclusion, truncated NMP22protein could be a remarkable tumor marker which can be used to early diagnosis of bladder cancer, additionally an assay based on immunologic reaction can be designed to detect native antigen in urine samples. Keywords : bladder cancer,truncated NMP22
205

The effectiveness and enzyme potential of honey for inhinition of growth on Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli
Fatemeh Taheri* azad univercity of lahijan
* marina_t2011@yahoo.com
Introduction : Honey has long been an effective agent in the treatment of skin diseases, ulcers, throat infections, diseases of the respiratory system and is known today largely for this property can be attributed to the enzyme glucose oxidase. Due to the increasing rate of antibiotic resistance in recent years trying to find alternative drugs especially from natural resources expanded. In this study, the antibacterial effect of honey on Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli (3 resistant bacteria to antibiotics) has been investigated . Materials and methods : After collecting 18 species of honey from different plant sources and in different parts of the country , acidity measured with pH meter and to determine the amount of sugar we used Parsazmoon suger test . then MIC and MBC determined by the disk diffusion method and amounts of MIC and MBC was confirmed with turbidimetric method. Then, amount of glucose oxidase was mesured using the enzyme glucose oxidase test and the OD measured spectrophotometrically was compared with the MIC results. Results : Among the 18 different kinds of honey, 16 types were effective on Staphylococcus aureus the highest amounts of MIC = 0/01% and MBC = 0/001% and the lowest MIC = 0/1% was determined. All honey were effective against Escherichia coli and MIC = 6/25% and MBC = 3/125% was determined. 11 species of honey were effective on Pseudomonas aeroginosa and the highest MIC =12/5% and the highest MBC = 6/25% was determined. A direct relationship was observed between the amount of MIC and the concentration of glucose oxidase . Conclusion : this study showed that the anti-bacterial properties of honey are well effective particularly on Staphylococcus aureus and honey is an effective alternative to antibiotics to treat infected wounds, burns, sore throat and etc . Keywords : Honey. Anti-bacterial, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli
206

Identification of GABA production by Lactobacillus casei and Lactobacillus parcasei and characterization of their glutamate decarboxylase gene
Yasaman Tavakoli* Abolghasem esmaeili Mohammad Rabbani university of Isfahan university of Isfahan university of Isfahan
* yasaman.t1988@yahoo.com
Introduction : Gamma-amino butyric acid (GABA) is a non-protein amino-acid that possesses several physiological functions such as neurotransmission, induction of hypotensia, diuretic and tranquilizer effects. GABA can be synthesized by different pathogenic and nonpathogenic bacteria. Production of GABA-enriched products by lactic acid bacteria has been a focus of researches in recent years because of their safety and health-promoting specifities. In lactic acid bacteria GABA is synthesized in acid stress condition by the pyridoxal 5-phosphate-dependent enzyme, glutamate decarboxylase (GAD). Although most of Lactic acid bacteria are capable of GABA production, the amount of this product is variable among different strains and it dependents extremely on the type of strain and growth condition. In this study, The GABA production in two local strains, Lactobacillus casei and Lactobacillus paracasei, was assessed by using different methods. In order to comparison of gad gene of these strains with other Lactic acid Bactria, genomic DNA fragments containing gad gene were isolated and ligated into cloning vector for further sequence analysis. Materials and methods : Lactobacillus casei and Lactobacillus paracasei were incubated in MRS medium containing 1% glutamic acid at 30 0C for 24 h then produced GABA was analyzed by HPLC and TLC. In order to clone the gad gene from these strains, the PCR method was used for cloning. PCR was carried out using primers designed based on conserved regions. The PCR product was purified and ligated into PGEM-T vector. Results : Results of TLC and HPLC show that both strains can produce GABA especially at acidic pH but the ability of GABA production is higher in Lactobacillus paracasei. PCR products also confirm presence of gad gene in both of them. Comparison of obtained sequences shows that this fragment codes the pyridoxal 5-phosphate binding region and is very similar to other bacteria like Ecoli and Lactobacillus brevis. Conclusion : The results from this study suggested that these strains could be used for the industrial production of GABA and also for development of functional fermented foods. The conserved PLP binding region can also be manipulate by mutation to either decrease or increase the activity of enzyme in pathogens and nonpathogens bacteria. Keywords : Gamma-amino butyric acid (GABA), Lactobacillus casei, Lactobacillus paracasei, glutamate decarboxylase
207

Construction of an Eukaryotic Plasmid Encoding ESAT-6 gene of Mycobacterium Bovis as a Candidate for DNA Vaccine
Azam Torabi Mojtaba Tahmoorespour Fatemeh Vahedi* Nader Mosavari Mohammad Reza Nassiry Ph. D Student, Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad. Mashhad, Iran. Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad. Mashhad, Iran. Department of Biotechnology, Razi Vaccine and Serum Research Institute, Mashhad, Iran. Department of PPD production, Razi Vaccine and Serum Research Institute, Karaj, Iran. Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad.
* vahedif@yahoo.com
Abstract: Mycobacterium Bovis is the agent of bovine tuberculosis in a range of animal species and human beings. For the cattle and other animals, after incubation of BCG, the results of allergic detection will always be the positive, so artificial immunization and natural infection are difficult to differentiate. Furthermore, it will affect the bovine quarantine and international trade, so we must develop a kind of new vaccine to prevent the bovine tuberculosis. DNA immunization With Plasmid DNA bacterial, Viral, Parasitic and tumor has been reported to trigger protective immunity. During the last decade, DNA vaccines have been developed against several viral, bacterial and parasitic infections. The ESAT-6 protein of Mycobacterium Bovis is an important structural and functional protein. Recent advances in immunology and the molecular biology of Mycobacterium identification of a large number of antigens with potential for development of new tuberculosis vaccine has been accomplished in recent years. In addition to the induction of immunity, DNA vaccine, Non viral vectors (plasmids) are preferred offer several advantages such as ease of production, stability, low immunogenicity reliable, cost effectiveness and the overall flexibility of the vaccine platform. In the current study, a partial sequence of protective antigen of Mycobacterium Bovis, as potent immunogenic target was selected. The DNA encoding this segment was utilized in the construction of pcDNA 3.1(+)/ESAT-6 plasmid. After intramuscular injection of BALB/c with pcDNA 3.1(+)/ESAT-6 plasmid the expression of ESAT-6 gene was assessed at RNA and protein levels. The integrity of pcDNA 3.1(+)/ESAT-6 plasmid construct was confirmed with restriction enzyme analysis and sequencing. ESAT-6 gene was successfully expressed at RNA and protein levels. Our results indicate that pcDNA 3.1(+)/ ESAT-6 plasmid Eukaryotic expressing vector could be a candidate for DNA vaccine against tuberculosis bovis. Keywords: Mycobacterium Bovis, ESAT-6, Eukaryotic plasmid, DNA vaccine
208

Developing of effective enzyme based biofuel cells
Hamideh Vaghari* Somayeh Vahidi Rad Azam Aydani Hoda Jafarizadeh-Malmiri Faculty of Chemical Engineering, Sahand University of Technology Faculty of Chemical Engineering, Sahand University of Technology Faculty of Chemical Engineering, Sahand University of Technology Faculty of Chemical Engineering, Sahand University of Technology
* vaghari_h@yahoo.com
Introduction : Fuel cells have been identified as one of the most promising and potent technologies which meet energysecurity, economic growth, and environmental sustainability requirements. Fuel cells are electrochemical devices that convert chemical energy intoelectrical energy. In some cases, they need expensive metal catalysts such as Pt, Pd making them uneconomical or very expensive. Biofuel cells are a subset of fuel cells that employ biocatalysts such as amicrobe, enzyme, or even organelle interacting with an electrode surface. Materials and methods : Biofuel cells like other ones require porous anode and cathode structures that support fueltransport to the catalyst reaction sites. The main types ofbiofuel cells are defined by the type of biocatalyst. Microbial fuel cells employ living cells to catalyze theoxidation of the fuel, whereas enzymatic fuel cells (EFCs) use enzymes for this purpose. In EFCs, expensive metal catalysts are replaced with cheap enzymes. EFCs possess several positive attributesfor energy conversions, including renewable catalysts, flexibility of fuel sand the ability to operate at room temperature. They also have the advantage of specificity. Results : However, EFCs remain limited by short lifetimes due to the fragile nature of the enzymeand low efficiency, as only asingle type of enzyme is employed and can only partially oxidize the fuel. Recent advancesin biofuel cell technology, include methods to increase lifetime and environmental stability. Firstly, anodes should possess multidimensional and multidirectional pore structures. Secondly, the successful immobilization of multi-enzyme systems is needed. Finally, the anode must supportefficient charge transfer mechanisms, whether it is direct or mediated, and balance electron transfer withproton transfer. Conclusion : The two main application areas that are being considered for EFCs are in vivo, implantable power supplies for sensors and pacemakers and ex vivo power supplies forsmall portable power devices (wireless sensor networks, portable electronics, etc.). Although fuel cell technology has matured substantially over the past decades, EFCs are still in anearly stage of developmentand some technological barriers, such as insufficient durability, cell life time, still delay commercialization in many applications. Keywords : Biofuel cell, biocatalyst, enzymatic fuel cell, energy
209
3rd International Student Biotechnology Congress Molecular Biotechnology

* *
**
noparvar_kheirandish@yahoo.com
**
G-ebrahimi@cc.sbu.ac.ir
: . . : . . . . . : . . . .. . . . . . . : . . . . : Bacillus pumilus
210

M13 GFP
Seyyedeh Elham Abedheydari *Mohammad Khalaj-Kondori university of tabriz university of tabriz
MohammadAli Hosseinpour Faizi university of tabriz

*
khalaj@tabrizu.ac.ir
: . . . M13 GFP . : ( )GFP pCMV Script EX M13 . AGS PCR GFP . : M13 AGS GFP . : . .
: M13
211

Analysis of intratype E6 variants of Human papillomavirus type 31, 52 and 58 in Indian HIV-positive women with different cervical disease status: a pilot study
Neda Asiaie
* *
National Institute of Virology
nasiabi@yahoo.com
Introduction: The E6 oncogene of Human papillomavirus (HPV) is critical to the process of immortalization and transformation of host cells. Recent reports suggest that variants in this gene may contribute to the risk of malignant progression of cancer in the uterine cervix. The variation of the E6 region of HPV16 is associated with a high risk for cervical carcinogenesis. To see whether the same is the case with HPV31, 52 and 58, known to have high homology with HPV16, we analyzed the E6 sequence variation of these HPVs in Indian HIV-positive women with different grades of cervical disease Materials and methods: A total of 278 HIV-infected women underwent cervical cancer screening and collection of cervicovaginal samples for detection of 37 HPV genotypes by Linear Array polymerase chain reaction assay. The genomic diversity within the E6 oncogene of HPV 31, HPV 52 and HPV 58 isolated were investigated using direct polymerase chain reaction-sequencing. Results: HPV genotypes were present in 52.5% )146/278( and carcinogenic HPV genotypes were present in 35.3% (98/278) HIV-infected women. The carcinogenic HPV types in declining order of prevalence included HPV 16, 56, 18, 39, 35, 51, 31, 59, 33, 58, 68, 45 and 52. A total of 10 genomic variants in HPV 31 were identified. The commonest mutations were A320T and C520T. A total of 12 genomic variants of HPV 52 were identified. The commonest mutation was G375T. Only a single genomic variant (C332T) in HPV 58 was identified. The genomic variants were more frequently observed in women with higher grade cervical lesions compared to those with normal cytology, P>0.05. Conclusion: Several novel mutations were identified in all three genotypes examined. In summary, the distribution of E6 variants is different among HPV types tested, suggesting a link between E6 variation and oncogenic potential being type-specific. Keywords: Human papilloma virus, cervical intraepithelial neoplesia, HIV positive women
212

Using a combination of mutations in photoprotein aequorin to application study
Faezeh Ghanbartalab* Mehdi Zeinoddini f.ghanbartalab@gmail.com Islamic azad univercity,science and vesearch branch Malek Ashtar University,Tehran
Introduction: Bioluminescence is a natural phenomenon wherewithal light is generated in living organisms by a biochemical reaction for a variety of purposes including breeding, feeding and defense.Aequorin is a Ca2+-regulated photoprotein responsible for the bioluminescence produced in the circumpolar umbrella of the jellyfish Aequorea victoria. it's composed of apoaequorin, coelenterazine and bound oxygen which when combined forms a stable complex. Upon binding to calcium, the protein undergoes a conformational change that triggers the oxidation of the chromophore, resulting in the emission of light. A biolumiesanse charecteristics of aequorin can be changed by many mutants.So some mutants occurred for make change of aequorin thermostable and color shift in order to increase the application of this protein. Because ,the best site for these changes are the EF-hand calcium binding sites or their vicinity , the two mutants His16Glu and His16Glu/ D21T occurred in the vicinity of these sites. Materials and methods: amino methane (Tris) free base, ethylenediaminetetraacetic acid (EDTA) sodium salt, glucose, sodium dodecyl sulfate(SDS), the plasmid extraction kit, the gel purification kit and the polymerase chain reaction (PCR) purification kit and the Ni2-nitrilotriacetate (Ni-NTA) and all restriction endonucleases, Luria Bertanibroth, LB agar and DNA mass ladder were used in experiment in order to make Site-directed mutagenesis , expression of mutant apoaequorins, purification of mutant apoaequorins ,generation of the mutant aequorin varians. The single and combination of mutated aequorin using Quick change site directed mutagenesis, were prepared. Then, function and color shift of mutated aequorin recorded using luminometer and spectrofluorimetry, respectively Results: The purity of two apoaequorin mutants were determined as a single band of about 25 KDan . the emission luminescanse activites of WT aequorin and aequorin mutants were shown by luminometer. The results showed that H16E and D21T /H16E aequorin mutants had less than 10% of WT emission bioluminescense activity and thermostable .also aequorin mutants didnt role in color shift assay. Conclusion: Achievement to mutant aequorin with suitable color shifts and activity can use for development of new reporter proteins to identification of cell markers in order to design of duplicity assay kits . Keywords: Aequorin, Mutation,bioluminescense, Color shift
213

Modification of Collagen- Chitosan Scaffold by PVA for Skin Tissue Engineering Application
Enaam Hakim Shahin Bonakdar* Mohsen Janmaleki Fatemeh Gheidari Mohammad Majidi
*
Biomedical Engineering Department, Amirkabir University of technology National Cell Bank of Iran, Pasteur Institute of Iran Nanomedicine and Tissue Engineering Research Center, Taleghani Hospital National Cell Bank of Iran, Pasteur Institute of Iran National Cell Bank of Iran, Pasteur Institute of Iran
shahinbonakdar@yahoo.com
Introduction: Skin as a barrier for foreign intrusion to the body by microorganisms is believed to play an important role personal health issue. Although, significant progress has been reported in the field of skin tissue engineering, there is no ideal substitute suggested for intensive skin injuries. Materials and methods : In this study, different scaffolds based on collagen and chitosan were prepared and modified by using 0, 5, 10, 20 and 50 weight percent of Polyvinyl alcohol (PVA) for skin tissue engineering application. Glutaraldehyde vapor and ethyldimethylaminopropylcarbodiimide (EDC) were used as chemical crosslinkersand freeze-thawing process applied as physical one. Results: Physical characterizations showed lower degradation rate and higher tensile strength for glutaraldehydesamples in comparison with the other ones. However, cytotoxicity (MTT assay and fluorescence staining) results confirmed the toxicity of this agent for tissue engineering application. Atomic force microscopy (AFM) observation revealed that increasing the amount of PVA, decreases the surface roughness of the specimens and this can be reflected the lower cell attachment. In the samples with the highest amount of PVA (20 ad 50 weigh percent) the lowest cell attachment were observed by optical microscopy evaluation. Conclusion: In conclusion, addition of PVA (5 to 10 %) improved the mechanical strength of the collagen- chitosan construct as well as ability of being crosslinked by freeze-thawing process and nontoxicity. Keywords: Skin regeneration, Tissue engineering scaffold, Collagen, Chitosan, Polyviyl alcohol
214

Cloning and overexpression of miR-939 in HUH7 cell line
Fahime Sadat Hosseini aghdai Sadat Dokanehiifard Bahram mohammad soltani*
*
tarbiat modares university tarbiat modares university tarbiat modares university
soltanib@modares.ac.ir
Introduction: MircoRNAs (miRNAs) are endogenously processed small non-coding RNAs, that regulate many processes. The abnormal expression of miRNAs may be valuable for the diagnosis and treatment of tumors. Among many tools, small RNA cloning is a powerful method to identify profile expression, function and as well as novel miRNAs. Retroviral system is also the minimum requirement for the studying of miRNAs in a highly stable population of cancer cells or other primary cell types with high expression. miR-939 directly regulates and translationally blocks the gene expression of human inducible nitric oxide synthase (hiNOS) by binding to its 3'UTR in liver, and other targets of this miRNA has not yet been discovered Materials and methods: So after miR-939 amplicon production from human genomic DNA, we directly cloned miR-939 into retroviral vector to yield ultimate over expression for functional study. Furthermore, miR-939 construct was over expressed in huh7 cell line. Results: After miRNA extraction and cDNA synthesis, real-time PCR revealed overexpression and true processing the miRNA in mentioned cell line. Sequencing result, after cloning PCR product in TA vector, confirmed specificity the miR-939 primers. Keywords: cloning, miR-939, overexpression
215

Efficient expression of laccase gene from Bacillus pumilus
Mahshid Hoseinzadeh Bahareh Dabirmanesh Khosro khajeh*
*
Tarbiat modares university Tarbiat modares university Tarbiat modares university
khajeh@modares.ac.ir
Introduction: Laccases are multicopper enzymes (EC1.10.3.2) that catalyze the oxidation of a variety of phenolic compounds. They are particularly promising enzymes for biotechnology and bioremediation purposes that are widely distributed in higher plants, fungi, insects and bacteria. A few bacterial laccases with high activity and stability at high temperatures and pH values have been characterized in recent years. In this research Bacillus pumilus laccase was cloned and expressed in Escherichia coli to achieve high-level production of the recombinant enzyme. Materials and methods: B. pumilus was grown in nutrient broth medium at 37 C and the genomic DNA was extracted. The gene encoding laccase was amplified using designed specific primers. The PCR amplicon was digested with Xho1 and Nde1 and ligated into the expression vector pET28a. The resulting recombinant plasmid was then transformed into Escherichia coli BL21 (DE3) for expression. The cells were induced with different concentrations of isopropylthio--galactopyranoside (IPTG) and CuSO4 to obtain the optimum protein expression under micro aeration condition. Results: The cloning process was verified by double digestion and sequencing analysis. Nucleotide sequencing revealed an open reading frame of 1533 bp encoding 510 amino acid residues. SDS-PAGE was done and revealed a band about 58 kDa. Its biochemical characterization (Km, kcat and kcat/Km) was investigated with using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) as a substrate. Conclusion: Biochemical characterization of the laccase from Bacillus pumilus revealed that this enzyme could be a suitable candidate in various fields of biotechnology and bioremediation applications. Keywords: Laccase; Bacillus pumilus; Expression; Bioremediation
216

The study of interaction between -Lactoglobulin with retinol at monomer and dimmer conditions by circular dichroism
Sabra khorsandahmadi*
*
Department of Biology, Faculty of Sciences, Mashhad Branch, Islamic Azad University
sabra_khorsandahmadi@yahoo.com
Introduction: Bovine -Lactoglobulin )-LG) is a major whey protein that present in the milk of most mammals with molecular mass of 18400 Dalton, each monomer including 162 amino acid residues. This small globular protein consists of one -helix and nine anti-parallel -sheets folding into a coneshape barrel that formed at hydrophobic packet. -LG looks as a stable monomer at the pH=2 and at pH=7 shows dimmer state. -LG has the ability to bind to several amphiphilic or hydrophobic ligands such as retinol. Retinol is one of the animal's forms of vitamin A and an alcohol is a first type. This vitamin translated in the body by materials carrier protein and sent to location required so interaction between -LG as a carrier protein with retinol at body is essential. Materials and methods: -Lctoglobulin retinol KH2PO4 HCL Apparatus Circular dichroism spectroscopy jasco model j-815 Results: Circular dichroism spectroscopy is a useful and sensitive method. The far UV-CD spectrum gives information on the polypeptide backbone conformations (secondary structure) of proteins. Changes in CD spectra can provide information on ligand-protein interactions. The far UV-CD spectra of -LG at two different monomer and dimmer conditions with various concentration of retinol is indicated that -sheet be converted to -helix in the present of retinol in both conditions namely increases -helix structure content, although the increase in -helix content and conversion of sheet to -helix at dimmer condition is less than monomer condition. Conclusion: The results revealed that presence of the retinol causes converting -sheet to -helix at two different conditions (monomer and dimmer) but conversion at monomer condition is higher than dimmer condition. Since increases -helix structure leads to enhancement of protein function therefore at monomer condition function of protein is further than dimmer condition. Although at two monomer and dimmer condition protein structure is native but since protein function at monomer condition is further than dimmer, it can be concluded that native structure of -LG at monomer condition is different as compared to native structure of -LG at dimmer condition are different. Keywords: -LG, retinol, spectroscopy
217

*Hajie Lotfi Vahideh Gougerdchi Tabriz University of Medical Sciences payame noor university, depatment of agriculture,Karaj, Iran * lotfi.hajie@yahoo.com
: . . : ( ) coat protein . Pepper mild mottle Potato virus X Tobacco mosaic virus Brome mosaic virus Poinsettia mosaic virus Oat blue dwarf virus virus agroinfection magnifection . Spinacia oleracea Nicotiana tabacum Vigna unguiculatas Nicotiana benthamiana . H5N1 LcrV E7 ( ) VLP GM CSF B . . . . :
218

*Maryam Mahjoobin Tehran Bahar Shahnavaz Somaye Sadeghi * mmahjoobin@yahoo.com Ferdowsi university of Mashhad Ferdowsi University of Mashhad Tehran University of Mashhad
: . . . . . . . . . . . . . . . ... . . :
219
220

Translational targeting of breast cancer cells using construct containing 5UTR of bFGF
Mohamad Mohaghegh Farnoush Jafari Fatemeh Rahbarizadeh*
*
Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares university, Tehran Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares university, Tehran Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares university, Tehran
RahbariF@modares.ac.ir
Introduction: Basic Fibroblast Growth Factors ( bFGFs), are a family of growth factors involved in angiogenesis, embryonic and tumor development. bFGF mRNA has a 5 untraslated region )5UTR( containing long GC rich and excessive secondary structures which are normally discriminated against by the translational machinery. The translation initiation factor (eIF4E) functions as the cap-binding subunit of the eIF4F complex, an ATP-dependent helicase that unwinds excess secondary structure in the 5UTR of mRNAs. eIF4E is elevated in most solid tumors resulting in translation of mRNAs that are normally repressed by their structured 5UTR, so bFGF upstream regulatory region could be considered as a cancer specific gene therapy. Materials and methods: In this study, we sub-cloned CMV promoter from pGL4.50 in pGL4.14 making a pGL4.14C vector containing CMV promoter, MCS and Luciferase reporter gene. This vector can be used for further analysis of 5UTR regions of different mRNAs. Then we cloned 443 bps upstream of human bFGF mRNA into pGL4.14C vector making pGL4.14CF construct. Thereafter, we transfected BT474, a kind of breast cancer cell line, and MCF10A, normal breast cell line, with the designed construct. Luciferase activity was measured by luminometer and luciferase assay kit Results: Our result showed that the level of luciferase activity increased in BT474 in comparison with MCF10A. Conclusion: Our data suggest that 5UTR of bFGF is worth noticing as a specific translational element in cancer gene therapy. Keywords: Translational targeting, bFGF, Cancer gene therapy
221

BRCA1
Sara mousavi *Aliakbar Haddad-Mashadrizeh Masoud Saleh Moghaddam
*
Ferdowsi University of Mashhad Ferdowsi University of Mashhad Department of Science, Payame Noor University of Mashhad
aliakbar.haddad@gmail.com
: . . : BRCA1 . . : 126 . 3 5 . SINE LINE . BRCA1. : . . . : BRCA1
222

Molecular aspects on the interaction of isatin-3-isonicotinylhydrazone to deoxyribonucleic acid
Parvaneh pakravan* Soheila Kashanian
*
Department of Chemistry, Zanjan Branch, Islamic Azad University, P O Box 49195-467, Zanjan, Iran Department of Chemistry, Sensor and Biosensor Research Center (SBRC) & Nanoscience and Nanotechnology Research Center (NNRC), Faculty of Science, Razi University, Kermanshah, Iran
pakravanparvaneh@yahoo.com
Introduction: Isatin-3-isonicotinylhydrazone (IINH) was screened against Mycobacterium tuberculosis (MTB) organism. This compound was found to be more sensitive than isoniazid and isatin drugs and minimum inhibitory concentration (MIC) results of this compound proved its higher potency. This compound may be recognized as a suitable anti-tubercular agent. Information obtained from this study will be helpful to understand the mechanism of isatin derivatives interaction with nucleic acids, and should be useful to develop potential probes of DNA structure and new therapeutic reagents for some diseases. Materials and methods: The interaction of native calf thymus DNA with isatin-3isonicotinylhydrazone (IINH) in 10 mM TrisHCl aqueous solutions at neutral pH 7.4 has been investigated by circular dichroism (CD), spectrofluorimetric, and viscometric techniques. Results: On increasing the amounts of IINH, the relative viscosity of CT-DNA solution increases steadily but is still smaller than those bound with EB, however, the value of 0.51 is still more than some intercalators. Therefore the results suggest that IINH intercalates between the base pair of DNA. the changes in the CD spectrum of CT-DNA in the presence of increasing concentrations of IINH are depicted. The positive band showed increase in molar ellipticity without any significant shift in the band maxima when the IINH concentration was progressively increased. These observations are supportive of the intercalative mode of binding of the IINH, where in the complex, molecules stack in between the base pairs of DNA, thus leading to an enhancement in the positive band. The positive slope in the Vant Hoff plot indicates that the reaction between the IINH and DNA was enthalpy favored (-30.187 kJ mol-1) and entropy disfavored (-20.46 J mol-1 K). Conclusion: The results obtained collectively show that IINH strongly interact with CT-DNA, by an intercalative mechanism. The planar ring system stacks well with base pairs in the intercalation complex. Intercalation is known to occur without interfering with hydrogen bonding of the base pairs, the planar heterocyclic dye is expected to stabilize its binding to DNA through favorable stacking interactions with its adjacent base pairs. Keywords: CT-DNA , Isatin-3-isonicotinylhydrazone, Intercalation
223

Shahrzad tavakolfar Parichehr yaghmaei Hasan hadadzade * Mona Salimi
*
Science and Research Branch,Islamic Azad University biochemistry department, sience and research branch, islamic azad university chemistry department,Isfahan university of Technologhy physiology and pharmacology department,Pasteur Institute of Iran,Tehran, Iran
salimi_mona@yahoo.com
: . . : 100-0.1 . 200-5 : ( 200 ) . . : . :
224

Isolation, Cloning and Expression Verification of the Mycobacterium Bovis CFP-10 Gene in BALB/c mice
Azam Torabi Mojtabat Tahmoorespour Fatemeh Vahedi* Nader Mosavari Mohammar Reza Nassiry
*
Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad. Mashhad, Iran. Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad. Mashhad, Iran. Department of Biotechnology, Razi Vaccine and Serum Research Institute, Mashhad, Iran Department of PPD production, Razi Vaccine and Serum Research Institute, Karaj, Iran. Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad. Mashhad, Iran.
vahedif@yahoo.com
Abstract: Mycobacterium Bovis is the most universal pathogen among the Mycobacteria and produce progressive disease in most domestic animal and human and developing countries where M. bovis infection is most likely to contribute to the prevalence of human tuberculosis. Over 50 million infected cattle throughout the world-wide economic losses of about three billion dollars annually to import agricultural produce. Protection of cattle against bovine tuberculosis by vaccination could be an important control strategy. Recent advances in immunology and the molecular biology of Mycobacterium identification of a large number of antigens with potential for development of new tuberculosis vaccine has been accomplished in recent years. During the last decade, DNA vaccines have been developed against Mycobacterium Bovis. The aim of this study was CFP-10 Gene Isolation, Cloning and Expression Verification of the Mycobacterium Bovis in BALB/c mice. In the study, the whole genome of the bacterium Mycobacterium bovis extracted then by using specific primer CFP-10 gene was amplified during PCR. PCR product was inserted to pcDNA3.1(+) eukaryotic expression vector. It was demonstrated that the eukaryotic expression vector pcDNA3.1(+)/CFP-10 was successfully constructed by restriction enzyme digestion, PCR and sequence analysis. Recombinant plasmid was intramuscular injection of BALB/c. After intramuscular injection of BALB/c with pcDNA 3.1(+)/ESAT-6 plasmid the expression of ESAT-6 gene was assessed at RNA and protein levels. pcDNA3.1(+)/CFP-10 cassette was constructed, confirmed by sequencing, restriction enzyme and PCR analysis. The expression CFP-10 gene was successfully detected at RNA and protein levels. Recombinant plasmid was used in this study could be a constructed as candidate DNA vaccine against Mycobacterium Bovis Keywords: Isolation, Cloning, Expression, Mycobacterium Bovis, CFP-10 Gene, BALB/c mice
225

Protein engineering of bacterial -xylosidase by Site-directed mutagenesis and expression in Pichia pastoris
Shirin Yousefian* Seyyed Omid Ranaei Siadat Mohammadtaghy Borjian Borujeni
*
Shahid Beheshti University Shahid Beheshti University Shahid Beheshti University
sh_yousefian67@yahoo.com
Introduction: Enzymes as biocatalysts are often used for different industrial processes such as the manufacture of various chemicals and as biosensors in medical diagnostics. Whereas most proteins are highly sensitive to high temperatures; thermal stability is a positive feature for proteins as biocatalysts. A number of studies have been conducted to enhance thermostability of enzymes by protein engineering. -xylosidases (EC 3.2.1.37) are exo-type glycosidases that catalyze the successive removal of -xylosyl residues from the non-reducing termini of xylobiose and higher linear -1,4-xylooligosaccharides and are essential in completely depolymerizing xylan, the most abundant hemicellulose in plant cell wall. Hydrophilic and polar amino acid content such as Arg, Glu and Tyr, at the surface of thermophilic proteins, is effective in more thermal stability of proteins. Analysis of the protein surface also suggests amino acids such as Ala, Ser, Gln and Asn being unfavorable for thermostability. The purpose of this study is to improve thermostability of bacterial -xylosidase by Site-directed mutagenesis and secretive expression of the recombinant -xylosidase in Pichia pastoris in order to achieve high-level expression. Materials and methods: In this study after analyzing of enzyme structure using Expasy server and ICM-Browser software, Aspargine-256 being on the surface of enzyme structure, was selected as a good candidate for targeted mutation. Mutation was induced in -xylosidase gene through suitable designed primers by PCR that Asn-256 switched to Glu. The gene was inserted into the P.pink expression vector and transformation of recombinant plasmids through electroporation method into the expression yeast was done. Recombinant yeast was cultured in BMMY medium and expression was induced by methanol. Results: The sequencing of mutant gene proved the successful induction of mutation and the existence of recombinant enzyme was proved through SDS-PAGE method and assay was done with PNPX as the substrate. Conclusion: Protein engineering of bacterial -xylosidase by Site-directed mutagenesis to improve thermostability and successful expression of gene in order to attain active and stable enzyme with high level expression from yeast expression system, was done. Keywords: -xylosidase, Protein engineering, Expression, Mutagenesis
226

Optimization of Genomic DNA Extraction of Mistletoe (Viscum album)
Bahareh zaheri* Arman mahmoodi otaghvari seyed kamal kazemitabar sedigheh kelij Mosleh Mohamadi Rad navideh anarjani ** Davoud Ahmadvand
*
University University University University Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, University Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran,
baharehabc@gmail.com da@farma.ku.dk
**
Introduction: Mistletoe by scientific name. Viscum album L belongs to the Viscaceae family is semiparasitic, evergreen, Epiphytic, Photosynthetic.It is important to analysis Mistletoe because of the damages that makes in the Coniferous forests, its high medicinal properties and the danger of plant extinction that makes it important for Investigators to research on Mistletoe and try to conserve its gene pool. Materials and methods: CTAB 3% (w/v), 1M Tris-Cl (pH 8), 0.5 M; EDTA (pH 8), 5 M NaCl, absolute ethanol (ARgrade), chloroform-IAA (24:1 [v/v]), polyvinyl pyrrolidone (PVP) (Sigma) and mercaptoethanol.The extraction buffer consisted of CTAB 3% (w/v), 100 mM Tris-Cl (pH 8), 25 mM EDTA (pH 8), and 2 M NaCl.DNA extraction was isolated from dried stem and seeds using a modified CTAB method. Results: the extracted DNA in the gel had no smear and fracture Conclusion: using a modified CTAB method is efficient, simple and inexpensive. Keywords: DNA Extraction, Mistletoe (Viscum album), Polymerase Chain Reaction
227

Pluripotency features in adipose tissue-derived stem cells
Zahra zamanzadeh*
*
national institut of genetic and biotechnology
za.zamanzadeh90@yahoo.com
Introduction: Adipose tissue contains a population of stem cells that can be easily harvested from the patients by a simple, minimally invasive method, and they can be easily cultured. Previous studies have confirmed a strong phenotypic resemblance between Adipose tissue-derived stem cells (ADSCs) and bone marrow mesenchymal stem cells (BM-MSCs). Also, some investigators have demonstrated that BM-MSCs and ADSCs express various genes shared by embryonic stem cells, such as Oct4, UTF-1 and Nodal. Materials and methods: In the present study, we evaluated the expression of pluripotency markers in the freshly isolated and cultured ADSCs. For this purpose, human ADSCs were isolated from adipose tissue obtained by abdominal reduction surgery. The expression of OCT4 and Sox2 proteins in the primary cultures of the ADSCs was also detected by immunocytochemistry. Results: Freshly isolated stromal vascular fraction (SVF) cells and cultured ADSCs expressed mesenchymal stem cell markers, CD73, CD90 and CD105. SVF cells and primary cultures of the ADSCs expressed OCT4A, Nanog, Sox2, Klf4 and c-Myc mRNAs. During sequential passages the expression of pluripotency markers disappeared. This implies that some degrees of differentiation can occur during sequential passages of the ADSCs. Conclusion: In conclusion, these findings show that human adipose tissue contains a population of stem cells with molecular resemblance to embryonic stem cells. Keywords: Adipose tissue, stem cell, OCT4
228

ND3 mitochondrial genes, a good candidate for DNA Barcoding
Reza Zati Keikha* Masoud Dehghan Tezerjani
*
shahid beheshti university shahid beheshti university
rezazatikeikha@gmail.com
Abstract: Given the abundance and biodiversity requires accurate way to identify each of these species to be felt. DNA Barcoding is most useful for species identification. . Maternal inheritance of mitochondrial DNA where it has a high mutation rate makes a significant difference in mitochondrial sequences between species and within species there is little difference in the mitochondrial sequences .In this method the most part, introduced as part of the genome for good candidate and it is dedicated.The mitochondrial genome is suitable for use in DNA Barcoding. In this study, the nine gene COX1, COX2, COX3, ATPase6, ND1, ND2, ND3, ND4, ND5 (in the respiratory chain complexes) with the D-Loop sequences in species of chimpanzee, gorilla, orangutan and modern humans were studied. Complete mitochondrial genome sequences of organisms used were obtained from GenBank database. These genes using the software ClustalW alignment were investigated and finally shrubs phylogenic Maximum Liklihood, Neighbor Joining and Parsimony using the software MEGA (version 5) were plotted. Survey results plotted shrubs showed that the genes for subunits NADH dehydrogenase mitochondrial pattern phylogenic with COX1 and COX2, which is abundant in DNA Barcoding are used to possess. of the gene ND3 of appropriate size sequence as a candidate gene for DNA Barcoding in Prymat be introduced. Keywords: DNA Barcoding, Mitochondrial genes, ND3 Gene, Primates
229
3rd International Student Biotechnology Congress Nono-Biotechnology

Experimental Study of Nanoarchaeosomal Carrier for Paclitaxel on MCF-7 Cell Line
Seyed Ebrahim Alavi* Pasteur Institute of Iran
Maedeh Koohi Moftakhari Esfahani Pasteur Institute of Iran Fatemeh Movahedi Azim Akbarzadeh
* **
Pasteur Institute of Iran Pasteur Institute of Iran
s.ebrahimalavi@gmail.com azimakbarzadeh1326@gmail.com
**
Introduction: Breast cancer is one of the most current cancers in women. Breast cancer ranks first among cancers in Iranian women. Paclitaxel is a chemotherapy compound for treatment of patients with cancer diagnosis, including breast cancer associated with several adverse effects. The aim of this study was preparing nanoarchaeosomal paclitaxel, in order to improve its therapeutic index and reduce side effects against breast cancer. Materials and methods: Archaeosomes were extracted from methanogenicarchi bacteria and synthesized with a certain ratio of paclitaxel in PBS. The mean diameters of nanoarchaeosomal paclitaxel were measured by Zeta sizer device. Drug loading efficiency was calculated by spectrophotometry and releasing paclitaxel in formulation was estimated within 26 hours by dialysis method. Also, this study investigated the cytotoxicity effect of nanoarchaeosomal paclitaxel using MTT assay. Results: Results verified that particles size of formulation was of nano dimensions. Loading efficiency of nanoarchaeosomal formulation was obtained as 99.1%. Besides, using dialysis, the pattern of drug release from nanoarchaeosomes has been studied and the results showed that the drug release of nanoarchaeosomal drug within 26 hours was equal to 0.137%. This study showed that cytotoxicity of nanoarchaeosomal paclitaxel is more in comparison with standard paclitaxel. Conclusion: Results showed nanoarchaeosomes seem to be better carriers to drug delivery. Keywords: Breast cancer, Paclitaxel, Nanoarchaeosomal, Cytotoxicity
230

Application of siRNA nanoparticles in stem cells differentiation
Masoud Dehghan Tezerjani* Reza Zati Keikha * Masoud.msdco@Gmail.com Genetic Department, Faculty of Biological sciences, ShahidBeheshti University, GC, Tehran, Iran Genetic Department, Faculty of Biological sciences, ShahidBeheshti University, GC, Tehran, Iran
Introduction:The emergence of nanotechnology into the stem cell field opens new approaches in regenerative medicine . Due to progress in biochemistry, novel nanobiomaterials with applications in tissue engineering and stem cells differentiation have been developed. These novel materials with their unique chemical and physical properties can be valuable tools to drive differentiation of stem cells into specific cell lineages .These cells can be used for generating special human tissues. Different micro-/nanofabrication technologies have been used to design scaffolds able to drive the differentiation of these cells. In this article we have reviewed studies regarding application of nanoparticles for making special scaffolds and delivering special kind of molecules such as smallinterfering RNA (siRNA) to stem cells. small-interfering RNA can silence synthesis of a specific protein by base pairing with its mRNA sequence when introduced into stem cells. Studies show cells can be induced to commit to alternative differentiation pathways in specific locations within the same implant in vitro and in vivo by delivering different siRNAs into distinct locations. Methods:We have conducted a thorough literature search using search engines in the medical and biological databases and collected the data and research results regarding role of nanotechnologies in delivering special molecules to stem cells for altering their differentiation. We focused on role of nanostructured scaffold capable of retaining and delivering siRNA, with applications for controlling stem cell differentiation. Results: A special nanoparticle, capable of delivering siRNA molecules into stem cells situated in a scaffold can enhance stem cells differentiation into bone, cartilage, fat, muscle, liver, and nerve cells. Studies show that siBCL2L2 and siTRIB2 can initiate early osteogenic and adipogenic differentiation. Nanoparticles such as Poly D, l-lactide -co-glycolide( PLGA), polyethylenimine (PEI), poly-L-lysine (PLL)-modified metal oxide , chitosan and polyamidoamines (PAMAM) can be used in cell culture for siRNA delivery to specific stem cells. Conclusion: Using nanoparticles in tissue engineering represents a unique,emerging interdisciplinary research field that can be useful in regenerative medicine . Nanoparticles can be replaced with traditional viral vectors, such as retroviruses, which have been implicated in causing complications in whole organisms such as inducing mutations leading to cancer. It is necessary to check other nanomaterials and other specific siRNAs in future studies to investigate effect of different molecules on stem cells differentiation.
231

The investigation of Electron transfer mechanism of glucose oxidase at graphene and graphene oxide electrode
khadijeh eskandari*
*
baqiatallah university
eskandari@ibb.ut.ac.ir
Introduction: Graphene, emerging as a true 2-dimensional material, has received increasing attention due to its unique physicochemical properties (high surface area, excellent conductivity, high mechanical strength, and ease of functionalization and mass production). Materials and methods: In this study, graphene oxide (GrO) was chemically synthesis and reduces to Gr by reducing. Gr characterized by spectroscopies methods such as FTIR, UV-Vis and so on. Electrochemical experiments were performed with an Autolabpotentiostat (PGSTAT 101). A platinum wire and Ag/AgCl, 3 M KCl were used as counter and reference electrodes, respectively. All potentials are referred to the later. The electrodes were inserted into the cell through holes in its Teflon cover. Cyclic voltammetry experiments were performed at 0.1 V s1. The amperometric experiments were carried out by applying the desired potential and allowing the transient current to reach the steady-state value prior to the addition of the analyte and the subsequent current monitoring. Results: This article was studied in graphene-based electrochemical biosensors. First, GrO was synthesized from graphite using the Hummers method. Gr was obtained by reduction of GrO with reducer. The IR spectrum of graphene oxide shows bands attributed to oxygen containing groups, which confirmed the successful oxidation of graphite. These bands are assigned to (O H) stretching vibrations mode of intercalated water )3400 cm1(; )C O( stretching )1730 cm1( ; (CO epoxy) stretching )1225 cm1(; and )CO alkoxy( stretching vibration )1050 cm1(. Also, the conductivity of GrO and Gr was studied by Elecrtochemical Impedance Spectroscopy (EIS). Conclusion: The results show the conductivity of Gr is 1000 order better than Gr. Cyclic voltammetry of glucose oxidase on Gr and GrO shows the electron transfering of Gr is better than GrO. Keywords: graphene, electrochemistry, reduce
232

The use of chitosan nanoparticles as new anticancer drug carrier system
Mohammad Ali Gazjahanian* HodaJafarizadeh-Malmiri
*
Sahand University of Technology Sahand University of Technology
jahanian.eng@gmail.com
Introduction: Many prevalent cancer drugs that use in the clinical phase can't achieve satisfactory results because they do not have the purposeful operation to effect the target position. The important problem in cancer chemotherapeutics are high toxicity of anticancer drugs (such as fluorouracil) due to inappropriate dispersion of drugs on safe organs those are not involved the abnormal treatment. In addition, solubility of most anticancer drugs in water is significantly weak and thus there are requirement to use organic solvents and detergents for therapeutic utilizations. Materials and methods: An effective way to solve this problem is the designing of targeted drug delivery systems that release the drugs and bioactive agents at the nominee site of the body. Chitosan as a cationic polysaccharide biopolymer has increasing attention within pharmaceutical and biomedical applications, because of its abundant availability, inherent pharmacological properties, and other biological properties such as biocompatibility, non-toxicity and low immunogenicity. The hydroxyl and amine groups located on the backbone of chitosan allow for chemical modification to control and change its physical properties. Results: When the hydrophobic agent is added to a chitosan molecule, the resulting amphiphile form nanoparticles that can encapsulate drugs and transfer them to the target site of the body. Both of many hydrophilic and hydrophobic drugs can be loaded into the chitosan nanoparticles during the preparation of the nanoparticles. Conclusion: These nanoparticles can revolve in the bloodstream for a comparatively long period without recognition by phagocytes and can easily accumulate at the cancerous tumor position and leaky vasculature site throughout the EPR effect. There are several methods to preparate chitosan nanoparticles, such as emulsion, ionotropic gelation, reverse micellar, solvent evaporation, spray drying, coacervation, and sieving methods. Keywords: Cancer, chitosan, nanoparticles, drug, targeted delivery
233

Viral-mediated gene delivery against cancer metastasis
Mahsa Kazerani* Shirin Farivar shahidbeheshtiunivercity/faculty of genetics shahidbeheshtiunivercity/faculty of genetics
*mahsa.kazerani@yahoo.com
Abstract: Viral-mediated gene delivery for cancer treatment is a promising procedure, while current standard cancer therapies like radiotherapy and chemotherapy against proliferation and movement of cancer cells has led to resistance. In the recent years, most of the viral vectors for cancer gene therapy have been modified for higher safety and efficacy as well as transitioned from being non-replicating to replication-competent. While traditional oncolytic vectors have focused on attenuating tumor growth, novel vectors purposely target epithelial-to-mesenchymal transition (EMT) in cancer cells, which could prevent the tumor metastasis. In this review article, in spite of highlighting the illustrative examples of cancer gene therapy in clinical trials, we emphasize some methods to enhance the safety and efficacy of oncolytic viral vectors in cancer gene therapy Keywords: Cancer gene therapy, Oncolytic viral vector,Cellmovement,Metastasis, Epithelial-tomesenchymal transition
234

Metal nanoparticle production assisted by -amylase
Sayyed Moein Mousavi*
*
Kerman University of Medical Sciences
moein67m@yahoo.com
Introduction: Metal nanoparticles have different applications in chemistry, physics, biomedical and material sciences. In biomedicine, gold nanoparticles (AuNPs) are used in several purposes such as leukemia therapy, biomolecular immobilization and biosensor design. Silver nanoparticles (AgNPs) are applied as selective coating agent for solar energy absorption, catalysts in chemical reactions and antimicrobial agents.Ivestigated on the biological production of gold nanoparticles using Bacillus licheniformis and demonstrated the key role of -amylase and their reducing moieties in such bioreduction processes. This study describes biosynthesis of Au, Ag and Au-Ag alloy nanoparticles by the enzyme of -amylase. The characterizations of produced nanoparticles have been also reported. Materials and methods: Formation of gold, silver and Au/Ag alloy nanoparticles was investigated by dissolving 2 mg of the pure enzyme (130 U/mg) in 2 mL deionized water followed by adding aqueous concentrations of HAuCl4 (0.05, 0.1, 0.5 and 1 mM), AgNO3 (0.05 to 10 mM) and different Au/Ag mole ratios (0.1:0.1, 0.1:0.5, 0.1:1, 0.5:0.1, 0.5:0.5, 0.5:1, 1:0.1, 1:0.5 and 1:1). UV-Vis spectra of the mixtures of nanoparticles were recorded by a Labomed Model UVD-2950 UV-Vis Double Beam PC Scanning spectrophotometer, with a resolution of 1 nm in the range of 300700 nm Results: Biosynthesis of AgNPs occurred only at 70C in 0.1 to 4 mM concentrations of AgNO3 and in concentrations higher than 4 mM, aggregation of nanoparticles was observed. Optimum condition for production of Au/Ag alloy nanoparticles was found to be at 70C with Au/Ag mole ratios of 0.1:0.1 and 0.1:1. In the mole ratio of 1:1 Au/Ag rapid formation of large and aggregated nanoparticles was observed. In other solutions [CuSO4, Bi5O(OH)9(NO3)4and Se2O] even after 48 hours, no change in maximum absorbance related to nanoparticles formation were detected Conclusion: Preparation of nanometals using physical methods such as attrition and pyrolysis supply nanostructures with narrow and controlled size ranges, however, these methods require very expensive equipments and the final yield is low Keywords: -Amylase, Green synthesis, Au/Ag alloy, Bimetallic nanoparticles
235

Co-delivery of shRNA and DNA by a neutral phospholipid-based bilayer nanosystem
Reihaneh Ramezani Majid Sadeghizadeh* Marzieh Karimi Mehrdad Behmanesh Saman Hoseinkhani Tarbiat Modares University Tarbiat Modares University Tarbiat Modares University Tarbiat Modares University Tarbiat Modares University
*sadeghma@modares.ac.ir
Introduction: Unique advantage of liposomes is that they are able to entrap biological macromolecules such as proteins, RNA, DNA, or small substances like drugs, nucleotides and even ions into their structures. They can even entrap these materials simultaneously. As mentioned in previous reports, it is possible to place all necessary elements for transcription, translation and protein synthesis inside the liposome, a system known as an artificial cell. This unique feature completely distinguishes these structures from other non-viral delivery systems. Materials and methods: DNA and shRNA was encapsulated in bilayer vesicles by employing two contiguous dehydration-rehydration processes. The characteristics of the obtained structure were investigated by various techniques such as electrophoresis, spectroscopy and DLS (dynamic light scattering). These structures were added to CHO cells to deliver shRNA and DNA which were responsible for silencing Green Fluorescent Protein (GFP). Their transfection efficiency was studied using fluorescence microscopy and fluorometry. Results: The designed lipid bilayer systems which were zwitterionic in terms of surface charges were able to encapsulate DNA and shRNA simultaneously with high efficiency (98%) even in the absence of cations, and these results were unprecedented. The resulted system was highly stable, in a way that it was able to keep the DNA molecule in its structure for over 6 months. These virus-like lipid bilayer vesicles were able to silence the reporter gene (GFP) in CHO cells. Conclusion: Due to promising results obtained in this study, it can be expected that cell membranebased neutral liposomes would be considered in the near future as an alternative to cationic carriers in gene delivery. By mimicking virus functions in fusion to cell membrane and transferring DNA and RNA to mammalian cells simultaneously, these neutral liposomes can be introduced as artificial viruses in gene therapy. Keywords: bilayer phospholipid vesicle, neutral liposome, artificial virus, gene delivery
236

Transcriptional targeting of breast cancer stem cells using anti-HER2 nanobody targeted dendrimeric nanoparticles
Azadeh Reshadmanesh Fatemeh Rahbarizadeh*
*
TarbiatModares University of Tehran TarbiatModares University of Tehran
rahbarif@modares.ac.ir
Introduction: According to cancer stem cell theory , cancer is caused by mutations occurred in stem cells within the normal tissues, These mutations disrupt cell cycle regulation mechanisms of stem cells. In conventhional cancer therapy methods terminally differentiated cancer cells are targeted which usually leave cancer stem cells unharmed, This allows them to repropagate and lead to disease reoccurance and even metastasis. Current studies are focused on developing methods towards specific targeting and eleminating cancer stem cells. One of the approaches to cancer therapy is called gene therapy. A promising strategy for enhancing cancer gene therapy is tumortargeted gene delivery using cationic polymers. PAMAM dendrimers have been evaluated as useful transfection systems.In this study we propose for the first time the targeted delivery of killer gene containing constructs to breast cancer cells using Nanobody conjugated dendrimeric PAMAM nanoparticles. Materials and methods: The G5 PAMAM dendrimer's number of primary amino groups was determined. For increasing the efficiency of gene therapy via systemic gene delivery and decreasing the cytotoxicity of dendrimers, PEG was used.Conjugation of PEG to PAMAM was confirmed by TNBS assay by determining primary amines. Conjugation of nanobody to PAMAM-PEG was determined also by ELLMAN assay. on the other hand, Dendriplexes composed of PAMAM G5 and DNA construct were prepared at different N/P charge ratios (5, 10, 15 and 25).Then these polymers were used to deliver a killer gene under the control of a breast cancer stem cell specific promoter to HER2 expressing breast cancer cell line such as BT474 and HER2 non-expressing NIH3T3 cell line as negative control. Results: TNBS assay and ELLMAN assay confirmed the conjugation of both PEG and nanobody to PAMAM dendrimers. The best PEG/PAMAM ratio was determined, cytotoxicity was significantly decreased after PEGylation. Different N/P ratios were tested for the best transfection efficiency. The best N/P ratio was determined. Conclusion: The feasibility of using PEGylated PAMAM dendrimer as the carrier for tumor targeting of genetic construct containing killer gene was validated in the present study. PEGylation successfully reduced cytotoxicity of PAMAM dendrimer and retained a certain degree positive charge which was helpful to cellular uptake. Keywords: cancer stem cell, gene therapy, dendrimer, nanobody , PAMAM , genetic construct, HER2
237
238

Spectroscopic studies of the interaction of a novel silver nanoparticles with bovine serum albumin
Ghasem Rezanejade Bardajee* Zari Hooshyar *: zari_Hooshyar@yahoo.com Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran
Abstract: In the present communication, the interaction between bovine serum albumin (BSA) and diamsar stabilized chemically synthesized silver nanoparticles (diamsar-AgNPs) was investigated in vitro. The conformational change of BLA upon interacting with AgNPswas monitored by UV-Vis spectroscopy, Furrier transformed infrared (FT-IR). It was also established from our experimental studies that AgNPs induced a significant quenching of tryptophan fluorescence of emitted from BSA Keywords: Silver nanoparticles, Bovine serum albumin,Conformational change
239

Antibacterial properties of magnetic hydrogel nanocomposite based on saleppoly (acrylic acid)
Ghasem Rezanejade Bardajee Zari Hooshyar Maryam Jahanbakhsh*
*
Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran
hooshyar@ch.iut.ac.ir
Abstracts: In this paper, antibacterial properties of magnetic hydrogel nanocomposite based on saleppoly (acrylic acid) were investigated against gram-negative E. coli and gram-positive S. aureus bacteria by disk diffusion technique. Furthermore bacterial growth was investigated by visually inspecting turbidity of the LB broth. These data clearly demonstrated that our samples have no antibacterial potential. This result can be considered as a good sign for the biocompatibility of magnetic hydrogel nanocomposite. Keywords: Antibacterial, Magnetic hydrogel, Nanocomposite
240

Controlled release of defrasirox through magnetic hydrogel nanocomposite based on saleppoly (acrylic acid)
Ghasem Rezanejade Bardajee* Zari Hooshyar Maryam Jahanbakhsh*
*
Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran
grezanejad@ymail.com
Abstract: A novel biocompatible and biodegradable magnetic hydrogel nanocomposite based on - poly (acrylic acid( was synthesized and used to investigate defrasirox release in pH 2 and 7 at 37 C. The cumulative release ratios of defrasirox from the magnetic hydrogel nanocomposite were 11% in pH 2 solution and 100% in pH 7 solutions within 8 h. Keywords: Defrasirox, Magnetic hydrogel, Nanocomposite, Controlled release
241

RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy
Farzaneh Sadeghi Mohammad Khalaj-Kondori*
*
Tabriz university Tabriz university
khalaj@tabrizu.ac.ir
Introduction: Therapeutics based on RNA interference (RNAi) hold great promise for managing cancer and treating it. RNAi is the process of suppressing the expression of a protein by using double stranded RNA (dsRNA). It appears to be a valuable tool to tackle the growing problems in cancer related diseases as it can inhibit the production of over-expressed genes. Materials and methods: we survey the literature that have been published to date and touch on the most recent developments of the subject. Results: The Fusion oncogenes have been attributed to causing the pathogenicity of several types of cancer and create the challenge to target them therapeutically. Growing resistance to current treatments calls for the development of improved therapy. Thus, an alternative is the use of RNA interference (RNAi) as a gene therapy model. Here, we discuss recent developments using RNAi to target the fusion oncoprotein in the prevalent cancers, such as prostate cancer, acute promyelocytic leukemia (APL), acute lymphoblastic leukemia (ALL) and Chronic Myeloid Leukemia (CML). Furthermore, we indicate how the targeting siRNAs were both potent and highly specific and significantly inhibited tumor growth. Conclusion: SiRNA has been demonstrated to result in efficient knockdown of gene expression targeting the breakpoint of fusion oncogenes. Delivery of specific siRNA may represent a promising treatment strategy for drug-resistant patients. Keywords: SiRNA, fusion oncogene, cancer therapy
242

Investigation of the effects of nanoparticles ZnO on the histopathological of lung rat
ataollah shokouhian* Masoud Ghorbani Saman Soheili
*
Payame Noor University-Department of Biology- Center of Tehran (MSc), 2Pasteur Institute of Iran, Production and Research Complex, Karaj, Iran 1Payame Noor University-Department of Biology- Center of Tehran (MSc)
ata_shu@yahoo.com
Introduction: in applica: Concerning to increase tions of nanoparticles (NPs) study of their toxic potentials to human body is of great significance. Nano-scale size and, easy spreading to environments made NPs to permeate and distribute in tissues easily. In particular, toxicity of ZnO NPs should be considered to ensure public and industrial health. Accordingly, this study focused on the oral toxicity of different amounts of ZnO NPs on rat Lung regarding to possible tissue damage and following enzyme release to blood Materials and methods: Methods: Different ascending amounts of ZnO NPs with approximately 15nm diameter were gavaged over a period of 14 days in wistar rats. Histopathological events observed at the end of experimental period as well as biochemical parameters including LDH Results: Mild, moderate and high degree of congestion, perivascular lymphocytic infiltration observed in the test groups in anas ascending manner from groups one to three. Serum level of LDH was also elevated as in one to three in a dose dependent manner. Student T test demonstrated significant mean difference between groups one and three (p value < 0.05). Conclusion: Histopathological findings were consistent with the increasing level of LDH. Oral administration of 100mg/kg of ZnO NPs over 14 days induced mild toxicity in wistar rats and was selected as toxic dose although overall health was not affected. Keywords: Nanoparticles, Rat, Lung ,Zno
243

( ) Monobromobimane
Amir Tayaranian Marvian *Dina Morshedi Mehryar Amininasab Farhang Aliakbari
*
Department of Cell and Molecular Biology, School of Biology, University College of Science, University of Tehran, Tehran, Iran. Industrial and Environmental Biotechnology Department, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran. Department of Cell and Molecular Biology, School of Biology, University College of Science, University of Tehran, Tehran, Iran Industrial and Environmental Biotechnology Department, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran.
morshedi@nigeb.ac.ir
: - . . . FRET fluorometry, flow cytometry, confocal . - Monobromobimane . ( ) . 149 - . . . : - - site direct mutagenesis pINC BL21 123 . ) mBBr (Monobromobimane . . CD ThT . : - . 123 . . CD ThT . : - .
244

Fluorescence spectroscopic evaluation of Cu-diamsar-bovine serum albumin interactions
Bahman Vasheghani Frarahani Ghasem Rezanejade Bardajee Zari Hooshyar* *Zhooshyar@gmail.com Imam Khomini international university, faculty of science, department of chemistry, PO Box 288, Qazvin, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Imam khomini international university
Abstract: The Cu-diamsar of has attracted interest because of a wide range of pharmacological activities. This study was undertaken to examine bonding interactions between the complex and bovine serum albumin (BSA) to help elucidate the mode of transport of the complex in vivo. Fluorescence spectroscopic studies were performed to obtain binding constants (Ka) between Cu-diamsar and BSA at four different temperatures according to the modified SternVolmer equation. Also, the thermodynamic parameters, enthalpy changes )H( and entropy changes )S(, for the reaction were calculated. Keywords: Thermodynamic parameters, Bovine serum albumin, Binding constant
245

Study of the Forster resonance energy transfer between [Co (diNOsar)] Cl3 and bovine serum albumin
Bahman Vasheghani Frarahani Ghasem Rezanejade Bardajee Zari Hooshyar* *: Zhooshyar@gmail.com Imam Khomini international university, faculty of science, department of chemistry, PO Box 288, Qazvin, Iran Department of Chemistry, Payame Noor University, PO BOX 19395-3697, Tehran, Iran Imam khomini international university
Abstract: Protein is an important chemical substance in our life and the major target of many types of medicine in the body. In this work, firstly, a new Co complex was synthesized and then it was mixed with bovine serum albumin to study the Forster resonance energy transfer (FRET). Also the distances between Co complex and BSA were calculated for different concentrations of Co complex. Keywords: Energy transfer, Cobalt complex, bovine serum albumin
246
3rd International Student Biotechnology Congress Bioinformatics

) (SNPs )(GWAS
*Morteza BitarafSani Ali Asghar Aslami Nejad Mohamad Reza Nasiri * mbetaraf@yahoo.com ferdowsi university ferdowsi university ferdowsi university
: . DNA : )(case (control). SNP . . 2003 HapMap 2005 . 3( :Case- control ) Cohort ( ) Trio ( ) . GWA case-control . SNP . . " 8000 " HapMap SNP-chip 300 400 . 3 . 100 100 100 100 . GWASimulator . 2000 8000 3 . SNPassoc R . " " 6822 SNP . :
247

*Fatemeh Farzaneh Zohreh Mirzapour Abbasabadi Mehdi Shamsara )National Institute of Genetic Engineering and Biotechnology (NIGEB )National Institute of Genetic Engineering and Biotechnology(NIGEB )National Institute of Genetic Engineering and Biotechnology(NIGEB
* farzanehfatemeh@ymail.com, zohrehmirzapoor@yahoo.com, shamsa@nigeb.ac.ir
: . . ( ) . ) (chromosomal position effect . . . ) (insulator DNA . . . . ) (enhancer ) (silencer . ) (trangenesis . :
248

Evaluating relationship in cytokines level, Fibromyalgia Impact Questionnaire and Body Mass Index in women with Fibromyalgia Syndrome
Ghizal Fatima Siddharth Das Abbas Mahdi* Department of Biochemistry, King Georges Medical University, Lucknow, India. Department of Rheumatology, King Georges Medical University, Lucknow, India. Department of Biochemistry, King Georges Medical University, Lucknow, India.
* aamahdi@gmail.com
Introduction: Cytokines (TNF- and IL-6) levels are found to be altered in Fibromyalgia syndrome (FMS) patients. Furthermore, Body Mass Index (BMI) may also be related to disturbed cytokines level. Therefore, in this study we have measured the level of cytokines and correlated it with BMI and Fibromyalgia Impact Questionnaire Revised (FIQR) in female FMS patients (n=50) and control group (n=50). Methods: 4 ml of blood samples were taken from both the group of patients and controls to measure the level of IL-6 and TNF- by the ELISA kit. Symptoms of FMS were measured by FIQR. BMI was calculated by a standard formula of weight in kilograms divided by height in meter square. Results: There were significant differences in BMI levels in FMS patients than in control group, and the significant association was found in BMI levels and IL-6. Whereas no significant association was found in between BMI and TNF- levels in patients and control group. Furthermore, a significant association was found in FIQR and BMI in patients than in control group. Conclusions: We conclude in this study, that patients with higher BMI may fall at the risk of FMS. Therefore, weight management may be an important aspect of treatment for high BMI levels in FMS patients. Keywords: Fibromyalgia Syndrome, Body Mass Index, Tumor Necrosis Factor
249

Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its Structure
Farnaz Ghasemian* Mahsa Mohseni Shiraz University Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran
* farnaz.ghasemian@gmail.com
Introduction : Survivin is a protein composed of 142 amino acids which is encoded by the BIRC5 gene in humans. This protein inhibits the programmed cell death (apoptosis) and also controls the cell cycle. Survivin is expressed highly in most human tumours, but is undetectable in most terminally differentiated normal tissues, making it an attractive protein in the study of cancer pathophysiology, drug discovery, and medical diagnosis. Among the studies related to the effect of Survivin inhibitory mutations in cancer cells, more attention has been on T34A mutation. Thus, in this study the effect of this mutation on the structure and function of the protein using molecular dynamic simulation in a 25-ns time scale was investigated. Materials and methods : At first, complete wild structure of protein was modeled using MODELLER 9.9 software. Also, for making the mutant model of protein, threonine 34 was changed to alanine using Swiss PDB Viewer software. Then, using GROMACS 4.5.4 package and Amber force-field, molecular dynamics simulation was done, and at the end, equilibrium structures of models were analized in order to investigate structural changes related to the protein function. Results : The results of modeling and molecular dynamics simulation of this protein in wild-type and mutant forms show that T34A mutation may disturb the interaction between Survivin and HBXIP (a cofactor for Survivin that is involved in antiapoptotic activity of Survivin) and also XPO 1 (a protein which mediates nuclear export of Survivin). On the other hand, this mutation may facilitate and support the interaction between Survivin and Smac/DIABLO (a protein that inhibits Survivin antiapoptotic activity), Borealin and INCENP (two subunits of CPC which are required for correct control of the cell cycle), and also histone H3 (a necessary protein for accurate chromosomal segregation during the control of the cell cycle). Conclusion : Overall, our study may provide the structural basis for functional changes of Survivin, as was experimentally observed for this mutation. Keywords : Survivin- Mutation
250

Prediction and modeling of Phytasethermostable structure based on bioinformatics tool
Animal Science Department, Faculty of Agriculture, Ferdowsi University, Mashhad Animal Science Department, Faculty of Agriculture, Ferdowsi University, Mashhad Department of Biochemistry and Bioinformatics Faculty of of Pharmacy, Mashhad University of Medical Sciences Department of Biology, Faculty of Science and Institute of Biotechnology, Ferdowsi University , Mashhad
Maryam Gholizadeh* Mohammad Reza Nassiry Mohammad Reza Saberi Aliakbar Haddadmashadrizeh * ma.gholizade@gmail.com
Abstract: Phytase enzyme belongs to a Specific group of phosphatases that Led to the initial hydrolysis of Phytic acid (Inositol hexakisphosphate). These enzymes are used widely in, poultry and fish industry for available phosphorus, minerals, energy and amino acid. Phytic acid is main but inaccessible form of phosphorus in poultry digestion tract. Without phytase, phytic acid will be excretes. at other hands, phytase can be used as additive feed but pjytase thermal instability is main problem at this regard. Therefore, production of anthermostable structure for phytase enzyme seem to be necessary. The aim of this study is thermal stabilization of fungal phytase. Thus amino acid sequence of 40 heat-stable enzymes, 30 enzymes that were randomly selected and 30 sequence of phytasewere collected. Initial analysis using bioinformatics software contains Interpro Scan, Protscal, Protparam, Motif Scan and statistical analysis was performed with the software SPSS16. thermo stable phytase model was constructed by replacing amino acid in natural phytase protein using the software MOE. Minimize energy modeling was performed using HyperChem software. analyzing protein structures for validity and assessing model was performed using the SAVES software.results indicate that favorable changes in the thermal stability of proteins with small changes in the amino acid sequence with no significant change in the shape and structure of the protein has been created. Keywords: Phytase, Bioinformatics, Protein modeling, Thermal stabilization
251

Determination of Listeriolysin O protein structure using Homology Modeling
Aida Hamidkhani* Roya Ghaderpanah * aida_hami@yahoo.com alzahra university Alzahra university
Abstract: Listeriolysin O(LLO) is pore forming toxin protein which is major virolance factor of listeria monocytogenes required for escape of bacteria from phagosomal vacuoles and entry into host cytosol whithout damaging the plasma membrane of infected cell.LLO is also a target antigen of antilisterial immunity and may represent the dominant target during the expression of the immune response to listeria monocytogenes. listeria monocytogenes is a bacterium that causes the infection listerosis and is one of most virulent food-borne pathogens whit 20 to 30 percent of clinical infections resulting in death .With an increase in the incidence of drug-resistant and the desire to develop more effective antibacterial therapies, it is essential that this infectious agent be thoroughly studied so in this study we try to find the structure of this toxin. In the first step, the sequence and information of target protein was extracted from the Uniport KB database. At the next stage by performing the Blast P, appropriate template was selected .then listerilysin O was modeled with swiss-model on the basis of selected template. to optimize the model and determine different parameters, available software and databases were used and parameters like patterns, hydrogen bound, RMSD, molecular surface, electrostatic potential, energy minimization, secondary structure and protein family were determined. Our target protein is Listeriolysin O, which its code in the UniprotKB database is P13128 and the selected template PDB code is 3HVN-A. The reasons of this template selection was its most identity with target protein ,and similar family and function of target and template proteins. our target protein belong to thiolactivated cytolysin family .The number of hydrogen bonds calculated 310 and molecular surface of protein was 2407/2 . Determination of electrostatic potential, expressed that the basic amino acid were scattered around the molecule while acidic types of amino acids were present sporadically in the center of protein. the amount of RMSD of this protein in comparison to template protein was 0/54. after energy minimization ,the protein energy was reduced from -22075/857 to -27231/529 the protein secondary structure consist of : Helix=18.9%, Strand=32.5%, Loop=48.6%. this protein include 8 prosite pattern as below: N-glycosylation site, cAmp-and cGmp dependent protein kinas , Casein kinase2 phosphorylation site, Tyrosine kinase phosphorylation site, N-myristoylation site, microbodies c terminal targeting signal, Thiol-activated cytolysine signature, Protein kinase c phosphorylation site The RMSD:0/54 shows that our modeling is proper and template selection is correct . by studying this modeled protein we would be able to find new ways (such as new vaccine)to confront bacterial infections. Keywords: Homology Modeling, protein structure, swiss-model
252

Using percolation theory for studying Studying the relationship between robustness against mutations in metabolic networks and lifestyle of organisms
Hawa Kouhestani Sayed-Amir Marashi* Majid Mahdavi * marashi@ut.ac.ir Tabriz state university Department of Biotechnology, College of Science, University of Tehran, Tehran Tabriz state university
Introduction: Robustness is defined as the insensitivy of a system to parametric variations. Variation in parameters occurs by changes in the environmental conditions or by internal alterations.In the present work, we introduce a novel approach to the analysis of metabolic network robustness. Materials and methods: The genome-scale metabolic network models of 14 species are used in this study, including 3 eukaryotes )group 1(, 6 free-living prokaryotes )group 2(, and 5 prokaryotes with highly specific growth conditions (group 3). Our algorithm is inspired by the concept of percolation. Results: We show that eukaryotes and free-living prokaryotes show much higher mutational robustness compared to organisms which are highly adapted to their habitats. Conclusion: Variations in environmental conditions or nutrients and intracellular changes such as genetic mutations have the potential to change stability and efficiency of an organism. Structural robustness helps biological systems to choose alternative routes of adaptation to varying conditions.The results of this study confirm that in organisms which are highly adapted to their environment, robustness to mutations may decrease compared to other organisms. Keywords: Robustness; Metabolic networks; metabolic fluxes; Percolation theory
253

Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP Technique
Fateme mortazavi* Ghassem Amoabediny Faramarz mehrnejad Ali Hossein Rezayan Morteza Hosseini * fatimamortazavi@gmail.com university of Tehran university of Tehran university of Tehran university of Tehran university of Tehran
Introduction: Ankylosing spondylitis is a form of ongoing joint inflammation disease (chronic inflammatory arthritis) that primarily affects the spine. This condition is characterized by back pain and stiffness. Over time, back movement gradually becomes limited as the bones of the vertebrae fuse together. The earliest symptoms of ankylosing spondylitis result from inflammation of the joints between the ilia and the sacrum. In the most advanced cases, this inflammation can lead to new bone formation on the spine, causing the spine to fuse in a fixed, immobile position, sometimes creating a forward-stooped. There is substantial evidence strongly favoring a direct role for HLA-B27 gene in genetic susceptibility to Ankylosing spondylitis (AS).HLA-B27 is a serologic specificity that encompasses 25 different alleles that encode 23 different proteins: HLA-B*2701 to HLA-B*2723. Materials and methods: These alleles are also called subtypes of HLA-B27 with a considerable geographic and ethnic difference in distribution. These subtypes are distinguished from changes mostly in exons 2 and 3, which encode the alpha 1 and alpha 2 domains of the B27 molecule. The sequences of these subtypes HLA-B*2701, HLA-B*2702, HLA-B-2704, HLA-B27052,HLA-B-2706, HLAB*2707, HLA-B*2712 got from The National Center for Biotechnology Information advances science and health. In silico AFLP analysis was performed on coding sequences by CLC Genomics Workbench 5.1 software. Results: Digestion of sequences was done via BglII, PstI, KpnI restriction enzymes and the profile of restricted fragments was constructed. Also phylogenetic tree constructed by the Maximum Likelihood method and the Neighbor join in algorithm. Profile showed that the smallest fragment had 16bp in HLA-B*2712 allele and the largest fragment observed in HLA-B*2707 allele. Also Phylogenetic tree constructed by the Maximum Likelihood method and the Neighbor join in algorithm, grouped all studied species into 3 clusters. Conclusion: The HLA-B*2701 and HLA-B*2712 was shown more similarity to each other and grouped in one cluster. The second cluster involve The HLA-B*2705 and HLA-B*2707 which have high similarity and grouped in second cluster. Keywords: Ankylosing spondylitis, HLA-B27 various alleles, in silico AFLP (amplified fragment length polymorphism)
254

cDNA
*Maryam Moshiry Ali Ashghar Aslaminejad Mostafa Ghaderi Ferdowsi University of Mashhad Ferdowsi University of Mashhad Yasouj University
* maryam.moshiry@gmail.com
: . cDNA . cDNA . cDNA . - . cDNA . . . cDNA Classical Clustering Methods Projection Methods . . . . Missing Completely At Random Missing At Random . . : . - . MATLAB R . : CDNA
255

Prediction of subnuclear location of proteins using Artificial Immune System
Zeynab piryaei Mehdi Sadeghi National Institute Of Genetic Engineering And Biotechnology National Institute Of Genetic Engineering And Biotechnology
* zeynab.piryaei@yahoo.com , sadeghi@nigeb.ac.ir
Introduction : Subcellular protein localization prediction is one of the important problems in bioinformatics to which attentions have been directed. Nucleus, the most important cell component, is divided to some sections called Subnucleus. Proteins are sublocalized according to their functions. So, protein mislocalization results in dysfunction and disease. Hence, there is a direct relation between protein localization and its function. Therefore, knowledge of protein localization leads to realize its function. Materials and methods : Although there are several experimental methods to protein sublocalization, being them time-consuming and costly leads to utilizing prevailing and efficient prediction methods based on learning machines. Different approaches for localization prediction include two distinct steps: 1. Protein representation methods which each produce different properties based on amino acid sequences analysis. 2. Use of classifiers algorithm for protein localization. Artificial Immune Systems(AIS), as one of the possible classification, are machinery systems. For the first time, this study deals with investigation of Artificial Immune System for nucleus proteins localization, considering its capabilities in pattern classification. First, different representations for protein sequences were obtained. Then, Artificial Immune System algorithm was performed as a classifier with training method (including all-against-all, one-against-all, one-againstone) and cross-validation test method on each of 37 representations. Finally, classification was performed using voting for 37 representations. Results : Negative selection algorithm had the highest accuracy among Artificial Immune System algorithms with overall accuracy of %56.34 Conclusion : This method performed less powerful than Nuc-ploc method. Keywords : nucleus, localization, protein sequence representation, Artificial Immune System.
256

Analysis Some of the Features Bioinformatics CSN3 Gene in Dairy Cattle
Zahra Roudbari Mohammad Reza Nassiry Khadijeh Nasiri Maryam Gholizade Animal Science Department, University, Mashhad Animal Science Department, University, Mashhad Animal Science Department, University, Mashhad Animal Science Department, University, Mashhad Faculty of Agriculture, Ferdowsi Faculty of Agriculture, Ferdowsi Faculty of Agriculture, Ferdowsi Faculty of Agriculture, Ferdowsi
* rodbari.zahra@gmail.com
Abstract: Kappa Casein protein is one of the major milk proteins and is controlled by a gene with five exons and four introns. The production of cheese and also the milk insolubility outside the refrigerator directly depends on the characteristics of the kappa casein milk this protein decreased milk coagulation time and increased stability and strength curdle milk. In this study, some of the characterizations bioinformatic these genes evaluated using of the NCBI database and Expasy. Map viewer data show that the gene encoding bovine kappa-casein is located on chromosome 6. Kappacasein proteins with molecular weights of 21,269 DA and 190 amino acids are coded by the gene CSN3. Kappa-casein protein is broken into five chains Casoxin-C, Casoxin-6, Casoxin-A, Casoxin-B and Casoplatelin. This protein contains 190 amino acid. Among which twenty-one amino acid sequences was the role signal peptide and One hundred and sixty-nine amino acid residues are involved in a chain. Genomatix program was used to determine This gene nucleotide composition and was determined that This gene has the highest percentage in adenine and thymine nucleotides (both 34%). also Smart program was used to determine the protein domains and it was found a signal peptide and Kappa- casein domain. The results of this analysis showed that the onset of the mature protein is twenty two number nucleotide, in addition to amino acid composition was determined using of Protparam program while Proline and Alanine amino acids are most abundant (respectively 11.1 and 8.9%) . isoelectric point is 6.83 and Half-life measured in mammalian cells 30 hours. also Mega5.0 software was used for plotting phylogenetic tree to investigate the evolutionary relationships of cattle and other mammals and determined that most closely corresponding gene is Bubalus bubalis (buffalo), also analyzed the promoter region of the CSN3 gene of cattle using of NSITE program that was found forty-six motif and the high number of motifs are causing the high expression of this gene in cattle. for plotting two-dimensional and three-dimensional structures of protein were used respectively Psipred and MOE programs. this study information can be helpful in vector selection and efficient systems for expression CSN3 gene. Keywords: Bioinformatics, CSN3 gene, Dairy Cattle
257

The Study of Human Glucose-6 Phosphatase Protein Structure using Homology Modeling
Shirin Shahsavari shirin_sh777@yahoo.com Introduction: Glucose-6 Phosphatase (G6PC) enzyme which is located at endoplasmic reticulum, is counted as one of the most important enzymes in Gluconeogenesis and Glicogenolysis metabolism pathways and also plays a significant role for adjusting an established level of blood glucose. Deficiency of mentioned enzyme causes a variety of genetic disorders such as Von gierke disease or glycogen storage desease type 1A . A metabolic disorder characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia. This study was aimed to model the Glucose-6 Phosphatase protein using Homology Modeling by Swiss Model software in order to optimize its performance in the human body. Method: In the first step, the sequence of mentioned protein(G6PC) was gained from the Uniport KB database. At the next step by performing the protein blast, appropriate pattern was selected based on similarity percentage, E-Value and the number of covering amino acids for comparison, then alignment was carried out by employing Clustal W. Simulation was done by Swiss Model software and constructed model was optimized using the PDB Viewer. Number of hydrogen bonds, the electrostatic potential, secondary structure content, determining the pattern of protein available, measurement of the accessible surface of the molecule, the energy minimizing determination and other required data were determined using available databases and softwares. The precision & accuracy of the model was evaluated by RMSD factor. Results: Our target protein is human Glucose-6 Phosphatase which its code in the Uniport KB database is P35575 and the selected patterns code is 3E6U in PDB. The number of hydrogen bonds was 219 and the accessible surface of molecule calculated as 19060.7 2. Determination of electrostatic potential, expressed that the basic amino acid had Alzahra University
258

been significantly accumulated in the most of the surface of the molecule while acidic types of amino acids were present sporadically in the protein. Content of second structure of this protein was as follows: Helix=72% Strand=2.2% Loop=25% Also the level of energy minimizing was calculated as-7000 Kj/mol. Prosite Patterns of target protein can be summarized as follows: N-glycosylation site (PS00001)
1. Protein kinase C phophorylation site(PS00005) 2. Casein kinase phosphorylation site (PS00006) 3. N-myristoylation site (PS00008) 4. Microbodies C-terminaltargeting site (PS00342) 5. Leucine zipper pattern (PS00029)
Considering the carbon , the amount of RMSD of this protein in comparison to pattern protein was 3/30 -Discussion: Modeling the Glucose-6 Phosphatase protein using homology modeling to predict its structure and performance, can facilitate its better identification and can also be helpful in better understanding the disorders associated by its deficiency and finding possible remediation option.
259

In silico Search and Synthesis Design of 3- (phenyl) acrylonitrile Derivatives and Evaluation Anti-inflammatory Properties with Marvin Sketch Software
Vida Sedighi
Biotechnology Research Center, Pasteur Institute, Tehran, Iran
Fatemeh Saadat*
Biotechnology Research Center, Pasteur Institute, Tehran, Iran Young researchers Club and Elite, Takestan branch, Islamic Azad University, Takestan, Iran.
sedighivida@yahoo.com
Abstract: A number of articles have already been published on the application of benzylidene acetone oxime ether as a bioactive compound1. In a recent survey it is reported that benzylidene acetone oxime ether possess anti inflammatory activity. Herein, we report the synthesis design a series of 3-(phenyl) acrylonitrile derivatives with Aldol mechanism. All the compounds were investigated in silico for anti inflammatory activities. Among the compounds 3-(4-methoxyphenyl) acrylonitrile showed the highest activity with in silico search, Average of anti inflammatory was 0.764 to 0.230. Between anti inflammatory properties these compound and Length perpendicular to the max area descriptor has liaised with used Marvinsketch software. Keywords: 3-(phenyl) acrylonitrile derivatives, anti inflammatory, in silico search, Marvin sketch software.
260

Bioinformatics Study Of microRNAs To Identify Genes and Cellular Pathways Associated With Medulloblastoma
Reza Zati Keikha* shahid beheshti university
* rezazatikeikha@gmail.com
Medulloblastoma is the most common malignancy brain tumors among children. Molecular mechanisms associated with these tumors has not been fully identified. Recent research related to medulloblastoma miroRNAs role in regulating processes has been documented. miRNA binding to the 3'UTR transcripts of a gene and the gene expression is regulated. Studies has approved the reduction of five miRNAs, hsamiR-150, hsa-miR-138, hsa-miR-128a, hsa-mir-124 and hsa-let-7g in medulloblastoma . The purpose of this bioinformatics study is to identify genes and cell pathways associated with medulloblastoma and new therapeutic target for this common cancer among children be introduced. Related to this miRNA sequences from miRBase database downloaded and the programs miRanda, PicTar, Target Scan and MicroCosm for all copies of genes 3'UTR sequences in NCBI and ENSEMBL databases To predict the binding site for this miRNAs were used. KEGG, BBID and BIOCARTA databases to identify cellular pathways associated with these genes and miRNA was used. To identify gene clusters that are similar to miRNA binding positions and thus have the same regulatory pattern; hierarchical clustering method by Tree View , Cluster3.0 software was performed. . MiRNA sequence alignment was done also by T-Coffee web application. A total of 109 genes with a number of five, four and three positions were identified for miRNA target. ARAF gene with the highest score with the five position for miRNAs were detected. RRAS, SOCS, PDCD6, BAX, RAB34, CTPS2, LIPH, RHOT2 important genes were identified. The role of these genes in other cancers has been approved. Twelve cellular pathways associated with these genes were found. Between this pathways the intracellular signaling cascade and negative regulation of cellular protein metabolic process were the most important . The results of hierarchical clustering showed that hsa-miR150 and hsa-miR-128a is located in a cluster, and thus possess a similar regulatory pattern. The results of alignment confirm that this miRNAs have the highest similarity in their regulatory regions. Keywords: Medulloblastoma, MicroRNAs, Bioinformatics Analysis
261

The Identifying Of Diagnostic Markers In Prostate Cancer By The Use Of ESTSSRs
Reza Zati Keikha* shahid beheshti university
* rezazatikeikha@gmail.com
Abstract: Prostate cancer is the second most common malignancy among men worldwide. SSRs are used in genetic studying due to their abundance ,wide variety, codominancy and multi allele. Up to now, many studies have been reported on the relationship between SSRs and prostate cancer. The CAG repeat sequences have been partly associated with prostate cancer. This study is aimed at investigating ESTSSRs located in normal and cancerous prostate tissue to recognize the type and number of SSRs and to introduce diagnostic markers in prostate cancer. Two EST libraries related to normal and cancerous prostate tissues was downloaded by the MEGA software from the website of Harvard University. SSR Locator software is used to identify the type and number of SSRs in ESTs. Primers were designed by primer3 program and virtual PCR was applied in order to diagnose SSRs. SPSS software was used For the statistical analysis. Statistical analysis demonstrated significant differences )p 0.05( between the trinucleotide and pentanucleotide SSRs in normal and cancerous prostate tissues. Two types of tissues in the type and number of amino acids were different. Abundance of amino acids cysteine and valine in cancer tissue was twise as much as the normal tissue. AGC abundance in cancer tissue was too high in camparison with normal tissue (more than six times). TTTTG and CCCAG pentanucleotides were present only in cancer tissue (more than a quarter). This SSRs can be used as a diagnostic marker in prostate cancer. Keywords: Prostate Cancer, EST, SSR
262
3rd International Student Biotechnology Congress General Biotechnology

Ali Alizade Tilki *Mostafa Motalebi Mohamad Reza Zamani *seyede yasaman alavian Zahra Moghadasi Jahromi Asal Akhavian Tehrani Gholamreza Nikbakht Brujeni National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology shahid beheshti school of pharmacy National Institute of Genetic Engineering and Biotechnology National Institute of Genetic Engineering and Biotechnology University of Tehran
* motalebi@nigeb.ac.ir, yasaman.alavian89@gmail.com
: . . . . . . : ( ). : 100 . . : 15 . :...
263

*Hossein Eyni Ali Bayander Abolfazl Shekari Zanjan University of Medical sciences Zanjan University of Medical sciences Zanjan University of Medical sciences
* h.eyni69@gmail.com
: . . . . : Pubmed SID 2005 2012 . : . . : . .

: .
264

*Zana Pirkhezranian Neda Naghibi Hossien Barzegar Faeq Khezri Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad college of scince, Ferdowsi University of Mashhad, Mashhad, Iran. Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad
* zanap.8690@gmail.com
: ()Bioethics Bio Ethics - . . . ( )Biocentric ( )Anthropoceutric ()Ecocentri . ( ) . . . . . :
265

*Zana Pirkhezranian Hossien Barzegar Neda Naghibi Hamid Goli Morteza Mahdavi * zanap.8690@gmail.com Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran faculaty of science ,Ferdowsi University of Mashhad, Mashhad, Iran Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran Department of Animal Sciences, college of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran.
: . . ) (Transgenic . . . ) (Genetically modified organism GMO . . ... . . . . . . . GMO . GMO GMO . . . . :
266

International Student Biotechnology Congress

Cargado por

Información del documento

Descripción original:

Derechos de autor

Formatos disponibles

Compartir este documento

Compartir o incrustar documentos

Opciones para compartir

¿Le pareció útil este documento?

¿Este contenido es inapropiado?

Copyright:

Formatos disponibles

International Student Biotechnology Congress

Cargado por

Copyright:

Formatos disponibles

3rd International Student Biotechnology Congress

In the name of God

3rd International Student Biotechnology Congress