Está en la página 1de 373

GUIA DE AYUDAPARA ELAUTOCONSTRUCTORMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORI AL YMEDIO AMBIENTEGUIA DE AYUDAPARA ELAUTOCONSTRUCTORMINISTERIO DE VIVIENDA, ORD ENAMIENTOTERRITORIAL YMEDIO AMBIENTE

GUIA DE AYUDA PARA EL AUTOCONSTRUCTOR GUIA DE AYUDAPARA ELAUTOCONSTRUCTOR

Ministro de Vivienda, Ordenamiento Territorial y Medio Ambiente Ing. Carlos Colacce Subsecretario de Vivienda, Ordenamiento Territorial y Medio Ambiente Arq.Jack Couriel Director de la Direccin Nacional de Vivienda Arq. Gonzalo Altamirano Programa CREDIMAT Arq. Diana Mndez en los anlisis previos, preparacin y ajuste de textos. Arq. Jorge Barcala autor (realizacin de textos y dibujos). Arq. Daniel Camacho en la correccin final. Diagramacin DiagramacinDiagramacinDiagramacinDiagramacinDiagramacin y armado y armadoy armadoy armadoy armadoy armado: ::::: Claudia Mongiardino Arq. Jorge Barcala

PROLOGOSolucionar el dficit de vivienda, mejorar la capacidad y calidad del stock habitacional existente en nuestro pas, requiere de diferentes programas que se complementen as como de la participacin de diversos actores. Dentro de este marco el Ministerio de Vivienda, Ordenamiento Territorial y Medio Ambiente y la KFW, agencia de cooperacin financiera del Gobierno Alemn, han puesto en marcha el CREDIMAT, programa novedoso que integra al sector pblico, Instituciones privadas y a la poblacin, aunando esfuerzos con un fin comn: mejorar la vivienda de las familias de bajos ingresos y por lo tanto su calidad de vida. El MVOTMA transfiere recursos a diversos Ejecutores, creando fondos rotatorios con el objetivo de brindar crditos sociales de bajo costo para el mejoramiento habitacional de las familias con ingresos de hasta 60 UR. La presente Gua de AyudaGua de AyudaGua de AyudaGua de AyudaGua de Ayuda fue creada c omo un servicio del Programa CREDIMAT, teniendo en cuenta que muchas familias de escasos recursos solucionan su problema habitacional por medio de la autoconstruccin o ayuda mutua. Con la Gua conformada por fichas tcnicas que pueden ser usadas en forma independiente segn la obra a realizar, se pretende facilitar y ayudar a dichas familias que tendrn con el CREDIMAT una nueva opcin para mejorar, ampliar o construir su vivienda. El objetivo es mejorar la calidad de la construccin para que los recursos y el tiempo invertido en obra, no se pierdan por falta de conocimiento que lleva a defectos constructivos, clculos errados o utilizacin de sistemas no apropiados. No sustituye el asesoramiento de los tcnicos, tampoco es un anlisis exhaustivo o profundo de la temtica constructiva, es simplemente una gua con recomendaciones de los rubros y sistemas constructivos comunmente usados en obras por autoconstruccin en las reas urbanas y suburbanas de nuestro pas. Se debe tener en cuenta antes de su aplicacin que no es posible su utilizacin sin considerar las distintas zonas, suelos, materiales disponibles y reglamentaciones municipales de cada lugar. Se desliga la responsabilidad tcnica de las obras realizadas en base a la presente Gua. Arq. Diana MndezArq. Diana MndezArq. Diana MndezArq. Diana MndezArq. Diana Mndez SUM CONSULSUM CONSULSUM CONSULSUM CONSULSUM CONSULTTTTT PROLOGOSolucionar el dficit de vivienda, mejorar la capacidad y calidad del stock habitacional existente en nuestro pas, requiere de diferentes programas que se complementen as como de la participacin de diversos actores. Dentro de este marco el Ministerio de Vivienda, Ordenamiento Territorial y Medio Ambiente y la KFW, agencia de cooperacin financiera del Gobierno Alemn, han puesto en marcha el CREDIMAT, programa novedoso que integra al sector pblico, Instituciones privadas y a la poblacin, aunando esfuerzos con un fin comn: mejorar la vivienda de las familias de bajos ingresos y por lo tanto su calidad de vida. El MVOTMA transfiere recursos a diversos Ejecutores, creando fondos rotatorios con el objetivo de brindar crditos sociales de bajo costo para el mejoramiento habitacional de las familias con ingresos de hasta 60 UR. La presente Gua de AyudaGua de AyudaGua de AyudaGua de AyudaGua de Ayuda fue creada c omo un servicio del Programa CREDIMAT, teniendo en cuenta que muchas familias de escasos recursos solucionan su problema habitacional por medio de la autoconstruccin o ayuda mutua. Con la Gua conformada por fichas tcnicas que pueden ser usadas

en forma independiente segn la obra a realizar, se pretende facilitar y ayudar a dichas familias que tendrn con el CREDIMAT una nueva opcin para mejorar, ampliar o construir su vivienda. El objetivo es mejorar la calidad de la construccin para que los recursos y el tiempo invertido en obra, no se pierdan por falta de conocimiento que lleva a defectos constructivos, clculos errados o utilizacin de sistemas no apropiados. No sustituye el asesoramiento de los tcnicos, tampoco es un anlisis exhaustivo o profundo de la temtica constructiva, es simplemente una gua con recomendaciones de los rubros y sistemas constructivos comunmente usados en obras por autoconstruccin en las reas urbanas y suburbanas de nuestro pas. Se debe tener en cuenta antes de su aplicacin que no es posible su utilizacin sin considerar las distintas zonas, suelos, materiales disponibles y reglamentaciones municipales de cada lugar. Se desliga la responsabilidad tcnica de las obras realizadas en base a la presente Gua. Arq. Diana MndezArq. Diana MndezArq. Diana MndezArq. Diana MndezArq. Diana Mndez SUM CONSULSUM CONSULSUM CONSULSUM CONSULSUM CONSULTTTTT

HERRAMIENTASHERRAMIENTASHERRAMIENTASHERRAMIENTASHERRAMIENTAS LO PRIMEROLO PRIMEROLO PRIMEROLO PRIMEROLO PRIMERO REPLANTEOREPLANTEOREPLANTEOREPLANTEOREPLANTEO ESTRUCTURAESTRUCTURAESTRUCTURAESTRUCTURAESTRUCTURA CIMIENTOSCIMIENTOSCIMIENTOSCIMIENTOSCIMIENTOS CIMIENTO CORRIDO DECIMIENTO CORRIDO DECIMIENTO CORRIDO DECIMIENTO CORRIDO DECIMI ENTO CORRIDO DE HORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CIC LOPEO CONTENIDOCONTENIDOCONTENIDOCONTENIDOCONTENIDO PATIN CORRIDO DEPATIN CORRIDO DEPATIN CORRIDO DEPATIN CORRIDO DEPATIN CORRIDO DE HORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO DADOS DE DADOS DEDADOS DEDADOS DEDADOS DEDADOS DE HORMIGON CICLOPEO HORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CICLOPEOHORMIGON CIC LOPEO PATIN DE PATIN DEPATIN DEPATIN DEPATIN DEPATIN DE HORMIGON ARMADO HORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO VIGAS DE VIGAS DEVIGAS DEVIGAS DEVIGAS DEVIGAS DE CIMENTACION CIMENTACIONCIMENTACIONCIMENTACIONCIMENTACIONCIMENTACION Contenido PAREDESPAREDESPAREDESPAREDESPAREDES

REFUERZOS REFUERZOSREFUERZOSREFUERZOSREFUERZOSREFUERZOS EN LOS MUROS EN LOS MUROSEN LOS MUROSEN LOS MUROSEN LOS MUROSEN LOS MUROS PILARES DE PILARES DEPILARES DEPILARES DEPILARES DEPILARES DE HORMIGON ARMADO HORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO VIGAS DE VIGAS DEVIGAS DEVIGAS DEVIGAS DEVIGAS DE HORMIGON ARMADO HORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO TECHOS TECHOSTECHOSTECHOSTECHOSTECHOS TECHOS TECHOSTECHOSTECHOSTECHOSTECHOSLIVIANOS LIVIANOSLIVIANOSLIVIANOSLIVIANOSLIVIANOS LOSA DE LOSA DELOSA DELOSA DELOSA DELOSA DE HORMIGON ARMADO HORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADOHORMIGON ARMADO ABERTURAS ABERTURASABERTURASABERTURASABERTURASABERTURAS REVOQUES REVOQUESREVOQUESREVOQUESREVOQUESREVOQUES AZULEJOS AZULEJOSAZULEJOSAZULEJOSAZULEJOSAZULEJOS PAVIMENTOS PAVIMENTOSPAVIMENTOSPAVIMENTOSPAVIMENTOSPAVIMENTOS AGUA AGUAAGUAAGUAAGUAAGUA CORRIENTE CORRIENTECORRIENTECORRIENTECORRIENTECORRIENTE Contenido DESAGESDESAGESDESAGESDESAGESDESAGES

VEAMOS LAS HERRAMIENTAS MASCOMUNES ENUNA OBRAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YME DIO AMBIENTEHERRAMIENTASJ.G.BARCALAVEAMOS LAS HERRAMIENTAS MASCOMUNES ENUNA OBRAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YME DIO AMBIENTEHERRAMIENTASJ.G.BARCALA A continuacin describiremos una serie de herra. mientas que suelen ser comunes en una obra. No so. todas las que se pueden usar y muchas podrn ser sus. tituidas por otras. A cada una de ellas se le ha diseado una repre. sentacin grfica que se podr encontrar luego, en la. distintas fichas. Las mismas tendrn una descripci. elemental que servir para identificar aquellas herra. mientas que se desconozcan.

Herramientas 1 - .

Herramientas 2(ngulo recto): Normalmente en madera, aluminio o hierro. Ideal para preparar canchadas de material como mezcla, hormign, etc. HILOEs sumamente necesario en el transcurso de una obra, el ms comnes la chaura ya que es resistente y es fcil de ver. CINTAMETRICALas hay de varias longitudes, como tambin de materiales. PLOMADADE PUNTANos sirve para bajar puntos exactos en un replanteo. ESCUADRA DE90 GRADOSPALADE PUNTAEs buena para comenzar a excavar, ya que la punt a favorece lapenetracin en el terreno. PALAANCHANos servir para excavar en terrenos duros o semiduros. PICOPISONSe usar para apisonar el suelo o un contrapiso. Se puede hacerfcilmente l lenando una lata con hormign y colocndole un caocomo elemento de agarre. SERRUCHOPara asegurar un buen corte, deberemos cuidar que los dientes seencuentr en siempre trabados y afilados. MARTILLO DECARPINTEROSe caracteriza por la ua que tiene atrs que sirve para sacar clavos. HACHA DECARPINTEROPermite cortar, clavar (parte de atrs), y desclavar ya que incl uyeuna ua. UAHecha en hierro, se utiliza para desencofrar o sacar clavos. Herramientas 2(ngulo recto): Normalmente en madera, aluminio o hierro. Ideal para preparar canchadas de material como mezcla, hormign, etc. HILOEs sumamente necesario en el transcurso de una obra, el ms comnes la chaura ya que es resistente y es fcil de ver. CINTAMETRICALas hay de varias longitudes, como tambin de materiales. PLOMADADE PUNTANos sirve para bajar puntos exactos en un replanteo. ESCUADRA DE90 GRADOSPALADE PUNTAEs buena para comenzar a excavar, ya que la punt a favorece lapenetracin en el terreno. PALAANCHANos servir para excavar en terrenos duros o semiduros. PICOPISONSe usar para apisonar el suelo o un contrapiso. Se puede hacerfcilmente l lenando una lata con hormign y colocndole un caocomo elemento de agarre. SERRUCHOPara asegurar un buen corte, deberemos cuidar que los dientes seencuentr en siempre trabados y afilados. MARTILLO DECARPINTEROSe caracteriza por la ua que tiene atrs que sirve para sacar clavos. HACHA DECARPINTEROPermite cortar, clavar (parte de atrs), y desclavar ya que incl uyeuna ua. UAHecha en hierro, se utiliza para desencofrar o sacar clavos.

Herramientas 1 - 3TENAZALas hay de carpintero y de herrero (esta ltima tiene medi o filoachatado para usarla como pinza y poder tirar del alambre sincortarlo). SIERRADE MANOSe usa para cortar metal y caos de plstico. Se compran las hojasde re puesto aparte. GRIFALas hay para cada dimetro de hierro que tengamos que doblar. Para los ms grandes donde hay que hacer mucha fuerza se lepuede extender el brazo de agarre con un cao de hierro. METRODe madera o plstico. NIVEL DEBURBUJASirve para nivelar superficies. Cuando se compra conviene probarl ode uno y otro lado para asegurar que marque igual. Los hay conburbuja para nive lar elementos verticales y otros con burbuja inclinada para superficies a 450. Se los encuentra de distintos largos; hechos en madera, plstico o aluminio siendo generalmente estos ltimos los de mayor calidad. NIVEL DEMANGARealizado con una manguera transparente a la que se le colocaagua. Los niveles superiores de agua se mantienen a igual altura. Conviene usar mangueras de paredes gruesas. BALDELos hay metlicos o de plstico, tienen una capacidad de 10 litrosde material ( 1/4 bolsa de portland). TACHONormalmente metlico tiene una capacidad de unos 20 litros dematerial (1/2 bo lsa de portland). PLOMADAConsta de una pesa de hierro, un taco de madera de igual ancho quela pesa y un hilo de unos 2 metros. La usaremos para verticalizarelementos, (aplomar). MACETALas hay de distintos pesos, complementa el uso de la punta y elcortafierro . CORTAFIERROY PUNTALa usaremos para cortar y picar sea ladrillo, hormign, etc. Los hayde varios tamaos. Herramientas 1 - 3TENAZALas hay de carpintero y de herrero (esta ltima tiene medi o filoachatado para usarla como pinza y poder tirar del alambre sincortarlo). SIERRADE MANOSe usa para cortar metal y caos de plstico. Se compran las hojasde re puesto aparte. GRIFALas hay para cada dimetro de hierro que tengamos que doblar. Para los ms grandes donde hay que hacer mucha fuerza se lepuede extender el brazo de agarre con un cao de hierro. METRODe madera o plstico. NIVEL DEBURBUJASirve para nivelar superficies. Cuando se compra conviene probarl ode uno y otro lado para asegurar que marque igual. Los hay conburbuja para nive lar elementos verticales y otros con burbuja inclinada para superficies a 450. Se los encuentra de distintos largos; hechos en madera, plstico o aluminio siendo generalmente estos ltimos los de mayor calidad. NIVEL DEMANGARealizado con una manguera transparente a la que se le colocaagua. Los niveles superiores de agua se mantienen a igual altura. Conviene usar mangueras de paredes gruesas. BALDELos hay metlicos o de plstico, tienen una capacidad de 10 litrosde material ( 1/4 bolsa de portland). TACHONormalmente metlico tiene una capacidad de unos 20 litros dematerial (1/2 bo lsa de portland). PLOMADAConsta de una pesa de hierro, un taco de madera de igual ancho quela pesa y un hilo de unos 2 metros. La usaremos para verticalizarelementos, (aplomar). MACETALas hay de distintos pesos, complementa el uso de la punta y elcortafierro . CORTAFIERROY PUNTALa usaremos para cortar y picar sea ladrillo, hormign, etc. Los hayde varios tamaos.

Herramientas 4CUCHARALas hay de varios tamaos, algunas de punta aguda y otras red ondeadas. Sirve para colocar material. LLANALas hay de madera o de aluminio, con diversas longitudes. Lausaremos para l a ejecucin de revoques, pisos, para nivelar, etc. Hay que cuidar que estn derechas, hecho que comprobaremosmirndola desde la punta. Es necesario mantenerla limpia. Utilizada normalmente para desgastar madera, la aplicaremos enel desgaste de los caos de plstico. FRATACHOEs metlica, se usa para lograr superficies muy lisas, por ejemploen la co locacin de endudo sobre una pared. REGLAPINCELETAEs buena para agregar agua al mortero que tengamos en el baldey pa ra mojar la pared que tengamos que revocar. HACHUELALa utilizaremos para cortar ladrillos. MAQUINAPARA CORTARSe utiliza para cortar baldosas cermicas de piso o revestimient osde pared. Tienen incluida una regla y gua para ubicar el corte. Las hay de distintas calidades y tamaos. Para cortar puede tambin usarse un lpiz de vidia. TERRAJACon ella se realizan las roscas a los caos de agua o gas. Las haypara caos de hierro o de plstico. Estas ltimas vienen con lascuchillas para caos de 1/2, 3/4 y 1 pulgada. PAPEL DE LIJALas hay de distinta rugosidad. Se distinguen por nmeros, cuantoms baj o sea ste, ms fina ser. ESCOFINAPINCELLos hay de muchos tamaos y calidades, segn el uso que deseemos darle. Son de madera. Se utilizan para emparejar las superficies de losrevoques. Convie ne mantenerlos limpios para que no rayen el trabajo que realizamos. Herramientas 4CUCHARALas hay de varios tamaos, algunas de punta aguda y otras red ondeadas. Sirve para colocar material. LLANALas hay de madera o de aluminio, con diversas longitudes. Lausaremos para l a ejecucin de revoques, pisos, para nivelar, etc. Hay que cuidar que estn derechas, hecho que comprobaremosmirndola desde la punta. Es necesario mantenerla limpia. Utilizada normalmente para desgastar madera, la aplicaremos enel desgaste de los caos de plstico. FRATACHOEs metlica, se usa para lograr superficies muy lisas, por ejemploen la co locacin de endudo sobre una pared. REGLAPINCELETAEs buena para agregar agua al mortero que tengamos en el baldey pa ra mojar la pared que tengamos que revocar. HACHUELALa utilizaremos para cortar ladrillos. MAQUINAPARA CORTARSe utiliza para cortar baldosas cermicas de piso o revestimient osde pared. Tienen incluida una regla y gua para ubicar el corte. Las hay de distintas calidades y tamaos. Para cortar puede tambin usarse un lpiz de vidia. TERRAJACon ella se realizan las roscas a los caos de agua o gas. Las haypara caos de hierro o de plstico. Estas ltimas vienen con lascuchillas para caos de 1/2, 3/4 y 1 pulgada. PAPEL DE LIJALas hay de distinta rugosidad. Se distinguen por nmeros, cuantoms baj o sea ste, ms fina ser. ESCOFINAPINCELLos hay de muchos tamaos y calidades, segn el uso que deseemos darle. Son de madera. Se utilizan para emparejar las superficies de losrevoques. Convie ne mantenerlos limpios para que no rayen el trabajo que realizamos.

Lo Primero 2 - 1Invertir tiempo previamente a construr algo es muyimportante. No slo tenemos que pensar en lo quepodamos necesitar ahora, tambin conviene proyectarse al futuro. Tal vez la familia crezca y haya queromper mucho para aumentar un dormitorio; y anpeor puede que no podamos ampliar ms nuestracasa, si no lo hemo s previsto antes. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTELO PRI MEROSiempre es buenopensar en el futuroDon Anastasiohaba trabajado decapatz antes de jubilarse Sabe? Sr. Anastasio, ahoraque tenemos el terrenito queremos hacernos una casa, chiquitavi Yo tengo algo de experiencia y puedo darlesuna manoPara comenzar hay quepensar en el tipo de casaquen ecesitanCon un dormitorioalcanza para mi yla JulietaLo Primero 2 - 1Invertir tie mpo previamente a construr algo es muyimportante. No slo tenemos que pensar en lo quepodamos necesitar ahora, tambin conviene proyectarse al futuro. Tal vez la familia crezca y haya queromper mucho para aumentar un dormitorio; y anpeor puede que no podamos ampliar ms nuestracasa, si no lo hemo s previsto antes. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTELO PRI MEROSiempre es buenopensar en el futuroDon Anastasiohaba trabajado decapatz antes de jubilarse Sabe? Sr. Anastasio, ahoraque tenemos el terrenito queremos hacernos una casa, chiquitavi Yo tengo algo de experiencia y puedo darlesuna manoPara comenzar hay quepensar en el tipo de casaquen ecesitanCon un dormitorioalcanza para mi yla Julieta

Lo Primero 2 - 2 Todo tiempo que se invierta enpensar antes de comenzar la obraser un ahorro de di nero despus. Solucionar problemas imprevistosdurante la obra sale caro. Algunas cosas atomar en cuenta: Mejor me hago unacasa a nuestrogusto. Pasemos a dibujar lavivienda que queremosporque despus tendremos que consultar a untcnico ya que ellos saben como se presentaa la IntendenciaMe dijeron que hayen la Intendencia unPlan E conmico. S, te dan un plano yahecho y de esa formaqueda todo regularizado Antes de construir hay que pedir un permiso en la Intendencia, la cual aprueba los planos de la vivienda. De esamanera se evitan multas en el futuro o problemas cuando sequiera vender la casa. Conviene tratar que el sol entre por las ventanas, siemprepodremos estar a tiemp o de evitarlo, pero no de hacerlo entrar si no orientamos bien las ventanas. Trataremos de evitarlas ventanas hacia el sur. Si se junta el bao a la cocina con un muro entre ellos, seahorra en caeras, ya que por ste podemos hacer correrun mismo cao para las dos cosas. No conviene hacer pasillos muy largos, se desperdicia reay materiales en lugares que slo nos servirn para caminar. Lo Primero 2 - 2 Todo tiempo que se invierta enpensar antes de comenzar la obraser un ahorro de di nero despus. Solucionar problemas imprevistosdurante la obra sale caro. Algunas cosas atomar en cuenta: Mejor me hago unacasa a nuestrogusto. Pasemos a dibujar lavivienda que queremosporque despus tendremos que consultar a untcnico ya que ellos saben como se presentaa la IntendenciaMe dijeron que hayen la Intendencia unPlan E conmico. S, te dan un plano yahecho y de esa formaqueda todo regularizado Antes de construir hay que pedir un permiso en la Intendencia, la cual aprueba los planos de la vivienda. De esamanera se evitan multas en el futuro o problemas cuando sequiera vender la casa. Conviene tratar que el sol entre por las ventanas, siemprepodremos estar a tiemp o de evitarlo, pero no de hacerlo entrar si no orientamos bien las ventanas. Trataremos de evitarlas ventanas hacia el sur. Si se junta el bao a la cocina con un muro entre ellos, seahorra en caeras, ya que por ste podemos hacer correrun mismo cao para las dos cosas. No conviene hacer pasillos muy largos, se desperdicia reay materiales en lugares que slo nos servirn para caminar.

Lo Primero 2 - 3Aqu presentamos un ejemplo dedistribucin de habitacionesPueden exi stir muchasvariantesLo Primero 2 - 3Aqu presentamos un ejemplo dedistribucin de ha bitacionesPueden existir muchasvariantes

Lo Primero 2 - 4Hay ordenanzas que hay querespetar por exigencia de la Intendenc iaORDENANZAS MUNICIPALES DE MONTEVIDEOVENTILACIONSUPERFICIEMINIMAObligatoriopone r: inodoropileta, duchaBAOUNO SOLOY PRINCIPALESTARCOMEDORDORM2,40 m2LADOMINIMO2,50 m 1,20 mALTURAMINIMA2,20 m50% de lasuperficie deiluminacindeben poderseabrir totalm enteCOCINAQUE DA AOTROLOCALPuede serentre3 a 5 m23/4 partes de lasuperficie deil uminacindeben poderabrirse totalmente hay queagregar un tirajede 30x30 concampana sobrezona de fuego1,40 m2,20 mSup erficieamboslocalesdividido 10mnimo2m2No esnecesarioluz naturalSuperficiedividido 10LUZNATURALDIRECTA4,20 m2COCINACERRADA1,60 m2,20 mSuperficiedividido 10mayorsie mpre que0,4 m210 m2UnahabitacinLas otras6,50m27 m22 m1,80 m2,40m2,20mTe puedes as esorar en Montevideoen los Centros Comunales y en elinterior en las intendencias . OTRAS ORDENANZAS: -Las paredes del bao tienen que estar revestidas hasta 1,80m., o revocadas con portland lustrado. -En la cocina el revestimiento mnimosobre la mesada es hasta los 50 cm. NOTA:Este cuadro es un extracto de las ordenanzas municipales deMontevideo,cada departamento puede tener sus variaciones. Siempre esfactible conocerlas en la Intendencia ocon a lgn tcnico. Debe abrirse laventanatotalmenteLa banderola oventana tiene queabrirse completamente y por lomenos tiene queser una superficiede 0,6x0,33Lo Primero 2 - 4Hay or denanzas que hay querespetar por exigencia de la IntendenciaORDENANZAS MUNICIPAL ES DE MONTEVIDEOVENTILACIONSUPERFICIEMINIMAObligatorioponer: inodoropileta, duchaBAOUNO SOLOY PRINCIPALESTARCOMEDORDORM2,40 m2LADOMINIMO2,50 m 1,20 mALTURAMINIMA2,20 m50% de lasuperficie deiluminacindeben poderseabrir totalm enteCOCINAQUE DA AOTROLOCALPuede serentre3 a 5 m23/4 partes de lasuperficie deil uminacindeben poderabrirse totalmente hay queagregar un tirajede 30x30 concampana sobrezona de fuego1,40 m2,20 mSup erficieamboslocalesdividido 10mnimo2m2No esnecesarioluz naturalSuperficiedividido 10LUZNATURALDIRECTA4,20 m2COCINACERRADA1,60 m2,20 mSuperficiedividido 10mayorsie mpre que0,4 m210 m2UnahabitacinLas otras6,50m27 m22 m1,80 m2,40m2,20mTe puedes as esorar en Montevideoen los Centros Comunales y en elinterior en las intendencias . OTRAS ORDENANZAS: -Las paredes del bao tienen que estar revestidas hasta 1,80m., o revocadas con portland lustrado. -En la cocina el revestimiento mnimosobre la mesada es hasta los 50 cm. NOTA:Este cuadro es un extracto de las ordenanzas municipales deMontevideo,cada departamento puede tener sus variaciones. Siempre esfactible conocerlas en la Intendencia ocon a lgn tcnico. Debe abrirse laventanatotalmenteLa banderola oventana tiene queabrirse completamente y por lomenos tiene queser una superficiede 0,6x0,33

Lo Primero 2 - 5Si el frente del terreno est fuera de escuadra con respecto a las medianeras, el hacerla casa al borde de la vereda nos pue deSi el predio estriangular, podemos buscarcolocarla paralelaa un ladogenerar problemas paraconstruir, especi almente si usamos techos inclinados que generaranfachadas en cuaDon Anastasio tienerazn, ahora tengoque ver do nde ubicola casa dentro delterrenitoUBIQUEMOSLA CASACuando el terreno esrectangu lar es fcilubicar la casa paralela a la medianera, yasea retirada de sta oapoyada en ella. Hay que pensar enlas dimensiones delas habitacionesLo Primero 2 - 5Si el frente del terreno est fuera de escuadra con respecto a las medianeras, el hacerla casa al borde de la vereda nos pue deSi el predio estriangular, podemos buscarcolocarla paralelaa un ladogenerar problemas paraconstruir, especi almente si usamos techos inclinados que generaranfachadas en cuaDon Anastasio tienerazn, ahora tengoque ver do nde ubicola casa dentro delterrenitoUBIQUEMOSLA CASACuando el terreno esrectangu lar es fcilubicar la casa paralela a la medianera, yasea retirada de sta oapoyada en ella. Hay que pensar enlas dimensiones delas habitaciones

Lo Primero 2 - 6RERTIRODE FONDOJ.G.BARCALACarlitos, la Intendencia no deja coloc ar la casa en cualquier lugar del terreno. Existen afectaciones que hay que respetar, como retiros, ensanchesque se averigu anen la IntendenciamismaCuente nomsDon AnastasioENSANCHESRETIROFRONTALSuele darse como unadistancia desde la lneade ensanche o desde elborde del predio en estazon a slo se permitenconstrucciones extremadamente livianas. Cuando la Intendenciaplanea ampliar la calle, afecta a los predios conensanche, el que lo dacon una medida quetoma normalmente desde el eje de la calle. No se puede construirnada en esa zona. Se da como una distancia a un terreno lindero. RETIRO LATERALNormalmente viene dadocomo un porcentaje del rea total del terreno. Por ejemplo, en el 20% final delterreno no se puede construir. Lo Primero 2 - 6RERTIRODE FONDOJ.G.BARCALACarlitos, la Intendencia no deja coloc ar la casa en cualquier lugar del terreno. Existen afectaciones que hay que respetar, como retiros, ensanchesque se averigu anen la IntendenciamismaCuente nomsDon AnastasioENSANCHESRETIROFRONTALSuele darse como unadistancia desde la lneade ensanche o desde elborde del predio en estazon a slo se permitenconstrucciones extremadamente livianas. Cuando la Intendenciaplanea ampliar la calle, afecta a los predios conensanche, el que lo dacon una medida quetoma normalmente desde el eje de la calle. No se puede construirnada en esa zona. Se da como una distancia a un terreno lindero. RETIRO LATERALNormalmente viene dadocomo un porcentaje del rea total del terreno. Por ejemplo, en el 20% final delterreno no se puede construir.

Lo Primero 2 - 7NOTA: Si no se limpia bien el terreno, no slo puede salir mal el replanteo sino que la casa puede llegar a ceder en algn sitio. HERRAMIENTASPara esto s que hayque ser amigoTenemos que sacartodas las hierbasdes de la razTambin laspiedras grandes... ...y los montes detierra y de basura. Don Anastasio, no olvide el escombro, ese tambin hay que sacarlode la obraNada debe molestar cuando vayamos ahacer el r eplanteo de mi casa. LIMPIEZA DEL TERRENOPrimero, junto unosamigos yme hago unalimpieza del terrenoJ. G.BARCALALo Primero 2 - 7NOTA: Si no se limpia bien el terreno, no slo puede salir mal el replanteo sino que la casa puede llegar a ceder en algn sitio. HERRAMIENTASPara esto s que hayque ser amigoTenemos que sacartodas las hierbasdes de la razTambin laspiedras grandes... ...y los montes detierra y de basura. Don Anastasio, no olvide el escombro, ese tambin hay que sacarlode la obraNada debe molestar cuando vayamos ahacer el r eplanteo de mi casa. LIMPIEZA DEL TERRENOPrimero, junto unosamigos yme hago unalimpieza del terrenoJ. G.BARCALA

Replanteo 3 - 1Los datos del terreno se obtienen de un plano hecho por uningeniero agrimensor que est en catastro, o tambin se puedeobtener de los ttulos de propiedad del predio. EL PRIMER PASO: antes que nada, tenemos queverificar las medidas del terreno. Si no lo hacemos podemos llegar a construir en terreno ajenoy meternos en problemas. REPLANTEOMINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL YMEDIO AMBIENTEDon Anastasio, Qu es eso del replanteo? Chiquiln, el replanteo es cuandopasamos al terreno todolo que hemos dibujadoen el papel, para as ubicar las paredes, lospilares y cimientos. De dnde sacolas medidasdel terreno? Si tenemos 3 lados del terreno construdos, no tendremos problemas, pero sino es a s conviene desde un lmite conocido verificar con la cinta mtrica las esquinas del terreno. J.G.BARCALAReplanteo 3 - 1Los datos del terreno se obtienen de un plano hecho por uningeniero agrimensor que est en catastro, o tambin se puedeobtener de los ttulos de propiedad del predio. EL PRIMER PASO: antes que nada, tenemos queverificar las medidas del terreno. Si no lo hacemos podemos llegar a construir en terreno ajenoy meternos en problemas. REPLANTEOMINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL YMEDIO AMBIENTEDon Anastasio, Qu es eso del replanteo? Chiquiln, el replanteo es cuandopasamos al terreno todolo que hemos dibujadoen el papel, para as ubicar las paredes, lospilares y cimientos. De dnde sacolas medidasdel terreno? Si tenemos 3 lados del terreno construdos, no tendremos problemas, pero sino es a s conviene desde un lmite conocido verificar con la cinta mtrica las esquinas del terreno. J.G.BARCALA

90 354Don Anastasio me dijo quesi se cumplen esas relaciones de lados: 3, 4 y 5; puedo trazar un tringulo - rectngulo. Esos lados puedenser 30, 40 y 50 centmetros o 3, 4 y 5 metros. Hago centro con un hilo y trazo un par de arcos que se crucen en 2 lugares (C - D). Uno los cruces y obtengo la lnea en ngulo recto. Si tengo una lnea conocida y deseo trazar otra lnea en ngulo recto sobre un punto"p": Marco a cada lado de"p" una misma distancia(por ejemplo 1m.), A - B. OTRO METODO: Algo paraayudar atrazarangulosrectosDBCA23190 354Don Anastasio me dijo quesi se cumplen esas relaciones de lados: 3, 4 y 5; puedo trazar un tringulo - rectngulo. Esos lados puedenser 30, 40 y 50 centmetros o 3, 4 y 5 metros. Hago centro con un hilo y trazo un par de arcos que se crucen en 2 lugares (C - D). Uno los cruces y obtengo la lnea en ngulo recto. Si tengo una lnea conocida y deseo trazar otra lnea en ngulo recto sobre un punto"p": Marco a cada lado de"p" una misma distancia(por ejemplo 1m.), A - B. OTRO METODO: Algo paraayudar atrazarangulosrectosDBCA231De esta forma marcamos los lmites del terreno por medio d. hilos o alambre dulce sobre caballetes de madera oestacas bien firmesEste caball ete tiene que ser fuerte Replanteo 3 - 2NOTA: Es importante ser preciso en todo replanteo, tanto del terreno como de loque vamos a construir.

El replanteo de lacasa lo haremos de lamisma forma que eldel terreno. Tenderemos hilosentre un amigo y yo, de caballete a caballete, definiendo exactamente la ubicacin decada muro. Vamos a comenzartirando 2 hilos de referencia puestos a escuadra, ya que la lneadel hilo es perfecta. QUE SE PUEDEREPLANTEAR DEUN MURO? Podemos marcar lacara exterior del muro, oambas. Podemos marcar eleje del muro (o sea lalnea que va por el medio exacto del mismo). Cmoempezar areplantearEl replanteo de lacasa lo haremos de lamisma forma que elde l terreno. Tenderemos hilosentre un amigo y yo, de caballete a caballete, definiendo exactamente la ubicacin decada muro. Vamos a comenzartirando 2 hilos de referencia puestos a escuadra, ya que la lneadel hilo es perfecta. QUE SE PUEDEREPLANTEAR DEUN MURO? Podemos marcar lacara exterior del muro, oambas. Podemos marcar eleje del muro (o sea lalnea que va por el medio exacto del mismo). Cmoempezar areplantear Si an tenemos extendidos los hilos del terreno po. demos basarnos en ellos para dar ubicacin a los qu. definirn los muros. NOTA:. Es conveniente ubica. los caballetes a una distanci. tal que al hacer las zanjas par. los cimientos no se vayan a mo. ver. Es buena idea usar una dis. tancia de 1 m.

Replanteo 3 - 3Pararecordar: Los caballetes tienen que estar a nivel y a la misma altura. Es necesario ir verificando las escuadras y medidas mientras trabajamos en el replanteo.

RECOMENDACIONESRECOMENDACIONES Replanteo 3 - 4Marcar la posicin del hilo enel caballete conun clavo o uncorte de sierra de1 cm para noperde r la posicincuando saquemoslos hilos. Marcar el ejedel muro es bueno, ya que esteva a coincidir conel del cimiento. Verificar antesde comenzar quela escuadra quetenemos tenga unverdadero ngulorecto . Verificar quelas habitacionestengan sus ladosparalelos. Si medimos las diagonales de un rectngulo tienenque ser iguales, si no lo son, entonces algn ladoo todos no sonparalelos. Si nuestracasa se apoyaen una medianera construda, tiraremos de igualforma un hilo deCuando tomemos medidascon una cinta ometro es necesario que sta est a nivel. Si tomamos medidas inclinadas nos dar errores. ms seguro quela pared rugosa. Si no podemosponerlo en la medianera, convienerencia con ningnmuro, es mejorque lo ubiquemosa una distanciade 1 m. con respecto a la medianera. Es ms fcilsumar y restar a1 m. que a0,75 m.. Las medidasque veamos en losplanos, son siempre (salvo que digan la contrario), de paredes terminadas, tendremosque restarle el espesor del revoque, que si es gruesa yfina ser 1 1/2 cm. referencia en ella. ya que va a se. ubicar el hilo e. el eje de algun. futura pared. Si no pode. mos hacer coinci. dir el hilo de refe.

VEAMOS ALGUNOS EJEMPLOSDe esta forma nos quedara un replanteo deuna casa como la aqu dibujada. VEAMOS ALGUNOS EJEMPLOSDe esta forma nos quedara un replanteo deuna casa como la aqu dibujada. Esta sera la ubicacin de los hilo. de referencia principales para ubica. una casa al frente, pegada a la vere. da, en caso de que no exista retir. frontal. Este caso representa la ubicacin de una casa co. un retiro frontal. El segundo hilo de referencia co. incide con la fachada, pero no as el primero que s. hizo coincidir con la medianera a una distancia "d. de la casa. Replanteo 3 - 5HERRAMIENTAS

Estructuras 4 - 1Este otro sistema utiliza paratransmitir el peso del techo al s uelo, una especie de jaula realizada por elementos verticales llamados pilares y otroshorizontales llamados vigas. Este sistema tiene como elementoprincipal el uso de las paredes (o algunas de ellas), para transmitir el peso deun techo o un entrepiso al suelo. El peso deltecho en esteejemplo se reparte alo largo de todo el muro.El pesodel techo lorecibirn las vigas, quienes a travs de los pilares lobajarn a tierra.NOTAnes son las estructuras enbas e a muros portantes ylas de pilares y vigas. Los sistemas ms comuDon Anastasio, cmo hagopara levantar mi casa? ESTRUCTURA ENBASE A PILARESY VIGASESTRUCTURA ENBASE A MUROSPORTANTESJ.G.BARCALAM INISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEESTRUCTURAHasta qu e no se terminenlos muros principales nopodemos poner el techo. Estructuras 4 - 1Este otro sistema utiliza paratransmitir el peso del techo al s uelo, una especie de jaula realizada por elementos verticales llamados pilares y otroshorizontales llamados vigas. Este sistema tiene como elementoprincipal el uso de las paredes (o algunas de ellas), para transmitir el peso deun techo o un entrepiso al suelo. El peso deltecho en esteejemplo se reparte alo largo de todo el muro.El pesodel techo lorecibirn las vigas, quienes a travs de los pilares lobajarn a tierra.NOTAnes son las estructuras enbas e a muros portantes ylas de pilares y vigas. Los sistemas ms comuDon Anastasio, cmo hagopara levantar mi casa? ESTRUCTURA ENBASE A PILARESY VIGASESTRUCTURA ENBASE A MUROSPORTANTESJ.G.BARCALAM INISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEESTRUCTURAHasta qu e no se terminenlos muros principales nopodemos poner el techo.

Estructuras 4 - 2de hormign armado, ya que suconstruccin no es confiable,muchosse deshacen al agarrarlos. S sirvenpara techos livianos. TIEMPOS DE DESENCOFRADOPilares 6 a 7 dasVigasLosas 14 dasEl ladrillo de campo ha d e serparejo y bien horneado. No pueden ser crudos que se rompenfcilmente, ni quemados que sondifciles de cortar y gen eralmente son torcidos, a dems de poseer fisuras importantes. Sus medidas varan segn quinlos fabrique. NOTALADRILLODE CAMPOLos huecos habrn de ir siemprepara arriba. NOTALADRILLOREJILLAHay que rechazar todos aquellosque estn fisurados o desparejos . NOTALADRILLODE PRENSAESTRUCTURA ENBASE A MUROSPORTANTESESTRUCTURA ENBASE A PILAR ESY VIGAS Cmo se hace un hormign? El hormign se compone de 2 ridos, uno grueso que es el pedregullo y otro finoque es la arena gruesa. Estos dos se unencon el cemento portland. Segn para qu se va a usar el hormign, varan las porporciones de sus componentes. La dosificacin ms comn es: 3 de pedregullo2 de arena guresa1 de cemento portlandA estos elementos se les ag rega aguadurante el amasado, lo que genera una pastamanejable que podremos coloc ar dentro demoldes (llamados encofrados), que contendrnarmaduras de hierro. Dentr o de estos encofrados endurecer (fraguar) el hormign, alcabo de un determinado tiempo se podr sacar el molde y tendremos nuestros pilares, vigas, losas o lo que hayamos realizado sostenindose por s solas. Los huecos que queden entre pilares yvigas se podrn llenar con ladrillo, ticholo, bloque o cualqueir mampuesto. El bloque comn no es adecuadopara soportar el peso de una losaNOTAPara poder sopo rtar un techo de hormign armado, un muro portante tiene queser construido con materiales resistentes: (un mes apuntaladas) Laterales 3 dasEstructuras 4 - 2de hormign armado, ya que suconstruccin no es confi able,muchosse deshacen al agarrarlos. S sirvenpara techos livianos. TIEMPOS DE DESENCOFRADOPilares 6 a 7 dasVigasLosas 14 dasEl ladrillo de campo ha d e serparejo y bien horneado. No pueden ser crudos que se rompenfcilmente, ni quemados que sondifciles de cortar y gen eralmente son torcidos, a dems de poseer fisuras importantes. Sus medidas varan segn quinlos fabrique. NOTALADRILLODE CAMPOLos huecos habrn de ir siemprepara arriba. NOTALADRILLOREJILLAHay que rechazar todos aquellosque estn fisurados o desparejos . NOTALADRILLODE PRENSAESTRUCTURA ENBASE A MUROSPORTANTESESTRUCTURA ENBASE A PILAR ESY VIGAS Cmo se hace un hormign? El hormign se compone de 2 ridos, uno grueso que es el pedregullo y otro finoque es la arena gruesa. Estos dos se unencon el cemento portland. Segn para qu se va a usar el hormign, varan las porporciones de sus componentes. La dosificacin ms comn es: 3 de pedregullo2 de arena guresa1 de cemento portlandA estos elementos se les ag

rega aguadurante el amasado, lo que genera una pastamanejable que podremos coloc ar dentro demoldes (llamados encofrados), que contendrnarmaduras de hierro. Dentr o de estos encofrados endurecer (fraguar) el hormign, alcabo de un determinado tiempo se podr sacar el molde y tendremos nuestros pilares, vigas, losas o lo que hayamos realizado sostenindose por s solas. Los huecos que queden entre pilares yvigas se podrn llenar con ladrillo, ticholo, bloque o cualqueir mampuesto. El bloque comn no es adecuadopara soportar el peso de una losaNOTAPara poder sopo rtar un techo de hormign armado, un muro portante tiene queser construido con materiales resistentes: (un mes apuntaladas) Laterales 3 das

Estructuras 4 - 3Ninguno de estos tipos de estructuras puede funcionar sin una correcta cimentacin. Ya que es la queapoya directamente en el suelo. SOBRE CADA UNO DE LOS DISTINTOS ELEMENTOSHABLAREMOS MAS ADELANTEA pesar de que n adie ve los cimientos, (yaque van enterrados), son muy importantes yno se puede escatimar ni dinero niesfuerzo en ellos. Estructuras 4 - 3Ninguno de estos tipos de estructuras puede funcionar sin una correcta cimentacin. Ya que es la queapoya directamente en el suelo. SOBRE CADA UNO DE LOS DISTINTOS ELEMENTOSHABLAREMOS MAS ADELANTEA pesar de que n adie ve los cimientos, (yaque van enterrados), son muy importantes yno se puede escatimar ni dinero niesfuerzo en ellos.

Cimientos 5 - 1Utilizaremos para ello un mtodo prctico. Haremos por lo menos 3 pozos en nuestro terreno de unaprofundidad no menor a 1 metro. Es bueno aprovechar la excavacin del pozo negro comoparte del estudio. Si el suelo cede, los muros descienden y si eso ocurre pueden aparecerfisuras en las paredes y en el peor de los casos un derrumbe de la construccin. Los cimientos son para la casa lo que los pies son para nosotros, si nos fallann os caemos. Todo suelo tiene un mximo de resistencia, elque hay que conocer para hacer una co rrecta cimentacin. No se debe superar esa resistencia, por eso las bases se hacen ms anchas que lapared. De esa forma se distribuye mejo r el pesosobre el terreno. Para poderconstrur unmuro hayque darlepreviamenteun apoyoseguro. Si no hacemos unabuena base el terrenopuede hundirse por elpeso de nuestra casa Cmo sabemosqu tipo de suelotenemos ennuestro predio? Para definir que cimiento se debe usar, hay que ver primero cmo es el suelo. Veremos entonces si es blando, semi-duro o duro. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTECIMIEN TOSCimientos 5 - 1Utilizaremos para ello un mtodo prctico. Haremos por lo menos 3 pozos en nuestro terreno de unaprofundidad no menor a 1 metro. Es bueno aprovechar la excavacin del pozo negro comoparte del estudio. Si el suelo cede, los muros descienden y si eso ocurre pueden aparecerfisuras en las paredes y en el peor de los casos un derrumbe de la construccin. Los cimientos son para la casa lo que los pies son para nosotros, si nos fallann os caemos. Todo suelo tiene un mximo de resistencia, elque hay que conocer para hacer una co rrecta cimentacin. No se debe superar esa resistencia, por eso las bases se hacen ms anchas que lapared. De esa forma se distribuye mejo r el pesosobre el terreno. Para poderconstrur unmuro hayque darlepreviamenteun apoyoseguro. Si no hacemos unabuena base el terrenopuede hundirse por elpeso de nuestra casa Cmo sabemosqu tipo de suelotenemos ennuestro predio? Para definir que cimiento se debe usar, hay que ver primero cmo es el suelo. Veremos entonces si es blando, semi-duro o duro. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTECIMIEN TOS

LA RESISTENCIA DEL SUELO SE COMPRUEBA AL EXCAVARLO Si la pala rebota o clava pocoen el suelo y es necesario usarel pico para ayudar , clasificaremos a este suelo como: semiduro, su resistencia es aptapara una cimentacin normal. Es conveniente preguntarle a los vecinos, el tipo desuelo que encontraron, los p roblemas o no que tuvieron, el tipo de cimentacin que utilizaron y a qu profundidadla hicieron. (Antes de preg untar conviene mirar si la casadel vecino tiene fisuras en sus muros). CONSEJOS IMPORTANTES Si el terreno es de arena y no aparece agua cuando excavamos no habr qu. preocuparse. Pero si encontramos agua deberemos cimentar ms arriba. Cimientos 5 - 2Si habiendo llegado a 1 m de profundidad tenemos un sueloblando ( sin ser arena). Si nuestro predio se encuentra en un mdano de arena. (Habr que cuidar el desplazamiento de la arena). Si encontramos agua al excavar. Si nos enteramos que el suelo de la zona es de arcilla expansiva(o sea que aumen ta su volmen en presencia de aguas). Es conveniente consultar a un tcnico cuando: Si la pala penetr. sin mucho esfuer. zo el suelo es blan. do, tiene una resis. tencia baja. Si para excavar hay qu. perforar a pico con u. gran esfuerzo, diremo. que el suelo es duro. Su resistencia es mu. buena.

Cuando sucede eso, el suelo seeleva, pudiendo superar los 10 cm. comoen algunos sitios de Libertad. Al mojarselas primeras capas de tierra se generauna zona bas tante impermeable. Es porCuando tenemos un suelo de arcillaexpansiva, o sea que modifica su volmensegn lapresencia de agua, la cosa se complica. Cuando sucede eso, el suelo seeleva, pudiendo superar los 10 cm. comoen algunos sitios de Libertad. Al mojarselas primeras capas de tierra se generauna zona bas tante impermeable. Es porCuando tenemos un suelo de arcillaexpansiva, o sea que modifica su volmensegn lapresencia de agua, la cosa se complica. eso que conviene construr nuestra cimentacin a una profundidad no menor a . metro. En el caso que tengamos una estructura que posea vigas de fundacin (la. que van por debajo de la tierra para sostener muros), va a ser importante prote. gerla contra esos movimientos, (veremos cmo hacerlo en estructuras de pilare. y vigas). Una mtodo que es posible utili. zar para disminuir el problema del em. puje hacia arriba del suelo, es rellena. con un material no expansivo como se. arena o un hormign ciclpeo. Un sistema que ha mostrado da. resultado cuando se usa en estos terre. nos una cimentacin corrida de hormi. gn ciclpeo es el colocar una capa d. hormign armado por debajo y por enci. ma de la misma.

Cimientos 5 - 3Para estos suelos expansivos es aconsejable realizar una vereda no menor de 1 metro alrededorde la construccin, esto evitar la ac cin delagua directamente en la zona de cimentacin. NOTA

Dentro de este grupopodemos dividirlasan en otrossubgrupos: aisladas, corridas y las delosas o plateasgenerales. Nombraremosalgunas de ellas. Don Anastasio cuente un pocosobre los tipos de cimentacin. A nosotrosnos interesan lascimentacionessuperficiales. Los cimientos se pueden clasificar en tres grandes grupos: profundos, semi-profundos y superficiales. Dentro de este grupopodemos dividirlasan en otrossubgrupos: aisladas, corridas y las delosas o plateasgenerales. Nombraremosalgunas de ellas. Don Anastasio cuente un pocosobre los tipos de cimentacin. A nosotrosnos interesan lascimentacionessuperficiales. Los cimientos se pueden clasificar en tres grandes grupos: profundos, semi-profundos y superficiales. Cimientos 5 - 4PLATEASAISLADASCORRIDASPatines de hormignarmado. Dados de hormignciclpeo. Cimentacin corrida dehormign ciclpeo. Patn corrido de hormign armado. Losa de hormign armado sobre el suelo. Se usa para terrenos con poqusima resistencia, tales quesi quisiramos usar cimentaciones aisladas, la superficiede ellas seran tan grandesque casi se tocaran. Sirven para cimentar estructuras de muros portantes. Sirven para cimentar estructuras de pilares y vigas.

Cimientos 5 - 5Si las paredes de la zanja se desmoronan ser necesario ensancharla lo suficientepara que la arena o tierra no caiga sobredonde tenemos que hacer la cimentacin. Si el terreno permite un cortelimpio del mismo ser suficienterealizar una zanja d el ancho necesario para hacer el mismo. VEAMOS COMO REPLANTEARUN CIMIENTO CORRIDOSi ahora tiramos un par de hilos tendre mos entonceslos bordes de nuestro futuro cimiento. Nos queda luego bajarpuntos d e referencia, lo haremos con una plomada de punta. Si encalamos un hilo y lo golpeamos contra el suelo tendremos marcada la lnea por donde deberemos excavar. Para un cimiento corrido marcaremos en los caballetes la mitad del ancho delcimiento a cada lado del ejedel muroJ.G.BARCALACimi entos 5 - 5Si las paredes de la zanja se desmoronan ser necesario ensancharla lo suficientepara que la arena o tierra no caiga sobredonde tenemos que hacer la cimentacin. Si el terreno permite un cortelimpio del mismo ser suficienterealizar una zanja d el ancho necesario para hacer el mismo. VEAMOS COMO REPLANTEARUN CIMIENTO CORRIDOSi ahora tiramos un par de hilos tendre mos entonceslos bordes de nuestro futuro cimiento. Nos queda luego bajarpuntos d e referencia, lo haremos con una plomada de punta. Si encalamos un hilo y lo golpeamos contra el suelo tendremos marcada la lnea por donde deberemos excavar. Para un cimiento corrido marcaremos en los caballetes la mitad del ancho delcimiento a cada lado del ejedel muroJ.G.BARCALA

PARA UNA CIMENTACIONPUNTALPARA UNA CIMENTACIONPUNTAL Haremos un marco de tabla d. madera de 15 cm. que tendr interior. mente el tamao del dado o patn d. hormign armado que tengamos qu. construir. Le marcaremos la mitad . cada lado para colocarle un par de hi. los que se crucen y definan el centr. del marco.

Cimientos 5 - 6excavacin. En los caballetes que tenemos re. planteado los muros, haremos las mar. cas de todos los ejes. Tirando hilo. desde stos definiremos los puntos e. que debern ubicarse los cimientos (cru. ce de hilos). Deberemos entonces, bajar co. plomada de punta el cruce de los hilo. haciendo coincidir con el cruce de hilo. del marco de madera. Fijando ste a l. tierra tendremos marcada la zona d.

nivelado y compactado. Este tipo de cimiento no esprctico para profundidades desuelo firme que superen e l metro ymedio. La zanja que realizaremospara su construccin no podr sermenor de 40 cm de ancho, a quese complica trabajar en un espaciotan reducido. Su fondo deber estarEl llena do de la zanja se har en capas alternadas dehormign y piedra grantica, antes de as colocaremosuna de arena gruesa de 5 cm.de altura. No deberemos usar piedraext remadamente grande ya que correremos el riesgo de un mal llenado dejando huecos en elcimiento. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTECIMIEN TO CORRIDODE HORMIGON CICLOPEO nivelado y compactado. Este tipo de cimiento no esprctico para profundidades desuelo firme que superen e l metro ymedio. La zanja que realizaremospara su construccin no podr sermenor de 40 cm de ancho, a quese complica trabajar en un espaciotan reducido. Su fondo deber estarEl llena do de la zanja se har en capas alternadas dehormign y piedra grantica, antes de as colocaremosuna de arena gruesa de 5 cm.de altura. No deberemos usar piedraext remadamente grande ya que correremos el riesgo de un mal llenado dejando huecos en elcimiento. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTECIMIEN TO CORRIDODE HORMIGON CICLOPEO Cimiento corrido 6 - 1Con en el mismo eje de la cimentacin y apoyada a lo largo de sta, construiremos una carrera de hormign armado del ancho del muro quelevantaremos y de una altura de unos30 cm (2 ta blas). La armadura correspondr a 4 hierros comunes de 10mm. con estribosde hierro comn de 6 cada 25 cm. Como la carrera estar en contacto conla humedad de la tierra nos aseguraremos un recubrimiento de hormign deunos 3 cm. Cada tanto podemos agregarlehierros de 6 tipo"U" invertidos quepenetren en la cimentacin unos 30a 40 cm. A estoshierros los haremos terminar en ganchos.

y ell

y ell

Hagamos los metrajes y veamosque materiales necesitamos paraesta cimentacin. Calcularemos 1 metro lineal de cimentacin. Deberemos entonces medir el recorrido de todas las paredes parasaber la totalidad de m ateriales. Mediremos primero lo correspondiente al hormign ciclpeo. Volumen de hormign armado en 1metro de cimiento. ALTURA x ANCHO x 1 m = Si hacemos: ALTURA x ANCHO x 1 mHaremos lo mismo con la carrera de hormign armado: Hagamos los metrajes y veamosque materiales necesitamos paraesta cimentacin. Calcularemos 1 metro lineal de cimentacin. Deberemos entonces medir el recorrido de todas las paredes parasaber la totalidad de m ateriales. Mediremos primero lo correspondiente al hormign ciclpeo. Volumen de hormign armado en 1metro de cimiento. ALTURA x ANCHO x 1 m = Si hacemos: ALTURA x ANCHO x 1 mHaremos lo mismo con la carrera de hormign armado: = Volumen d. hormign ciclo. peo en 1 metro d. cimiento. Teniendo los volmenes totales multiplicaremos por los siguientes valores para obt ener la totalidad d. los materiales. . . = m3 de piedra grantic. 0,2. = m3 de arena grues. 0,4. = m3 de pedregull. 3,. . bolsas de cemento portlan. Metros cbico. totales de hormig. ciclpe. . = m de hierro comn de . . = m de hierro comn de 1. 0,. =. m3 de pedregull. 0,. . m3 de arena grues. . . bolsas de cemento portlan. 0,. .

kilos de alambre para atar hierr. 1. . tablas para encofrad. 0,. . kilos de clavos de 2 pulgada. . Metros cbico. totales d. carrer. NOTA:. Son cantidades aproximada. Cimiento corrido 6 - .

MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEPATIN CORRIDODE H ORMIGON ARMADOEs la cimentacin ideal pararealizar sobre terrenos arenososo de una resistencia baja. Veamos un patn corrido enhormign armadocasos hay que ensanchar la base del cimient o, sehace ms fcil realizarlo con hormign armado. Para construir un patncorrido de hormign armadoconviene hacerlo calcular porun tcni co especialista. Este tipo de cimiento esnecesario realizarlo cuando elpeso de la construccin es i mportante y el suelo es de bajaresistencia. Como en estosJ.G.BARCALAVeremos algun as generalidades: MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEPATIN CORRIDODE H ORMIGON ARMADOEs la cimentacin ideal pararealizar sobre terrenos arenososo de una resistencia baja. Veamos un patn corrido enhormign armadocasos hay que ensanchar la base del cimient o, sehace ms fcil realizarlo con hormign armado. Para construir un patncorrido de hormign armadoconviene hacerlo calcular porun tcni co especialista. Este tipo de cimiento esnecesario realizarlo cuando elpeso de la construccin es i mportante y el suelo es de bajaresistencia. Como en estosJ.G.BARCALAVeremos algun as generalidades: En general el ancho superar lo. 40 cm ya que como dijimos anterior. mente se usan cuando es necesario en. sanchar la base. La primer capa de hor. mign de recubrimiento de la armadur. ser de 4 a 5 cm. Sobre sta apoyare. principales que van a lo ancho no debe. rn ser nunca menores a 8 mm. Lo. hierros que van a lo largo pueden se. menores e ir separados cada 25 cm. Se puede reducir la cantidad de hormi. gn haciendo chanfles a partir de lo. Patn corrido 7 - 1mos la parrilla de hierros. Los hierros15 cm del fondo.

VEAMOS COMO METRAR UNPATIN CORRIDOVEAMOS COMO METRAR UNPATIN CORRIDO El metraje depender del diseo de patn que nos presente el tcnico calculista. Haremo. siempre el clculo de 1 metro. Patn sin carrera superior. Calcularemos las reas de: Patn con una carrerasin pendientes laterales. Calcularemos las reas de: Patn con una carrerasobre l, donde apoyar el muro. Calcularemos las reas de: Las reas sumadas y multiplicadas por 1 m nos dar el volmen en metro. cbicos que deberemos multiplicar por la totalidad de metros lineales de muros qu. tengamos que cimentar. Ese valor total lo multiplicaremos por las cifras de abaj . para obtener la cantidad de material necesario (aproximado), para su construccin.

0,. =. m3 de pedregull. 0,. . m3 de arena grues. . . bolsas de cemento portlan. 1. . tablas para encofrad. . . kilos de clavos de 2 pulgada. . . kilos de alambre para atar hierr. Volmen tota. de pat. . El hierro depender del tcnico calculista. Para una aproximacin de lo qu. necesitamos podra multiplicarse el volumen total de patn por 25 kilos. Patn corrido 7 - .

Los dados de hormign ciclpeo se hacen colocando en el pozo realizado para la cimen J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEDADOS DEHORMIGON CICLOPEOLos dados de hormign ciclpeo se hacen colocando en el pozo real izado para la cimenJ.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEDADOS DEHORMIGON CICLOPEO tacin una serie de capas de hormign y piedra grantica. No llevan varillas de hierro . Dados 8 - 1La altura que se suele dar aun dado de hormign ciclpeo seencuentra en e l orden de los 60 a90 cm. Su ancho rondar los 40a 50 cm, y su largo los 60 cm. La separacin razonable entre uno y otro es entre los 2,80 a3 m. Cuando por alguna razn, dos dados se juntan mucho, podemos (y esconveniente), uni rlos, transformando su largo no ya a 60 cm, sino a lo quefuera necesario, (por e jemplo 1,50 m).

Metrar los dados de hormign ciclpeo es fcil. En los planos de estructura, e. la parte correspondiente a cimiento. podremos encontrar las distintas di. mensiones de nuestros dados de hor. mign ciclpeo. Deberemos hallar el volmen d. un prisma. ALTO x ANCHO x PROFUNDIDA. As haremos con todos para lue. go sumarlos y obtener la totalidad d. hormign ciclpeo que necesitaremo. en obra. Este valor total, lo multiplicare. mos entonces por los de la tabla d. abajo para obtener las cantidades d. los distintos materiales que compon. drn los dados. Dados 8 - 2 1= m3 de piedra grantica 0,25= m3 de arena gruesa 0,45= m3 de pedregullo 3,4= bolsas de cemento portland10= tablas para encofrado (si es necesario) 1= kilos de clavos de 2 pulgadasXTotal dehormignciclpeo

Patines 9 - 1PRESTEMOS ATENCION A ALGUNOS DETALLESPara colocar laarmadura debere mos antes haceruna capa de 5 cm. de hormign paraluego apoyarla. Se har unaparrilla segn losplanos. Todos loshierros debern estar doblados en suspuntas y bien atados. Veamos unafundacincon patinesEl patn de hormign armado viene a ser como el pie del pilar. Segn el peso que apoyesobre l, ser el tamao de esta fundacin. En los planos de estructura encontramos las medidasnecesarias para su realizacin, como as tambin lo s hierros que tendremos que colocarle y ala profundidad que deberemos hacerlo. MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEPATIN DEHORMIGON ARMADOJ.G.BARCALAPatines 9 - 1PRESTEMOS ATENCION A ALGUNOS DETALLESPara colocar laarmadura deberemos antes haceruna capa de 5 cm. de hormign paraluego apoyarla. Se har unaparrilla segn losplanos. Todos loshierros debern estar doblados en suspuntas y bien atados. Veamos unafundacincon patinesEl patn de hormign armado viene a ser como el pie del pilar. Segn el peso que apoyesobre l, ser el tamao de esta fundacin. En los planos de estructura encontramos las medidasnecesarias para su realizacin, como as tambin lo s hierros que tendremos que colocarle y ala profundidad que deberemos hacerlo. MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEPATIN DEHORMIGON ARMADOJ.G.BARCALA

Cuando los muros denuestra casa van justo porla lnea de nuestro predio, tenemos que cuidar que loscimientos no queden dellado del vecinoCuando los muros denuestra casa van justo porla lnea de nuestro predio, tenemos que cuidar que loscimientos no queden dellado del vecino En este caso los patines slo podr. pasar para el otro lado de la lnea divisori. 15 cm., que corresponden a la medianer. del vecino. El resto ha de quedar de nues. tro lado. Si la cimentacin de la obra del veci. no da justo donde est la nuestra, entonces ellos podrn picar los 15 cm si. perjudicar el equilibrio de nuestra casa. Patines 9 - 2Si la cimentacin nuestra cae justo enun ngulo del terreno respetaremo s los15 cm. en ambos lados.

Veamos los materialesque necesitaremos paraconstrur un patn dehormign armado. Metrajetotal dehormignM3Xhacer es metrar los patines. Para ello nos basaremos en los planos de estructura, ya que all tendremos las medidas. Obtenida la cantidad de hormign, que necesitamos para la obra la multiplicaremos por los valores siguientes, esto nos dar una buena aproximacin de los materiales que deberemos conseguir. Lo primero que se deber Veamos los materialesque necesitaremos paraconstrur un patn dehormign armado. Metrajetotal dehormignM3Xhacer es metrar los patines. Para ello nos basaremos en los planos de estructura, ya que all tendremos las medidas. Obtenida la cantidad de hormign, que necesitamos para la obra la multiplicaremos por los valores siguientes, esto nos dar una buena aproximacin de los materiales que deberemos conseguir. Lo primero que se deber 0,9= m3 de pedregullo 0,6= m3 de arena gruesa 7= bolsas de cemento portland10= tablas para encofrado (aproximado) 1= kilos de clavos de 2 pulgadas 1= kilos de alambre para atar Patines 9 - 3El tipo de hierro y cantidad deberemos obtenerloleyendo los planos de estructura, ya que all nos dirn cual ir y cada cuanto deber colocarse. De igual forma si multiplicamos la totalidad dehormign por 25 kilos, tendremos un a buena aproximacin en peso de lo que necesitaremos. Con ellospodremos obtener precios dentro d el mercado.

MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEVIGAS DECIMENTACI ONPara poder soportar losmuros de la planta bajanecesitamos apoyarlos envigas. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEVIGAS DECIMENTACIONPara poder soportar losmuros de la planta bajanecesitamos apoyarlos envigas. J.G.BARCALA Si nuestra cimentacin es por medio de patines, las vigas de cimentaci. apoyarn en los pilares que nacern de stos. Si nuestra cimentacin es de dados de hormign ciclpeo, las vigas apo. yarn sobre stos y de estas nacern los pilares. PILA. PATI. VIG. DAD. VIG. Para el armado de las vigas de cimentacin ver vigas de hormign armado.

Vigas de cimentacin 10 - .

Vigas de cimentacin 10 - 2Hay terrenos arcillosos que cuando sehumedecen se comienzan a hinchar aumentando su volmen. La fuerza quegeneran hacia arribaes muy importante ypueden generar fisurasi mortantes en nuestraconstruccin. DESCALCE DE LAS VIGAS DE CIMENTACIONDos formas de liberarlos fondos de vigasPara evitar ese problema se deja libre de tierra unespacio debajo de las vigas. NOTA: No es convenienteusar viruta en vez dearena porque la madera cuando se pudre perjudica al hormign. HERRAMIENTASPara saber cunto material necesitamos en obra, deberemos realizar ant eslos metrajes correspondientes a todas las vigas de cimentacin. Tomaremos las medidas de cada una y multiplicaremosALTURA X ANCHO X LARGO. Si su mamos los volmenes obtenidosllegaremos a conocer la totalidad de metros cbicos de hormign que debemoshacer. Multiplicaremos entonces este valor final por los corre spondientes a latabla inferior, obtendremos as la cantidad de materiales que nece sitaremos enobra para la realizacin de nuestras vigas de cimentacin. Metrajetotal dehormignX 2 = kilos de clavos de 2 pulgadas 2 = kilos de alambre 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 60 = tablas para encofrado (aproximado) La cantidad de hierro depender de lo que indiquen los planos de estructura. Pero si al metraje total de hormign para vigas lo multiplicamos por85 k , tendremos una aproximacin del kilaje que necesitaremos en obra. Vigas de cimentacin 10 - 2Hay terrenos arcillosos que cuando sehumedecen se comienzan a hinchar aumentando su volmen. La fuerza quegeneran hacia arribaes muy importante ypueden generar fisurasi mortantes en nuestraconstruccin. DESCALCE DE LAS VIGAS DE CIMENTACIONDos formas de liberarlos fondos de vigasPara evitar ese problema se deja libre de tierra unespacio debajo de las vigas. NOTA: No es convenienteusar viruta en vez dearena porque la madera cuando se pudre perjudica al hormign. HERRAMIENTASPara saber cunto material necesitamos en obra, deberemos realizar ant eslos metrajes correspondientes a todas las vigas de cimentacin. Tomaremos las medidas de cada una y multiplicaremosALTURA X ANCHO X LARGO. Si su mamos los volmenes obtenidosllegaremos a conocer la totalidad de metros cbicos de hormign que debemoshacer. Multiplicaremos entonces este valor final por los corre spondientes a latabla inferior, obtendremos as la cantidad de materiales que nece sitaremos enobra para la realizacin de nuestras vigas de cimentacin. Metrajetotal dehormignX 2 = kilos de clavos de 2 pulgadas 2 = kilos de alambre 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 60 = tablas para encofrado (aproximado) La cantidad de hierro depender de lo que indiquen los planos de estructura. Pero si al metraje total de hormign para vigas lo multiplicamos por85 k

, tendremos una aproximacin del kilaje que necesitaremos en obra.

Paredes 11 - 7Verificar que lasuperficie est horizontal. Usar 2reglas y el nivel demanga. Si no loest hay quecorregirlo. Limpiar lasuperficie delcimiento. Verificar los caballetes de replanteo, si estn bien bajaremos los puntos con plomada depunta y los marcaremos en elcimiento haciendo unas lneascon el canto de la cuchara sobrearena y portland. A SEGUIRPASOSAhora comenzaremos a levantarlos muros.Veremos primerocmo se hace us ando ladrillos. Luego veremosrecomendaciones para eluso de otros materiales, s? J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL YMEDIO AMBIENTEPAREDESParedes 11 - 7Verificar que lasuperficie es t horizontal. Usar 2reglas y el nivel demanga. Si no loest hay quecorregirlo. Limpiar lasuperficie delcimiento. Verificar los caballetes de replanteo, si estn bien bajaremos los puntos con plomada depunta y los marcaremos en elcimiento haciendo unas lneascon el canto de la cuchara sobrearena y portland. A SEGUIRPASOSAhora comenzaremos a levantarlos muros.Veremos primerocmo se hace us ando ladrillos. Luego veremosrecomendaciones para eluso de otros materiales, s? J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL YMEDIO AMBIENTEPAREDES

Paredes 11 - 8Las reglas tienen que estar bien fijas, las podemos clavar con unp ar de tablas a estacas enterradas firmemente. Las tablas usadas(escuadras), tien en que estar ubicadas en las 2 direcciones principales de la regla como indica el dibujo arriba a la izquierda. El hilo tiene que quedar siempre tenso. Hay que cuidar que no se enganche, ha de quedar libre para que no engae. Conviene verificar cada tanto que las reglas continuen a plomo. Otra forma de llevar el hilo es colocando un ladrillo encada extremo del muro, m idiendo con el metro la altura dela hilada. Sobre stos colocaremos otro cruzado ( sin material) al que ataremos el hilo definiendo as para elresto de la hilada la altura y posicin a seguir. NOTAColocaremos una regla de aluminio o madera, en cada extremodel muro, bien aplomadas en sus 2sentidos princip ales. A ellas debemos colocarle un hilo que coincidacon la cara exterior de la pared quequeremos l evantar. Para que sto suceda la cara de laregla por la cual deslizar el hilo deber coincidir con la del futuro muro. El hilo nos servir para ir marcandocada hilada de ladrillo que levantemos y nosas egurar que al respetarlo nuestra paredest a plomo y conforme un plano bien hecho. Para ladrillo visto, es conveniente marcar en las reglas de madera laaltura de cada hilada, la que se calcula sumando la correspondiente alladrillo ms la de la junta, loharemos de arriba hacia abajo. LADRILLO VISTOParedes 11 - 8Las reglas tienen que estar bien fijas, las podemos clavar con unpar de tablas a estacas enterradas firmemente. Las tablas usadas(es cuadras), tienen que estar ubicadas en las 2 direcciones principales de la regla como indica el dibujo arriba a la izquierda. El hilo tiene que quedar siempre tenso. Hay que cuidar que no se enganche, ha de quedar libre para que no engae. Conviene verificar cada tanto que las reglas continuen a plomo. Otra forma de llevar el hilo es colocando un ladrillo encada extremo del muro, m idiendo con el metro la altura dela hilada. Sobre stos colocaremos otro cruzado ( sin material) al que ataremos el hilo definiendo as para elresto de la hilada la altura y posicin a seguir. NOTAColocaremos una regla de aluminio o madera, en cada extremodel muro, bien aplomadas en sus 2sentidos princip ales. A ellas debemos colocarle un hilo que coincidacon la cara exterior de la pared quequeremos l evantar. Para que sto suceda la cara de laregla por la cual deslizar el hilo deber coincidir con la del futuro muro. El hilo nos servir para ir marcandocada hilada de ladrillo que levantemos y nosas egurar que al respetarlo nuestra paredest a plomo y conforme un plano bien hecho. Para ladrillo visto, es conveniente marcar en las reglas de madera laaltura de cada hilada, la que se calcula sumando la correspondiente alladrillo ms la de la junta, loharemos de arriba hacia abajo. LADRILLO VISTO

Paredes 11 - 9Pondrermos una cucharada dearena, cemento portland e hidrfugosobre la superficie del cimiento, luego la extenderemos usando la propia cuchara. lo pondremos con lapanza hacia arriba. Si el ladrillo tiene cierta curvatura, Es bueno poner material en la cara chica delladrillo para ayudar a llenar las juntas verticales. Pero no deben estar chorreando. Debemos mojar los ladrillosantes de usarlos. Podremos terminar de acentarlo con unosgolpecitos de la cucharacon la que retiraremos losexced entes laterales dematerial para colocarlosen las juntas verticales. Asentaremos elladrillo empujando ymoviendolo en vaivn. Para colocar el ladirllo es convenienteseguir un movimientodeslizante como indicael dibujo. PARA RECORDAR: Si no se moja elladrillo, ste chupar el agua del material yterminar despegndose. Paredes 11 - 9Pondrermos una cucharada dearena, cemento portland e hidrfugosobre la superficie del cimiento, luego la extenderemos usando la propia cuchara. lo pondremos con lapanza hacia arriba. Si el ladrillo tiene cierta curvatura, Es bueno poner material en la cara chica delladrillo para ayudar a llenar las juntas verticales. Pero no deben estar chorreando. Debemos mojar los ladrillosantes de usarlos. Podremos terminar de acentarlo con unosgolpecitos de la cucharacon la que retiraremos losexced entes laterales dematerial para colocarlosen las juntas verticales. Asentaremos elladrillo empujando ymoviendolo en vaivn. Para colocar el ladirllo es convenienteseguir un movimientodeslizante como indicael dibujo. PARA RECORDAR: Si no se moja elladrillo, ste chupar el agua del material yterminar despegndose.

Paredes 11 - 10Verificaremos cada 5 o 6 hiladas la verticalidad del muro, usando plomada, y la horizontalidad usando una regla larga sobre ste ala que le colocaremos un nivel de bu rbuja. Las juntas tienen que quedar no menos de1 - 11/2 cm de ancho dependiendo que sea ladrillode prensa o de campo. Para que el muro sea resistente es convenienteir alternando las juntas verticale s entre una hiladay la siguiente. ello, aplastaremos el material con la cuchara deplano (planchado). Hay queEs necesario que no quedeningn huequito. Paraempezar de abajo para arriba. Continuaremos levantando el muro con la mismatcnica pero usando una combinacin de mezclagruesa con cemento o arena y articor. Terminadas las 3 primeras hiladas deladrillo, usando el mismo material de arena ycemento portland con hidrfugo, revocaremoslos tres lados del pequeo muro. Solapar emos lacapa impermeable unos 5 cm sobre el cimiento. Paredes 11 - 10Verificaremos cada 5 o 6 hiladas la verticalidad del muro, usando plomada, y la horizontalidad usando una regla larga sobre ste ala que le colocaremos un nivel de bu rbuja. Las juntas tienen que quedar no menos de1 - 11/2 cm de ancho dependiendo que sea ladrillode prensa o de campo. Para que el muro sea resistente es convenienteir alternando las juntas verticale s entre una hiladay la siguiente. ello, aplastaremos el material con la cuchara deplano (planchado). Hay queEs necesario que no quedeningn huequito. Paraempezar de abajo para arriba. Continuaremos levantando el muro con la mismatcnica pero usando una combinacin de mezclagruesa con cemento o arena y articor. Terminadas las 3 primeras hiladas deladrillo, usando el mismo material de arena ycemento portland con hidrfugo, revocaremoslos tres lados del pequeo muro. Solapar emos lacapa impermeable unos 5 cm sobre el cimiento.

Vimos ya comolevantar un murosimple de 15 cmVeamos ahora como se colocan losladr illos para un muro deSe comienza con unmurito de 15 cm., de 2 hiladas trabadas al que se loaplaca un ladrillo de canto. Luego haremos otras2 hiladas trabadas pero desplazadas hacia la otra caradel muro, para terminar conotro aplacado. Vimos ya comolevantar un murosimple de 15 cmVeamos ahora como se colocan losladr illos para un muro deSe comienza con unmurito de 15 cm., de 2 hiladas trabadas al que se loaplaca un ladrillo de canto. Luego haremos otras2 hiladas trabadas pero desplazadas hacia la otra caradel muro, para terminar conotro aplacado. Paredes 11 - 11MURO DE 30Se comienza la primera hilada con losladrillos colocado s a lo ancho del muro. La segunda hilada secolocar en el otro sentido(a lo largo del muro). Losdos prime ros ladrillos de lamisma debern cortarse alas 3/4 partes para que lasjuntas quede n trabadas. Para cortar un ladrillo se lotoma en la mano y se logolpea con la hachuela en el sitio de corte.

Paredes 11 - 12USANDO EL LADRILLOUSANDO VARILLASHERRAMIENTASLo hacs con el mismo ladrilloo con varillas de hierroCuando levantamos un muro podemos dejar huecos del tamao delancho de un ladrillo (cada 4 hiladas). Estos huecos recibirn posteriormentela otra pared. Tambin podr dejarse1/2 ladrillo hacia afuera para engancharel futuro muro. Si debemos unir una pared quetenemos que levantar a otra existente, podemos hacerlo colocando varillas dehierro, (basta con un dimetro de6 mm). Habr que picar cada 5 o 6 hiladas. Usaremos un material de 3 partes de arena y 1 de cemento portlandpara amurar las varillas de hierro en lapare d existente. Este mtodo nos puede venir bienpara trabar una pared de ticholos obloques con otr a de ladrillo que estemos levantando. Si levantamos los 2 muros almismo tiempo podemos hacer as. varilla de hierroCarlitos, cuando junts 2 muros tensque trabarlos, uno con el otro. Paredes 11 - 12USANDO EL LADRILLOUSANDO VARILLASHERRAMIENTASLo hacs con el mismo ladrilloo con varillas de hierroCuando levantamos un muro podemos dejar huecos del tamao delancho de un ladrillo (cada 4 hiladas). Estos huecos recibirn posteriormentela otra pared. Tambin podr dejarse1/2 ladrillo hacia afuera para engancharel futuro muro. Si debemos unir una pared quetenemos que levantar a otra existente, podemos hacerlo colocando varillas dehierro, (basta con un dimetro de6 mm). Habr que picar cada 5 o 6 hiladas. Usaremos un material de 3 partes de arena y 1 de cemento portlandpara amurar las varillas de hierro en lapare d existente. Este mtodo nos puede venir bienpara trabar una pared de ticholos obloques con otr a de ladrillo que estemos levantando. Si levantamos los 2 muros almismo tiempo podemos hacer as. varilla de hierroCarlitos, cuando junts 2 muros tensque trabarlos, uno con el otro.

EL TICHOLOEL TICHOLO Qu es eso del ticholo? Es un material cermico igua. que el ladrillo, se hace con una m. quina. Gracias a su tamao y a su. huecos que lo hacen liviano las pa. redes se levantan rpidamente. Hay que mojarlo como al ladri. llo, pero no chupa tanta agua ste. Para cortarlo se usa el cant. de la cuchara, dando un golpe sec. en el sitio de corte. Los hay de distintos grosores para levantar muros de 10 cm, 15 . mayores. Es un material que no sirve para apoyar directamente un techo d. hormign, pero s para llenar espacios entre pilares y vigas. Los muros levantados con este material pesan menos que los hecho. en ladrillo de campo o prensa.

Paredes 11 - 13No se puede sacar y volver a colocar un ladrillo o ticholo ya pue sto, porque se pierde resistencia en el muro. No vuelven a pegar bien. PARARECORDAR

EL BLOQUEEl bloque es un elemento baratopara construr, pero tienesus inconvenient es EL bloque comn no tiene mucha resistencia como para sostener un techo pesado. Hay muchos bloques que son pobres en cemento y se rompen sencillamente usando nu estra. manos, es conveniente no aceptar esos bloques. No es un buen aislante trmico, las habitaciones suelen ser fras y hmedas en inviern o . calurosas en verano; para aislar ms conviene aplacarle ladrillos. Las paredes de bloque hay que reforzarlas con varillas de hierro. La junta como en cualquier otro manpuesto (ladrillo de prensa, de campo, ticholo o rejilla), tien. que ser continua y jams debe bajar de 1 cm de espesor. Hay que tener cuidado cuando se pica porque sedestroza fcilmente. Por sus dimensiones asegura un levantamientorpido de muros. Se puede construir la estructura por dentro de los bloques, aprovechando los huecos. Paredes 11 - 14NOTASe pueden fabricar bloques usando un moldellamado bloquera y un mortero de 1 parte decemento portland ms 8 partes de arena. Parafabricar 100 b loques neceitamos 7 bolsas decemento portland y 2 m3 de arena. Luego dehechos, p ara usarlos hay que esperar 4 semanas. El bloque no se moja para colocarlo. Si serecibe mojado hay que dejarlos secar a ntesde usarlos, porque cuando estn as se hinchan y al secarse se retraen despegandose. Por eso conviene tapar el muro que no est terminado. Cuando se levanta una pared, loshuecos del bloque van para abajo.

Primero tens que hacer un metraje delas paredes segn el espesor que vayana tener l as de 15 por un lado, las de20 por otro. Lo mismo si son de bloques y otras de ladrillo. Pero cmo se cuantomaterial tengoque comprar? Primero tens que hacer un metraje delas paredes segn el espesor que vayana tener l as de 15 por un lado, las de20 por otro. Lo mismo si son de bloques y otras de ladrillo. Pero cmo se cuantomaterial tengoque comprar? Haremos grupos de muros segn el tipo de material . espesor que usemos. Juntaremos los resultados de multiplicar los anchos po. los altos de las distintas paredes de esos grupos. Cuando hayan ventanas o puertas le restaremos lo que ocupan las mis. mas. Cuando tengamos la suma de los distintos grupos de paredes multipli. caremos ese resultado por lo que indiquen las tablas de las pginas 11 y 12. Don Anastassio, No me da unejemplito? VEAMOS EL METRAJEDE 2 PAREDES PARED . 2,40 x 2 = 4,80 m. PUERT. 2,05 x 1 = 2,05 m. 4,80 - 2,05 = 2,75 m. TOTAL DE PARED . PARED . 2,40 x 3 = 7,20 m. VENTAN. 1 x 1,10 = 1,10 m. TOTAL DE PARED . 7,20 - 1,10 = 6,10 m. LA SUPERFICI. TOTAL DE LAS DO. PAREDES SERA. 2,75 m. 6,10 m. 8,85 m. .

Paredes 11 - 1.

MUROS DE 10 c. DE ESPESO. x 3. = cantidad ladrill. x 0,0. = mezcla gruesa m. x . = kilos de portlan. EN LADRILLO DE CAMPO EN ESPEJ. Superfici. de muroSe pueden hacer con ladrillo. o ticholo, algunos lugares ven. den bloquetas finas. Slo sirve para separacione. que no requieren gran esfuer. zo, como ser laterales de pla. cares. EN LADRILLO DE PRENSA EN ESPEJ. Superfici. de mur. x 3. = cantidad ladrill. x 0,0. = mezcla gruesa m. x . = kilos de portlan. EN TICHOLO DE 8 X 25 X 25 c. x 1. = cantidad ticholo. x 0,0. = mezcla gruesa m. x . = kilos de portlan. Superfici. de mur. MUROS DE 15 c. DE ESPESO. EN LADRILLO DE CAMP. Superfici. de mur. x 6. = cantidad ladrill. x 0,04. = mezcla gruesa m. x . = kilos de portlan. Podemos hacerlo de ladrillos. ticholos o bloques. Este muro ya puede soporta. un techo de hormign si s. hace de ladrillo o de rejill. pero no de bloques o ticholo. No es un buen aislante de fr. o del calor. EN LADRILLO DE PRENS. Superfici. de mur. x 6. = cantidad ladrill.

x 0,04. = mezcla gruesa m. x . = kilos de portlan. EN TICHOLO DE 12 X 25 X 2. Superfici. de mur. x 1. = cantidad ticholo. x 0,02. = mezcla gruesa m. x . = kilos de portlan. EN BLOQUES 12 X 20 X 4. x 1. = cantidad bloque. x 0,0. = mezcla gruesa m. x . = kilos de portlan. Superfici. de mur. Paredes 11 - 1.

MUROS DE 20 c. DE ESPESO. x 9. = cantidad ladrill. x 0,06. = mezcla gruesa m. x . = kilos de portlan. EN LADRILLO DE CAMP. Superfici. de muroEs un muro que aisla el fro . el calor aceptablemente. En el caso del bloque y ladrill. requiere un mortero impermea. ble entre ellos, usando aren. (3 tachos), ms cemento por. tland (1 tacho), ms hidrfug. segn las indicaciones del fa. bricante. x 3. = cantidad rejill. x 0,0. = mezcla gruesa m. x . = kilos de portlan. Superfici. de mur. EN TICHOLO REJILLO. x 1. = cantidad bloque. x 3. = cantidad ladrill. x 0,0. = mezcla gruesa m. x . = kilos de portlan. EN BLOQUE CON LADRILLO D. CAMPO APLACAD. Superfici. de mur. MURO DE 30 c. DE ESPESO. x 13. = cantidad ladrill. x 0,0. = mezcla gruesa m. x . = kilos de portlan. EN LADRILLO DE CAMP. Superfici. de muroLa aislacin trmica lograd. con este tipo de muro es mu. aceptable. x 4. = cantidad rejill. x 0,04. = mezcla gruesa m. x . = kilos de portlan.

EN TICHOLO REJILLO. Superfici. de mur. Paredes 11 - 17Cada bolsa de portland lleva 50 kilos, entonces necesito un poquitoms que 3 bolsas y media (3,6). Veamos comose usa estatablaSi el metraje de muros de 20 cm me da 60 metros cuadrados y lo quiero hacer en ticholo rejilln: 60 m2 x 33= 1980 ticholos60 m2 x 0,03= 1,8 m3 de mezcla gruesa60 m2 x 3= 180 kil os de portland.

Refuerzos en los muros 12 - 1MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YME DIO AMBIENTEREFUERZOSEN LOS MUROSVEAMOS CUALES REFUERZOS HAREMOSLos muros sean d e ladrillo o bloques hay que reforzarlos para que aguanten ms y no aparezcan fisuras. Si hemos decidido construir una casa a base depilares y vigas, stas estarn diseadas para soportarlas fuerzas que se producen, y los muros sern merastapas entre ello s. Pero cuando nuestras paredes soportarn peso importante habr que reforzarlas. Algo vimos ya cuando hablamos de trabar las paredescon el mismo material o con v arillas de hierro. ESTEJ.G.BARCALARefuerzos en los muros 12 - 1MINISTERIO DE VIVIENDA, ORDENAMIENTO TERRITORIAL YMEDIO AMBIENTEREFUERZOSEN LOS MUROSVEAMOS CUALES REFUERZOS HAREMOSL os muros sean de ladrillo o bloques hay que reforzarlos para que aguanten ms y no aparezcan fisuras. Si hemos decidido construir una casa a base depilares y vigas, stas estarn diseadas para soportarlas fuerzas que se producen, y los muros sern merastapas entre ello s. Pero cuando nuestras paredes soportarn peso importante habr que reforzarlas. Algo vimos ya cuando hablamos de trabar las paredescon el mismo material o con v arillas de hierro. ESTEJ.G.BARCALA

La carrera d. hormign armad. se hace del mism. ancho que el muro, y de una altura jamsmenor de 15 cm (1 tabla de encofrado). CARRERAS Un alto adecuado sera unos 25 cm. Se le debe colocar una armadura de cuatr. hierros de 8mm. tratados, y estribos de hierro comn de 6 mm.

La armadura debe ser 1 cm m. chica de cada lado que el tama. definitivo de la carrera. Cuando se llen. el encofrado d. hormign ha. que cuidar d. que los hierro. no apoyen con. tra la madera. ENCOFRAD. Debemos mojar el encofrado antes de llenarlo con hormign. Sacaremos los encofrados laterales a los 3 das de llenado. Refuerzos en los muros 12 - .

Refuerzos en los muros 12 - 3El resultado lo multiplicaremos por la siguiente ta bla. ANCHODE LACARRERAALTODE LACARRERALARGODE LACARRERAMETROCUBICO(m3) XX= Metroscbicos dehormign 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7= bolsas de cemento portland 40 = tablas para encofrado (aproximado) 2 = kilos de clavos de 2 pulgadas 2= kilos de lambre para atar N18= Metros de hierro que habr que dividir por 6 si son varillas de seis metros o por 12si son de doce metros. =Largo de un solo estriboPara saber que material necesitamos en la construccin de una carrera haremos la siguiente cuenta: Para el hierro tendremos que metrar cada varilla y tomar en cuenta que se venden en el mercado de 6 metros y 12 metros de largo. Si dividimos el largo de la carrera entre 0,25 (la separacin entre estribos), tendremos la cantidad de estribos que necesitamos. Podemos multiplicar ese nmero por el largo de un estribo y as obtener el totalde m etros de varilla comn de 6 mm. Conviene sumarle un 10% que se irn en desperdicios ocasionados por los cortes. XPara metrar los estribos podemos tomar: Refuerzos en los muros 12 - 3El resultado lo multiplicaremos por la siguiente ta bla. ANCHODE LACARRERAALTODE LACARRERALARGODE LACARRERAMETROCUBICO(m3) XX= Metroscbicos dehormign 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7= bolsas de cemento portland 40 = tablas para encofrado (aproximado) 2 = kilos de clavos de 2 pulgadas 2= kilos de lambre para atar N18= Metros de hierro que habr que dividir por 6 si son varillas de seis metros o por 12si son de doce metros. =Largo de un solo estriboPara saber que material necesitamos en la construccin de una carrera haremos la siguiente cuenta: Para el hierro tendremos que metrar cada varilla y tomar en cuenta que se venden en el mercado de 6 metros y 12 metros de largo. Si dividimos el largo de la carrera entre 0,25 (la separacin entre estribos), tendremos la cantidad de estribos que necesitamos. Podemos multiplicar ese nmero por el largo de un estribo y as obtener el totalde m etros de varilla comn de 6 mm. Conviene sumarle un 10% que se irn en desperdicios ocasionados por los cortes. XPara metrar los estribos podemos tomar: Largo d. carrer. . . (cantida. de varillas. . 1,1. (desperdici. y ganchos.

2 veces e. alto de l. carrer. . 2 veces e. ancho de l. carrer.

La armadura de los pilares se atana la de la cimentacin haciendo unaescuadra en l a basePondremos los pilares en los ngulosde la casa y en todo otro encuentroimpor tante de muros. Los muros queno son principales podemos trabarlosusando el mismo ladrillo como yavimos. Cuando un muro es muy largo, conviene cortarlo con pilares de traba, paraque no queden paos mayores de 3 o4 metro s. Se puede levantar los muros dejandoel espacio para el pilar. En este casoconvien e dejar las puntas de estosmuros lo ms rugosas posibles, paraasegurar una buena a dherencia. TerEs ms cmodo dejar 4 patasatadas al cimiento, que sobresalganunos 40 cm; a las que ataremos luego la armadura del pilar. PILARES DE TRABALos realizaremos con 4 varillas dehierro tratado de 10, con estr ibos de 6comn cada 15 cm. La armadura de los pilares se atana la de la cimentacin haciendo unaescuadra en l a basePondremos los pilares en los ngulosde la casa y en todo otro encuentroimpor tante de muros. Los muros queno son principales podemos trabarlosusando el mismo ladrillo como yavimos. Cuando un muro es muy largo, conviene cortarlo con pilares de traba, paraque no queden paos mayores de 3 o4 metro s. Se puede levantar los muros dejandoel espacio para el pilar. En este casoconvien e dejar las puntas de estosmuros lo ms rugosas posibles, paraasegurar una buena a dherencia. TerEs ms cmodo dejar 4 patasatadas al cimiento, que sobresalganunos 40 cm; a las que ataremos luego la armadura del pilar. PILARES DE TRABALos realizaremos con 4 varillas dehierro tratado de 10, con estr ibos de 6comn cada 15 cm. minando los muros ataremos la armadura del pilar, limpiaremos la base y colo. caremos un tablero de cada lado el que podremos fijar atando uno a otro co. alambre y clavando algunas escuadras. La base del tablero deber quedar bie. firme, pues all se ejerce la mayor fuerza al llenar de hormign. Podremos sacar los encofrados a los 7 das de llenados. Refuerzos en los muros 12 - 4Los pilares tienen que estar definidosen el momento de hacer los cimientosRECORDAR

Refuerzos en los muros 12 - 5Antes de comenzar a levantar los muros, se marcan la ubicacin de las puertas yventanas sobre las vigas y carreras de loscimientos. Con el filo de la cuchara haremos unalnea en una capa de arena y cemento portland. De esta forma sabremos donde terminar la pared para dejar el hueco de la puerta. Todo hueco de ventana o puerta necesita un dintel. Este sostiene lo que queda de muro arriba de l.IMPORTANTEY para las puertasDon An astasio Cmo hago? El dintel puede ser hecho dehormign armado, de ladrillo armado, de perfil de hierro, etc. Normalmente comienza unos5 a 7 cm. arriba de la abertura, salvoque al hacerlo es t ya puesta la ventana o puerta en cuyo caso lo haremos directamente sobre ella. La diferencia que queda sirve paraacuar el marco contra el dintel concascote, are na y cemento portland. Para una puerta normal la alturausual de comenzar el dintel es a 2, 10metros, ya que 2,05 metros suele tener de alto una abertura estandar quecompremos en una barraca. Refuerzos en los muros 12 - 5Antes de comenzar a levantar los muros, se marcan la ubicacin de las puertas yventanas sobre las vigas y carreras de loscimientos. Con el filo de la cuchara haremos unalnea en una capa de arena y cemento portland. De esta forma sabremos donde terminar la pared para dejar el hueco de la puerta. Todo hueco de ventana o puerta necesita un dintel. Este sostiene lo que queda de muro arriba de l.IMPORTANTEY para las puertasDon An astasio Cmo hago? El dintel puede ser hecho dehormign armado, de ladrillo armado, de perfil de hierro, etc. Normalmente comienza unos5 a 7 cm. arriba de la abertura, salvoque al hacerlo es t ya puesta la ventana o puerta en cuyo caso lo haremos directamente sobre ella. La diferencia que queda sirve paraacuar el marco contra el dintel concascote, are na y cemento portland. Para una puerta normal la alturausual de comenzar el dintel es a 2, 10metros, ya que 2,05 metros suele tener de alto una abertura estandar quecompremos en una barraca.

22 Refuerzos en los muros 12 - 6Ponemos una primera hilada de ladrillos a la que superpondremos un morterode arena y cemento portland (3 x1). Dentro de este mortero colocaremoslas varillas de hierro segn el ancho delhueco, como indica la tabla inferior. ANCHO DE ABERTURATIPO DE HIERRO2 Varillas tratadas de 83 Varillas tratadas de 8 o2 varillas tratadas de 103 varillas tratadas de 10 o2 varillas tratadas de 123C ontinuamos el muro otra hiladams acentada con el mismo mortero, dejando las varillas tipo sandwuichDe 2 a 3 mDe 1,20 a 2 mHasta 1,20 m1Colocamos una tabla bien sujeta ala altura donde quiero comenzar el dintel, la pondremos de lado a lado del hueco. DINTEL DE LADRILLO ARMADO

Cuando trabajamos con bloques podemos usar para hacer losdinteles aquellos en rma de "U" . Le ponemos los hierrosdentro y lo llenamos dehormignLos hierros van segn el e la abertura indicada en la pgina 18. Cuando trabajamos con bloques podemos usar para hacer losdinteles aquellos en rma de "U" . Le ponemos los hierrosdentro y lo llenamos dehormignLos hierros van segn el e la abertura indicada en la pgina 18. A cada lado de una abertura hay que reforzar el muro de bloques con la col. cacin de una varilla de 10 mm. del alto del muro. Para poder colocarlo se va rompiend. el fondo del bloque en cada hilada de form. de dejar un hueco del alto del muro, al qu. llenaremos con hormign luego de puesta l. varilla.

fo anchod fo anchod

Si la ventana va a llevar cajn de cortin. se le puede dejar bigotes de hierro de 6 mm.. de la altura que ste tendr.

El frente lo haremos en base a metal des. plegado. Tendremos un bigote en cada junta d. bloque "U" del dintel. Refuerzos en los muros 12 - 7DOSIFICACION PARAEL HORMIGON3 partes de pedregullo2 partes de arena gruesa1 parte de cemento portlandHERRAMIENTAS

MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEPILARES DEHORMIGO N ARMADOVeamos como son los pilares de hormign armado. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEPILARE S DEHORMIGON ARMADOVeamos como son los pilares de hormign armado. J.G.BARCALA En los planos de estructura encontraremos los pilare. numerados con todas las medidas correspondientes para ubi.

carlos correctamente. Encontraremos a su vez las dimensione. que debern tener, como ser 15 x 40 cm. Tambin los hierros con los que debern armarse y l. altura que tendrn.

Pilares 13 - 1123456789123456789123456789123456789123456789123456789Significa qu e el pilar termina a ese nivel. Cmo losveremosdibujadosen los planos? Significa que el pilar nacea ese nivel . Significa que el pilar vienede ms abajo y contina.

Pilares 13 - 2Don Anastasio, muestre comoes eso de los ENCOFRADOSpara pilares. Comenzaremos con el primer marco a nivel de la base delpilar, a los 30 cm. podremos colocar el segundo. Luego iremos ubicndonoscada 35 a 40 cm de distancia. A la altura de encuentro conla viga haremos el corte del lateral para poder poner la tabla quehar de fondo de sta. En la base del encofrado deberemos dejar una abertura quenos permita limpiar el interior antes de llenar de hormign. Para asegurar la verticalidaddel encofrado deberemos colocarleescuadras de mader a firmementeagarradas al suelo. Las colocaremos en las 2 direcciones principales del pilar. Haremos los encofrados depilares con tableros verticales, alos que le colocaremo s marcos hechos de media tabla. ENCOFRADOPilares 13 - 2Don Anastasio, muestre comoes eso de los ENCOFRADOSpara p ilares. Comenzaremos con el primer marco a nivel de la base delpilar, a los 30 cm. podremos colocar el segundo. Luego iremos ubicndonoscada 35 a 40 cm de distancia. A la altura de encuentro conla viga haremos el corte del lateral para poder poner la tabla quehar de fondo de sta. En la base del encofrado deberemos dejar una abertura quenos permita limpiar el interior antes de llenar de hormign. Para asegurar la verticalidaddel encofrado deberemos colocarleescuadras de mader a firmementeagarradas al suelo. Las colocaremos en las 2 direcciones principales del pilar. Haremos los encofrados depilares con tableros verticales, alos que le colocaremo s marcos hechos de media tabla. ENCOFRADO

Pilares 13 - 3VEAMOS COMO COLOCAR LOS HIERROSDE UN PILARPara unirlos luego con e l resto de laarmadura. Deberemos entonces doblar los hierros en forma de cuellode botella paraque mantenganuna misma lnea. Dejar los bigoteshace que seams cmodo eltrabajo en la obra. Normalmente colocaremos 4hierros iguales segn lo que indiquen los planos, irn sujetospor los estribos, hechos en hierro ms fino que debern respetar tamao y separacin segnlos clculos del tcnico. COMO TERMINAR LOS HIERROSPara ello deberemos doblar los hierrosdel pilar en form a de "L" para poderatarlos a los de la viga de cimentacin. Deberemos introducir loshierros en la viga superior o carrera doblando laspuntas. Ataremos entonces las 2 armaduras. PATINESSi hemos dejado bigotes salientesde nuestracimentacin. DADOSSe puede dejar colocada la armaduradel pilar desde el momento en quehacemos los cimientos. Pilares 13 - 3VEAMOS COMO COLOCAR LOS HIERROSDE UN PILARPara unirlos luego con e l resto de laarmadura. Deberemos entonces doblar los hierros en forma de cuellode botella paraque mantenganuna misma lnea. Dejar los bigoteshace que seams cmodo eltrabajo en la obra. Normalmente colocaremos 4hierros iguales segn lo que indiquen los planos, irn sujetospor los estribos, hechos en hierro ms fino que debern respetar tamao y separacin segnlos clculos del tcnico. COMO TERMINAR LOS HIERROSPara ello deberemos doblar los hierrosdel pilar en form a de "L" para poderatarlos a los de la viga de cimentacin. Deberemos introducir loshierros en la viga superior o carrera doblando laspuntas. Ataremos entonces las 2 armaduras. PATINESSi hemos dejado bigotes salientesde nuestracimentacin. DADOSSe puede dejar colocada la armaduradel pilar desde el momento en quehacemos los cimientos.

Totalde hormignde pilares 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland80 = tablas para encofrado (aproximado) 2 = kilos de clavos de 2 pulgadas 2 = kilos de alambre para atarxVEAMOS COMO METRAR UN PILARTotalde hormignde pilar es 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland80 = tablas para encofrado (aproximado) 2 = kilos de clavos de 2 pulgadas 2 = kilos de alambre para atarxVEAMOS COMO METRAR UN PILAR Para metrar los pilares tomaremos laaltura de ellos desde la cara superior de la fundacin hasta la parte ms alta de la viga. Haremos entonces el metraje de un pilar dela siguiente manera: ancho x largo x altura = m3 de hormign. Obteniendo el metraje de homign de un pilar, podremos multiplicarlo porla totalid ad de los pilares iguales que tengamos. Este valor final lo multiplicaremos por los valores de abajo y obtendremos la cantidad de material necesario. Los hierros dependern de lo que nos digan los planos de estructura. De todas formas, multiplicar el total de hormign de pilares por 125 k. nos dar. una aproximacin del kilaje de hierro que tendremos que conseguirpara la obra. HERRAMIENTA. Pilares 13 - .

Vigas 14 - 1MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEVIGAS DEHORMIGON ARMADOJunto a estos dibujos se suele agregaruna tabla de datos. En st a encontraremos el tipo de viga que es, el ancho, alto y largo de la misma; el tipo dearmadura longitudinal y los estribos. V001 (15 x 40) Al nmero de viga se le suele agregar lasdimensiones en centmetros, colocando primero la base de la viga y luego la altura. (En el ejemplo: 15cm. x 40cm.). Esto indica que la viga va para arriba de lalosa de hormign. Este otro indica que la viga va para abajode la losa. V 001V 001En los planos de estructura, las vigasaparecen numeradas en el siguien te orden: de arriba hacia abajo (V001-V002)yde izquierda a derecha (V051-V052). Se las dibuja de apoyo a apoyo con 2 lneas o una con flecha en ambas puntas. J.G.BARCALAVigas 14 - 1MINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AM BIENTEVIGAS DEHORMIGON ARMADOJunto a estos dibujos se suele agregaruna tabla de datos. En sta encontraremos el tipo de viga que es, el ancho, alto y largo de la misma; el tipo dearmadura longitudinal y los estribos. V001 (15 x 40) Al nmero de viga se le suele agregar lasdimensiones en centmetros, colocando primero la base de la viga y luego la altura. (En el ejemplo: 15cm. x 40cm.). Esto indica que la viga va para arriba de lalosa de hormign. Este otro indica que la viga va para abajode la losa. V 001V 001En los planos de estructura, las vigasaparecen numeradas en el siguien te orden: de arriba hacia abajo (V001-V002)yde izquierda a derecha (V051-V052). Se las dibuja de apoyo a apoyo con 2 lneas o una con flecha en ambas puntas. J.G.BARCALA

Vigas 14 - 2Para recibir el encofrado de viga colocaremos sobre cada puntal (pre viamentecortados a medida) un par de tablas cortas de aproximadamente 1 m clavad as unaa la otra (cruceta). Estas irn escuadradas de un lado y del otro del puntal con otrasENCOFRADODescribiremos el armado de un encofrado parauna viga sencilla de bordeque soportar una losa dehormign armado. Ms adelante veremosun detalle de viga invertida. Pongamos el ojo en el clavo yveamos primero unencofrado de viga. tablas de unos 60 cm de largo. (Ver figura ala derecha). Tambin le colocaremos unos pequeosgateles (maderas finas), de unos 5 o 7 cmde anch o, clavadas a lo largo del puntal. Los puntales que estarn distanciadosentre ellos unos 90 cm., irn apoyados sobreuna tabla o tabln en el suelo. El que deber estar bien asentado. Para que el fondo de laviga se encuentre a nivel usaremos u n par decuas de madera, que solaparemos debajo decada puntal. Con ellas podremos levantarloslo que sea necesario. Verificaremos con elnivel de burbuja y una regl a o en su defectoen ambos extremos con un nivel de manga. Para conseguir este hormigncomenzaremos colocando unatabla sobre puntales. Vigas 14 - 2Para recibir el encofrado de viga colocaremos sobre cada puntal (pre viamentecortados a medida) un par de tablas cortas de aproximadamente 1 m clavad as unaa la otra (cruceta). Estas irn escuadradas de un lado y del otro del puntal con otrasENCOFRADODescribiremos el armado de un encofrado parauna viga sencilla de bordeque soportar una losa dehormign armado. Ms adelante veremosun detalle de viga invertida. Pongamos el ojo en el clavo yveamos primero unencofrado de viga. tablas de unos 60 cm de largo. (Ver figura ala derecha). Tambin le colocaremos unos pequeosgateles (maderas finas), de unos 5 o 7 cmde anch o, clavadas a lo largo del puntal. Los puntales que estarn distanciadosentre ellos unos 90 cm., irn apoyados sobreuna tabla o tabln en el suelo. El que deber estar bien asentado. Para que el fondo de laviga se encuentre a nivel usaremos u n par decuas de madera, que solaparemos debajo decada puntal. Con ellas podremos levantarloslo que sea necesario. Verificaremos con elnivel de burbuja y una regl a o en su defectoen ambos extremos con un nivel de manga. Para conseguir este hormigncomenzaremos colocando unatabla sobre puntales.

Vigas 14 - 3Luego de asegurar el fondo (1), comenzaremos a colocar los tableroslaterales (2)(3), los que llevarncostillas (4) conformadas por unatabla de canto cada 60 cm aproximadamente, irn apoyados sobre lascrucetas (5) de los puntales. Para asegurar su posicin vertical llevarn una escuadra (6) clavada en lo alto de la costilla de unlado y a la cruceta del otro. La parte inferior de las costillas irn aseguradas por un listnhorizontal clavado a las crucetas. Sobre las costillas (7) del tablero interno deberemos clavar otrolistn (8) de madera para apoyar lascostillas ( 9) que soportarn las tablas del encofrado (10) de la losa. Vigas 14 - 3Luego de asegurar el fondo (1), comenzaremos a colocar los tableroslaterales (2)(3), los que llevarncostillas (4) conformadas por unatabla de canto cada 60 cm aproximadamente, irn apoyados sobre lascrucetas (5) de los puntales. Para asegurar su posicin vertical llevarn una escuadra (6) clavada en lo alto de la costilla de unlado y a la cruceta del otro. La parte inferior de las costillas irn aseguradas por un listnhorizontal clavado a las crucetas. Sobre las costillas (7) del tablero interno deberemos clavar otrolistn (8) de madera para apoyar lascostillas ( 9) que soportarn las tablas del encofrado (10) de la losa.

1Debemos comenzar doblandolos hierros segn indican los planos, para ello usaremos la grifa cuyo tamaNOTAEs importante respetartodo lo que indican losplanos de estructura. Ya que la estabilidad dela casa depende de ello. Grifa en mano veamoscomo van los hierros1Debemos comenzar doblandolos hierros se gn indican los planos, para ello usaremos la grifa cuyo tamaNOTAEs importante respetartodo lo que indican losplanos de estructura. Ya que la estabilidad dela casa depende de ello. Grifa en mano veamoscomo van los hierros GANCHO misma viga. Mnimo 40 dimetros o depender del dimetro del hierr. que vayamos a trabajar. El doblado de la varilla se deb. hacer en fro, no se calienta a fuego. Todo hierro, salvo que indique. lo contrario los planos de estructura. debern terminar en un gancho. Si queda corta una varilla podre. mos empalmarla con otro trozo par. tener el largo indicado en los planos. En este caso deberemos solaparnos uno. 40 dimetros de la varilla que esta. mos uniendo, o sea que si tenemo. una varilla de 10 mm. solaparemo. 40 cm., con una de 8 mm. solapare. mos unos 32 cm. Conviene hacer un atado de to. dos los hierros correspondientes a un. Vigas 14 - 4

. Colocaremos las dos varilla. correspondientes a los ngulos supe. riores de la viga sobre caballetes, cu. yos apoyos sean una barra de hierr. de unos 10-12 mm. . Marcaremos sobre stas,la ubicacin indicada en los planos para los estri. bos, los que comenzaremos a distribur colgndolos de las 2 varillas, (varillas po. dentro). Una vez colocados todos en sus lugares los ataremos.

Deberemos ahora dar vuelta la armadura y colgarla de los hierros restantesSi ten emos un hierro tipo"B" o negativo, convendr ubicarlo eneste momento, lo colocarem os pordentro de los estribos y luego lo ataremos a ellos. 45 que apoyaremos en los caballetes. Hecho sto, los ataremos a los estribos. Vigas 14 - 5Repetiremos sto con cadaviga que tengamos, para noentreverarnos le co locaremosun cartelito atado con elnmero que le correspondaen el plano.

VEAMOS METRAJESDE VIGASPara tomar el largo los dospilares. Tomaremos entonces: Este valor lo deberemos multiplicar por la totalidad de vigas iguales y hacer lo mismo con aquellasque no lo De sta forma y sumando todos los valores obtendremos el metraje total de hormign que necesitaremos para construr nuestras vigas. VEAMOS METRAJESDE VIGASPara tomar el largo los dospilares. Tomaremos entonces: Este valor lo deberemos multiplicar por la totalidad de vigas iguales y hacer lo mismo con aquellasque no lo De sta forma y sumando todos los valores obtendremos el metraje total de hormign que necesitaremos para construr nuestras vigas. LARGO X ANCHO X ALTO = m3 DE UNA VIG.

de las vigaslo haremos midiendo entre

son.

de las vigaslo haremos midiendo entre

son.

Este total deberemos multiplicarlo por los siguientes valores para saber los mat e. riales que requeriremos. Metrajetotal dehormignX 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 70 = tablas para encofrado (aproximado) 2 = kilos de alambre 2 = Kilos de clavos de 2 pulgadasLa cantidad de hierro depender de lo que indique n los planos de estructura. Pero si al metraje total de hormign para vigas lo multiplicamos por115 k, tendremos una aproximacin del kilaje que necesitaremos en obra. Vigas 14 - 6HERRAMIENTAS

Vigas 14 - 7Veamos un ejemplo de una viga quetiene que soportar el peso de un te chodistancia de 3,50 m. apoyos estn separados unade hormign armado y que susNuestra viga tendr una seccin de 15 cm. de base por 35 cm. de alto. ARMADURASArmadura: en la parte baja de la vigacolocaremos 3 hierros, dos sern de 8 mm. tratados y el restante de 10 mm. tratado. De stos tres doblaremos el de 10 mm. para que sobre los apoyos tengamos mshierro en la parte de arriba de la viga. Los hierros superiores sern de 6 mm. (comn). Tendremos que hacer 14 estribos devarilla comn de 6 mm., los que separaremos 24 cm. entre s. UBICACIONDE LOSHIERROSEN LA VIGAVigas 14 - 7Veamos un ejemplo de una viga quetie ne que soportar el peso de un techodistancia de 3,50 m. apoyos estn separados unade hormign armado y que susNuestra viga tendr una seccin de 15 cm. de base por 35 cm. de alto. ARMADURASArmadura: en la parte baja de la vigacolocaremos 3 hierros, dos sern de 8 mm. tratados y el restante de 10 mm. tratado. De stos tres doblaremos el de 10 mm. para que sobre los apoyos tengamos mshierro en la parte de arriba de la viga. Los hierros superiores sern de 6 mm. (comn). Tendremos que hacer 14 estribos devarilla comn de 6 mm., los que separaremos 24 cm. entre s. UBICACIONDE LOSHIERROSEN LA VIGA

Techos 15 - 1TECHOS PESADOSTECHOS LIVIANOSComprenden estos techos aquellos de ch apa galvanizada, fibrocemento, fibra de vidrio y techos de tejas sobre estructurasde madera, hierro, etc. Comprenden estos techos los de hormign armado hechos en el sitio, aquellosde losetas de hormign prefabricadas, de bovedillas cermicas sobre viguetasde hormign, etc. De este otro grupo veremosel techo de hormign armado. De este grupoveremos lostechos de chapagalvanizada. TECHOSMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEEs hora de ver los TECHOSSepararemoslos techos en livianos y pesados. J.G.BARCALATechos 15 - 1TECHOS PESADOSTECHOS LIVIANOSComprenden estos techos aqu ellos de chapa galvanizada, fibrocemento, fibra de vidrio y techos de tejas sobre estructurasde madera, hierro, etc. Comprenden estos techos los de hormign armado hechos en el sitio, aquellosde losetas de hormign prefabricadas, de bovedillas cermicas sobre viguetasde hormign, etc. De este otro grupo veremosel techo de hormign armado. De este grupoveremos lostechos de chapagalvanizada. TECHOSMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEEs hora de ver los TECHOSSepararemoslos techos en livianos y pesados. J.G.BARCALA

Techos Livianos 16 - 1Techos livianos de chapa galvanizadaALGUNAS VENTAJAS DE UN TECHO LIVIANO O DE CHAPA-Es de rpida colocacin. -No necesita impermeabilizante. -Se consiguen coloreadas de fbricapero tambin pueden ser pintadas para darun aspec to singular al techo. -Al ser livianas permiten un buen manejo en obra. -Se cortan fcilmente con tijera dechapa o sierra. -Dependiendo del diseo que se elija, puede salvar distancias importantes casisin apoyos intermedios. -Son muy buenas para hacer sobretechos en casas de cubiertas de hormign, sto beneficia trmicamente a la vivienday tambin ayuda a evitar humedades. -Son de fcil recambio. ALGUNAS DESVENTAJAS DEUN TECHO LIVIANO DE CHAPA-Si no se hace una buena aislacintr mica por debajo de ellas, genera locales extremadamente fros en invierno ycalurosos en verano. Cuando afuera hacefro, e l calor del interior hace condensarel vapor y chorrear agua. -Con el paso del tiempo "envejecen" y pierden el zinc protector oxidndose. -Requieren un buen trato en obraya que son fciles de doblar. -Si no se respetan los solapes y elresto de ejecuciones indicadas por los tcnicos fabricantes puede pasar agua alinterior de la vivienda. -Por ser livianas corren el riesgo deser levantadas por fuertes vientos, paraevi tar sto, tienen que estar correctamentesujetadas. J.G.BarcalaMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTETECHOS LIVIANOSTechos Livianos 16 - 1Techos livianos de chapa galvanizadaALGUNAS VENTAJ AS DE UNTECHO LIVIANO O DE CHAPA-Es de rpida colocacin. -No necesita impermeabilizante. -Se consiguen coloreadas de fbricapero tambin pueden ser pintadas para darun aspec to singular al techo. -Al ser livianas permiten un buen manejo en obra. -Se cortan fcilmente con tijera dechapa o sierra. -Dependiendo del diseo que se elija, puede salvar distancias importantes casisin apoyos intermedios. -Son muy buenas para hacer sobretechos en casas de cubiertas de hormign, sto beneficia trmicamente a la vivienday tambin ayuda a evitar humedades. -Son de fcil recambio. ALGUNAS DESVENTAJAS DEUN TECHO LIVIANO DE CHAPA-Si no se hace una buena aislacintr mica por debajo de ellas, genera locales extremadamente fros en invierno ycalurosos en verano. Cuando afuera hacefro, e l calor del interior hace condensarel vapor y chorrear agua. -Con el paso del tiempo "envejecen" y pierden el zinc protector oxidndose. -Requieren un buen trato en obraya que son fciles de doblar. -Si no se respetan los solapes y elresto de ejecuciones indicadas por los tcnicos fabricantes puede pasar agua alinterior de la vivienda. -Por ser livianas corren el riesgo deser levantadas por fuertes vientos, paraevi tar sto, tienen que estar correctamentesujetadas. J.G.BarcalaMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTETECHOS LIVIANOS

Este tipo de chapa es la ms comn en los techos de viviendas, veremos luegocomo se arman estos techos. Para guardar las chapas en obra hay quehacerlo separadas del suelo y unas sobreo tras coincidiendo las canaletas. Esto evitar el deterioro de las mismasEste tipo de chapa es la ms comn en los techo s de viviendas, veremos luegocomo se arman estos techos. Para guardar las chapas en obra hay quehacerlo separadas del suelo y unas sobreo tras coincidiendo las canaletas. Esto evitar el deterioro de las mismas CARACTERISTICAS CHAPAS ACANALADAS Se encuentran en plaza varios largos que van desde LARGOS. 1,83 m. hasta pasando los 4,57 m. (a pedido). Lo. de uso ms comn son los de 1,83 - 2,13 - 2,44 m. La chapa viene de 88 cm., pero como hay que solaparANCHO. las cubren un ancho real de 80 cm. Se fabrican 2 espesores, stos influyen en los pesos . ESPESOR. tambin en la separacin necesaria entre apoyos. Techos Livianos 16 - 2ran los 105 y 115 cm., dependiendo si es una chapafina o gr uesa respectivamente. Considerando que se puede llegar a caminar sobre el DISTANCIA. techo, las separaciones mximas entre apoyos rondaENTRE APOYOS.

Techos Livianos 16 - 3Cuando debemos cubrir el largo del techo con ms de una chapa, tendremos que solaparlas con un mnimo de 30 cm. En estecaso la pendiente podr variar100 cmPara una chapa que cubre la totalidad del techoen su largo la pendientemnima estara dada por: 100 cm8 cm15 cm a20 cmLas PENDIENTES ylos solapes delas chapas estnextrctamentelig ados. Los techos inclinados pueden escurrirel agua de lluvia en forma directa, o sea cada libre o puedejuntrsela por medio de un canaln al final de lapendientePUNTOS A CUIDARCUANDO EL TECHO TIENECAIDA LIBRE: Que el agua no escurra directamenteal vecino. Que el agua no escurra sobrela puerta de entrada. Que el agua no caiga sobre unlugar de tierra ya quepodr zocavar. Techos Livianos 16 - 3Cuando debemos cubrir el largo del techo con ms de una chapa, tendremos que solaparlas con un mnimo de 30 cm. En estecaso la pendiente podr variar100 cmPara una chapa que cubre la totalidad del techoen su largo la pendientemnima estara dada por: 100 cm8 cm15 cm a20 cmLas PENDIENTES ylos solapes delas chapas estnextrctamentelig ados. Los techos inclinados pueden escurrirel agua de lluvia en forma directa, o sea cada libre o puedejuntrsela por medio de un canaln al final de lapendientePUNTOS A CUIDARCUANDO EL TECHO TIENECAIDA LIBRE: Que el agua no escurra directamenteal vecino. Que el agua no escurra sobrela puerta de entrada. Que el agua no caiga sobre unlugar de tierra ya quepodr zocavar.

Techos Livianos 16 - 4Podremos hacer las correas en diversos materiales, madera, perfil de hierro, reticuladas en hierro redondo, perfil dechapa, etc. Para una vivienda lo ms normal es el uso de correasde madera, son de fcil trabajo en obra, y suelen ser ms econmicas que las dems. Es conveniente usar madera de primera calidad. No hade ser verde para que al sec ar no se arquee, ya que necesitaremos que sea recta. Hay que cuidar de que no est apolillada yque tampoco tenga muc hos nudos, especialmente aquellos nudos pasantes o muy grandes. las paredes estn ms alejadas debemos entonces, colocar una viga en elmedio. La dim ensin de sta depender del material con que querramoshacerla. CORREASSirven para sujetar laschapas. Para apoyos entre paredes distanciadas en el orden de los2,50 m. y 3 m., podemoscolocar tirantes de maderaque vayan de una a otra. Paralograr eso nos podemos aprovechar de las paredes que separan distintos ambientes. SiDISTINTOS TIPOS DE CORREASPodremos hacer las correa s en diversos materiales, madera, perfil de hierro, reticuladas en hierro redondo, perfil dechapa, etc. Para una vivienda lo ms normal es el uso de correasde madera, son de fcil trabajo en obra, y suelen ser ms econmicas que las dems. Es conveniente usar madera de primera calidad. No hade ser verde para que al sec ar no se arquee, ya que necesitaremos que sea recta. Hay que cuidar de que no est apolillada yque tampoco tenga muc hos nudos, especialmente aquellos nudos pasantes o muy grandes. las paredes estn ms alejadas debemos entonces, colocar una viga en elmedio. La dim ensin de sta depender del material con que querramoshacerla. CORREASSirven para sujetar laschapas. Para apoyos entre paredes distanciadas en el orden de los2,50 m. y 3 m., podemoscolocar tirantes de maderaque vayan de una a otra. Paralograr eso nos podemos aprovechar de las paredes que separan distintos ambientes. SiDISTINTOS TIPOS DE CORREAS

Cmo hacemos para armar un techo liviano? Una vez que tengamos nuestras paredes levantadas o las vigas desencofradas, deberemos distribuir los tirantes de apoyo de laschapas. Las separaciones entre estos depenCmo hacemos para armar un techo liviano? Una vez que tengamos nuestras paredes levantadas o las vigas desencofradas, deberemos distribuir los tirantes de apoyo de laschapas. Las separaciones entre estos depenTechos Livianos 16 - 5separacin mxima de105 cm.105 cmmximoColocaremos primero losti rantes extremos, el del bordesuperior y el del borde inferior. Deben quedar bien nivelados. Para que ello ocurra la superficie donde stos apoyan deber ser pareja. Del primer tirante al ltimo deberemos tirar un par dehilos tensos, lo haremos de ambos extremos. Este hilo ubicar las caras superiores de todos los tirantes que deberemos colocar. Tenemos de esta formaun plano bien definidoHILOTIRANTE DE BORDE INFERIORTIRANTE DE BORDESUPERIORpara colocar. Si nos basamos en la chapa acanalada comn, y enel e spesor menor de ellas, fijaremos nuestros apoyos con unapara la ubicacin de las chapasgalvanizadas. dern de la chapa que hayamos comprado

Techos Livianos 16 - 6Colocaremos por debajo delos hilos el resto de lostirantes , respetando el plano definido por los 2 hilosy la separacin mxima deapoyos que tolera el tipode chap a que usaremos. Una vez colocados los tirantes deberemos amurarlos. Es sumamente importanteque una estructura de techoliviano se encuentre bienancla da ya que vientos fuertes tienden a levantarla. TERMINACION DE TECHO CON CANALON Y EN CAIDA LIBREComenzaremos a clavar las chapas por lafaja ms baja, siendola primera de ellasaquella que se ubique del lado opuesto dedonde vienen los vientos principales. Debemos asegurarnos que el borde interiorde las chapas sea paralelo a la pared, ya que enun trecho largo pueden torcerse fcilmente. La segunda hilada de chapas deber montarse sobre la primera y as sucesivamente. El solape se har en el orden de los30 centmetros. Si el borde inferior lleva uncanaln receptor de aguas de lluvia, deberemos fijarlo antes decomenzar a colocar las chapas. Estos debern ser colocados conuna pendiente de 1/2 centmetropor metro hacia los em budos dedesage. Si el techo tiene cada libre, conviene volar la chapa unos30 centmetros con respecto almuro exterior. Colocaremos por debajo delos hilos el resto de lostirantes, respetando el plano definido por los 2 hilosy la separacin mxima deapoyos que tolera el tipode chap a que usaremos. Una vez colocados los tirantes deberemos amurarlos. Es sumamente importanteque una estructura de techoliviano se encuentre bienancla da ya que vientos fuertes tienden a levantarla. TERMINACION DE TECHO CON CANALON Y EN CAIDA LIBREComenzaremos a clavar las chapas por lafaja ms baja, siendola primera de ellasaquella que se ubique del lado opuesto dedonde vienen los vientos principales. Debemos asegurarnos que el borde interiorde las chapas sea paralelo a la pared, ya que enun trecho largo pueden torcerse fcilmente. La segunda hilada de chapas deber montarse sobre la primera y as sucesivamente. El solape se har en el orden de los30 centmetros. Si el borde inferior lleva uncanaln receptor de aguas de lluvia, deberemos fijarlo antes decomenzar a colocar las chapas. Estos debern ser colocados conuna pendiente de 1/2 centmetropor metro hacia los em budos dedesage. Si el techo tiene cada libre, conviene volar la chapa unos30 centmetros con respecto almuro exterior.

Techos Livianos 16 - 7VEAMOS ALGUNOS DETALLESEN CASODE QUE LACORREA SEAMETALICA. ESTE ES UN EJEMPLO DE UNAGARRE DE LA CHAPA SOBREUN TIRANTE DE MADERA. CANALONTechos Livianos 16 - 7VEAMOS ALGUNOS DETALLESEN CASODE QUE LACORREA SEAME TALICA. ESTE ES UN EJEMPLO DE UNAGARRE DE LA CHAPA SOBREUN TIRANTE DE MADERA. CANALON

Cuando nuestro techo termine contra una pared, deberemos amurar una baveta de chapa galvanizada. Usaremos paraello arena y cemento fugo para evitar la entrada del agua por launin de sta con Cuando nuestro techo termine contra una pared, deberemos amurar una baveta de chapa galvanizada. Usaremos paraello arena y cemento fugo para evitar la entrada del agua por launin de sta con Cuando el techo comienza directament. desde un muro que sobresale, deberemos colo. car una pieza especial que tiene la forma de la. ondas de la chapa del techo. Esta pieza que ir. sujeta al muro para su unin con ste, deber. cubrirse con una baveta de chapa galvanizad. amurada con arena y cemento portland con hi. drfugo. Cuando tenemos en nuestro techo un. cumbrera por ser ste a 2 aguas, deberemo. usar una pieza especial para cumbrera. Ten. dremos que cuidar que el solape de estos ele. mentos no coincida con el de las chapas d. techo. Para ello cortaremos la primera cum. brera como indica el grfico, sto nos permi. tir ir desfazados con la chapa. HERRAMIENTA. Techos Livianos 16 - .

portland con hidrel muro. portland con hidrel muro.

Losa de hormign 17 - 1DETERMINACION DE ALTURADE ENCOFRADOJ.G.BARCALAbern estar del nivel defondo de losa a una separacin igual al del espesor de la tablaque usaremos para el encofrado (normalmente 2,5 cm). Para ubicar la parte altadel tirante restaremos los 15 cm. de las tablas de costillas. Estos tirantes podrn conformarsetambin con 2 tablas de encofrado de15 cm. (una al lado de la otra, clavadas). Para armar el encofrado comenzaremospor el permetro, colocando tirantes apoyados sobre puntales a medida. Sobre stos apoyaremos las costillas cada 60cm, hechas de tablas separadas entre s. La parte de arriba de las costillas deMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTELOSA DEHORMIGON A RMADOVeamos unejemplo de unalosa horizontal simpleLosa de hormign 17 - 1DETERMINA CION DE ALTURADE ENCOFRADOJ.G.BARCALAbern estar del nivel defondo de losa a una s eparacin igual al del espesor de la tablaque usaremos para el encofrado (normalmente 2,5 cm). Para ubicar la parte altadel tirante restaremos los 15 cm. de las tablas de costillas. Estos tirantes podrn conformarsetambin con 2 tablas de encofrado de15 cm. (una al lado de la otra, clavadas). Para armar el encofrado comenzaremospor el permetro, colocando tirantes apoyados sobre puntales a medida. Sobre stos apoyaremos las costillas cada 60cm, hechas de tablas separadas entre s. La parte de arriba de las costillas deMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTELOSA DEHORMIGON A RMADOVeamos unejemplo de unalosa horizontal simple Deberemos ubicar en obra la altur. del fondo de la losa, sta ser la sum. de la altura libre del techo al piso ms e. revoque de cielorraso. Ese punto ser l. ubicacin de la cara superior del encofra. do que tendremos que construir.

Empujando hacia adentro lascuas podremos levantar el encofrado. Si no existieran stas, nopodramos desencofrar la losa. De las costillas ya apoyadas colgaremos con alambre elresto de los tirantes, respetandouna separacin aprox imada a los90 o100 cm. Luego colocaremos lospuntales para apoyar esos tirantes colgados. Los puntales apoyarn sobre tablas puestas en el suelo queseguirn la direccin de los tirantes. Se usarn cuas paraajustar la altura de los mismos. Una vez colocadas todas las tablas planas podremos controlar el nivelpor medio de una regla larga y un nivelde burbuja. Lo haremos en los 2 senEmpujando hacia adentro lascuas podremos levantar el encofrado. Si no existieran stas, nopodramos desencofrar la losa. De las costillas ya apoyadas colgaremos con alambre elresto de los tirantes, respetandouna separacin aprox imada a los90 o100 cm. Luego colocaremos lospuntales para apoyar esos tirantes colgados. Los puntales apoyarn sobre tablas puestas en el suelo queseguirn la direccin de los tirantes. Se usarn cuas paraajustar la altura de los mismos. Una vez colocadas todas las tablas planas podremos controlar el nivelpor medio de una regla larga y un nivelde burbuja. Lo haremos en los 2 sentidos principales del encofrado. Para llevarlo a nivel deberemos ir ajustando la altura d. los puntales por medio de las cuas, que por ltimo las clavaremos a la tabla del pi s. para que no se deslicen. Queda an clavar las costillas a todos los tirantes que habamos colgado, l. haremos con tablitas (gateles) bien verticales. Losa de hormign 17 - 2IMPORTANTEPara asegurar toda la estructura de madera, y que no se muevan los puntales, deberemos clavar tablas en forma de "X".

Losa de hormign 17 - 3Veamos cmo solucionar un bordecon viga invertida que hace de pretil para azotea. Cuando hay que aadir un trozo de puntal a otro para llegar a la altura adecuadase har sobre la parte baja del mismo y nuca se aadir en el medio. Se har clavando 4 tablas finas como quien haceuna caja. Estas debern solapar cada trozo de puntal por lo menos 30 - 40 cm. NOTALosa de hormign 17 - 3Veamos cmo solucionar un bordecon viga invertida que hac e de pretil para azotea. Cuando hay que aadir un trozo de puntal a otro para llegar a la altura adecuadase har sobre la parte baja del mismo y nuca se aadir en el medio. Se har clavando 4 tablas finas como quien haceuna caja. Estas debern solapar cada trozo de puntal por lo menos 30 - 40 cm. NOTA

LECTURA DE PLANO. Las losas (o planchadas) son dibujadas en lo. planos con un smbolo que define su altura y el tip. de varilla de hierro que ir en cada sentido con s. correspondiente separacin. 1. Veamos cada una de esos smbolos. 1. Implica hierro tratado (no comn) de un dimetro de 1. milmetros, puede simbolizarse con un crculo con un. X por encima. Indica el el sentido en que se colocarn las varillas d. hierro. El nmero entre estas lneas define la separacin qu. debern llevar las varillas (en este ejemplo se separa. 18 cm las de 10). Este nmero en el medio del cuadrado indica el espeso. de hormign que deber llenarse (la altura del hormi. gn). Indica lo que es la losa y lo que son sus bordes de apoy. (podr ser que apoye sobre vigas, o sobre una carrera qu. est colocada sobre un muro portante). 1. Pueden graficarse otros elementos como refuerzos (hierros que se agregan e. lugares crticos), hierros que se doblan; los que van por debajo y los que van po. arriba, etc. Pero las ms comunes son las anteriormente descriptas. Losa de hormign 17 - .

Losa de hormign 17 - 5 Y los hierrosDon Anastasio? Esta graficacin indica que se colocarn2 hierros tipo "A"... Se debe respetar todo lo que plantea un plano de estructura. Las medidas de hierro colocadas estn estudiadaspara soportar los pesos por los cuales fueron diseadas. ...y luego uno de tipo "B"... ...para luego seguir con 2 de tipo "A" y as sucesivamente. 2A1BSi no se indica como debe ser el doblado del hierro tipo "B", tomaremoscomo norma comenzar a doblarlo a una distancia de la viga correspondiente ala dcima pa rte del largo que tiene que recorrer. A dems de los smbolosdescriptos anteriormente un plano puede indicar como debenser doblados los hierros y cuntos irn de cada uno. largo 5largo 5Losa de hormign 17 - 5 Y los hierrosDon Anastasio? Esta graficacin indica que se colocarn2 hierros tipo "A"... Se debe respetar todo lo que plantea un plano de estructura. Las medidas de hierro colocadas estn estudiadaspara soportar los pesos por los cuales fueron diseadas. ...y luego uno de tipo "B"... ...para luego seguir con 2 de tipo "A" y as sucesivamente. 2A1BSi no se indica como debe ser el doblado del hierro tipo "B", tomaremoscomo norma comenzar a doblarlo a una distancia de la viga correspondiente ala dcima pa rte del largo que tiene que recorrer. A dems de los smbolosdescriptos anteriormente un plano puede indicar como debenser doblados los hierros y cuntos irn de cada uno. largo 5largo 5

Losa de hormign 17 - 6Marcaremos con tiza sobre el encofrado la ubicacin de los hierros, respetaremos la separacin indicada en los planospara cada sentido de la armadura. 1La primer marca se ubicar a la distancia de una separecin con respecto al apoyo de lalosa (viga o carrera). Continuaremos con ellas hasta cubrir todoel desarrollo del encofrado. 2Colocaremos los hierros segn el orden que le corresponda, ubicandolosen cada mar ca. Se deber comenzar por aquellos hierros que indiquen los planos, si stos no dicen nada podemos pensar que por debajo irn aquellas varillas quecrucen e l lado ms corto de la losa. Si la losa es cuadrada y tiene buenos apoyosen todo su contorno, dar igual por cual hierro se comience. Si la losa solo est apoyada en dos lados loshierros principales, que sonlos que primero se ponencorr espondern a los quevayan de apoyo a apoyo. VEAMOS COMO COLOCAMOS LOS HIERROSLosa de hormign 17 - 6Marcaremos con tiza sobre el encofrado la ubicacin de los hierros, respetaremos la separacin indicada en los planospara cada sentido de la armadura. 1La primer marca se ubicar a la distancia de una separecin con respecto al apoyo de lalosa (viga o carrera). Continuaremos con ellas hasta cubrir todoel desarrollo del encofrado. 2Colocaremos los hierros segn el orden que le corresponda, ubicandolosen cada mar ca. Se deber comenzar por aquellos hierros que indiquen los planos, si stos no dicen nada podemos pensar que por debajo irn aquellas varillas quecrucen e l lado ms corto de la losa. Si la losa es cuadrada y tiene buenos apoyosen todo su contorno, dar igual por cual hierro se comience. Si la losa solo est apoyada en dos lados loshierros principales, que sonlos que primero se ponencorr espondern a los quevayan de apoyo a apoyo. VEAMOS COMO COLOCAMOS LOS HIERROS

4Una vez extendidos loshierros principales colocaremos sobre ellos los que vanen el otro sentido. Cada cruce de varilla deber ser atada con alambre dulce (N0 18 va bien), paraello deberemos usar una tenaza de herrero, ya que sta permite cortar y a su vezapreta r, tirando del alambre. La forma de terminar la atadura es retorciendo las 2punt as de alambre. 34Una vez extendidos loshierros principales colocaremos sobre ellos los que vanen el otro sentido. Cada cruce de varilla deber ser atada con alambre dulce (N0 18 va bien), paraello deberemos usar una tenaza de herrero, ya que sta permite cortar y a su vezapreta r, tirando del alambre. La forma de terminar la atadura es retorciendo las 2punt as de alambre. 3 Es conveniente atar las puntas de los hierros a la armadura del apoyo.

HERRAMIENTA.

Losa de hormign 17 - .

Losa de hormign 17 - 8Veamos quemateriales necesitamospara nuestra obraDebemos ca lcular elvolmen de hormign que necesitamos. Para ello multiplicaremos los anchos por los largos y por las alturas de cadauna de las losas que tengamos que construir. ANCHODELOSAALTODELOSALARGODELOSAxxEl volmen total de hormign deberemos multiplicarlo por cada uno de losvalores indicados en la tablainferior. Metrajetotal dehormignX 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 50 = tablas para encofrado (aproximado) 2 = kilos de alambre 2 = Kilos de clavos de 2 pulgadasLa cantidad de hierro depender de lo que indique n los planos de estructura. Pero si al metraje total de hormign para losas lo multiplicamos por60 k ., tendremos una aproximacin del kilaje que necesitaremos en obra. Losa de hormign 17 - 8Veamos quemateriales necesitamospara nuestra obraDebemos ca lcular elvolmen de hormign que necesitamos. Para ello multiplicaremos los anchos por los largos y por las alturas de cadauna de las losas que tengamos que construir. ANCHODELOSAALTODELOSALARGODELOSAxxEl volmen total de hormign deberemos multiplicarlo por cada uno de losvalores indicados en la tablainferior. Metrajetotal dehormignX 0,9 = m3 de pedregullo 0,6 = m3 de arena gruesa 7 = bolsas de cemento portland 50 = tablas para encofrado (aproximado) 2 = kilos de alambre 2 = Kilos de clavos de 2 pulgadasLa cantidad de hierro depender de lo que indique n los planos de estructura. Pero si al metraje total de hormign para losas lo multiplicamos por60 k ., tendremos una aproximacin del kilaje que necesitaremos en obra.

Observemos un ejemplo de una losa de hormign armado. Observemos un ejemplo de una losa de hormign armado. Nuestra losa de 3,5 m. por 5 m. se encuentra apoyada en todos sus lados. dar lo mismo para el ejemplo que est apoyada sobre vigas o carreras. La armare. mos con hierros tratados de 8 mm. en el sentido ms corto de la losa y hierr. tratado de 6 mm. en el largo. Colocaremos los de 8 mm. primero, para que quede. por debajo de los de 6 mm. De cada 3 hierros uno ir doblado ( hierro tipo B), esto lo haremos en ambo. sentidos. Tendremos entonces 35 varillas de 8 mm. de las cuales 12 irn levantadas en los bordes d. apoyo de la losa. Tendremos 22 varillas de 6 mm. de las cuales 7 irn levantadas en sus extremos. Mediremos entonces cada tipo de varilla para sabe. la cantidad de hierro que debemos comprar. Deberemos metrar la losa para saber las cantidades de mateiales que necesitamos.

5 m. X 3,5 m. X 0,10 m. = 1,75 m3 de hormign.

Losa de hormign 17 - 9Pedregullo1.75 X 0.9 = 1.6m3Arena gruesa1.75 X 0.6 = 1.05m3 Cemento portland1.75 X 7 = 12.25 (12 bolsas y 1/4) Alambre1.75 X 2 = 3.5 kilosClavos de 2 pulgadas1.75 X 2 = 3.5 kilosTablas3.5 X 5 X 3 = 52.5 (53) Puntales3.5 X 5 X 1 = 17.5 (18)

Aberturas 18 - 1El mercado nos permite elegir entre diversos tipos deaberturas, tanto en diseo como en material. En cuanto a material tenemos: Madera Requiere un mantenimiento de pinturaperidico, hay que protegerla de los go lpes especialmente durante la obra, conviene colocar los marcos con una mano de aceite de linaza. Aluminio No requiere mantenimiento, tiene queprotegerse del mortero durante su c olocacin, loharemos con vaselina, grasa o nylon. Plstico (PVC) No requiere mantenimiento, hay que cuidarla siempre de los golpes. Herrera comn Estn hechas con perfiles de hierro como ser "L" "T". Requiere mantenimiento de pintura peridica. Carpintera metlica Hechas con perfiles especiales de hierro o tambin enchapa doblad a. Requiere mantenimiento de pintura peridica. Hormign Se puede encontrar para vidrios fijos o con otros elementos incertosen di stinto material para lograr movilidad de hojas. Las hay slo de hormign ocombinadas con otros materiales. ABERTURASVENTANASY PUERTAS CUAL ELEGIR? J.G.BARCALAABERTURASMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIE NTEAberturas 18 - 1El mercado nos permite elegir entre diversos tipos deabertura s, tanto en diseo como en material. En cuanto a material tenemos: Madera Requiere un mantenimiento de pinturaperidico, hay que protegerla de los go lpes especialmente durante la obra, conviene colocar los marcos con una mano de aceite de linaza. Aluminio No requiere mantenimiento, tiene queprotegerse del mortero durante su c olocacin, loharemos con vaselina, grasa o nylon. Plstico (PVC) No requiere mantenimiento, hay que cuidarla siempre de los golpes. Herrera comn Estn hechas con perfiles de hierro como ser "L" "T". Requiere mantenimiento de pintura peridica. Carpintera metlica Hechas con perfiles especiales de hierro o tambin enchapa doblad a. Requiere mantenimiento de pintura peridica. Hormign Se puede encontrar para vidrios fijos o con otros elementos incertosen di stinto material para lograr movilidad de hojas. Las hay slo de hormign ocombinadas con otros materiales. ABERTURASVENTANASY PUERTAS CUAL ELEGIR? J.G.BARCALAABERTURASMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIE NTE

VEAMOS ENTONCES ALGUNOS SISTEMAS DE VENTANA. VENTANA BATIENTE: permite una ventilacin total de. hueco de la ventana. Se le puede colocar cualquier tipo d. proteccin exterior como ser cortina de enrollar, postign. etc. Permite la limpieza fcil de los vidrios sin tener qu. salir. Lo que se hace difcil es dejar una endija peque. abierta para invierno o das de lluvia. VENTANA TABAQUERA: muy comn en baos, per. mite una ventilacin buena, ayuda a generar circulacin d. aire alta. Es posible colocarla fuera del alcance de la mano. ya que se la puede manejar a distancia por medio de u. comando a simpln. Como suele colocarse alta, se hac. difcil la limpieza de la cara exterior del vidrio. VENTANA BALANCIN: permite un buen control de l. ventilacin. Se puede mantener abierta an estando llovien. do. Ayuda a generar una circulacin de aire alta. Permit. una fcil limpieza del vidrio. No es posible colocar cortin. de enrollar, ni postign de proteccin. VENTANA CORREDIZA: permite un buen control de l. ventilacin. Acepta cualquier tipo de proteccin. Permit. hacer ventanas de grandes dimensiones de fcil solucin. Pero el problema radica en que no se puede abrir ms qu. la mitad de la ventana, aunque ambas hojas sean mviles. VENTANA DE GUILLOTINA: permite una buena ven. tilacin y control de la misma. Acepta cualquier tipo d. proteccin. Son de difcil limpieza, hay que limpiar un. cara desde el exterior. Como en el caso de la corrediza, sol. queda abierta la mitad de la ventana. Aberturas 18 - .

VEAMOS ENTONCES ALGUNOS SISTEMAS DE PUERTA. PUERTA BATIENTE COMUN: es la normal en tod. vivienda. Las hay para exterior (puerta de entrada), y d. interiores. Existe una gran gama de diseos y precios. La. exteriores tienen que ser resistentes a la intemperie. La. hay de hoja derecha (si al empujar abren a la derecha), . izquierdas (si al empujar abren a la izquierda). PUERTA VAIVEN: es una puerta de uso comunment. interior, salvo en locales pblicos. Abre para cualquiera d. los dos lados, no tiene tope. No es una puerta normal par. vivienda, si no tiene buenos herrajes (bisagras de giro). termina golpeando contra el marco. PUERTA CORREDIZA: La hoja de la puerta corre col. gada por una gua metlica. Sirve para aquellos lugares qu. no hay lugar para el movimiento de una hoja de puert. normal. Si la gua no est puesta entre dos muros, tendre. mos el problema de que no podremos recostar nada sobr. la pared en el sitio que corre la hoja. PUERTA PLEGABLE: son ideales para aquellos lugare. en que ni siquiera podemos poner las corredizas, ya qu. quedan en el mismo ancho del muro. La hoja se plieg. corriendo colgada de un riel. Son puertas interiores. PUERTA PIVOTANTE: es una puerta tpicamente exte. rior, el eje por el cual gira est alejado del borde de la hoja. No es comn en viviendas unifamiliares.

Aberturas 18 - .

Aberturas 18 - 4Si podemos regular la apertura de una ventana podremosregular la fuerza del aire que circula.NOTA Cmo conviene ventilar, don Anastasio? Aberturas 18 - 4Si podemos regular la apertura de una ventana podremosregular la fuerza del aire que circula.NOTA Cmo conviene ventilar, don Anastasio? Cuando hablamos de un. ventilacin natural, el efecto d. enfriamiento es consecuencia d. la direccin y velocidad de la rfa. ga de aire que cruza la casa. Por supuesto, influye mu. cho que podamos proteger la ven. tana para evitar la entrada de so. (acero, cortina de enrollar, celo. cas, etc). Para favorecer la circulaci. de aire en un local es convenient. colocar aberturas en lados opues. tos. Esto genera una rfaga de air. cruzada que en cierto grado pode. mos dirigirla segn la ventana qu. se elija. Por ejemplo: una ventan. tabaquera eleva la rfaga de aire.

VEAMOS COMO HACER EN OBRAJ.G.BARCALALos sitios donde van a irlas aberturas se de benmarcar en el cimientoantes de levantarlos muros. Lo haremos sobre unacapa de arena yportland. VEAMOS COMO HACER EN OBRAJ.G.BARCALALos sitios donde van a irlas aberturas se de benmarcar en el cimientoantes de levantarlos muros. Lo haremos sobre unacapa de arena yportland. De esa forma no coloca. remos pared donde va un. puerta. Las aberturas pueden co. locarse a medida que se levan. ta el muro, o despus, segn e. tipo de material con que est. construda. Por ejemplo, una d. aluminio es prefererible amurar. la al final para cuidar que el cemento o la cal no la ataquen. Lo mismo convendr . hacer con el plstico y con las de perfiles de hierro.

MARCOS DE MADER. Deberemos marcar sobre lo. marcos el nivel donde estar el pis. terminado, como tambin 1 metro co. respecto a ste. Esta marca deber. coincidir con la que habr en la obra. Aberturas 18 - .

Marco tipotirante, ubicadoa plomo interior. Marco tipo cajn, ocupa todo elespesor del muro. Debemos ubicar la parte inferiordel marco, lo alinearemos con el muropor medio d e un hilo que pasar por losmontantes del marco. Si no se ha levantado la pared an, este hilo tambin servir para su replanteo . Deberemos definir segn el marco que tengamos la ubicacin de stedentro del espesor del muro. Marco tipotirante, ubicadoa plomo interior. Marco tipo cajn, ocupa todo elespesor del muro. Debemos ubicar la parte inferiordel marco, lo alinearemos con el muropor medio d e un hilo que pasar por losmontantes del marco. Si no se ha levantado la pared an, este hilo tambin servir para su replanteo . Deberemos definir segn el marco que tengamos la ubicacin de stedentro del espesor del muro. Aberturas 18 - 6NOTA IMPORTANTESi la pared est correctamenteaplomada: Para un revoque de 2 capas, laprimera de mezcla gruesa y la ltimade mezcla fina, consideraremos 1,5 cm. Para un azulejo y su mortero de toma, consideraremos 3 cm. Cunto ocupa un revoque o unazulejo? Cuando colocamos el marco en su lugar de. bemos considerar el futuro revoque o azu. lejo. Slo as podr quedar este en el mis. mo plano que el revoque.

Aberturas 18 - 7 COMO SE REPLANTEA UN PLANO DE REVOQUE? De uno de los lados de la pared debemos colocarprximo al techo un taquito de made ra, amurado conmezcla gruesa cuya superficie diste de la pared una distancia igual que el espesor del revoque. Usando una plomada colocaremos prximo al pisootro taco de madera. Si se hace bien , los tacos quedarnexctamente a igual distancia con respecto al muro. Repetiremos este proceso del otro lado de la pared. Una vez colocados los cuatro tacos de madera, quedar definido el plano de terminacin del revoque. Si tiramoshilos entre ellos podremos ubicar exactamente el marco. Aberturas 18 - 7 COMO SE REPLANTEA UN PLANO DE REVOQUE? De uno de los lados de la pared debemos colocarprximo al techo un taquito de made ra, amurado conmezcla gruesa cuya superficie diste de la pared una distancia igual que el espesor del revoque. Usando una plomada colocaremos prximo al pisootro taco de madera. Si se hace bien , los tacos quedarnexctamente a igual distancia con respecto al muro. Repetiremos este proceso del otro lado de la pared. Una vez colocados los cuatro tacos de madera, quedar definido el plano de terminacin del revoque. Si tiramoshilos entre ellos podremos ubicar exactamente el marco.

Aberturas 18 - 8Queda ahora nivelar elmarco con respecto a la marca de 1 metro sobre el nivelde piso terminando. Deberncoincidir ambas marcas, lad el marco y la de la pared. Para lograr sto nosaprovecharemos de cuas demadera con las que levantaremos el marco lo necesario. Nos queda nivelar el marco usando la plomada comoindica el dibujo. En ambas dire cciones, para asegurarnosque quede bien aplomado. NOTA: Jams deber sacarse las escuadras de un marcohasta que est amurado. Usaremos arena y cemento portland (3x1) para amurar el marco a la pared. Para lograrlo, stos debern tenergrapas (ganchos) que qued arn dentro del muro. Asegurando as una correcta adherencia. Las hojas de las aberturas las deberemos colocar alfinal, pero antes que pintemo s, para ya tenerlasajustadas. HERRAMIENTASAberturas 18 - 8Queda ahora nivelar elmarco con respecto a la marca de 1 metro sobre el nivelde piso terminando. Deberncoincidir ambas marcas, lad el marco y la de la pared. Para lograr sto nosaprovecharemos de cuas demadera con las que levantaremos el marco lo necesario. Nos queda nivelar el marco usando la plomada comoindica el dibujo. En ambas dire cciones, para asegurarnosque quede bien aplomado. NOTA: Jams deber sacarse las escuadras de un marcohasta que est amurado. Usaremos arena y cemento portland (3x1) para amurar el marco a la pared. Para lograrlo, stos debern tenergrapas (ganchos) que qued arn dentro del muro. Asegurando as una correcta adherencia. Las hojas de las aberturas las deberemos colocar alfinal, pero antes que pintemo s, para ya tenerlasajustadas. HERRAMIENTAS

Revoques 19 - 1REVOQUE EXTERIOR - 3 CAPASEste revoque se hace as: 1er Capa - Arena y cemento portland(3x1), con hidrfugo segn indicacionesde fbrica. Esta capa es impermeable, evita que se moje la pared. Esta capa tiene que ser bien cuchareada(apretada con la cuchara), no puede quedar ningn agujerito. Se termina con unaazotada de mezcla gruesa media lquida. Si sta no se da, la siguiente capano agarrar. Esta azotada tiene que cubrir la superficie completa, se da con lacuchara, salpicando la pared. 2da. Capa - Mezcla gruesa ms cemento portland (5 partes de mezcla ms1/2 parte de cemento portland). Si lapared e st bien, con 1 cm. de gruesaser suficiente. Se aplica con cuchara deabajo hacia ar riba. Comenzaremos por laparte alta del muro. Se emparejar conla regla (madera de recha o perfil de aluminio), y de ser necesario con fratachode madera. 3ra. Capa - Mezcla fina y cemento portland (1/2 de cemento). Esta capa es laterminacin, se fratacha para dar unasuperf icie lisa. Se puede variar, para lograr distintos efectos estticos. Puededarse un balai (queda a pinchitos), etc, etc. Los revoques ms comunes son los quese usan para exteriores e interiores. Dependiendo del tipo de revoque, encontraremos variacin en sus capas. REVOQUESMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEVAMOS ARE VOCARJ.G.BARCALARevoques 19 - 1REVOQUE EXTERIOR - 3 CAPASEste revoque se hace as: 1er Capa - Arena y cemento portland(3x1), con hidrfugo segn indicacionesde fbrica. Esta capa es impermeable, evita que se moje la pared. Esta capa tiene que ser bien cuchareada(apretada con la cuchara), no puede quedar ningn agujerito. Se termina con unaazotada de mezcla gruesa media lquida. Si sta no se da, la siguiente capano agarrar. Esta azotada tiene que cubrir la superficie completa, se da con lacuchara, salpicando la pared. 2da. Capa - Mezcla gruesa ms cemento portland (5 partes de mezcla ms1/2 parte de cemento portland). Si lapared e st bien, con 1 cm. de gruesaser suficiente. Se aplica con cuchara deabajo hacia ar riba. Comenzaremos por laparte alta del muro. Se emparejar conla regla (madera de recha o perfil de aluminio), y de ser necesario con fratachode madera. 3ra. Capa - Mezcla fina y cemento portland (1/2 de cemento). Esta capa es laterminacin, se fratacha para dar unasuperf icie lisa. Se puede variar, para lograr distintos efectos estticos. Puededarse un balai (queda a pinchitos), etc, etc. Los revoques ms comunes son los quese usan para exteriores e interiores. Dependiendo del tipo de revoque, encontraremos variacin en sus capas. REVOQUESMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEVAMOS ARE VOCARJ.G.BARCALA

Revoques 19 - 2para cubrir las imperfecciones. RECORDEMOS: REVOQUE INTERIOR - 2 CAPAS Don Anastasio, los revoques lo vamos areplantear como hicimos cunado vimos lasabe rturas? Revoques 19 - 2para cubrir las imperfecciones. RECORDEMOS: REVOQUE INTERIOR - 2 CAPAS Don Anastasio, los revoques lo vamos areplantear como hicimos cunado vimos lasabe rturas? Est constitudo por dos capas, una primera con mezcla gruesa y otra con fina. la diferencia con los revoques para exteriores es que carecen de la capa hidrfuga , . que la fina usa menos cemento portland (1/4 de cemento). Primero deberemos hacer do. fajas de revoque verticales. Estas . rectas conformarn un plano de revo. Para hacer una faja colocaremos un taquit. de madera prximo al techo, ste tendr la altur. del espesor de la capa gruesa de revoque. Est. espesor depender de que tan a plomo est la pa. red; cuanto ms perfecta la hayamos levantado. ms fina ser la capa de revoque. Si la pared est muy torcida deberemos i. cargndola con mezcla de a poquito, para que n. se raje y desprenda. Que los muros queden fuer. de plomo genera un gasto de mezcla innecesario. y una prdida de tiempo importante muchas vece. es necesario aplacar cascotes de ladrillo o ticholo.

Revoques 19 - 3Para poder revocar una pared, hay que mojarla previamente. Esoevitar que se chupe el agua de lamezcla y sta term ine cayendo. Lapared no debe quedar chorreando, esbueno mojarla con una pincelet a. Deberemos ir cargando el muro de abajo para arriba, de forma que la mezclaya apl icada de apoyo a la que vayamos a colocar. Pero cubriremos el muro comenzando por la parte de arriba, de modo de no estropear el trabajo realizado. Una vez cargada la pared entrelas 2 fajas, pasaremos una reglapor ellas en forma de zig-zag (conviene en posicin inclinada). El revoque que vaya quedando lo har siempre con el mismo espesor (elque hemos dado a las fajas). El material que sobre con elpaso de la regla lo devolveremos albalde. Arrojar mezcla sobre la paredgenera un desperdicio importante, ya que cae bastante al suelo. Si colocamos antes una tabla en el piso contra el muro, podremos recuperar buena parte de ste. Para pegar la mezcla a la pared hayque arrojarla con la cuchara de una distancia muy cercana; para ello usaremosun giro de mueca. Revoques 19 - 3Para poder revocar una pared, hay que mojarla previamente. Esoevitar que se chupe el agua de lamezcla y sta term ine cayendo. Lapared no debe quedar chorreando, esbueno mojarla con una pincelet a. Deberemos ir cargando el muro de abajo para arriba, de forma que la mezclaya apl icada de apoyo a la que vayamos a colocar. Pero cubriremos el muro comenzando por la parte de arriba, de modo de no estropear el trabajo realizado. Una vez cargada la pared entrelas 2 fajas, pasaremos una reglapor ellas en forma de zig-zag (conviene en posicin inclinada). El revoque que vaya quedando lo har siempre con el mismo espesor (elque hemos dado a las fajas). El material que sobre con elpaso de la regla lo devolveremos albalde. Arrojar mezcla sobre la paredgenera un desperdicio importante, ya que cae bastante al suelo. Si colocamos antes una tabla en el piso contra el muro, podremos recuperar buena parte de ste. Para pegar la mezcla a la pared hayque arrojarla con la cuchara de una distancia muy cercana; para ello usaremosun giro de mueca.

Revoques 19 - 4FORMA DE MOVER ELFRATACHOFORMA DE APLICAR LAMEZCLA CON LA CUCHARA Y con la fina, DonAnastasio, cmohacemos? La colocaremos sobre lagruesa una vez que stahaya secado. Comenzaremos de lo alto de lapared, hacia abajo para no estropear loya hecho, au nque la aplicaremos deabajo para arriba. Esta ltima capa derevoque habr de ser fin a (1/2 cm.), ydeberemos fratacharla para que quedelisa y pareja, sin ondulacione s. Para comprobar que est quedando bienpodemos usar una luz rasante. Si la ltima fratachada la hacemos con unaesponja mejoraremos su terminacin. Antes de comenzar tenemos que mojar nuevamente la pared. Deberemosaplicar la mez cla fina por medio de la cuchara (sin arrojarla), lo haremos conla parte de abaj o de sta. Para ayudarnos usaremos el fratacho para sosteneruna cantidad de mezcla como para 2, 3 o 4 cucharadas de material. Revoques 19 - 4FORMA DE MOVER ELFRATACHOFORMA DE APLICAR LAMEZCLA CON LA CUCHARA Y con la fina, DonAnastasio, cmohacemos? La colocaremos sobre lagruesa una vez que stahaya secado. Comenzaremos de lo alto de lapared, hacia abajo para no estropear loya hecho, au nque la aplicaremos deabajo para arriba. Esta ltima capa derevoque habr de ser fin a (1/2 cm.), ydeberemos fratacharla para que quedelisa y pareja, sin ondulacione s. Para comprobar que est quedando bienpodemos usar una luz rasante. Si la ltima fratachada la hacemos con unaesponja mejoraremos su terminacin. Antes de comenzar tenemos que mojar nuevamente la pared. Deberemosaplicar la mez cla fina por medio de la cuchara (sin arrojarla), lo haremos conla parte de abaj o de sta. Para ayudarnos usaremos el fratacho para sosteneruna cantidad de mezcla como para 2, 3 o 4 cucharadas de material.

Revoques 19 - 5Es mucho ms fcil dar vueltas a lamanibela de la mquina, la que podem os conseguir en cualquier barraca, pinturera oferretera. El Balai se puede aplicar sobre una capade mezcla gruesa, tambin podemos proyectarlo directamente sobre el ladrillo o bloque. Es muy comn su uso en exteriores. Otra versin que puede ser ms adecuada para muros interiores es la de planchar con una llana las puntitas dejadas porel Balai. Otra posibilidad un tanto ms rstica que la anterior podra ser el dar unaazotada de revoque para luego plancharla por medio de regla y fratacho. BALAIEl Balai puede hacerse a mano o a mquina. En forma manual, tendremosque moja r una pinceleta con mezcla (fina o gruesa), y cemento portland. Prximoa la pared procederemos a golpearla contra un palo, proyectando de esa forma elmortero. No es necesario quedarnos con una paredlisa, hay otras terminaciones. Revoques 19 - 5Es mucho ms fcil dar vueltas a lamanibela de la mquina, la que podem os conseguir en cualquier barraca, pinturera oferretera. El Balai se puede aplicar sobre una capade mezcla gruesa, tambin podemos proyectarlo directamente sobre el ladrillo o bloque. Es muy comn su uso en exteriores. Otra versin que puede ser ms adecuada para muros interiores es la de planchar con una llana las puntitas dejadas porel Balai. Otra posibilidad un tanto ms rstica que la anterior podra ser el dar unaazotada de revoque para luego plancharla por medio de regla y fratacho. BALAIEl Balai puede hacerse a mano o a mquina. En forma manual, tendremosque moja r una pinceleta con mezcla (fina o gruesa), y cemento portland. Prximoa la pared procederemos a golpearla contra un palo, proyectando de esa forma elmortero. No es necesario quedarnos con una paredlisa, hay otras terminaciones.

REVOQUE A LA BOLSAREVOQUE A LA BOLSA Este tipo de revoque suele usarse sobre una base de ladrillo, permite que l. forma de stos sea vista. Para su ejecucin basta con pasar un trapo sobre el muro recin hecho, exten. diendo el mortero sobrante de las juntas (por lo que no hay que retirarlo cuando s. colocan los ladrillos). Este tipo de revoqu. es econmico y rpido d. hacer, pero es totalemt. rstico. Todo revoque co. mucha rugosidad es m. adecuado para exteriore. que para interiores, y. que acumula mucho pol.

GRUESA FRETACHADA CONTERMINACION EN CAL EN PASTA Este tipo de revoque evita la capa d. mezcla fina. Ha de fratacharse bien la superfi. cie de la capa de mortero grueso. Sobre ell. aplicaremos cal en pasta por medio de una lla. na. La cal tapar los poros dejados por la are. na gruesa de la mezcla y la superficie resultan. te ser algo parecido a una superficie endud. (no tan perfecta). Revoques 19 - .

ALGUNAS COSAS PARA TOMAR EN CUENTA. Antes de comenzar a revocar, tenemos quehaber colocado los caos de elctrica, sanit aria, etc. Como as los tacos de madera para la colocacin dezcalos, de sta forma evitaremos los parches. ALGUNAS COSAS PARA TOMAR EN CUENTA. Antes de comenzar a revocar, tenemos quehaber colocado los caos de elctrica, sanit aria, etc. Como as los tacos de madera para la colocacin dezcalos, de sta forma evitaremos los parches. Todo cao de hierro habr que protegerlo con arena y cemento portland, ya qu. la cal los deteriora, los de plomo los cubriremos con papel o nylon. Se debe recordar retirar los bolines antes de aplicar la capa de revoque fina. La segunda capa de revoque fina se puede aplicar cuando la capa de revoqu. gruesa haya secado un poco. Si tenemos una superficie de hormign deberemos dar una azotada de arena . cemento portland chirla (3x1 - 4x1), para obtener as una pared rugosa donde pode. prender el revoque. La aplicacin de un mortero de mezcla o arena y cemento portland ha de ser co. firmeza, para que no caiga. Colocar los bolines prximos al techo y a un mismo nivel nos permitir replantea. el revoque del techo. Para ello colocamos los bolines de ambos extremos del muro . con un hilo replanteamos los otros intermedios. Las fajas no podrn se hechas hasta que no haya endurecido el mortero de lo. bolines, y no podremos cargar entre fajas hasta que stas no hayan endurecido (par . poder pasar la regla correctamente). Si va a pasar tiempo entre una capa y otra de revoque conviene peinar la mezcl. para dar adherencia a la capa. Toda superficie a la que se le vaya a proyectar un mortero, ha de estar libre d. polvo. A la capa de mezcla fina conviene humedecerla para que no raje el material . Revoques 19 - 7seque parejo. Si se quiere una terminacin bien lisa se usar una lla na (fratachometlico).

VEAMOS LAS CANTIDADES DE MATERIALES QUENECESITAMOSVEAMOS LAS CANTIDADES DE MATER IALES QUENECESITAMOS Debemos hallar las reas totales de las paredes que tenemos que revocar. Par. ello haremos en todas ellas: ancho altura . Sumaremos todas las superficie. para multiplicar luego por los valores de las tablas de ms abajo. REVOQUE EXTERIOR CON HIDROFUGO 3 CAPA. Metros cuadrado. de muro exterio. a revoca. . 0,0. = m3 de mezcla grues. 0,00. = m3 de mezcla fin. 7,. = kilos de cemento porltan. 0,0. = m3 de arena grues. 0,. = litros de hidrfug. Revoques 19 - 8HERRAMIENTASREVOQUE INTERIOR 2 CAPAS0,02= m3 de mezcla gruesa0,00 5= m3 de mezcla fina3= kilos de cemento porltandXMetros cuadradosde muro interio ra revocar

Azulejos 20 - 1Colocaremos ahora 2 pendicolas (alambresatados a 2 puntas), que d ebern estar bien aplomadas y debern rozar la superficie de los azulejos. Podremos ahora atar un hilo a 2 ganchitoshechos con alambre. Este hilo lo haremo s correrpor los alambres, definiendo el plano de la paredterminada, o sea la sup erficie exterior del azulejoo cermica. Si lo ponemos horizontal tendremos elcontrol de cada hilada. HABLEMOS DELOS AZULEJOSEl mtodo nosservir para cualquiercermicaColocar cermica o azu lejo es caro, por eso es conveniente usarlo en lugares donde hayamucha humedad y tenga posibilidades de mancharse (baos, cocinas, lavaderos). J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEAZULEJ OSREPLANTEOPara que el azulejo quede bien, es conveniente comenzar replanteando el plano de la paredterminada. Lo haremos tal como lo hicimos conlos revoques. Deberemos definir 4 puntos, los que podrn ser hechos aprovechando un azulejo ya quenos dar el espacio necesario para azu lejar. Azulejos 20 - 1Colocaremos ahora 2 pendicolas (alambresatados a 2 puntas), que d ebern estar bien aplomadas y debern rozar la superficie de los azulejos. Podremos ahora atar un hilo a 2 ganchitoshechos con alambre. Este hilo lo haremo s correrpor los alambres, definiendo el plano de la paredterminada, o sea la sup erficie exterior del azulejoo cermica. Si lo ponemos horizontal tendremos elcontrol de cada hilada. HABLEMOS DELOS AZULEJOSEl mtodo nosservir para cualquiercermicaColocar cermica o azu lejo es caro, por eso es conveniente usarlo en lugares donde hayamucha humedad y tenga posibilidades de mancharse (baos, cocinas, lavaderos). J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEAZULEJ OSREPLANTEOPara que el azulejo quede bien, es conveniente comenzar replanteando el plano de la paredterminada. Lo haremos tal como lo hicimos conlos revoques. Deberemos definir 4 puntos, los que podrn ser hechos aprovechando un azulejo ya quenos dar el espacio necesario para azu lejar.

Azulejos 20 - 2Este mtodo permite colocar el piso por debajodel azulejo. Una vez colocado el pavimento podremospegar la primera hilada de azulejos. Para colocar una cermica o azulejo es necesario sumergirlo previamente en agua por unbuen rato. Tomando un azulejo con la mano colocaremos el mortero hecho en base a mezcla fina (6) y cemento portland (1) en laparte de atrs de ste. Lo haremos con lacu chara. Lo ubicaremos sobre la madera ajustndolo contra la pared. Terminaremos el procedimiento con unos golpecitos delmang o de la cuchara. Seguiremos as hasta terminar la hilada. El hilo nos ayudar a que todos los azulejos se mantengan en el mismo plano, pero de igual formadebe mos ir controlando la verticalidad con plomada o nivel de burbuja. DeberemosNo c onviene colocar la primer hilada de azulejos si no tenemos hecho elpiso. Por esa razn se suele ubicar unatabla o regla, cuya superficie superiorcoincida con el inicio del segundo azulejo. Esta regla servir de apoyo a la segunda hilada. cuidar expresamente que no queden dientes, ya que la diferencia aumentar conlas siguientes hiladas de azulejos. Hay que cuidar de que el materialquede distribudo en forma pareja portodo el azul ejo. Si no es as, una vezcolocados, si reciben un golpe puedenromperse. NOAzulejos 20 - 2Este mtodo permite colocar el piso por debajodel azulejo. Una ve z colocado el pavimento podremospegar la primera hilada de azulejos. Para colocar una cermica o azulejo es necesario sumergirlo previamente en agua por unbuen rato. Tomando un azulejo con la mano colocaremos el mortero hecho en base a mezcla fina (6) y cemento portland (1) en laparte de atrs de ste. Lo haremos con lacu chara. Lo ubicaremos sobre la madera ajustndolo contra la pared. Terminaremos el procedimiento con unos golpecitos delmang o de la cuchara. Seguiremos as hasta terminar la hilada. El hilo nos ayudar a que todos los azulejos se mantengan en el mismo plano, pero de igual formadebe mos ir controlando la verticalidad con plomada o nivel de burbuja. DeberemosNo c onviene colocar la primer hilada de azulejos si no tenemos hecho elpiso. Por esa razn se suele ubicar unatabla o regla, cuya superficie superiorcoincida con el inicio del segundo azulejo. Esta regla servir de apoyo a la segunda hilada. cuidar expresamente que no queden dientes, ya que la diferencia aumentar conlas siguientes hiladas de azulejos. Hay que cuidar de que el materialquede distribudo en forma pareja portodo el azul ejo. Si no es as, una vezcolocados, si reciben un golpe puedenromperse. NO

Como es difcil que entre unnmero entero de azulejos enuna pared, hay que pensar do ndequeremos que queden los cortes. Una vez terminada una pared iremos ala otra, repitiendo el procedimiento. Por ltimo haremos la lechada, que terminar cubriendo las juntas de los azulejos. Esta capase hace con cemento portland blanco y carbonato (enel caso de cermica o azulejo blanco). Al cemento portland le agregamos tierraComo es difcil que entre unnmero entero de azulejos enuna pared , hay que pensar dondequeremos que queden los cortes. Una vez terminada una pared iremos ala otra, repitiendo el procedimiento. Por ltimo haremos la lechada, que terminar cubriendo las juntas de los azulejos. Esta capase hace con cemento portland blanco y carbonato (enel caso de cermica o azulejo blanco). Al cemento portland le agregamos tierra de color para aquellos azulejos o cermicas de color. El agregado que le ponga. mos al cemento no podr exceder el 50 % (mitad y mitad). QUE MATERIALES NECESITAMOS? Debemos metrar las paredes tal comohicimos en el momento que trabajamos conlos r evoques. Mediremos entonces ancho y altura hasta donde vamos a revestir las paredes. Encontraremos el rea de cada una ( area = ancho x alto ) yterminamos hallando el rea total al sumar todas las pareMultiplicaremos esa superficie total, por los valoresabajo indicados para obtene r los materiales necesarios. Azulejos 20 - 3 1=m2 de azulejo o cermica (45 azulejos) 0,03=m3 de mezcla fina 3=kilos de cemento portland gris 0,5=kilos de cemento porrtland blanco 0,05=kilos de carbonato o tierra de colorSuperficietotal en m2x

! "

$!

&

'

$ (

" &

"

! "

$!

&

'

$ (

" &

"

+ ,

-%

" (

&

% #

# %

&

% ! "

%$

&

% #

& " *

, "

-%

, " -

+ ,

-%

" (

&

% #

# %

&

% ! "

%$

&

% #

& " *

, "

-%

, " -

( !

, -% # $

! "

/0 1%1+20 !

20

1%130 /20

/0 1%1+20 20

42 5/

"

& "

7 #

( !

, -% # $

! "

/0 1%1+20 !

20

1%130 /20

/0 1%1+20 20

42 5/

"

& "

7 #

Agua corriente 22 - 1consultar con los vecinos para saber sitienen problemas con el suministro, comoquedarse sin agua o con poca agua en lacanilla en determinad a hora del da. A toda rosca deberemosponerle cinta de tefln o camo, los que enrollaremos ensentido contrario a la rosca, para que no se salga, eso evitar que se escape el agua. IMPORTANTEEl agua queentrega O.S.E. no tiene lamisma presinen todos lados. Es convenienteSi existe ese problema convieneponer untanque deagua. Comenzaremosprximo a la lnea del prediocon un trozo decaito (niple), al que le colocaremos unallave de pas o. Ah ser donde O.S.E. conectar el contador. Continuaremos enroscando uncao de 1/2 pulgada a la llave de pasopara luego coloca r una canilla. Veamos una instalacin usual (de1/2 pulgada) en viviendas, en que lapresin es corre cta sin necesidad decolocar un tanque de agua. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEAGUACO RRIENTEHablaremos sobre las instalaciones en plstico, pues sonfciles de realizar ya que norequieren de herramientas complicadas ni caras. Hablaremos sobre las instalaciones en plstico, pues sonfciles de realizar ya que norequieren de herramientas complicadas ni caras. Agua corriente 22 - 1consultar con los vecinos para saber sitienen problemas con el suministro, comoquedarse sin agua o con poca agua en lacanilla en determinad a hora del da. A toda rosca deberemosponerle cinta de tefln o camo, los que enrollaremos ensentido contrario a la rosca, para que no se salga, eso evitar que se escape el agua. IMPORTANTEEl agua queentrega O.S.E. no tiene lamisma presinen todos lados. Es convenienteSi existe ese problema convieneponer untanque deagua. Comenzaremosprximo a la lnea del prediocon un trozo decaito (niple), al que le colocaremos unallave de pas o. Ah ser donde O.S.E. conectar el contador. Continuaremos enroscando uncao de 1/2 pulgada a la llave de pasopara luego coloca r una canilla. Veamos una instalacin usual (de1/2 pulgada) en viviendas, en que lapresin es corre cta sin necesidad decolocar un tanque de agua. J.G.BARCALAMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTEAGUACO RRIENTEHablaremos sobre las instalaciones en plstico, pues sonfciles de realizar ya que norequieren de herramientas complicadas ni caras. Hablaremos sobre las instalaciones en plstico, pues sonfciles de realizar ya que norequieren de herramientas complicadas ni caras.

Cuando trabajemos en plstico usa. remos una terraja y la mano. Se in. serta la punta del cao sin rebarba. por detrs, en una gua que debe se. del mismo tamao que el cao. Sosteniendo firmemente el cao. para desenroscarlo. Si no podemos sostener el cao conla mano, es buena idea usar una pinza pico de loro. se comienza a girar la terraja en elsentido que van las agujas del reloj. Una vez que el cao aparezca sobresaliendode la terraja. Giraremos en el otro sent ido Cmo hagola rosca? PIEZAS COMUNES EN UNA INSTALACIO. Codo: para los cambios d. direccin en ngulo recto. Buje o Cupla de reduc. cin: sirve para reducir d. tamao de cao. Por ejem. plo bajar de 3/4 pulgadas a mediaTe: para hacer una salid. intermedia (continuar otr. caera a otro sitio en n. gulo recto). Tapn macho o hembra. para tapar una caera. Cupla: para hacer una ex. tensin de un cao. Colilla: sirve para conec. tar los aparatos sanitarios . la caera. Los extremo. pueden ser machos o hembra.Entrerrosca con o si. tuerca: sirve para unir de. elementos con rosca hem. bra. Unin doble: cuando ve. nimos con 2 caos ya ins. talados y tenemos qu. unirlos usamos una doble unin. Cruz: sirve para tener . salidas de caos en distin. tas direcciones. Nos pue. de servir para armar un. grifera para baera. Llave de paso: sirve par. cortar el paso del agua po. una caera, la colocaremo. inmediatamente despus del contado. de agua, antes de un calefn, etc. Niple: trozo de cao co. rosca en ambos extremos. Agua corriente 22 - .

Veamos algunos detalles d. como se hace una instalaci. de agua y que elementos l. componen. CALEFO. Es necesario colocar una llave d. paso en la conexin del calefn con e. agua fra para poder cortar el ingres. de la misma si hay problemas con ste. NOTA. Si se llega a trabajr co. cao de hierro galvanizado, es conve. niente separar el de caliente con el d. fra en unos 15 cm. DUCHER. Se puede comprar la grifera qu. viene con un block mezclador con la. llaves laterales ya incorporadas.

Agua corriente 22 - .

Para una vivienda de 2 dormitorio. lo menos 2 mt. con respecto a la sa. no deberemos tener un tanque menor . lida del duchero (cuanto ms altura e. 500 lt. (lo adecuado sera uno d. mejor). 750 lt.). Hacer la salida de agua por e. Si necesitamos un tanque de agu. costado, a unos 10 cm del fondo. Per. grande, ms cmodo ser dividirlo en . mite que el contenido de polvo qu. chicos ya que podremos limpiar un. hay en el agua decante en el fondo . mientras funciona el otro. Es ms livian. pase en monor grado a la caera. mover los 2 que uno grande. Si la salida se hace por debaj. Las tapas de los tanques de agu. habr que dejar elevado el tanque po. deben ser aseguradas para que no la. lo menos unos 50 cm para poder tra. levante el viento. bajar comodamente. Para tener una buena presin de. Los tanques hay que limpiarlo. beremos levantar el tanque de agua po. una vez por ao, por decreto municipal. Agua corriente 22 - .

Veamos una vivienda para desarrollarun ejemplo de instalacinde agua. Veamos una vivienda para desarrollarun ejemplo de instalacinde agua. Para poder ver el desarrollo de las caeras hemos realizado algunos muro. transparentes en este ejemplo sencillo y econmico podemos localizar las distinta. piezas que ya hemos visto (te, codos, llaves de paso, etc).

Si hacemos un. entrada independiente par. el bao y otra para la coci. na, podemos colocar un. llave de paso que nos per. mita cortar el suministro d. agua en el bao sin perde. el correspondiente al de l. cocina. Esto genera un pe. queo aumento de cost. pero nos permite tener siem. pre agua dentro de la casa. Agua corriente 22 - 5HERRAMIENTAS

Desages 23 - 1: DESAGESMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTELos desages secundarios se deben conectar a los de primarios a travs de elementos con sifn. PRIMARIOS: Son los que desaganLOS DESAGES SE DIVIDEN EN: SECUNDARIOS: Carlitos, ... para que una instalacin de sanitaria seaaceptada en una intendencia , hay que conseguirfirma de un tcnico sanitario. J.G.BARCALADesages 23 - 1: DESAGESMINISTERIO DE VIVIENDA, ORDENAMIENTOTERRITORIAL YMEDIO AMBIENTELos desages secundarios se deben conectar a los de primarios a travs de elementos con sifn. PRIMARIOS: Son los que desaganLOS DESAGES SE DIVIDEN EN: SECUNDARIOS: Carlitos, ... para que una instalacin de sanitaria seaaceptada en una intendencia , hay que conseguirfirma de un tcnico sanitario. J.G.BARCALA

Desages 23 - 2codo de 90 gradosdimetro 40 mmcao dimetro 40 mmcodo a 45 gradosdimetro 40 mmcao 110mmCodo 90 grados, dimetro 110mm, con 3 entradas en un dimetro de63mm. para poder conectar lasalida de la caja sifo nada. Esas entradas vienen tapadas, hay que romper la tapa de laque se va a usar (conviene golpearde adentro del cod o hacia afuera). Los receptculospara ducheros, vienencon tapa rejilla, ypueden ser con salidahoriz ontal o salida vertical. Desagede lavatorioDesagede inodoroDesagede ducheroCaja sifonada, separa losdesages s ecundarios de losprimarios. Sirve para desaguar pisos o duchero dependiendodonde se ubique, viene contapa rejilla.A cmarade inspe ccinExisten en el mercado varios materiales para ser usados en unainstalacin sanit aria. Hemos elegido sin embargo para describir elPVC, ya que es de fcil utilizacin . VEAMOS UN EJEMPLO DE DESAGESDE UN BAODesage de bideDesage delavado de piso Desages 23 - 2codo de 90 gradosdimetro 40 mmcao dimetro 40 mmcodo a 45 gradosdimetro 40 mmcao 110mmCodo 90 grados, dimetro 110mm, con 3 entradas en un dimetro de63mm. para poder conectar lasalida de la caja sifo nada. Esas entradas vienen tapadas, hay que romper la tapa de laque se va a usar (conviene golpearde adentro del cod o hacia afuera). Los receptculospara ducheros, vienencon tapa rejilla, ypueden ser con salidahoriz ontal o salida vertical. Desagede lavatorioDesagede inodoroDesagede ducheroCaja sifonada, separa losdesages s ecundarios de losprimarios. Sirve para desaguar pisos o duchero dependiendodonde se ubique, viene contapa rejilla.A cmarade inspe ccinExisten en el mercado varios materiales para ser usados en unainstalacin sanit aria. Hemos elegido sin embargo para describir elPVC, ya que es de fcil utilizacin . VEAMOS UN EJEMPLO DE DESAGESDE UN BAODesage de bideDesage delavado de piso

VEAMOS AHORA DONDE TERMINA ESTE BA. IMPORTANT. La profundidad del colector hay que preguntarla en la Intendencia de Montevideo u OSE en el rest. del pas. Con el proyecto en mano habr que calcular, tomando en cuenta las pendient es la altura fina. de la instalacin. Eso determinar si nos da la profundidad de conexin o tendremos qu e subir el bao.

Desages 23 - .

ALGUNAS ANOTACIONE. Las caeras principales no podrn ir po. dentro de un muro medianero. Deber ventilarse la caera principal, co. locando una rejilla de 10 x 10 cm. en la part. ms baja y un cao con sombrerete en la part. ms alta. Habr que poder acceder a los caos . travs de cmaras de inspeccin cada vez que. 1- Cambiemos de direcci. 2- Unamos 2 o ms cao. 3- Conectemos con red cloacal o pozo negr. 4- Tengamos 25 m de ca. 5- Cambiemos de material de cao. Las caeras principales ubicadas en el suelo podrn llevar una pendiente qu. oscile entre 2 a 5 cm., cada metro de longitud (2% a 5%). Las caeras secundaria. podrn llevar una pendiente de 1 cm. cada metro, al igual que aquellas caeras qu. slo lleven agua de lluvia. Conviene siempre, tener definido el nivel del piso terminado para no equivocar. se con las pendientes. Es conveniente saber la pro. fundidad de coneccin con e. colector si es que lo hay. La distancia mxima entr. un inodoro y una cmara de ins. peccin es de 10 metros. CAMARAS DE INSPECCIO. Las cmaras de inspeccin sirven par. acceder a las caeras. Las hay de ladrillos. hormign y PVC. Para uso domstico, las cmaras podr. hacerse con muros de 15 cm, ya que tendr. profundidades menores a 2 m. Sus paredes irn revestidas de arena . cemento portland en una relacin de 2 parte. de arena ms 1 de cemento portland y se ter. minar con portland lustrado. Desages 23 - .

Podemos hacer unpozo negro o unafosa sptica. POZO NEGRO Qu hago si no hay colector? Podemos hacer unpozo negro o unafosa sptica. POZO NEGRO Qu hago si no hay colector? Los pozos negros habrn de contruir. se slidamente, podrn ser hechos de la. drillo, hormign, piedra, etc. Debern ser ubicados con preferen. cia en los espacios libres prximos a la v. pblica para facilitar el vaciado por el ca. min baromtrico. Est prohibido contruirl. a menos de 1 m. de las medianeras, . menos de 5 m. de los aljibes y a meno. de 10 metros de los pozos manantiales. Tampoco podrn ubicarse bajo las habi. taciones. La capacidad mnima ser de 5 m. hasta el nivel en que desagua en l e. cao de 100mm que viene de la cmar. de inspeccin. Podrn ser cilndricos . prismticos. Veremos aqu uno cilndri. co mnimo, hecho en ladrillo. Los ladrillos debern ser de prime. ra calidad y sern levantados con u. mortero compuesto d. 1 parte de cement. portland y 4 de aren. gruesa. Interiorment. ir revocado con aren. y cemento portland. (2 de arena ms 1 d. cemento), llevar un. terminacin en cemen. to portland lustrado. Desages 23 - 5

Hay que replantear la ubicacin de los artefactos sanitarios. Comenzaremos lainsta lacin, a partir del codo del inodoro al que se unir luego todo lo dems . La bocadel codo tiene que estar bien horizontal. Antes de comenzar a pegar conviene tener toda la instalacin hecha y puestaen su s itio. Si hay que perforar la pared para que pase el cao de 100mm, habr quehacerlo en este momento. Todo corte de cao deber hacerse derecho, o sea perpendicular al eje del cao. Conviene usar un cajn gua para ello. Hay que sacarle las rebarbas que queden yempa rejar el borde con la escofina. Es conveniente tener el suelo lmpio y con unacapa de arena gruesa esparcida para asentar los caossin daarlos. OTRAS ANOTACIONESPERO SOBRE LOSCAOS DE PVCPara trabajar con caos de plstico requeriremos: -una sierra para metal-un pincel de 1/2 pulgada-papel de lija N01-una escofina o lima. Para poner el adhesivo, habr que lijar lassuperficies del cao hasta que pierda el birllo. El adhesivo se pondr con el pincel, en lassuperficies ya lijadas. Se har pasndolo e n forma longitudinal. Una vez introducido el cao, no deber girrselo, ya que podra no pegarse. No deje que los caos al sol, porque losHay que replantear la ubicacin de los artef actos sanitarios. Comenzaremos lainstalacin, a partir del codo del inodoro al que se unir luego todo lo dems . La bocadel codo tiene que estar bien horizontal. Antes de comenzar a pegar conviene tener toda la instalacin hecha y puestaen su s itio. Si hay que perforar la pared para que pase el cao de 100mm, habr quehacerlo en este momento. Todo corte de cao deber hacerse derecho, o sea perpendicular al eje del cao. Conviene usar un cajn gua para ello. Hay que sacarle las rebarbas que queden yempa rejar el borde con la escofina. Es conveniente tener el suelo lmpio y con unacapa de arena gruesa esparcida para asentar los caossin daarlos. OTRAS ANOTACIONESPERO SOBRE LOSCAOS DE PVCPara trabajar con caos de plstico requeriremos: -una sierra para metal-un pincel de 1/2 pulgada-papel de lija N01-una escofina o lima. Para poner el adhesivo, habr que lijar lassuperficies del cao hasta que pierda el birllo. El adhesivo se pondr con el pincel, en lassuperficies ya lijadas. Se har pasndolo e n forma longitudinal. Una vez introducido el cao, no deber girrselo, ya que podra no pegarse. No deje que los caos al sol, porque los daa.

Los golpes pueden daar las piezas de PVC, tanto cuando las bajamos del cami. como cuando ya estn instaladas. Conviene antes de taparla hacer una prueb. de agua a la instalacin para ver si pierde. Desages 23 - 6HERRAMIENTAS