166

15. Procesos Metabólicos

Introducción

Se denomina metabolismo al conjunto de reacciones químicas controladas genéticamente
que ocurren en los biosistemas y tienen por objeto mantener al biosistema alejado del
equilibrio termodinámico. Este conjunto de procesos se puede discriminar en dos
subgrupos que son complementarios y a los que se denominan Catabolismo y Anabolismo.
En la figura siguiente se describen las características generales del proceso metabólico.


Los subgrupos de las reacción son inversos y complementarios, hecho que se traduce en
una interdependencia para la cual los productos primarios del catabolismo (ATP, NADH,
NADPH y FADH
2
) son consumidos en el anabolismo, con el fin de producir metabolitos
primarios además de ADP, NAD
+
, NADP
+
y FAD

(productos oxidados) para con esto
reiniciar el ciclo.

El catabolismo es pues la serie de reacciones en la que, como producto final del proceso, se
libera energía en forma química gracias a la degradación de moléculas complejas. Se
consideran vías catabólicas las respiraciones aerobia, anaerobia y la fermentación. Por su
parte, el anabolismo resume la síntesis de moléculas complejas a partir de componentes
estructurales más simples, siendo la síntesis de proteínas un ejemplo de anabolismo.

Tal y como se observa en la figura siguiente, el catabolismo es un evento convergente,
mientras que el anabolismo es divergente.



167


Dos reacciones químicas generales determinan el funcionamiento metabólico de los
biosistemas. La primera denominada fotosíntesis, tiene por objeto transformar la energía
lumínica en energía química; energía que a su vez se empleará en el mantenimiento del
desequilibrio que como se ha expresado en reiteradas ocasiones, es propio de lo viviente.
La segunda reacción, denominada respiración es inherente a todos los organismos y tiene
por objeto obtener energía química que permite la realización de trabajo biológico tal y
como se resume en la figura siguiente.


El trabajo biológico está mediado por la hidrólisis del ATP, que a su vez se produce en
cualquiera de los procesos de respiración, como esquematiza en la figura siguiente.

Fosfol Fosfolí ípidos pidos
Triacilgliceroles Triacilgliceroles
Acidos Acidos grasos grasos
Fosfol Fosfolí ípidos pidos
Triacilgliceroles Triacilgliceroles
Acidos Acidos grasos grasos
Acetato Acetato
Acetil Acetil- -CoA CoA
Fenilalanina Fenilalanina
Isoleucina Isoleucina
Leucina Leucina
Acetato Acetato
Acetil Acetil- -CoA CoA
Fenilalanina Fenilalanina
Isoleucina Isoleucina
Leucina Leucina
IPP IPP IPP IPP
Gomas Gomas
Carotenoides Carotenoides
Colesterol Colesterol
Gomas Gomas
Carotenoides Carotenoides
Colesterol Colesterol
Colesteril Colesteril- -esteres esteres
Esteroides Esteroides
Acidos Acidos
biliares biliares
Colesteril Colesteril- -esteres esteres
Esteroides Esteroides
Acidos Acidos
biliares biliares
Mevalonato Mevalonato
Acidos Acidos grados grados
Mevalonato Mevalonato
Acidos Acidos grados grados
Eicosanoides Eicosanoides
Triacilgliceroles Triacilgliceroles
CDP CDP- -digliceridos digliceridos Fosfol Fosfolí ípidos pidos
Eicosanoides Eicosanoides
Triacilgliceroles Triacilgliceroles
CDP CDP- -digliceridos digliceridos Fosfol Fosfolí ípidos pidos
Piruvato Piruvato
Alanina Alanina
Serina Serina
Piruvato Piruvato
Alanina Alanina
Serina Serina
Acetoacetil Acetoacetil- -CoA CoA Acetoacetil Acetoacetil- -CoA CoA
CATABOLICO CONVERGENTE CATABOLICO CONVERGENTE
ANABOLICO DIVERGENTE ANABOLICO DIVERGENTE
CATABOLICO CICLICO CATABOLICO CICLICO
CO
2
CO
2
CO
2
CO
2
IPP= Isopentenil PPi
fotosíntesis
E. química E. lumínica
Qu Quí ímico mico
Biosíntesis
Mec Mecá ánico nico
Contracción
Transporte Transporte
Respiración
Energía disipada al medio Energía disipada al medio
Trabajo biológico

168

Un segundo mecanismo químico de acumulación de energía en los biosistemas, se
argumenta en la figura siguiente, y para la cual se compara el AG asociado a la hidrólisis de
los dos tipos de ésteres posibles en los biosistemas. Como se puede observar, la liberación
de energía que está asociada al tioester es mayor, lo que hace fácilmente sustentable desde
la perspectiva evolutiva su presencia universal.

En la figura siguiente se presenta la estructura correspondiente al Acetíl Coenzima A.

Moléculas
combustibles
O O
2 2
CO CO
2 2
+ H + H
2 2
0 0
R
e
s
p
i
r
a
c
i
ó
n
ADP+Pi
ATP
Contracción Transporte
Biosíntesis
ATP + H
2
O · ADP + Pi AG° = -7.3 Kcal/mol

169
El Catabolismo

Los procesos catabólicos se dividen en tres grandes fases. En la primera, que como ya se
dijo es de condensación, se tiene por objeto producir Acetil-CoA. De los tres grandes
grupos de metabolitos primarios (azúcares, lípidos y proteínas) se conocen rutas
bioquímicas que conducen a esta biosíntesis degradativa. La segunda fase comprende las
reacciones que conducen hacia la oxidación del Acetil-CoA previamente sintetizado. En la
tercera y última fase se da el transporte de los electrones, proceso tras el cual se de la
síntesis de energía química. El siguiente esquema presenta un resumen del proceso general
del catabolismo.





Amino Amino
á ácidos cidos
Acidos Acidos
grasos grasos
Glucosa Glucosa
Glic Glicó ólisis lisis
Piruvato Piruvato
Acetil Acetil- -CoA CoA
CO CO
2 2
e e
- -
e e
- -
e e
- -
e e
- -
Citrato Citrato
CO CO
2 2
NADH NADH
FADH FADH
2 2
CO CO
2 2
e e
- -
e e
- -
e e
- -
e e
- -
e e
- -
Oxaloacetato Oxaloacetato
Ciclo del Ciclo del
Á Ácido C cido Cí ítrico trico
e e
- -
Cadena Transportadora de Cadena Transportadora de
electrones electrones
ADP + ADP + Pi Pi ATP ATP
FASE I FASE I
Producci Producció ón de n de Acetil Acetil- -CoA CoA
FASE II FASE II
Oxidaci Oxidació ón del n del Acetil Acetil- -CoA CoA
FASE III FASE III
Transferencia de electrones Transferencia de electrones
Fosforilaci Fosforilació ón oxidativa n oxidativa
2H
+
+ ½ O
2
H
2
O

170

El catabolismo se puede describir en términos de la geográfica celular de eucariotes de la
siguiente manera.









Fase I. Producción del Acetíl-CoA.


Durante la glucólisis -que ocurre en el citosol- y que constituye la primera parte de esta
fase de producción del Acetil-CoA, una molécula de glucosa que debe ser transportada al
interior, es degradada hasta formar dos moléculas de piruvato. En estos eventos se da la
producción neta de dos moléculas de ATP por fosforilación al nivel del sustrato y
simultáneamente se obtienen cuatro átomos de hidrógeno que se extraen de la molécula de
glucosa y se emplean para producir dos de NADH. En el esquema siguiente se indican las
reacciones correspondientes.
Gluc Gluc
ext ext
Gluc Gluc
int int
glic glicó ólisis lisis
Piruvato Piruvato
Lactato/Etanol Lactato/Etanol
anaerobiosis anaerobiosis
Citosol Citosol
Piruvato Piruvato Acetil Acetil- -CoA CoA
Ciclo
de
Krebs
CO CO
2 2
Ciclo
de
Krebs
CO CO
2 2
O O
2 2
O O
2 2
H H
2 2
O O
CO CO
2 2
Mitocondria Mitocondria
LOCALIZACIÓN CELULAR

171

Fase II. Oxidación del Acetil CoA

Obtenido el piruvato y dependiendo de las condiciones celulares (presencia o no de oxígeno
molecular), se continúa con la segunda parte que es consecutiva a la formación del
producto de la fase I. Esta nueva fase involucra al denominado complejo piruvato
deshidrogenasa para descarboxilar al piruvato y finalmente obtener el Acetil-CoA, según se
describe en la siguiente figura. Para que se de la reacción, el piruvato debe ser transportado
al interior de la mitocondria.
(2) (2)
(2) (2)
(2) (2)
(2) (2)
(2) (2)
Glucosa Glucosa
6 6- - Glucosa Glucosa
Fructosa Fructosa- -6 6- -fosfato fosfato
Fructosa Fructosa- -1,6 1,6- -difosfato difosfato
Gliceraldehido Gliceraldehido- -3 3- -fosfato fosfato
Dihidroxi Dihidroxi- -acetona acetona - -3 3- -fosfato fosfato
1,3 1,3- - Bifosfoglicerato Bifosfoglicerato
3 3- -Fosfoglicerato Fosfoglicerato
2 2- -Fosfoglicerato Fosfoglicerato
Fosfoenol Fosfoenol- -piruvato piruvato
Piruvato Piruvato
(2) (2)
(2) (2)
(2) (2)
(2) (2)
(2) (2)
Glucosa Glucosa
6 6- - Glucosa Glucosa
Fructosa Fructosa- -6 6- -fosfato fosfato
Fructosa Fructosa- -1,6 1,6- -difosfato difosfato
Gliceraldehido Gliceraldehido- -3 3- -fosfato fosfato
Dihidroxi Dihidroxi- -acetona acetona - -3 3- -fosfato fosfato
1,3 1,3- - Bifosfoglicerato Bifosfoglicerato
3 3- -Fosfoglicerato Fosfoglicerato
2 2- -Fosfoglicerato Fosfoglicerato
Fosfoenol Fosfoenol- -piruvato piruvato
Piruvato Piruvato

172
A partir del Acetil-CoA generado se da una condensación con el oxaloacetato para formar
el citrato y así iniciar dos procesos de descarboxilación hasta formar nuevamente el
oxaloacetato.

El sistema es controlado enzimáticamente a través de efectos alostéricos tal y como se
indica en el siguiente esquema.
Inhibición
Inducción
Inhibición
Inducción
Inhibición
Inducción

173
Fase III

A partir de los productos reducidos formados (NADH, FADH
2
) se da inicio a la tercera y
última fase, que corresponde a la fosforilación oxidativa y que se resume a continuación.
En resumen, durante la respiración aerobia se oxida una molécula de combustible como la
glucosa para formar dióxido de carbono y agua. La respiración aerobia es un proceso redox
en el cual se transfieren electrones de la glucosa (que se oxida) al oxígeno (que se reduce).

En la respiración aerobia se producen entre 36 y 38 moléculas de ATP por cada glucosa.
Las reacciones químicas de la respiración aerobia ocurren en cuatro etapas, a saber:
glucólisis, formación de AcetilCoA, ciclo del ácido cítrico y cadena de transporte de
electrones/quimiósmosis.

En la glicólisis se degrada la molécula de glucosa para generar dos piruvato. Cada una de
las dos moléculas de piruvato libera una de dióxido de carbono, y los grupos acetilo
residuales se combinan con coenzima A, para producir dos moléculas de acetilCoA. Se
forma una molécula de NADH al convertirse cada piruvato en acetilCoA.

Cada AcetilCoA entra en el ciclo del ácido cítrico y se combina con un compuesto de
cuatro carbonos, el oxalacetato, con la formación de citrato, que es un compuesto de seis
carbonos. Por cada molécula de glucosa entran en el ciclo dos de acetilCoA. Por cada dos
carbonos que entran en el ciclo como parte de una AcetilCoA, dos salen como dióxido de
carbono. Adicionalmente, por cada AcetilCoA se transfieren hidrógenos a tres NAD
+
y un
FAD; sólo un ATP se produce por fosforilación a nivel del sustrato. Los átomos de
hidrógeno (o sus electrones) disociados de las moléculas de combustible, se transfieren de
un aceptor de electrones a otro en la cadena de transporte de electrones localizada en la
Membrana externa Membrana externa
Permeable para pequeñas
moléculas e iones.
Membrana interna Membrana interna
Impermeable a muchas
pequeñas moléculas e iones,
incluyendo H+.
Contiene:
Cadena transportadora de
electrones
ADP-ATP translocasas
ATP sintetasa
Matriz Matriz
Contiene:
Complejo piruvato
deshidrogenasa
Enzimas ciclo de citrato
Enzimas |÷oxidación
Enzimas oxidativas de
aminoacidos
ADN, ribosomas
ATP, ADP, P y metabolitos
intermediarios.
Ribosomas
Canales
ATP sintetasa
Crestas
Membrana externa Membrana externa
Permeable para pequeñas
moléculas e iones.
Membrana interna Membrana interna
Impermeable a muchas
pequeñas moléculas e iones,
incluyendo H+.
Contiene:
Cadena transportadora de
electrones
ADP-ATP translocasas
ATP sintetasa
Matriz Matriz
Contiene:
Complejo piruvato
deshidrogenasa
Enzimas ciclo de citrato
Enzimas |÷oxidación
Enzimas oxidativas de
aminoacidos
ADN, ribosomas
ATP, ADP, P y metabolitos
intermediarios.
Ribosomas
Canales
ATP sintetasa
Crestas
Membrana externa Membrana externa
Permeable para pequeñas
moléculas e iones.
Membrana interna Membrana interna
Impermeable a muchas
pequeñas moléculas e iones,
incluyendo H+.
Contiene:
Cadena transportadora de
electrones
ADP-ATP translocasas
ATP sintetasa
Matriz Matriz
Contiene:
Complejo piruvato
deshidrogenasa
Enzimas ciclo de citrato
Enzimas |÷oxidación
Enzimas oxidativas de
aminoacidos
ADN, ribosomas
ATP, ADP, P y metabolitos
intermediarios.
Ribosomas
Canales
ATP sintetasa
Crestas

174
membrana mitocondrial interna.

A nivel mitocondrial se tiene: 1) Formación de agua cuando el oxígeno se combina con H
+

y con electrones de la cadena de transporte. 2) Según el modelo quimiosmótico, parte de
la energía de los electrones transferidos en la cadena de transporte se usa para generar un
gradiente de protones a través de la membrana mitocondrial interna. 3) La difusión de los
protones de un lado a otro de la membrana, desde el espacio intermembranoso hacia la
matriz mitocondrial (a través de conductos formados por el enzima ATP sintasa)
proporciona la energía necesaria para la síntesis de ATP.

Además de la glucosa, otros nutrimentos orgánicos se convierten en los compuestos
adecuados y pasan a la glucólisis o al ciclo del ácido cítrico. Los aminoácidos
experimentan desaminación, y sus esqueletos de carbono se convierten en intermediarios
metabólicos de la glucólisis y el ciclo del ácido cítrico. Tanto el glicerol como los ácidos
grasos, que componen a los lípidos se oxidan como combustible. Los ácidos grasos se
convierten en moléculas de acetilCoA por el proceso de |-oxidación.

En la respiración anaerobia, se transfieren electrones de las moléculas de combustible a
una cadena de transporte; el aceptor final de electrones es una sustancia inorgánica como
nitrato o sulfato y nunca oxígeno molecular.

La fermentación es un proceso anaerobio en el que no participa una cadena de transporte
de electrones. Hay una ganancia neta de apenas dos moléculas de ATP por cada una de
glucosa (producidas durante la glucólisis). Para mantener el aporte de NAD
+
necesario para
la glucólisis, se transfieren hidrógenos del NADH a un compuesto orgánico derivado del
nutrimento inicial. Las células de levadura realizan la fermentación alcohólica en la que
alcohol etílico y dióxido de carbono son los productos de desecho. Algunos hongos,
bacterias y células animales realizan la fermentación láctica, en la cual se agregan átomos
de hidrógeno al piruvato y se forma lactato como producto de desecho.

En el siguiente esquema se presenta el mecanismo general para las fermentaciones
alcohólica y láctica.


175




En las páginas siguientes se da cuenta de los procesos generales del catabolismo para los
tres tipos de metabolitos primarios.

176


177
ACTIVIDAD CATABOLICA EN LIPIDOS

178
ACTIVIDAD CATABOLICA EN PROTEINAS



179
El Anabolismo

Al considerar el origen etimológico de la palabra anabolismo se tiene que el prefijo ana
significa “de nuevo” y el sufijo ismo “actividad o movimiento”. El anabolismo entonces se
refiere a síntesis de moléculas complejas a partir de moléculas simples. Los procesos
anabólicos son generalmente reductivos y proceden simultáneamente con el catabolismo,
constituyendose el metabolismo (como un todo) en un proceso dinámico que llega a
convertirse en un ESTADO ESTACIONARIO entre la producción y el consumo de
energía.

Si bien los procesos anabólicos son esencialmente contrarios a los catabólicos y poseen
algunas reacciones compartidas y reversibles, esencialmente se consideran vías diferentes.
Un ejemplo claro de anabolismo está representado por la GLUCONEOGÉNESIS que
consiste en la formación de glucosa a partir de precursores “no hexósicos”.

La gluconeogénesis sucede en todos los tipos de organismos: animales, plantas, hongos y
microorganismos, siendo esencialmente la misma secuencia para todos los casos. Al
considerar la glucólisis se tiene que básicamente tres reacciones son irreversibles:

La primera se da al inicio de la secuencia e involucra una fosforilación:


1. GLU ¬ GLU-P (HEXOQUINASA)


La segunda reacción igualmente compromete una fosforilación:

2. FRU-P ¬ FRU-2P (FOSFOFRUTOQUINASA)


La tercera y última reacción igualmente compromete a quinasa


3. FOSFOENOLPIRÚVICO ¬ PIRÚVICO (PIRUVATO QUINASA)

En el gráfico de la página siguiente se presenta el esquema general de la gluconeogénesis
con los tres puntos de control claramente definidos.




180




181
El segundo ejemplo de procesos ANABÓLICOS se centra en el caso de los lípidos, para los
cuales se tienen dos tipos de rutas igualmente definidas: Biosíntesis de ácidos
grasos/eicosanoides y la vía de los terpenoides. En ambos casos se parte de la unidad
estructural Acetil~CoA, pero mientras en el primero la unidad estructural es evidente y de
allí deriva el nombre policétidos, en el segundo la unidad estructural corresponde a un
compuesto de 5 carbonos (unidad isoprénica) que es derivado del mevalonato y del cual
recibe el nombre la ruta.


En la figura de la página siguiente se indica el modelo general de biosíntesis de ácidos
grasos. Como se puede ver, el iniciador del proceso es un complejo compuesto por:
Sintetasa de Acidos Grasos, una molécula de malonil CoA y una molécula de Acetil CoA.
En la molécula de malonil se presenta un buen grupo saliente (carboxilato) que estimula el
ataque nucleofílico sobre el grupo carbonilo del Acetíl unido al enzima. Este proceso se
repite cuantas veces sea necesario según sea el tamaño del a. graso. Del gráfico igualmente
se pueden destacar dos hechos: 1) La formación del malonil CoA y 2) la reducción de la
unidad de dos carbonos que se incorpora a la cadena.

La síntesis de terpenoides se describe en la página 17. En el recuadro se indican tanto los
modelos de regulación de la ruta como los carbonos que resultarían marcados cuando se
emplean precursores marcados en el carbono carboxilato.


182




183
El tercer y último ejemplo de procesos anabólicos se refiere a proteínas y aminoácidos.
Esta ruta biosintética general está relacionada directamente con el ciclo del nitrógeno, que a
su vez es dependiente del proceso denominado fijación del nitrógeno. En términos macro
el proceso de fijación se describe en el siguiente esquema.

Al considerar la biosfera, se tiene que la fijación del nitrógeno juega un papel clave en la
disposición de aminoácidos y proteínas a lo largo de la cadena trófica, por lo que es
indispensable considerarlo y fundamentalmente porque la reserva más importante del
nitrógeno está en la atmósfera. Se estima que el total de nitrógeno fijado anualmente en la
biosfera excede los 10
11
kg.

Muy pocos organismos, concretamente procariotes están en capacidad de fijar el nitrógeno
atmosférico. Estos organismos se restringen a su vez a los grupos: cianobacter, azobacter y
bacterias fijadoras simbiontes con raíces de leguminosas.

La reducción de nitrógeno hasta amonio es un proceso exergónico


N
2
+ 3H
2
→ 2NH
3
AG´° = -33,5 Kj/mol


Se estima que la gran estabilidad del triple enlace del nitrógeno es lo que requiere de una
gran cantidad de energía de activación. Industrialmente -proceso de Haber- solo es viable a
condiciones extremas: 400-500 °C y altas presiones. Paradójicamente en la condición
biológica el proceso ocurre a 0,8 atm de Nitrógeno y la denominada temperatura biológica .
La reacción general en el caso biológico es

N
2
+ 10 H
+
+ 8e
-
+ 16 ATP → 2 NH
4
+
+ 16 ADP + 16 Pi + H
2


184
La reducción biológica –que recibe el
nombre de fijación– es responsabilidad
de un complejo proteico altamente
conservado denominado “ COMPLEJO
NITROGENASA” cuyos componentes
claves son dinitrogenasa reductasa y la
dinitrogenasa. Ver figura al costado

El enzima dinitrogenasa reductasa
corresponde a un dímero con dos
subunidades idénticas que poseen un
centro redox (4Fe-4S) que se reducen u
oxidan por acción de un electrón y es
dependiente de ATP. El papel del ATP
se asocia con el incremento en el papel
reductor de -250 a -400 mv lo que
posibilita la transferencia de electrones
hasta la dinitrogenasa. Este complejo es
extremadamente susceptible a la
presencia de oxígeno.

El nitrógeno reducido biológicamente y
que se encuentra en forma de NH
4
+
es
asimilado por los organismos al
incorporarlo en la formación de
aminoácidos. En este sentido, los
aminoácidos glutamato y glutamina se
constituyen en los puntos críticos de esta
ruta anabólica: El glutamato es la fuente
de grupos amino para una cantidad
importante de aminoácidos por la vía de
trasaminación, mientras que el grupo N
amida en la glutamina es fuente de
grupos amino para otras biomoléculas.

La biosíntesis de glutamato-glutamina está muy generaliza en toda la escala biológica,
siendo el punto crítico la asimilación que involucra dos reacciones. La primera catalizada
por la glutamina sintetasa y que se da en dos etapas:

glutamato –P + ATP → ¸ glutaril-P + ADP
¸ glutaril-P + NH
4
+
→ glutamina + Pi + H
+


E glutamato + NH4
+
+ ATP → glutamina + ADP + Pi + H
+



La glutamina sintetasa se ha reportado en todos los tipos de organismos y en mamíferos se

185
le atribuye un papel destoxificador al fijar el amonio libre para ser transportado en sangre.
Adicionalmente se estima que este enzima constituye el PUNTO PRIMARIO DE
REGULACIÓN del metabolismo del nitrógeno. Al estudiar con detenimiento el caso de E
coli se tiene que está compuesto por 12 subunidades iguales de Mr 50.000 y que se regula a
dos niveles: 1) Nivel alostérico y 2) Modificación covalente. En la figura siguiente se
describen ambos fenómenos.


La regulación por modificación covalente, lo que realmente posibilita, es afianzar la
regulación alostérica. Para el caso descrito como a) se realiza una adenilación del enzima a
nivel del residuo tirosina. El efecto será mayor cuan mayor sea el número de subunidades
adeniladas. El equilibrio adenilación-desadenilación es promovido por el enzima
adeniltransferasa (AT). La actividad de “adenilación” está modulada por la unión con una
proteína (P
II
) que a su vez es regulada por una uridilación, esto último realizado por un
enzima simple llamada Uridiltrasferasa (UT), proceso que igualmente está regulado. Ver
esquema parte b).


(a)

186
La biosíntesis de un aminoácido supone la fusión de dos rutas: Por un lado intermediarios
de la glucólisis, ciclo de Krebs y vía pentosas y por el otro la incorporación de nitrógeno
vía glutamato-glutamina, tal y como se denota en la figura y tabla siguientes.



Una vez se ha realizado la síntesis biológica de aminoácidos el sistema se enfoca hacia la
síntesis proteica, que en general se compone de 5 etapas generales:

1 Activación de los aminoácidos
2 Iniciación de la cadena polipeptídica
3 Elongación de la cadena
4 Terminación de la cadena
5 Plegamiento y procesos postraduccionales.

Se estima que la síntesis de proteínas es el más complejo de los procesos biosintéticos. En
eucariotas involucra cerca de 70 diferentes proteínas ribosomales, 20 o más para la
activación de los aminoácidos, al menos una docena de enzimas están involucrados en las
etapas de iniciación, elongación y finalización. Probablemente se requieren de no menos
de 100 enzimas adicionales en el procesamiento final y no menos de 40 o más clases de

187
rRNA (ribosomal) y tRNA (transferencia) están igualmente involucrados.

En resumen cerca de 300 moléculas son necesarias para que mediante un trabajo
cooperativo se realice la síntesis de un péptido y para muchas de estas biomoléculas se
requiere un acople tridimensional con los ribosomas.

En la década de los cincuenta del siglo pasado Zamecnick y colaboradores mediante
experimentos de marcaje isotópico demostraron la existencia de una subunidad celular con
estructura definida y que era responsable de la síntesis proteica. Esta organela se denominó
RIBOSOMA.

En la síntesis es posible la traducción fiable del lenguaje genético al proteico gracias a un
sistema de interacción denominado CODÓN-ANTICODÓN definidos en una “tabla de
traducción” tal y como se muestra en la figura siguiente. La tripleta AUG -marcada en la
tabla- corresponde al codón de iniciación, los demás codones marcados se denominan de
finalización.
El modelo general para la síntesis de proteínas en eucariotes se describe en el esquema
siguiente:
Los elementos básicos requeridos en cada uno de las etapas de síntesis proteica se describen
de manera general en la tabla siguiente.

ADN RNA
RNA PROTEINA
Función
Biológica
ADN RNA
RNA PROTEINA
Función
Biológica

188
RNA mensajero (mRNA). La síntesis del mRNA se da a nivel nuclear, siendo
significativamente diferente en eucariotas y procariotas. En el esquema siguiente se
describe el proceso de síntesis para el caso de los eucariotas.

Con el DNA como molde, la RNA polimerasa separa las dos fibras, usando para la
transcripción solo una de ellas. El producto es un transcripto primario que mediante
modificaciones se trasforma en un RNAm maduro.

RNA de Transferencia (tRNA). Se describe como la molécula responsable de la
compatibilidad entre el lenguaje genético y el proteico. El RNAt es una molécula pequeña
de entre 73-93 nucleótidos con un peso molecular entre 24.000-31.000 que se pliega
tridimensionalmente donde cloroplastos y mitocondrias poseen sus propios RNAt. Una
célula posee una molécula de RNAt de cada clase, donde la clase se establece por la
capacidad de reconocer cada aminoácido. Una célula entonces requiere al menos de 32
clases de RNAt aunque usualmente se emplean más de este número. En la siguiente figura
se presenta el modelo de tRNA de levadura deducido por Holley y colaboradores en 1965 y
que se conoce como “hoja de trébol”. Esta organización tridimensional se caracteriza por
un apareamiento intracatenario y que da origen a cuatro brazos que según el sentido de las
manecillas del reloj se nombran como:

1. Brazo aminoácido
2. Brazo T+C
3. Brazo anticodón
4. Brazo D




189


De los 76 nucleótidos 10 están modificados; muchos tRNA terminan en 5
´
pG (guanilato) y
todos poseen en 3´ la secuencia CCA. Dos de los brazos son críticos para la función. El
brazo aminoácido, dado que es el responsable del trasnporte se ha esterificado por el
extremo carboxilato con el hidroxilo 2´ o 3´ de la adenosina que se encuentra en la posición
3´del RNAt siendo el otro brazo crítico dado que contiene el anticodón. Los otros dos
brazos se sabe que juegan un papel importante en el plegamiento, aunque la función
específica no se tiene clara.

Ribosoma. Se constituye en el último de los elementos estructurales importantes en la
síntesis, consiste en un complejo supramolecular que para el caso de los procariotes puede
llegar hasta 15.000 por célula, lo que se traduce en que representa aproximadamente el 35%
de la proteína presente. Un ribosoma posee un diámetro aproximado de 18 nm con dos
subunidades denominados 30 S y 50 S en procariotas. En la tabla y figura siguientes se
describen los componentes y la estructura tanto para procariotas como para eucariotas.


190


La Síntesis Proteica

Definidos los elementos estructurales necesarios para la síntesis y teniendo en cuenta que es
un proceso endergónico, queda por establecer el mecanismo general; que como se planteó
anteriormente está compuesto por cinco etapas.

Etapa 1. Activación de los aminoácidos.

Los tRNA son activados por la presencia de la tRNA-Aminoacil Sintetasas al nivel del
citosol, siendo el producto de esta activación la esterificación con sus correspondientes
tRNAs. Muchos organismos poseen enzimas específicos por cada aminoácido. En la
figura siguiente se describe la activación del aminoácido y su posterior esterificación.



191

En estudios para los diferentes aminoácidos se ha demostrado que existe una gran
especificidad dado que el sistema distingue entre valina e isoleucina que como se sabe se
diferencian estructuralmente por la presencia de un metileno (-CH
2
).

Etapa 2. Iniciación

La síntesis de proteínas propiamente dicha comienza por el extremo amino terminal, tal
como lo establecio H. Dintzis en 1961. El codón de iniciación AUG corresponde a
metionina y es el mismo para el caso de todos los eucariotas. Existe un segundo codón para
metionina que se emplea en las codificaciones internas de la cadena que se está
sintetizando. Existen pequeñas diferencias en los modelos descritos para procariotas y
eucariotas, sin embargo se puede dar cuenta de un modelo general biológico.

En las células eucariotas todos los polipéptidos que se sintetizan en los ribosomas
citosólicos comienzan por Met; mientras que en bacterias se inicia por formilmetionina. La
etapa de iniciación en bacterias se discrimina a su vez en tres pasos y requiere de los
siguientes elementos:

- La unidad ribosomal 30 S.
- mRNA específico para el polipéptido en proceso de síntesis.

192
- Complejo de iniciación fMet-tRNA
- Factores de iniciación proteicos (IF-1, IF-2 y IF-3)
- GTP y Mg
2+

- Unidad 50 S

El procedimiento general de la primera fase y que corresponde al complejo de iniciación, se
describe en el esquema siguiente.
La subunidad 30 S se une a los factores IF-1 y IF-3. El factor 3 se sabe que actúa
previniendo que las subunidades ribosomales (mayor y menor) se unan de manera
prematura. Posteriormente se une el mRNA ubicando el codón AUG en el sitio P,
anteponiendo una secuencia que se conoce Shine-Dalgarno y que se asume cumple un
papel de acoplamiento. En la figura se describen los sitios P y A. Para el caso bacteriano
se han identificado 3 sitios específicos en el ribosoma que se denominan sitio aminoacil
(A), sitio Peptidil (P) y sitio de salida (E). Ambas subunidades ribosomales están
comprometidas en la conformación espacial de los sitio P y A, mientras que E está
básicamente definido por la subunidad 50S. El sitio de iniciación está ubicado en P y solo
el complejo fMet-tRNA
fmet
se puede acoplar. El IF-1 se une a A evitando que el tRNA se
una durante la iniciación. La segunda parte de la formación del complejo de iniciación
implica que al primer ensamble se ajuste el mRNA.
Con esto ya queda conformado adecuadamente el sitio de iniciación y de esta manera
entran fMet-tRNA
fmet
+ IF-2 + GTP. En este instante Anticodón y Codón deben alinearse
correctamente.

193
El nuevo complejo se une a la subunidad 50S y concomitantemente el GTP es hidrolizado y
los tres factores salen del complejo dando por terminada esta primera etapa.

En eucariotas la formación del complejo de iniciación es básicamente el mismo, con
pequeñas diferencias:

1. El RNA se encuentra formando un complejo con proteínas que se denominan de
unión.
2. En el extremo 3´ del mRNA se encuentra una proteína PoliA unida a su vez a la
proteína PAB.

En la figura siguiente se presenta un esquema de la formación del complejo de iniciación en
eucariotas y en la tabla se resumen los factores requeridos en el complejo de inicación tanto
para procariotas como para eucariotas.







194
Etapa 3. Formación de Enlaces peptídicos y elongación de la Cadena

En esta fase además del complejo de iniciación se requiere:

- a.a-tRNAs
- Proteínas citosólicas solubles denominadas factores de elongación (EF-Tu, EF-Ts y
EF-G)
- GTP.

La etapa de elongación a su vez se discrimina en tres pasos:

1. Unión con aminoacil-tRNA “entrante”

El segundo aminoacil-tRNA se acomoda en el sitio A a
expensas de la hidrólisis de GTP y un programa de reciclaje.
Ver figura al costado.

En el paso siguiente de la elongación se da la formación del
enlace peptídico. Este proceso involucra al aminoácido situado
en P y al nuevo aminoácido situado en A. El aa de A ataca
nucleofílicamente al complejo situado en P, desplazando el
tRNA
fmet
. Históricamente se había referido esta actividad a la
acción del enzima PEPTIDIL-TRANSFERASA y que se
encontraría asociado a la subunidad mayor. Hoy se considera
que esta acción es responsabilidad de la unidad catalítica 23 S
del rRNA al actuar como ribozima. El esquema inferior
modela el hecho.


195
El paso final de la etapa de elongación se denomina translocación y supone el moverse en
un codón hacia el extremo 3´. Con este movimiento se transfiere el tRNA-dipéptido de
A→P y el tRNA libre de P→E, para posteriomente salir a citosol. El resultado de la
operación deja el sitio A libre para que se acople un nuevo anticodón. Todo el proceso de
translocación es dependiente de un enzima traslocasa (EF-G) que a su vez procede a
expensas de la hidrólisis de un GTP. En resumen, por cada aa adicionado se gastan 2 GTP.

La etapa de elongación en eucariotas
es bastante similar a lo sucedido en
bacterias, siendo los factores de
elongación eEF1|¸, eEF1o y eEF2.
Una importante diferencia se tiene
en que los ribosomas de eucariotas
no poseen sitio E y el tRNA
descargado es expelido directamente
desde P.

Prueba de Lectura en el Ribosoma

La actividad de la GTPasa del EF-
TU durante la etapa de elongación
(ver figura lateral de página anterior)
es fundamental para que se de una
correcta lectura del lenguaje genético
dado que el complejo EF-TU-GTP
existe solo por unos pocos
milisegundos. Esto permite que la interacción Codón-Anticodón actue como corrector de
lectura ya que un aminoacil-tRNA incorrecto se disocia en A. Cuando se emplean bases
análogas como GTP¸S disminuye la velocidad de hidrólisis y simultáneamente mejora la
fidelidad, pero disminuye la velocidad de síntesis.

La síntesis proteica es un claro ejemplo de balance evolutivo entre fidelidad y velocidad:
El mejoramiento de una es detrimento de la otra y viceversa. Además es importante tener
en cuenta que la prueba de lectura únicamente se da en el apareamiento de bases y por
tanto cuando se porta un aa inadecuado este es EFICIENTEMENTE incorporado en la
proteína.

4. Etapa de Finalización

La elongación de la cadena continúa hasta que se consolida la etapa de finalización, que a
su vez se da en 4 pasos. El primero implica la presencia de uno de los tres codones de
finalización en el mRNA (UAA, UAG, UGA). En bacterias, una vez el codón de
finalización ocupa A, tres factores de finalización (proteínas RF1, RF2 y RF3) actúan para
que termine el proceso de síntesis. La secuencia se puede describir así:

- Ubicación del codón de finalización en el sitio A

196
- Hidrólisis del enlace peptido-tRNA final
- Disociaciación del complejo ribosomal.

En la figura siguiente se describe la etapa final del proceso de síntesis.


5. Etapa de Plegamiento y modificaciones postraduccionales

Una vez realizada la síntesis y antes o después del plegamiento, el polipéptdo puede ser
sometido a modificaciones enzimáticas que pueden incluir la remosión de uno o más
aminoácidos del aminoTerminal, la adición de acetil, fosforil, metil, carboxil u otros grupos
y sobre aas específicos, hidrólisis enzimática o adición de oligosacáridos o grupos
prostéticos. En la figura siguiente se presenta un esquema específico de modificación
postraduccional que se da en el caso de las proteínas. La ruta establecida se puede resumir
de la siguiente manera: Síntesis en Ribosomas → Modificación en Retículo

197
Endoplasmático → Modificación en Complejo de Golgi → Exportación.













































TALLER 15

198

1. Determine la estructura primaria del péptido que se generaría a partir de la siguiente
fracción de un gen del DNA.

3’TTGTATACATAGGAGGAGGAGATATCTAGATACATACCTATACATACTCA5’

2. Investigue entre las proteínas, los carbohidratos y los lípidos, que biomolécula
generaría mayor cantidad de ATP por gramo consumido y explique la razón
3. Realice cálculos de ATP producidos por el catabolismo aerobio década una de las
siguientes moléculas: glucosa, alanina, ácido oleico, ácido palmítico
4. Si se tiene una molécula de triptófano marcada en todos sus carbonos y se degrada
en el organismo y un producto de la degradación pudiera utilizarse para
gluconeogénesis, en qué carbono quedaría marcada la glucosa formada?
5. Si tiene acetil CoA y se quiere obtener un tromboxano TX2 (una molécula que actúa
como hormona de acción local que permite la coagulación sanguínea), y usted
pudiera manipular el metabolismo de una célula modelo de laboratorio, en qué ruta
metabólica utilizaría el acetil CoA?
6. El cianuro y el fluoroacetato son inhibidores irreversibles, en que rutas metabólicas
actúan y cuál es su modo de acción
7. Si tengo un polisacárido de almacenamiento tal como el almidón y lo degrado, lo
puedo utilizar para producir lípidos? ¿cómo?
8. Si tengo un polisacárido de almacenamiento tal como el almidón y lo degrado, lo
puedo utilizar para producir proteínas? ¿cómo?
9. Si tengo un polisacárido de almacenamiento tal como el almidón y lo degrado lo
puedo utilizar para producir ácidos nucleicos? ¿cómo?
10. Si tengo un lípido como un aceite y lo degrado, lo puedo utilizar para producir
carbohidratos? ¿cómo?
11. Si tengo una proteína y la degrado, la puedo utilizar para producir carbohidratos?
¿cómo?
12. Si tengo una proteína y la degrado, la puedo utilizar para producir lípidos? ¿cómo?
13. Si tengo una proteína y la degrado, la puedo utilizar para producir ácidos nucleicos?
¿cómo?
14. Enumere dos rutas anabólicas y dos rutas catabólicas de cada una de las
biomoléculas
15. Por qué motivo los ésteres fosfato se presentan como alternativas energéticas
mejores para ser utilizadas en las rutas metabólicas que los ésteres normales?

Sign up to vote on this title
UsefulNot useful