Food Control 32 (2013) 198e204

Contents lists available at SciVerse ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Short communication

Simultaneous detection of six food-borne pathogens by multiplex PCR with

a GeXP analyzer
Beili Zhou a, b,1, Jinwen Xiao b, c,1, Shengfeng Liu b, c, Jun Yang b, c, Yu Wang b, c, Fuping Nie b, c, Qing Zhou b, c,
Yingguo Li b, c, Guohua Zhao a, d, *
a
College of Food Science, Southwest University, Chongqing 400715, PR China
b
Chongqing Entry-Exit Inspection and Quarantine Bureau of China, Chongqing 400020, PR China
c
Chongqing Import and Export Food Safety Engineering Center, Chongqing 400020, PR China
d
Key Laboratory of Food Processing and Technology of Chongqing, Chongqing 400715, PR China

a r t i c l e i n f o a b s t r a c t

Article history: A novel application of GeXP analyzer was developed for simultaneous detection of six pathogens asso-
Received 11 July 2012 ciated with food poisoning outbreaks, including Salmonella enterica, Escherichia coli O157:H7, Listeria
Received in revised form monocytogenes, Staphylococcus aureus, Shigella spp., and Campylobacter jejuni. Chimeric primers con-
21 November 2012
taining both microbe- and pMD19-specific sequences were fused to universal sequences resulted in PCR
Accepted 27 November 2012
products with intended sizes. The PCR products were separated by capillary electrophoresis and iden-
tified by using fluorescence spectrophotometry. Plasmid pMD19-T was added to each reaction as positive
Keywords:
control to ascertain the PCR steps and data analysis step of the assay. The results indicate that the GeXP
Food-borne pathogens
GenomeLab Gene Expression Profiler
method is both specific and sensitive for the detection of all six food-borne pathogens in a single
(GeXP) reaction-without any enrichment step. In conclusion, the GeXP-PCR assay is a rapid, sensitive and high-
Multiplex PCR throughput method for parallel analysis of food-borne pathogens.
Parallel analysis Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction
Illnesses resulting from the consumption of foods contaminated
with pathogens and/or their toxins have a wide range of economic
and public health impact worldwide (Motarjemi & Käferstein,
1999). Therefore, it is important to develop and validate methods
for the rapid detection of biological contaminants in foods.
Conventional detection methods for pathogenic bacteria rely
primarily on direct plating methods and biochemical tests, which
are time-consuming and labor-intensive (Kim et al., 2007). Conse-
quently, a variety of researchers have tried to develop rapid and
sensitive analytical methods for the detection of pathogenic
bacteria. The polymerase chain reaction (PCR) is the most
commonly employed molecular tool for the detection of pathogens.
It allows the target gene of specific bacteria present at extremely
low level to be identified after exponential amplification
(Tang, Procop, & Persinga, 1997). However, the conventional PCR
* Corresponding author. College of Food Science, Southwest University, # 1
Tiansheng Road, Chongqing, 400715, PR China. Tel.: þ86 23 68 25 19 02; fax: þ86
68 25 19 47.
E-mail address: zhaogh@swu.edu.cn (G. Zhao).
1
These authors contributed equally to this work.
methods require agarose gel analysis to detect PCR products, which
was unsuitable for high-throughput analysis and have a lower
sensitivity than real-time PCR (Perry et al., 2007). Compared to
conventional PCR, the Taqman probe-based real-time PCR has some
advantages, including potential for quantification, higher sensi-
tivity, and minimal cross- contamination potential, and is widely
used in various applications including pathogen diagnosis
(Amoroso et al., 2011; Rodríguez-Lázaro et al., 2005). However, the
limited availability of spectrally distinct fluorescent tags has
impeded analysis using real-time PCR of more than four target
pathogens per sample in a single run (Grace et al., 2003). Another
popular method, the DNA microarray analysis, offers an efficient
approach to detect microbial pathogens. In recent times, it has been
available for the rapid detection and identification of 170 strains of
bacteria belonging to 11 genera or sequence-specific identification
of up to 18 pathogenic microorganisms (Jin et al., 2005; Wilson
et al., 2002). Although the development of microarray platform
has made it capable of high-throughput analysis, the method has
a disadvantage in the accuracy of identification. DNA microarray
technology is based on the hybridization of probes to target genes,
and therefore, non-specific hybridization is inevitable, and differ-
ences in the melting temperatures of probes and targets reduce the
resolution of the method (Shin, Hwang, Oh, Doh, & Jung, 2010).
Moreover, the limitations in dynamic range leading to saturation at

0956-7135/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.foodcont.2012.11.044
 B. Zhou et al. / Food Control 32 (2013) 198e204 199

higher intensity levels and lack of standard procedures for signal/

Concentration
noise optimization have seriously reduced the utility of microarray
technology and impeded the subsequent development of down-
stream applications (Rai, Kamath, Gerald, & Fleisher, 2009).

(mM)

0.5
1
1
1
1
1
1

10
The GenomeLab Gene Expression Profiler (GeXP) genetic anal-
ysis system was originally designed to allow for a high throughput,
robust and differential assessment of a multiplex gene expression
profiling analysis (Rai et al., 2009). The GeXP-PCR detection can

fragment
Random
combine patented XP-PCR priming strategy with capillary electro-

region
Target

dnaA
ipaH
gyrB
gyrB
rfbE
phoretic separation, resulting in a high level of specificity, sensi-

coa
tivity and high-throughput capacity. With the GeXP, up to 35 genes
can be easily multiplexed in a single reaction. The major advantages
of this method include high performance, high multiplexing

Amplicon
size (bp)
capability, and the ability to process samples in parallel. These
advantages have further widened its areas of application. Recently,

269
320
156
242
256
316
217
the GeXP analyzer has been used in simultaneous detection and
identification of up to 68 unique varicella zoster virus gene tran-
scripts (Nagel, Gilden, Shade, Gao, & Cohrs, 2009) or genotyping of
11 human papillomavirus in a single reaction (Yang et al., 2012).

GTACGACTCACTATAGGGATCAGC(A/G)ATTTCACGTTTTCG
GTACGACTCACTATAGGGAGCAGAGACGGTATCGGAAAG
GTACGACTCACTATAGGGATCATCGCACCGTCAAAGGAA
However, there has been no report on the detection or identifica-

GTACGACTCACTATAGGGAATTTACGACGAGGTTCCACG
GTACGACTCACTATAGGGATGTAATTGTGCCCTGTGGAA

GTACGACTCACTATAGGGAACCCGCACTATCATAGCCAC
GTACGACTCACTATAGGGACGCTCTGCTAATCCTGTTA
tion of pathogenic bacteria using the GeXP analyzer.
Salmonella is the leading cause of food-borne illness, which is
a significant risk to public health (Taskila, Tuomola, & Ojamo, 2012).
Worldwide, Escherichia coli O157:H7 is considered as a leading
cause of diarrhea, hemorrhagic colitis and hemolytic-uremic
syndrome (Besser, Lett, Weber, & Doyle, 1993). Listeria mono-
cytogenes is associated with listeriosis, a severe disease with high

GTACGACTCACTATAGGGA
morbidity and mortality rates (Todd & Notermans, 2011). Staphy-

a
lococcus aureus is a major pathogen that causes serious infections in

Reverse primer(50 -30 )

Table 1
Bacterial strains, their sources and enrichment media.

No Bacteria Serovar/strain Sourcea Enrichment

media
1 Salmonella enterica Enteritidis ATCC 13076 TSB
2 Salmonella enterica Enteritidis Clinical isolate TSB

The forward universal primer was covalently labeled with Cy5 fluorescent dye at the 50 end.
3 Salmonella enterica Typhimurium ATCC 14028 TSB
AGGTGACACTATAGAATAGAAACAAGAGAAGC(G/A)GTTGC

AGGTGACACTATAGAATAATCAGCA(A/G)GGTTTAATGGCG
4 Salmonella enterica Typhimurium Unknown TSB
AGGTGACACTATAGAATAATTAAC(C/A)TCTTCGCCGGACT

5 Salmonella enterica Choleraesuis ATCC 10708 TSB

AGGTGACACTATAGAATAGTGAAATTATCGCCACGTTCG

AGGTGACACTATAGAATATGAAGGTGGAATGGTTGTCA
AGGTGACACTATAGAATAGGATACAACCATGAATCCGG

AGGTGACACTATAGAATATCACGCTGTAGGTATCTCAG

6 Escherichia coli NCTC 12900 TSB

7 Escherichia coli O157：H7 ATCC 8739 TSB
8 E coli O157：H7 Unknown TBS
9 Escherichia coli O157：H7 Unknown TSB
10 Listeria monocytogenes ATCC 15313 BHI
Primers characteristics and their concentration utilized in multiplex assay.

11 Listeria monocytogenes Unknown BHI

12 Listeria monocytogenes Salmon BHI
13 Listeria monocytogenes Salmon BHI
14 Listeria innocua Cow brain BHI
AGGTGACACTATAGAATAc

15 Staphylococcus aureus ATCC 6538 BHI

a

16 Staphylococcus aureus CMCC 26003 BHI

Forward primer(50 -30 )

Underlined oligonucleotides are universal sequences.

17 Staphylococcus aureus Meat BHI

18 Staphylococcus aureus Meat BHI
19 Staphylococcus aureus Unknown BHI
20 Campylobacter jejuni ATCC 33291 BB
21 Campylobacter jejuni Chicken sausage BB
UWD-F/UEV-R are the universal primers.

22 Campylobacter jejuni Clinical isolate BB

23 Shigella flexneri Serotype 2b ATCC 12022 TSB
24 Shigella flexneri Serotype 2b Meat TSB
25 Shigella sonnei ATCC 25931 TSB
26 Shigella boydii Serotype 1 ATCC 9207 TSB
27 Cronobacter sakazakii ATCC 51329 TSB
Escherichia coli O157：H7

28 Staphylococcus epidermidis ATCC 12228 TSB

Listeria monocytogenes
Staphylococcus aureus

29 Klebsiella pneumoniae ATCC 700603 TSB

Campylobacter jejuni
Salmonella enterica

30 Vibrio parahemolyticus ATCC 17802 TSB

Positive control

UWD-F/UEV-Rb

31 Vibrio parahemolyticus Salmon TSB

32 Bacillus subtilis ATCC 6633 TSB
Shigella spp.
Organism

33 Clostridium perfringens ATCC 13124 TSB

34 Bacillus cereus ATCC 11778 TSB
Table 2

a
ATCC, American Type Culture Collection; NCTC, National Collection of Type
b
c
a

Cultures; CMCC, National Center for Medical Culture Collection.

200 B. Zhou et al. / Food Control 32 (2013) 198e204
humans, including pneumonia, septicemia and endocarditis
(McClelland et al., 1999). In developing countries, shigellosis caused
by Shigella spp. is a prevalent diarrhea disease (Carlson, Thornton,
DuPont, West, & Mathewson, 1983). In recent times, Campylo-
bacter jejuni has received increasing attention as a predominant
cause of bacterial food-borne enteritis in many countries (Piddock,
Ricci, Stanley, & Jones, 2000).
The objective of this study was to develop a rapid, sensitive and
high-throughput pathogenic bacteria diagnostic technique using
GeXP-based multiplex PCR assay (GeXP-PCR) for simultaneous
detection of six food-borne pathogens, namely Salmonella enterica,
Shigella spp., L. monocytogenes, C. jejuni, Staph. aureus and E. coli
O157:H7.
2. Materials and methods
2.1. Bacterial strains and their cultivation
The strains used for specificity testing are listed in Table 1. For
the identification of six food-borne pathogens and the sensitivity of
the GeXP assay experiments, the following strains were used: S.
enterica serotype Enteritidis ATCC 13076, E. coli O157:H7 ATCC
8739, L. monocytogenes ATCC 15313, Staph. aureus ATCC 6538, C.
jejuni ATCC 33291, and Shigella flexneri serotype 2b ATCC 12022. C.
jejuni was microaerobically incubated in brucella broth (BB; Difco
laboratories, Detroit, MI) at 42  C for 48 h. Clostridium perfringens
was anaerobically grown in tryptic soy broth (TSB; Difco laborato-
ries, Detroit, MI) at 37  C for 24 h. The other bacterial strains were
grown in tryptic soy broth (TSB) or brain-heart-infusion (BHI;
Oxoid Ltd., Basingstoke, UK) at 37  C for 24 h.
2.2. Preparation of positive-control plasmid pMD19
The pMD19-T vector (TaKaRa, Japan) was transformed in
competent E. coli DH5a(Life Technologies Inc., Gaithersburg, MD.)
and the cell suspension was added to the Luria broth. After being
incubated overnight at 37  C, the empty plasmid was extracted
using an E.Z.N.A Plasmid Extraction Kit (Omega Biotek Inc.,
Guangzhou, China). The plasmid DNA obtained was added to each
reaction during the multiplex PCR step as positive control.
2.3. GeXP-PCR primer design
Two types of primers were present in the reaction: 1) Chimeric
primers containing a gene-specific sequence with a universal tag at
the 50 end; 2) Universal primers that have the same sequence as the
universal tags used in the chimeric primers. Six pairs of chimeric
primers, one pair of positive-control primers, and one pair of
universal primers (UWD-F/UEV-R) were designed for this assay.
Six pairs of chimeric primers were designed according to the
conserved regions of the target bacterial gene segment using the
GenomeLab GeXP eXpress Profiler software (Beckman Coulter,
Fullerton, CA). One pair of primers for the detection of plasmid
pMD19-T gene that was used as positive control was also design.
The primer sequences, the target regions, and the size of the
resulting amplicons are listed in Table 2. The forward universal
primer was covalently labeled with Cy5 fluorescent dye at the 50 end
and yielded signals that corresponded to the amount of product in
the multiplex reaction. All chimeric primers and the universal
primers were obtained from Takara Corporation (Dalian, China).
2.4. Genomic DNA extraction and GeXP multiplex PCR
Genomic DNAs of all strains were extracted with an E.Z.N.A
Bacterial DNA Isolation Kit (Omega Biotek Inc., Guangzhou, China)
according to manufacturer’s procedures. PCR amplification of DNA
from bacteria was performed using the Veriti 96-Well Thermal
Cycler (Applied Biosystems, Foster City, CA). PCR amplification was
performed in a 20 mL reaction volume containing 2 mL (200e
500 ng) of bacterial genomic DNA, 2 mL (200e500 ng) of plasmid
pMD19 DNA, 10 mM of each of the forward universal primer and
reverse universal primer, 1 mM of each of the forward and reverse
chimeric primers of each targeted bacteria, 0.5 mM of each of the
pMD19 forward chimeric primer and reverse pMD19 chimeric
primer, 3.0 mM of MgCl2 (Promega, Madison, WI), 0.15 U of Taq DNA
polymerase (Promega, Madison, WI), 0.5 mM of each dNTP
(Promega, Madison, WI), and 1  PCR Master Mix buffer
(GenomeLab GeXP Start Kit; Beckman Coulter, Fullerton, CA) con-
taining 10 mM of HCl and 50 mM of KCl. In addition, the plasmid
pMD19 DNA was added directly to the PCR mixture as positive
control. Nuclease-free sterile distilled water (Invitrogen, Paisley,
UK) was used as negative control throughout the assay. The
amplification procedure consisted of two steps with different
annealing temperatures: step 1: 12 PCR cycles of DNA denaturation
at 94  C for 45 s, primer annealing at 52  C for 45 s, and DNA
extension at 72  C for 30 s; step 2: 20 cycles at 94  C for 45 s, 60  C
for 45 s, and 72  C for 30 s. A part of the amplified sample was
analyzed using 2.0% agarose gel electrophoresis. DNA bands were
stained with ethidium bromide (EB) and photographed using the
BIO-BEST 200E image system (SIM, HK, China).
2.5. GeXP multiplex data analysis
The GeXP system (Beckman Coulter, Fullerton, CA) was used to
separate the PCR products and analyze the data according to the
manufacturer’s instructions. The capillary array was pre-heated to
50  C for 15 min before analysis. 1 mL of the undiluted PCR product
was added to a 37.75 mL of sample loading solution along with
0.25 mL of DNA size standard-400 (GenomeLab GeXP Start Kit;
Beckman Coulter, Fullerton, CA). The PCR products were separated
based on size using high-resolution capillary gel electrophoresis,
presented as separated peaks in the electropherogram and identi-
fied in terms of their intended sizes. The data can be exported from
the GeXP Express Analysis module (Beckman Coulter, Fullerton, CA)
as a tab-delimited file for further statistical analysis. The presence
of a target pathogen was considered in the initial template when
the dye signal of the corresponding microbe-specific product was
greater than 2000 arbitrary units (A.U.).
2.6. Specificity of the GeXP-PCR assay
To assess the specificity of the GeXP-PCR assay, cultures of 34
target and non-target bacterial strains (Table 1) were prepared.
The purity of the genomic DNA was assessed by determining
the A260/A280 ratio using a spectrophotometer (BioMate 3; Ther-
moSpectronic, Rochester, NY). The GeXP-PCR was performed indi-
vidually for each of DNA samples of 34 strains in a multiplex primer
system using the experimental conditions described above. The
inclusivity and exclusivity were calculated according to the
Microval protocol (Anonymous, 2002). Inclusivity is the ability of
the PCR method to detect the target analyte from a wide range of
strains. Inclusivity is defined as the percentage of target DNA
samples that gave a correct positive signal. Exclusivity is defined as
the percentage of non-target DNA samples that gave a correct
negative signal.
2.7. The detection limits of the GeXP-PCR assay
Each target pathogen was cultured to obtain an approximate
cell concentration in the range of 108e109 CFU/mL. The cell
 B. Zhou et al. / Food Control 32 (2013) 198e204 201

suspension was serially diluted 10-fold with 0.9% (w/v) NaCl
to result in a cell concentration ranging from 106 to 10 0 CFU/mL.
The concentration of each bacterium (4.2  108 CFU/mL of
Salmonella, 9.3  108 CFU/mL of E. coli O157:H7, 3.1  108 CFU/mL
of L. monocytogenes, 2.7  108 CFU/mL of Staph. aureus,
8.5  108 CFU/mL of Shigella spp., and 6.6  108 CFU/mL of C.
jejuni) was determined by surface plating (0.1 mL) of the
appropriate dilutions onto corresponding agar plates. The C.
jejuni dilution was inoculated onto surface-dried charcoal cefo-
perazone deoxycholate agar (CCDA; Oxoid Ltd., Basingstoke, UK)
plate and the plate was subsequently microaerobically incubated
at 37  C for 48 h to count the colonies. For others, the number of
bacteria in the culture was estimated by standard plate count.
200 mL of 6 bacteria suspensions with the same dilution were
mixed to obtain the 1200 mL (200 mL  6) bacteria mixture.
The mixture was processed for DNA extraction and the DNA
obtained was added directly to the PCR mixture. GeXP-PCR
was performed using the experimental conditions as described
above. After amplification, 1 mL of each Cy5-labeled PCR
product was separated via GeXP capillary electrophoresis and
detected by fluorescence spectrophotometry. The experiment
was run in triplicate for each concentration ranging from 10 0 to
106 CFU/mL. The detection limit was determined as the lowest
concentration of bacterial dilution, at which the positive result
was reproducibly detected in all of the replicates.
3. Results
3.1. Identification of food-borne pathogens
Six food-borne pathogens, including S. enterica, E. coli O157:H7,
L. monocytogenes, Shigella spp., Staph. aureus and C. jejuni were
detected simultaneously via the GeXP multiplex PCR assay using
multiplex primer set (Fig. 1 Panel (A)). No PCR product corre-
sponding with target microorganism was detected in negative
control using the multiplex primer set (Fig. 1 Panel (B)). PCR
products corresponding with the positive-control plasmid pMD19-
T gene were detected from both negative control and pure cultures
of six pathogens.
3.2. Specificity of the GeXP-PCR assay
The specificity of the GeXP-PCR assay was examined by isolating
genomic DNA from 34 target and non-target bacterial strains. As
shown in Fig. 2, amplification products of the expected sizes were
obtained by PCR on six representative bacterial strains. All six
S. enterica strains, all three E. coli O157:H7 strains, four L. mono-
cytogenes strains, four Shigella spp. strains, five Staph. aureus
strains, and three C. jejuni strains were positive in the GeXP-PCR
assay and all of the non-target organisms were negative in the
assay. No mispriming or non-specific amplification was observed.

Fig. 1. Identification of 6 food-borne pathogens. Panel (A) shows the results of amplification of six food-borne pathogens in a single reaction. (B) No peak of the pathogen was
observed in negative control using the multiplex primer set; the red peaks indicate the DNA size standard-400 (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of this article.)
202 B. Zhou et al. / Food Control 32 (2013) 198e204
Fig. 2. Specificity of the GeXP-PCR assay. Panels (AeF) show the results of amplifica-
tion of six representative bacterial strains: (A) Listeria monocytogenes strain (ATCC
15313); (B) Escherichia coli O157:H7 strain (ATCC 8739); (C) Shigella flexneri 2b strain
(ATCC 12022); (D) Staphylococcus aureus strain (ATCC 6538); (E) Campylobacter jejuni
strain (ATCC 33291); (F) Salmonella enterica serovar Enteritidis strain (ATCC 13076). (G)
Nuclease-free water was used as negative control, the red peaks indicate the DNA size
standard-400. (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of this article.)
None of the reactions generated more than a single peak and peaks
of same species with different serotypes were shown in same
position. In addition, the expected size of each pathogen amplicon
was obtained only from the target microorganisms, resulted in
100% inclusivity and 100% exclusivity.
3.3. The detection limits of the GeXP-PCR assay
For each of the six pathogens, GeXP-PCR assay achieved
a sensitivity of 101e102 CFU/mL for both a single bacterial target
(data not shown) and when all the six pre-mixed bacterial targets
were present (Fig. 3). The detection limit of the GeXP-PCR assay was
420 CFU/mL for Salmonella, 93 CFU/mL for E. coli O157:H7,
Fig. 3. The detection limits of the GeXP-PCR assay were determined by amplifying
10-fold diluted, purified DNA, of known concentration of each target species simul-
taneously: (A) 4.2  105, 9.3  105, 3.1  105, 8.2  105, 8.5  105, 6.6  105 CFU/mL of
Salmonella, E. coli O157:H7, L. monocytogenes, S. aureus, Shigella spp., and C. jejuni,
respectively; (B) 4.2  104, 9.3  104, 3.1  104, 2.7  104, 8.5  104, 6.6  104 CFU/mL of
Salmonella, E. coli O157:H7, L. monocytogenes, S. aureus, Shigella spp., and C. jejuni,
respectively; (C) 4.2  103, 9.3  103, 3.1  103, 2.7  103, 8.5  103, 6.6  103 CFU/mL of
Salmonella, E. coli O157:H7, L. monocytogenes, S. aureus, Shigella spp., and C. jejuni,
respectively; (D) 560, 930, 310, 270, 850, 660 CFU/mL of Salmonella, E. coli O157:H7,
L. monocytogenes, S. aureus, Shigella spp., and C. jejuni, respectively; (E) 93, 85, 66 CFU/
mL of E. coli O157:H7, Shigella spp., and C. jejuni, respectively.
310 CFU/mL for L. monocytogenes, 270 CFU/mL for Staph. aureus,
85 CFU/mL for Shigella spp. and 66 CFU/mL for C. jejuni (Fig. 3). This
level of sensitivity is sufficient to allow practical detection of
pathogens in a variety of samples. All six pathogens in the mixed
culture were detected in GeXP analysis along with plasmid pMD19-
T as positive control. They exhibited the same peak position as
 B. Zhou et al. / Food Control 32 (2013) 198e204 203

results from their respective samples with GeXP-PCR assay when
performed in uniplex (Fig. 2). The reaction at each concentration of
the template was repeated in triplicate and similar results were
obtained each time (coefficient of variation (CV) 9.7% for each
dilution).
4. Discussion
Rapid and sensitive detection of food-borne pathogens is crucial
not only to control and investigate food poisoning outbreaks but
also to improve food safety and risk management. In this study, we
developed and evaluated a novel application of the GeXP analyzer,
which was capable of detecting the presence of multiple pathogens
in a single reaction. The analytical procedure includes primer
design, PCR amplification using both chimeric primers and
universal primers, capillary electrophoretic separation based on the
size of the PCR product followed by identification in terms of the
expected size. Results of our analysis show that the GeXP analyzer
provides a specific, cost-effective and high-throughput method,
which allows for the rapid and sensitive detection of six food-borne
pathogens.
For the analysis of GeXP-PCR assay, we chose six of the repre-
sentative bacteria usually associated with food-borne illnesses: S.
enterica, E. coli O157:H7, L. monocytogenes, Staph. aureus, Shigella
spp., and C. jejuni. The GeXP method is capable of detecting these
six pathogens in approximately 4 h (1 h for DNA extraction, 2 h for
PCR amplification, 45 min/row of 8 samples for capillary electro-
phoretic separation, and 10 min for interpretation). In addition, the
cost of the method for simultaneous identification of six food-
borne pathogens is approximately $10 per test. This is, by far,
cheaper than the $10 cost per test for each pathogen using
a conventional detection method (Kim et al., 2007), which relies
primarily on direct plating methods and biochemical tests.
Many other studies have also reported analysis for methods of
multiple microbes in a single sample. However, some multiplex PCR
methods for the simultaneous detection of pathogens were
developed using agarose gel analysis to detect PCR products, which
have low sensitivity and were unsuitable for high-throughput
analysis. In contrast, GeXP-PCR assay was a sensitive method,
capable of detecting as low as 101e102 CFU/mL of six pathogens in
a single tube without any enrichment steps. The GeXP analyzer uses
capillary electrophoretic separation of PCR products to provide the
relative intensity versus size for all target amplicons in a DNA
sample. The fragments corresponding to each microbe were suffi-
ciently separated by using the GeXP analysis, while the conven-
tional gel electrophoresis failed to sufficiently differentiate PCR
products originating from the 6 pathogens (Fig. 4). Additionally,
two 96-well plates can be used in parallel to analyze 192 samples in
a single analysis simultaneously, indicating the high throughput of
the GeXP-PCR assay.
Each pair of target-specific primers only generated a single peak
for each microbe species and peaks of same species with different
serotypes were shown in same position. No non-specific or false-
positive result was observed, indicating the specificity of the
GeXP analysis. Several noise peaks were observed among the
PCR products represented 101 CFU/mL and 102 CFU/mL in Fig. 3,
however, the locations of the noise peaks were quite different from
those of the diagnostic peaks of the pathogens of interest, meaning
that these peaks did not interfere with the detection of the target
pathogens.
The GeXP multiplex PCR amplification condition was improved
by using a fixed annealing temperature, including 2 steps with
different annealing temperatures: step 1 (first 12 cycles) was per-
formed at a higher temperature using the gene-specific sequence
of the chimeric primers to produce amplicons that have universal
tags; step 2 was predominantly performed using universal
primers at a lower temperature in the subsequent cycles (numbers
13e32). The improved PCR condition enhanced the specificity
and sensitivity of multiplex PCR analysis. It also minimized the
occurrence of inferior and non-specific amplifications (data not
shown). Moreover, the plasmid pMD19 was added to each reaction
as positive control to ascertain whether the PCR step and data
analysis step of the assay were carried out correctly. Further eval-
uation of the GeXP-PCR assay with a larger number of real food
samples from different sources is necessary to confirm its value and
modify the analysis procedures to reduce the number of steps
involved.
In conclusion, our findings demonstrate that the GeXP multiple
PCR method is a rapid, sensitive and high-throughput method for
parallel analysis of food-borne pathogens. It may also lead to the

Fig. 4. Agarose gel analysis of amplification products obtained using the multiplex PCR assay developed for the simultaneous detection of Listeria monocytogenes strain (156 bp),
positive control (217 bp), Escherichia coli O157:H7 strain (242 bp), Shigella flexneri 2b strain (256 bp), Staphylococcus aureus strain (269 bp), Campylobacter jejuni strain (316 bp), and
Salmonella enterica serovar Enteritidis strain (320 bp). Lane M, DNA marker (DL2000; TaKaRa, Dalian, China) with 2000, 1000, 750, 500, 250 and 100 bp; lane 1, Listeria mono-
cytogenes strain ATCC 15313; lane 2, positive control; lane 3, Escherichia coli O157:H7 strain ATCC 8739; lane 4, Shigella flexneri 2b strain ATCC 12022; lane 5, Staphylococcus aureus
strain ATCC 6538; lane 6, Campylobacter jejuni strain ATCC 33291; lane 7, Salmonella enterica serovar Enteritidis strain ATCC 13076; lane 8, mixture of positive control and the six
bacteria together.
204 B. Zhou et al. / Food Control 32 (2013) 198e204
establishment and improvement of food safety systems for patho-
genic bacteria.
Funding source
This work was supported by the Chongqing Science and Tech-
nology Commission (CSTC2011AC1056). The sponsors had no role
in study design, data collection, analysis and interpretation, writing
of the report or the decision to publish.
Acknowledgments
We are grateful to Dr. Zongyi Zou for his valuable assistance in
experiment and Mr Uchenna Anunne for reviewing the manuscript.
References
Amoroso, M. G., Salzano, C., Cioffi, B., Napoletano, M., Garofalo, F., Guarino, A., et al.
(2011). Validation of a Real-time PCR assay for fast and sensitive quantification
of Brucella spp. in water buffalo milk. Food Control, 22(8), 1466e1470.
Anonymous. (2002). Microbiology of food and animal feeding stuffs-protocol for the
validation of alternative methods (EN ISO 16140). Paris, France: European
Committee for Standardization.
Besser, R. E., Lett, S. M., Weber, J. T., & Doyle, M. P. (1993). An outbreak of diarrhea and
hemolytic uremic syndrome from Escherichia coli O157:H7 in fresh-pressed apple
cider. The Journal of the American Medical Association, 269(17), 2217e2220.
Carlson, J. R., Thornton, S. A., DuPont, H. L., West, A. H., & Mathewson, J. J. (1983).
Comparative in vitro activities of ten antimicrobial agents against bacterial
enteropathogens. Antimicrobial Agents and Chemotherapy, 24(4), 509e513.
Grace, M. B., McLeland, C. B., Gagliardi, S. J., Smith, J. M., Jackson, W. E., III, &
Blakely, W. F. (2003). Development and assessment of a quantitative reverse
transcription-PCR assay for simultaneous measurement of four amplicons.
Clinical Chemistry, 49(9), 1467e1475.
Jin, L. Q., Li, J. W., Wang, S. Q., Chao, F. H., Wang, X. W., & Yuan, Z. Q. (2005).
Detection and identification of intestinal pathogenic bacteria by hybridiza-
tion to oligonucleotide microarrays. World Journal of Gastroenterology, 11(48),
7615e7619.
Kim, J. S., Lee, G. G., Park, J. S., Jung, Y. H., Kwak, H. S., Kim, S. B., et al. (2007). A novel
multiplex PCR assay for rapid and simultaneous detection of five pathogenic
bacteria: Escherichia coli O157:H7, Salmonella, Staphylococcus aureus, Listeria
monocytogenes, and Vibrio parahaemolyticus. Journal of Food Protection, 70(7),
1656e1662.
McClelland, R. S., Fowler, V. G., Sanders, L. L., Gottlieb, G., Kong, L. K., Sexton, D. J.,
et al. (1999). Staphylococcus aureus bacteremia among elderly vs younger adult
patients: comparison of clinical features and mortality. Archives of Internal
Medicine, 159(11), 1244e1247.
Motarjemi, Y., & Käferstein, F. (1999). Food safety, hazard analysis and critical
control point and the increase in foodborne diseases: a paradox? Food Control,
10(4e5), 325e333.
Nagel, M. A., Gilden, D., Shade, T., Gao, B., & Cohrs, R. J. (2009). Rapid and sensitive
detection of 68 unique varicella zoster virus gene transcripts in five multiplex
reverse transcription-polymerase chain reactions. Journal of Virological Methods,
157(1), 62e68.
Perry, L., Heard, P., Kane, M., Kim, H., Savikhin, S., Dominguez, W., et al. (2007).
Application of multiplex polymerase chain reaction to the detection of
pathogens in food. Journal of Rapid Methods & Automation in Microbiology, 15(2),
176e198.
Piddock, L. J. V., Ricci, V., Stanley, K., & Jones, K. (2000). Activity of antibiotics used in
human medicine for Campylobacter jejuni isolated from farm animals and
their environment in Lancashire. Journal of Antimicrobial Chemotherapy, 46(2),
303e306.
Rai, A., Kamath, R., Gerald, W., & Fleisher, M. (2009). Analytical validation of the
GeXP analyzer and design of a workflow for cancer-biomarker discovery using
multiplexed gene-expression profiling. Analytical and Bioanalytical Chemistry,
393(5), 1505e1511.
Rodríguez-Lázaro, D., D’Agostino, M., Herrewegh, A., Pla, M., Cook, N., &
Ikonomopoulos, J. (2005). Real-time PCR-based methods for detection of
Mycobacterium avium subsp. paratuberculosis in water and milk. International
Journal of Food Microbiology, 101(1), 93e104.
Shin, G. W., Hwang, H. S., Oh, M. H., Doh, J., & Jung, G. Y. (2010). Simultaneous
quantitative detection of 12 pathogens using high-resolution CE-SSCP. Electro-
phoresis, 31(14), 2405e2410.
Tang, Y. W., Procop, G. W., & Persinga, D. H. (1997). Molecular diagnostics of
infectious diseases. Clinical Chemistry, 43(11), 2021e2038.
Taskila, S., Tuomola, M., & Ojamo, H. (2012). Enrichment cultivation in detection of
food-borne Salmonella. Food Control, 26(2), 369e377.
Todd, E. C. D., & Notermans, S. (2011). Surveillance of listeriosis and its causative
pathogen, Listeria monocytogenes. Food Control, 22(9), 1484e1490.
Wilson, W. J., Strout, C. L., DeSantis, T. Z., Stilwell, J. L., Carrano, A. V., &
Andersen, G. L. (2002). Sequence-specific identification of 18 pathogenic
microorganisms using microarray technology. Molecular and Cellular Probes,
16(2), 119e127.
Yang, M. J., Luo, L., Nie, K., Wang, M., Zhang, C., Li, J., et al. (2012). Genotyping of 11
human papilloma viruses by multiplex PCR with a GeXP analyzer. Journal of
Medical Virology, 84(6), 957e963.