POLSKIE TOWARZYSTWO MIKROBIOLOGW POLISH SOCIETY OF MICROBIOLOGISTS

Polish Journal of Microbiology

I am pleased to inform you that Polish Journal of Microbiology has been selected for coverage in Thomson Scientific products and customers information services. Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM is included in: Science Citation Index Expanded (ISI) and Journal Citation Reports (JCR)/Science Edition. Stanisawa Tylewska-Wierzbanowska Editor in Chief

2011

Polish Journal of Microbiology

formerly Acta Microbiologica Polonica

2011, Vol. 60, No 1

CONTENTS
MINIREWIEV New antibacterial therapeutics and strategies
KUREK A., GRUDNIAK A.M., KRACZKIEWICZ-DOWJAT A., WOLSKA K.I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

ORIGINAL PAPERS Clonning, expression and identification by immunohistochemistry of humanized single-chain variable fragment antibody against Hepatitis C virus core protein
LUN Y.-Z., CHENG J., ZHONG Y.-W., YU Z.-G., WANG Q., WANG F., FENG J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

13

The occurrence and comparative phenotypic characteristics of Staphylococcus spp. from healthy and diseased, household and shelter dogs, based on routine biochemical diagnostic methods
KASPROWICZ A., BIAECKA A., BIAECKA J., GODZISZ I., BARABASZ W., JAWORSKA O., MAACHOWA N., MIDZOBRODZKI J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

19 27 35 43 51 59

Comparison of different PCR methods for detection of Brucella spp. in human blood samples
AL-AJLAN H.H., IBRAHIM A.S.S., AL-SALAMAH A.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Antibiofilm activity of selected plant essential oils and their major components
BUDZYSKA A., WICKOWSKA-SZAKIEL M., SADOWSKA B., KALEMBA D., RALSKA B. . . . . . . . . . . . . . . . . . . . .

Competitiveness of Rhizobium leguminosarum bv. trifolii strains in mixed inoculation of clover (Trifolium pratense)
WIELBO J., MAREK-KOZACZUK M., KIDAJ D., SKORUPSKA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Selection and adaptation of Saccharomyces cerevisae to increased ethanol tolerance and production
FIEDUREK J., SKOWRONEK M., GROMADA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Cytotoxicity of the Aspergillus fungi isolated from hospital environment

GNIADEK A., MACURA A.B., GRKIEWICZ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Production and partial charcterization of high molecular weight extracellular "-amylase from Thermoactinomyces vulgaris isolated from Egyptian soil
ABOU DOBARA M.I., EL-SAYED A.K., EL-FALLAL A.A., OMAR N.F. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

65 73

Halomonas sp. nov., an EPA-producing mesophilic marine isolate from the Indian Ocean
SALUNKHE D., TIWARI N., WALUJKAR S., BHADEKAR R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

SHORT COMMUNICATIONS Yersinia species in the dunnock (Prunella modularis) in sub-alpine habitats of the western Carpathians
KISKOV J., HREHOV Z., JANIGA M., LUK M., HAAS M., JUROVIOV M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

79 85

First report of Serratia plymuthica causing onion bulb rot in Poland

KOWALSKA B., SMOLISKA U., OSKIERA M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

INSTRUCTIONS TO AUTHORS AND FULL TEXT ARTICLES (IN PDF FORM) AVAILABLE AT: www.microbiology.pl/pjm

Polish Journal of Microbiology 2011, Vol. 60, No 1, 312

MINIREVIEW

New Antibacterial Therapeutics and Strategies

ANNA KUREK, ANNA M. GRUDNIAK, ANNA KRACZKIEWICZ-DOWJAT and KRYSTYNA I. WOLSKA*

Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology University of Warsaw, Warsaw, Poland Received 13 January 2011, accepted January 2011
Abstract Studies on new antibacterial therapeutics and strategies are currently being conducted in many microbiological, pharmaceutical and biochemical laboratories. The antibacterial activity of plant-derived compounds as well as silver and gold nanoparticles is the subject of this minireview. The application of photodynamic therapy is also discussed. K e y w o r d s: nanoparticles, new antimicrobials, phototherapy, plant compounds

Introduction The growing antibiotic resistance of pathogenic bacterial species is a serious problem for public health. It can be assumed, that although the bulk of traditional antibiotics can still manage drug-resistant bacteria, many commonly used antibiotics are no longer effective (Levy, 1998; Wright, 2010). This situation is aggravated by a decline in the development of new antibiotics, so recently few substances have appeared in the market (Donadio et al., 2010; Hgberg et al., 2010). In view of above, the growing interest in the studies aimed at developing new antibacterial therapeutics and strategies is very important not only from medical point of view but also for agriculture and animal breeding (Myles, 2003). The list of such therapeutics is long with stress on the use of bacteriophages as antibacterial agents (Chibani-Chennoufi et al., 2004; Grski et al., 2009). Many papers cover this problem so it will not be the subject of our publication. The present article describes the antibacterial potency and application of plant-derived compounds, nanoparticles and also the very promising photodynamic therapy. Plant-derived compounds Plant-derived compounds of therapeutic value are mostly the secondary plant metabolites (Cowan, 1999). Antibacterial phytochemicals are divided in several

categories, this article describe two of them terpenes and phenolics including polyphenols. As a matter of fact, these compounds cannot be considered a new group of antimicrobials because people have applied plants and plant extract for medical purposes for centuries (Rios and Recio, 2005). Terpenes. Terpenes, also referred to as isoprenoids, are based on an isoprene structure with general chemical formula C10H16 and are biosynthesized from the same basic units, isopentenyl diphosphate, IPP, and its isomer dimethylallyl diphophate, DMAPP (Fig. 1A). Their derivatives containing additional elements, usually oxygen, are called terpenoids. These compounds have a lot of biological functions and are applied as pharmaceuticals, fragrances, colorants. Terpenes constitute a very diverse group of compounds isolated not only from higher plants but also from microorganisms (Sacchettini and Poulter, 1997). Successful approaches in engineering Escherichia coli towards biosynthesis of functional isoprenoids were recently described (Harada and Misawa, 2009). Of special interest are two pentacyclic triterpenoids oleanolic acid (OA) and ursolic acid (UA) and their derivatives containing sugar moieties glucosides and glucuronides. The chemical formulas of OA/UA are presented in Figure 1B. The antibacterial activity of these compounds was recently reviewed (Wolska et al., 2010a). The data described in many papers are contrasting and indicate either a strong or weak

* Corresponding author: K.I. Wolska, Department of Bacterial Genetics, Institute of Microbiology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland; phone: (+48) 22 55-41-302; fax: (+48) 22 55 41402; e-mail: izabelaw@biol.uw.edu.pl

Kurek A. et al.

Fig. 1. Chemical formula of IPP and DMAPP (A) and OA and UA (B)

antibacterial effect of OA and UA which likely results from the method of compound purification and the bacterial strain used. A relatively small number of studies has been performed to investigate the basis of OA/UA antibacterial activity. It has been shown that both acids affected peptidoglycan metabolism in Listeria monocytogenes (Kurek et al., 2010), oleanolic acid cyclodextrins inhibited insoluble glucan synthesis by Streptococcus mutans (Kozai et al., 1999) and oleane-type triterpenoid, glycyrrhizin acted as a potent E. coli heat-labile enterotoxin inhibitor (Chen et al., 2009). In turn Ren and coworkers (2005) using microaaray techniques demonstrated that UA caused differential gene expression in E. coli and inhibited biofilm formation in several bacterial species.Recently Ge and coworkers (2010) proved the synergistic interactions of OA in combination with isoniazid, rifampicin or ethanbutol against Mycobacterium tuberculosis. The third pentacyclic triterpenoid with similar chemical structure betulic acid (BA) is inactive against a large number of Gram-positive and Gram-negative bacteria. This result illustrates the strong structurefunction influence of the antibacterial potential of terpenes (Fontanay et al., 2008; Wansi et al., 2010). Other terpenes or terpenoids, such as monoterpenes and sesquiterpenes and their derivatives, also display antimicrobial activity (Ahmed et al., 1993; Amaral et al., 1998; Habtermariam et al., 1993). Many publications describe the antibacterial potential of diterpenoids. It was demonstrated that six diterpenoids isolated from the bark of Podocarpus nagi, of which the most abundant compound was totarol, exhibited potent bactericidal activity against Gram-positive bacteria: Propionobacterium acnes, S. mutans and Staphylococcus aureus (Kubo et al., 1992). Naturally occurring diterpenoids with a dehydroabietane skeleton are highly bioactive (Savluchinske-Feio et al., 2006) e.g. isopimaric acid

extracted from immature cones of Pinus nigra inhibited the growth of multidrug-resistant and methicillinresistant Staphylococcus aureus MRSA (Smith et al., 2005). Antibacterial activity of diterpenoids isolated from hairy roots of Salvia sclarea L was also studied. The results showed that abietane diterpenoids: salvisipone, aethopinone, 1-oxoaethopinone and ferrugiol were bacteriostatic as well as bacteriocidal for cultures of S. aureus and S. epidermidis but not for the Gram-negative species, E. coli and Pseudomonas aeruginosa (Kuma et al., 2007). Salvipisione and aethiopinone expressed staphylococcal anti-biofilm activity, the reduction in the number of live biofilm cells and changes of biofilm morphology were observed. Both diterpenoids showed synergy with several classes of antibiotics, in case of $-lactams this phenomenon was due to the probable alternation of cell surface hydrophobicity and cell envelopes permeability (Walencka et al., 2007). It was also demonstrated that diterpenes inhibited the growth of M. tuberculosis (Copp and Pearce, 2007) and recently the Chinese group showed that diterpenes isolated from the genus Scutellaria possessed the substantial antimicrobial and antiviral activities (Shang et al., 2010). Phenolics and polyphenols. Phenolics and polyphenols constitute a very large group of chemical compounds. Simple phenols consist of a single substituted phenolic ring, flavones and their derivatives flavanoids and flavanols are phenolic structures containing one carbonyl group, while quinones contain two carbonyl groups. Tannins are polymeric phenolic substances and coumarins are phenolic compounds made of fused benzene and pyrone rings (Cowan, 1999). The chemical formulas of exemplary phenolic compounds are shown in Figure 2. The simple phenol, caffeic acid isolated from perennial thorny shrub, Paliurus spina-christi was

New antibacterial therapeutics and strategies

Fig. 2. Chemical formulas of exemplary phenolic compounds with antibacterial activity. Catechin (A), Antraquinone (B), Tannin (C)

effective against Gram-positive bacterial species (Brantner et al., 1996). p-guanidinethyl and its simple parent phenols were active against S. aureus; the simple phenolic species showed lower activity that their calixarene analogues (Mourer et al., 2009). Other groups demonstrated that more highly oxidized phenols were also more active probably due to their ability to oxidize of sulfhydryl groups in proteins (Urs and Dunleavy, 1975; Mason and Wasserman, 1987). Flavones and their derivatives, flavonoids and flavonols, due to their extremely large amount of biological properties, including the antibacterial activity, are placed among the most attractive plant derivatives enriching the current therapy options (Cazarolli et al., 2008). These compounds can form complexes with cell wall and also disrupt bacterial envelopes (Tsuchiya et al., 1996; Nakayama et al., 2000). Of special interest are catechins, the subgroup of flavonoids present in the oolong green teas which beneficial effect on human health is well known (Cabrera et al., 2006). These compounds are active against food-borne pathogenic bacteria and therefore exert the beneficial effect in gastrointestinal diseases (Friedman, 2007; Dryden et al., 2006; Koo and Cho, 2004). It was shown that catechins inhibited in vitro the growth of several bacterial species such as Vibrio cholerae, S. mutans and Shigella spp. (Borris, 1996; Sakanaka et al., 1992; Vijaya et al., 1995). Inactivation of specific bacterial enzymes, V. cholerae toxin and glucosyltransferases in S. mutans, was also reported (Borris, 1996; Nakahara et al., 1993). Chrysin, another flavonoid abundant in propolis, also displays substantial antimicrobial activity, preferentially against Gram-positive species, e.g. Streptococcus sobrinus, Enterococcus faecalis and Micrococcus luteus (Uzel et al., 2005). Its activity against certain oral pathogens, such as Peptostreptococcus anaerobius, Peptostreptococcus micros and Lactobacillus acidophilus creates the possibility of propolis application in the treatment of oral cavity diseases (Koru et al., 2007). Recently novel C(7) modified chrysin was synthesized. This modification was deliberately designed in order to enhance the anti-

bacterial effect. The biological assays indicated that this compound is a potent inhibitor of beta-ketoacyl-acyl carrier protein synthetase (FabH) in E. coli (Suresh Babu et al., 2006; Li et al., 2009). A number of papers are concerned with the antibacterial activity of quinones. This activity is based on their high chemical reactivity inactivating the chemical compounds, mainly proteins. Surfaceexposed bacterial adhesins, cell wall polypeptides and membrane bound enzymes are their probable targets (Cowan, 1999; Koyama, 2006). Because the redoxpotential of these compounds was so essential to their activity, electrochemical techniques along with biochemical and medical knowledge were successfully combined to design and develop therapeutically efficient derivatives (Hillard et al., 2008). It should be also mentioned that quinones are strong poisons for bacterial type II topoisomerases gyrase and TopoIV (Pommier et al., 2010). Potent antibacterial activity is attributed to the anthraquinones. It was demonstrated that anthraquinone isolated from Cassia italica is bacteriostatic for Bacillus antracis, Corynebacterium pseudodiphtericum and P. aeruginosa (Kazumi et al., 1994), in turn hypericin and hyperforin isolated from Hypericium perforatum (St. Johns wort) were active against Gram-positive species S. aureus, S. epidermidis, E. faecalis and Bacillus subtilis (Males et al., 2006; Saddiqe et al., 2010). Recently it was shown that the antibacterial activity of anthraquinone derivatives from Heterophyllaea postulata against S. aureus involved an increase in the level of superoxide anion and singlet molecular oxygen (Comini et al., 2010). The antimycobacterial activity of quinones was also described (Copp and Pearce, 2007). Tannins are divided in two groups hydrolysable (derivatives of gallic acid) and condensed, also called proanthocyanidins (derived from flavonoid monomers). Among the various health beneficial activities of tannins their antimicrobial activity is often referred to. These compounds are characterized by strong antiperoxidation properties which may be responsible for the inactivation of microbial adhesions, enzymes and

Kurek A. et al.

cell envelope transport proteins (Okuda, 2005). The antioxidation activity of tannins is based on their ability to scavenge free radicals, to chelate metals and to inhibit of prooxidative enzymes and lipid peroxidation (Koleckar et al., 2008). It was well documented that tannins inhibited the growth of aquatic and foodborne bacteria, so they can be used in food processing to increase the storage time of certain foods (Chung et al., 1998). Tannins, especially proanthocyanins, inhibit the growth of uropathogenic E. coli (Cimolai and Cimolai, 2007), S. mutans (de la Iglesia et al., 2010) as well as ruminal bacteria. For the latter it was documented that condensed tannin (sainfoin) inhibited the growth and protease activity of Butyrivibrio fibrisolvens A38 and Streptococcus bovis. The morphological changes of these species implicated the cell wall as a target of tannin toxicity (Jones et al., 1994). In turn, both hydrolysable tannins and proanthocyanidines suppressed the oxacillin-resistance of MRSA (Hatano et al., 2005). The number of publications dealing with antimicrobial activity of yet another group of phenolics, cummarins, is scarce and generally it can be concluded that this property has not been evaluated systematically (Borges et al., 2005; Cechinel Filho et al., 2009). Silver and gold nanoparticles Nanoparticles (NPs) are defined as the clusters of atoms of size ranged from 1 to 100 nm. Their network forms are called nanowires. NPs are characterized by a very large surface area to volume ratio (Rai et al., 2009). Copper, zinc, magnesium but especially silver and gold NPs display antibacterial activity and are used for various healthcare, hygiene and personal care purposes and also in water-treatment (Edwards-Jones, 2009; Gurunathan et al., 2009). The conventional methods of NPs preparation involves the use of highly toxic chemical agents, however more friendly techniques have also been developed (Baker et al., 2005; Wangoo et al., 2008). Recently the biological systems for nanoparticles synthesis were elaborated, the process is known as green synthesis. Sharma and coworkers (2009) described the production of silver nanoparticles (AgNPs) by plant extract containing proteins able to reduce Ag cations. Bacteria and fungi can also be explored for AgNPs production. Their biosynthesis was achieved through reduction of Ag+ ions by Klebsiella pneumoniae (Shahverdi et al., 2007), E. coli (Gurunathan et al., 2009) and Bacillus licheniformis (Vaidyanathan et al., 2010). Ingle et al. (2008) and Gade et al. (2008) reported the use of fungi, respectively Fusarium accuminatum and Aspergillus niger, for the production of AgNPs. In turn He et al. (2008) described the synthesis of gold nanowires using an extract of Rhodopseudomonas capsulata. It

Fig. 3. Different types of silver and gold nanoparticles

should be noted that recently microbial synthesis of selenium, tellurium platinum, thitania, uranitnie and other nanoparticles by bacteria, actinomycetes, fungi, yeasts and viruses was also reported (Narayanan and Sakthivel, 2010). Silver in ionic form has been known for centuries to cure venereal diseases, bone and perianal abscesses, eye diseases and burns. It was proved that Ag+ was active against various bacterial species e.g. E. coli, S. aureus, Klebsiella sp. and Pseudomonas sp. (Rai et al., 2009; Chopra, 2007). AgNPs have an advantage over ionic silver because they show reduced toxicity and 1.41.9 times higher antibacterial potential (Ingle et al., 2008). Reports pointing to silver toxicity, including arygria and the deposition of silver in liver are rather scarce (Tomi et al., 2004; Landsdown, 2006). The antibacterial effect of AgNPs depends on their size. Smaller-sized particles show stronger antibacterial activity due to their higher surface area to volume ratio (Morones et al., 2005). It was also proved that the truncated triangular AgNPs displayed stronger bacteriocidal action against E. coli compared with spherical and rod-shaped nanoparticles, suggesting shape-dependent interaction at least with Gram-negative bacteria (Pal et al., 2007). Different shapes of silver and gold nanoparticles are shown in Figure 3. Several studies demonstrated that bacterial membranes constituted the main target of AgNPs antibacterial activity, nanoparticles caused their disruption probably due to the production of reactive oxygen species (ROS), including free radicals. Production of ROS is one of the primary mechanisms of nanoparticle toxicity; it may result in oxidative stress, inflammation, and consequent damage not only of membranes but also of DNA and proteins (Singh et al. 2008). The model of bacterium nanoparticle interactions presented by Neal (2008) is based on contact-mediated membrane lipid peroxidation by arising reactive oxygen species. Contact was facilitated by electrostatic forces between nanoparticles and negatively charged cell envelopes. Scanning and transmission electron

New antibacterial therapeutics and strategies

microscopy images confirmed the formation of pits in the E. coli cell wall and the accumulation of silver in bacterial membranes which increases permeability and therefore results in cell death (Sondi and SalopekSondi, 2007). AgNPs may target the bacterial membrane, leading to a dissipation of the proton motive force as shown by proteomic data and biochemical studies. Short exposure of E. coli cells to AgNPs resulted in alterations in the expression of several envelope proteins (OmpA, OmpC, OmpF, OppA, MetQ) and heat shock proteins, (IbpA, IbpB and 30S ribosomal subunit) (Lok et al., 2006). AgNPs interaction with membrane sulfur-containing proteins was also proven (Rai et al., 2009). Membrane disruption allowed the passage of AgNPs into cytoplasm causing subsequent damage of DNA and other phosphorus containing compounds and impairing the respiratory chain and cell division. The antibacterial activity of AgNPs is enhanced by their decomposition and the release of Ag ions within bacterial cell (Feng et al., 2000; Morones et al., 2005). The antibacterial activity of AgNPs was well proven basing on in vitro experiments. Activity against MRSA (Panacek et al., 2006), E. coli (Sondi and Salopek-Sondi, 2007; Morones et al., 2005; Pal et al., 2007; Yoon et al., 2007), P. aeruginosa (Morones et al., 2005), Vibrio cholera (Morones et al., 2005) and B. subtilis (Yoon et al., 2007) was reported. Kim and coworkers (2007) demonstrated that E. coli was inhibited at low concentration of AgNPs whereas the growth-inhibitory effect of S. aureus was mild. The efficient antibacterial activity of AgNPs impregnated with bacterial cellulose against E. coli and S. aureus has also been demonstrated (Castellano et al., 2007). Sucrose and soluble and waxy corn starch can also serve as stabilizers (Valodkar et al., 2010). Synergistic antimicrobial activity of AgNPs with penicillin G, amoxicillin, erythromycin, clindamycin and vancomycin against S. aureus and E. coli was observed (Shahverdi et al., 2007). It was also shown that AgNPs prevent the formation of bacterial biofilms, e.g. biofilms formed by P. aeruginosa and S. epidermidis were inhibited in more than 95% (Kalishwaralal et al., 2010). This property made these nanoparticles especially useful in controlling biofilms within the oral cavity (Allaker, 2010). Biofilm formation was inhibited due to the ability of AgNPs to prevent the initial step in biofilm development i.e. microbial adhesion to various surfaces (Monteiro et al., 2009). AgNPs are characterized by so many medical and technological applications that they are considered as new antibacterial agents revolutionizing applied medicine. They are used in wounds and ulcers healing, usually in the form of dressings and creams (Cortivo et al., 2010; Jun et al., 2007). They are also utilized to coat medical devices such as catheters, den-

tures or surgical masks (Li et al., 2006). Silver, together with copper, is commonly used to inhibit bacterial and fungal growth in chicken farms and in post harvested cleaning of oysters (Singh et al., 2008). AgNPs and other nanoparticles can be used in water filtration and disinfection (Li et al., 2008; Jain and Pradeep, 2005) as well in the production of textiles, both non-toxic and possessing antimicrobial properties (Dastjerdi and Montazer, 2010) and in the production of antimicrobial nanopaints (Kumar et al., 2008). Gold nanoparticles (AuNPs) also can be used as antimicrobial agents. In this case the majority of papers describes their application as a tool to deliver other antimicrobials or as a factor enhancing photodynamic destruction of bacteria (Pissuwan et al., 2009). AuNPs were very suitable for delivering drugs, including antibiotics; AuNPs conjugates with vancomycin proved to be 50-fold more active that the free antibiotic against Enterococcus faecium and E. faecalis (Gu, 2003). The AuNPs-ciprofloxacin and aminoglycosidic antibiotics conjugates were also described (Tom et al., 2004; Grace and Pandian, 2007). The role of AuNPs was to facilitate the attachment of conjugated antibiotic to bacterium and therefore penetrating of cell wall. However it should be stressed that there is no consensus concerning the efficacy of AuNPsantibiotic conjugates compared with the same dosage of free antibiotic, e.g. Rosemary et al. (2006) found that AuNPs enhanced the efficacy of ciprofloxacin against E. coli what was not observed for gentamycin (Burygin et al., 2009). AuNPs were also used as stabilizers for various antimicrobial photosensitizers. Four-fold increase of S. aureus elimination was observed when toluidine blue O-AuNPs conjugates and methylene blue-AuNPs conjugates were used in photodynamic therapy compared to dyes alone (Gil-Toms et al., 2007; Perni et al., 2009). AuNPs enhanced the absorption of light due to their plasmon resonance (Pitsillides et al., 2003) which could cause local hyperthermic effect leading to the efficient destruction of E. coli irradiated with X-rays (Simon-Deckers et al., 2009), P. aeruginosa exposed to near-infrared laser (Norman et al., 2008) or S. aureus irradiated with strong laser light (Zharov et al., 2006). AuNPs are very useful for detection and diagnosis of bacteria even in complex media like blood (Kaittanis et al., 2010), this being mainly based on the detection of bacterial DNA by change of color (Elghanian et al., 1997). They have been used for fast, accurate and sensitive detection of Staphylococcus sp. (Storhoff et al., 2004) and M. tuberculosis (Baptista et al., 2006; Veigas et al., 2010). AuNPs were also applied to improve the sensitivity of bacterial detection methods based on flow cytometry and fluorescence (Zaharov et al., 2007; Wang et al., 2009).

8
Natural and synthetic dyes and photodynamic therapy

Kurek A. et al.

The antimicrobial effect of natural and synthetic dyes has been known for many decades. Already in the beginning of the last century proflavine, acriflavine, crystal violet and brilliant green were used against bacterial infections, mainly to cure infected wounds (Wainwright, 2008; Wainwright, 2010). Preoperative use of iodine still remains a common practice. Gentian (crystal) violet was shown to be very efficient in the eradication of MRSA from skin lesions (Saji et al., 1995). Recently it was shown that the tiazol dye, thioflavin T, exerted a strong inhibitory effect on S. aureus, the effect on E. coli was less pronounced (Lakato, 2010). The list of dyes with antibacterial properties included also pigments synthesized by microorganisms (Wolska et al., 2010b). The pigment produced by P. aeruginosa pyocyanin, due to its unique redox properties, actively eliminated many bacterial species, especially Gram-positive aerobes (Baron and Rove, 1981). In turn violacein extracted from Chromobacterium violaceum displayed a potent antileishamanial activity (Leon et al., 2001). Many dyes can serve as photosensitizers, sometimes called photomicrobial agents, and are applied in photodynamic antimicrobial therapy (PACT). Photosensitizers can be activated by visible light to generate cytotoxic radicals, superoxide radicals and singlet oxygen O2 which are the reactive oxygen species (ROS). ROS are highly toxic to various type of cells, including bacteria, causing the damage of the outer membrane, cell wall, ribosomes and nucleic acids and thus impairing many cellular functions (for review see Wainwright, 2010; Ryskova et al., 2010). Photosensitizers are usually dyes such as methylene blue (Gad et al., 2004), porphyrins (Hamblin et al., 2005), crystal violet (Saji et al., 1995), iodocyanine green (Unno et al., 2008) and erytrosine (Wood et al., 2006).The latter is of special interest because it can be used for the therapy of oral plaque biofilms (Wood et al., 2006). Positively charged (cationic) photosensitizers such as methylene blue and crystal violet act as broad-spectrum antimicrobials, while the negatively charged (anionic) compounds lack efficacy against Gram-negative species (Demidova et al., 2005). This is because anionic photosensitizers are not able to penetrate the lipopolysaccharide outer membrane of Gram-negative bacteria. In practice photosensitizers are usually activated by red light and the preferable source of light is low-power lasers (Ryskova et al., 2010). The stabilization of various photosensitizers by AuNPs was described in the previous chapter. Beside dyes, also fullerenes which are stable chemical molecules composed of 60 carbon atoms arranged in a soccer ball-

shaped structure are proved to be the efficient photosensitizers (Krokosz, 2007). Photodynamic therapy is used mainly in the treatment of local infections. Its efficacy was proved in healing cutaneous infections e.g. poor-healing wounds caused by Mycobacterium marinum (Rallis and Koumantaki-Mathioudaki, 2007) and oral microbial related diseases such as periodontitis (Liu et al., 2009). It was clinically studied for leishmaniasis (Dai et al., 2009). It should be stressed that photodynamic therapy can be applied in the eradication of antibioticresistant pathogens e.g. MRSA (Griffiths et al., 1997), VRE (Soncin et al., 2002) and P. aeruginosa (Minnock et al., 1996) which are life-threat danger in hospitals. Recently it was shown that two water soluble photosensitizers: methylene blue and neutral red enclosed in liposomes gave a stronger antibacterial effect than their free forms (Nisnevitch et al., 2010). It should be also noted that photodynamic therapy was applied and found to be efficient in treating lung, stomach and skin tumors (Maisch et al., 2005). Conclusions The huge and constantly growing amount of papers describing new antibacterial therapeutics reflects an urgent need to find efficient antimicrobials which can be an alternative to antibiotics. Plants and their extracts have been used even in ancient times for medical purposes. Recently, studies are focused on the activity of purified compounds. Trials aimed at resolving the mechanism of their action are also performed. The majority of studies are held in vitro but the results of preclinical and clinical trial have also been reported. As it was shown that many plant compounds exert a cytotoxic effect (Zhang et al., 2007) efforts have been made to synthesize derivatives with less toxicity and better water solubility (e.g. Farina et al., 1998; Liu, 2005), which can enhance the possibility of their therapeutic application. Studies on the antibacterial activity of silver and gold nanoparticles are more advanced and also comprise their synergism with commonly used antibiotics and the application of AuNPs in stabilizing photosensitizers used in photodynamic therapy, which is a very proficient new antibacterial strategy. Considering the enormous scientific effort put in elaborating new antibacterial compounds and strategies, alternative possibilities to cope with bacterial diseases can emerge in the near future.
Acknowledgment This study was partially supported by Ministry of Science and Higher Education grant NN302 027937.

1
Literature

New antibacterial therapeutics and strategies

Ahmed A.A., A.A. Mahmoud, H.J. Williams, A.I. Scott, J.H. Reinbenspiesand and T.J. Mabry. 1993. New sesquiterpene "-methylene lactones from the Egyptian plant Jasonia candicans. J. Nat. Prod. 56: 12761280. Allaker R.P. 2010. The use of nanoparticles to control oral biofilm formation. J. Dent. Res. 89: 11751186. Amaral J.A., A. Ekins S.R. Richards and R. Knowles. 1998. Effect of selected monoterpenes on methane oxidation, denitrification, and aerobic metabolism by bacteria in pure culture. Appl. Environ. Microbiol. 64: 520525. Baker C., A. Pradhan, L. Pakstis, D.J. Pochan and S.I. Shah. 2005. Synthesis and antibacterial properties of silver nanoparticles. J. Nanosci. Nanotechnol. 5: 244249. Baptista P.V., M. Koziol-Montewka, J. Paluch-Oles, G. Doria and R. Franco. 2006. Gold-nanoparticle-probe-based assay for rapid and direct detection of Mycobacterium tuberculosis DNA in clinical samples. Clin. Chem. 52: 14331434. Baron S. and J.J. Rove. 1981. Antibiotic action of pyocyanin. Antimicrob. Agents Chemother. 20: 814830. Borges F., F. Roleira, N. Mihazes, L. Santana and E. Uriarte. 2005. Simple coumarins and analogues in medical chemistry: occurrence, synthesis and biological activity. Curr. Med. Chem. 12: 887916. Borris R.P. 1996. Natural products research: perspectives from a major pharmaceutical company. J. Ethnopharmacol. 51: 2938. Brantner A., . Male, S. Pepelnjak and A. Antoli. 1996. Antimicrobial activity of Paliurus spina-christi Mill. (Christs thorn). J. Ethnopharmacol. 52: 119122. Burygin G.L., B.N. Khlebtstov, A.N. Shantrokha, L.A. Dykman, V.A. Bogatyrev and N.G. Khlebtsov. 2009. On the enhanced antibacterial activity of antibiotics mixed with gold nanoparticles. Nanoscale Res. Lett. 4: 794801. Cabrera C., R. Artacho and R. Gimnez. 2006. Beneficial effect of green tea a review. J. Am. Coll. Nutr. 25: 7999. Castellano J.J., S.M. Shafii, F. Ko, G. Donate, T.E. Wright, R.J. Mannari, W.G. Payne, D.J. Smith, M.C. Robson. 2007. Comparative evaluation of silver-containing antimicrobial dressings and drugs. Int. Wound J. 4: 114122. Cazarolli L.H., L. Zanatta, E.H. Alberton, M.S. Figueiredo, P. Folador, R.G. Damazio, M.G. Pizzolatti and F.R. Silva. 2008. Flavonoids: prospective drug candidates. Mini Rev. Med. Chem. 8: 14291440. Cechinel Filho V., C. Meyre-Silva and R. Neiro. 2009. Chemical and pharmacological aspects of the genus Calophyllum. Chem. Biodivers. 6: 313327. Chen J.-C., T.-H. Ho, Y.-S. Chang, S.-L. Wu, C.-C. Li and C.-Y. Hsiang. 2009. Identification of Escherichia coli enterotoxin inhibitors from traditional medical herbs in silico, in vitro and in vivo analyses. J. Ethnopharmacol. 121: 372378. Chibani-Chennoufi S., J. Sidoti, A. Bruttin, E. Kutter, S. Sarker and H. Brussow. 2004. In vitro and in vivo bacteriolytic activities of Escherichia coli phages: implications for phage therapy. Antimicrob. Agents Chemother. 48: 25582569. Chopra I. 2007. The increasing use of silver-based products as antimicrobial agents: a useful development or a case for concern? J. Antimicrobial. Chem. 59: 587590. Chung K.T., T.Y. Wong, C.I. Wei, Y.W. Huang and Y. Lin. 1998. Tannins and human health: a review. Crit. Rev. Food Sci. Nutr. 38: 421464. Cimolai N. and T. Cimolai. 2007. The cranberry and urinary tract. Eur. J. Clin. Microbiol. Infect. Dis. 26: 767776. Comini L.R., S.C. Nez Montoya, P.L. Pez, G.A. Argello, I. Albesa and J.L. Cabrera. 2010. Antibacterial activity of anthra-

quinone derivatives from Heterophyllaea postulate (Rubiaceae). J. Photochem. Photobiol. B. Copp B.R. and A.N. Pearce. 2007. Natural product growth inhibitors of Mycobacterium tuberculosis. Nat. Prod. Rep. 24: 278297. Cortivo R., V. Vindigni, L. Iacobellis, G. Abatangelo, P. Pinton and B. Zavan. 2010. Nanoscale particle therapies for wounds and ulcers. Nanomedicine 5: 641656. Cowan M.M. 1999. Plant product as antimicrobial agents. Clin. Microbiol. Rev. 12: 564582. Dai T., Y.-Y. Huang and M.R. Hamblin. 2009. Photodynamic therapy for localized infections state of art. Photodiag. Photodyn. Ther. 6: 170188. Dastjerdi R. and M. Montazer. 2010. A review on the application of inorganic nano-structured materials in the modification of textiles: focus on anti-microbial properties. Colloids Surf. B. Interfaces. 79: 518. de la Iglesia R., F.I. Milagro, J. Campin, N. Boqu and J.A. Martinez. 2010. Healthy properties of proanthocyanidins. Biofactors 36: 159168. Demidova T.N. and M.R. Hamblin. 2005. Effect of cell-photosensitizer binding and cell density on microbial photoinactivation. Antimicrob. Agents Chemother. 49: 23292335. Donadio S., S. Maffiolo, P. Monciardini, M. Sosio and D. Jabes. 2010. Antibiotic discovery in the twenty-first century: current trends and future perspectives. J. Antibiot. (Tokyo) 63: 423430. Dryden G.W., M. Song and C. McClain. 2006. Polyphenols and gastrointestinal diseases. Curr. Opin. Gastroenterol. 22: 165170. Edwards-Jones V. 2009. The benefits of silver in hygiene, personal care and healthcare. Lett Appl. Microbiol. 49: 147152. Elghanian R., J.J. Storhoff, R.C. Mucic, R.L. Letsinger and C.A. Mirkin. 1997. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Science 277: 10781081. Farina C., M. Pinza and G. Pifferi. 1998. Synthesis and antiulcer activity of new derivatives of glycyrrhetic, oleanolic and ursolic acids. Pharmacology 53: 2232. Feng Q.J., J. Wu, G.Q. Chen, F.Z. Cui, T.N. Kim and J.Q. Kim. 2000. A mechanistic study of the antibacterial effect of silver ions on Escherichia coli and Staphyloccocus aureus. J. Biomed. Matter 52: 662668. Fontanay S., M. Grare, J. Mayer, C. Finance and R.E. Duval. 2008. Ursolic, oleanolic and betulic acids: Antibacterial spectra and selectivity indexes. J Ethnopharmacol. 120: 272276. Friedman M. 2007. Overwiew of antibacterial, antitoxin, antiviral and antifungal activities of tea flavonoids and teas. Mol. Nutr. Food Res. 51: 116134. Gad F., T. Zahra, T. Hasan and M.R. Hamblin. 2004. Effect of growth phase and extracellular slime on photodynamic inactivation of Gram-positive pathogenic bacteria. Antimicrob. Agents Chemother. 48: 21732178. Gade A.K., P. Bonde, A.P. Ingle, P.D. Marcato, N. Duran and M.K. Rai. 2008. Explotation of Aspergillus niger for synthesis of silver nanoparticles. J. Biol. Mater. Bioener. 2: 15. Ge F., F. Zeng, S. Liu, N. Guo, H. Ye, Y. Song, J. Fan, X. Wu, X. Wang, X. Deng, Q. Jin and L. Yu. 2010. In vitro synergistic interactions of oleanolic acid in combination with isoniazid, rifampicin or ethambutol against Mycobacterium tuberculosis. J. Med. Microbiol. 59: 56772. Gil-Thoms J., S. Tubby, I.P. Parkin, N. Narband, L. Dekker, S.P. Nair, M. Wilson and C. Street. 2007. Lethal photosensitisation of Staphylococcus aureus using toluidine blue O-tioproningold nanoparticle conjugate. J. Mat. Chem. 17: 37393746. Grski A., A. Midzybrodzki, J. Borysowski, B. WeberDbrowska, M. obocka, W. Fortuna, S. Letkiewicz, M. Zimecki

10

Kurek A. et al.

and G. Filby. 2009. Bacteriophage therapy for the treatment of infections. Curr. Opin. Investig. Drugs 10: 766774. Grace N.A. and K. Pandian. 2007. Antibacterial efficacy of aminoglycosidic antibiotics protected gold nanoparticles A brief study. Colloids Surf. A Physicochem. Eng. Asp. 297: 6370. Griffiths M.A., B.W. Wren and M. Wilson. 1997. Killing of methicillin-resistant Staphylococcus aureus in vitro using aluminium disulphonated phthalocyanine, a light-activated antimicrobial agent. J. Antimicrob. Chemother. 40: 873876. Gu H., P.L. Ho, E. Tong, L. Wang, B. Xu. 2003. Presentation of vancomycin on nanoparticles to enhance antimicrobial activities. Nano Lett. 3: 12611263. Gurunathan S., K. Kaliswaralal, R. Vaidyanathan, D. Venkataraman, S.R. Pandian, J. Hariharan and S.H. Eom. 2009. Biosynthesis, purification and characterization of silver nanoparticles using Escherichia coli. Colloids Surf. B. Interfaces 74: 328335. Habtermariam S., A.I. Gray and P.G. Waterman. 1993. A new antibacterial sesquiterpene from Premna oligotricha. J. Nat. Prod. 56: 140143. Hamblin M.R., J. Viveiros, C.H. Yang, A. Ahmadi, R.A. Ganz and M.J. Tolkoff. 2005. Helicobacter pylori accumulates photoactive porphyrins and is killed by visible light. Antimicrob. Agents Chemother. 49: 28222827. Harada H. and N. Misawa. 2009. Novel approaches and achievements in biosynthesis of functional isoprenoids in Escherichia coli. Appl. Microbiol. Biotechnol. 84: 10211031. Hatano T., M. Kusuda, K. Inada, T.O. Ogawa, S. Shiota, T. Tsuchiya and T. Yoshida. 2005. Effects of tannins and related polyphenols on methicillin-resistant Staphylococcus aureus. Phytochemistry 66: 20472055. He S., Y. Zhang, Z. Guo and N. Gu. 2008 . Biological synthesis of gold nanowires using extact of Rhodopseudomonas capsulata. Biotech. Prog. 24: 476480. Hillard E.A., F.C. de Abreu, D.C. Ferreira, G. Jaouen, M.O. Goulart, C. Amatore. 2008. Electrochemical parameters and techniques in drug development, with an emphasis on quinones and related compounds. Chem Commun. (Camb.) 21: 26122628. Hgberg L. D., A. Heddini and O. Cars. 2010. The global need for effective antibiotics: challenges and recent advances. Trends Pharmacol. Sci. 31: 509515. Ingle A., A. Gade, S. Pierrat, C. Sonnichsen and M. Rai. 2008. Mycosynthesis of silver nanoparticles using the fungus Fusarium acuminatum and its activity against some human pathogenic bacteria. Curr. Nantechnol. 4: 141144. Jain P. and T. Pradeep. 2005. Potential of silver nanoparticlecoated polyurethane foam as an antibacterial water filter. Biotechnol. Bioeng. 90: 5963. Jones G.A., T.A. McAllister, A.D. Muir and K.J. Cheng. 1994. Effects of sainfoin (Onobrychis viciifolia Scop.) condensed tannins on growth and proteolysis by four strains of ruminal bacteria. Appl. Environ. Microbiol. 60: 13741378. Jun J., D. Yuan-Yuan, W. Shao-feng, W. Zhong-yi. 2007. Preparation and characterization of antibacterial silver-containing nanofibers for wound dressing applications. J. US-China Med. Sci. 4: 5254. Kaittanis C., S. Santra and J.M. Perez. 2010. Emerging nanotechnology based strategies for the identification of microbial pathogenesis. Adv. Drug Deliv. Rev. 62: 408423. Kalishwaralal K., S. BarathManiKanth, S.R. Pandian, V. Deepak and S. Gurunathan. 2010. Silver nanoparticles impede the biofilm formation by Pseudomonas aeruginosa and Staphylococcus epidermidis. Colloids Sur. B Biointerfaces 79: 340344. Kazumi M.H., A. Malik, S. Hammed, N. Akhtar and S. Noor Ali. 1994. An anthraquinone derivative from Cassia italica. Phytochemistry 36: 761763.

Kim J.S., E. Kuk, K.N. Yu, J.H. Kim, S.J. Park, H.J. Lee, S.H. Kim,. Y.K. Park, C.Y. Hwang, Y.K. Kim, Y.S. Lee, D.H. Jeong and M.H. Cho. 2007. Antimicrobial effect of silver nanoparticles. Nanomedicine 3: 95101. Koleckar V., K. Kubikova, Z. Rehakova, K. Kuca, D. Jun, L. Jahodar and L. Opletal. 2008. Condensed and hydrolysable tannins as antioxidants influencing the health. Mini Rev. Med. Chem. 8: 436447. Koo M.W. and C.H. Cho. 2004. Pharmacological effect of green tea on the gastrointestinal system. Eur. J. Pharmacol. 500: 177185. Koru O., F. Toksoy, C.H. Acikel, Y.M. Tunca, M. Baysallar, A. Uskudar Guculu, E. Akca, A. Ozkok Tuylu, K. Sorkun, M. Tanyuksel and B. Salih. 2007. In vitro antimicrobial activity of propolis samples from different geographical origins against certain oral pathogens. Anaerobe 13: 140145. Koyama J. 2006. Anti-infective quinone derivatives of recent patents. Recent Pat. Antiinfect. Drug Discov. 1: 113125. Kozai K., J. Suzuki, M. Okada and N. Nagasaka. 1999. Effect of oleanolic acid-cyclodextrin inclusion compounds on dental carries by in vitro experiment in rat-carries model. Microbios 97: 179188. Krokosz A. 2007. Fullerenes in biology (in Polish). Post. Biochem. 53: 9196. Kubo I., H. Muroi and M. Himejima. 1992. Antibacterial activity of totarol and its potentiation. J. Nat. Prod. 55: 14361440. Kumar A., P. K. Vemula, P. M. Ajayan and G. John. 2008. Silver nanoparticle-embeded antimicrobial paints based on vegetable oil. Nat. Mater. 7: 236241. Kurek A., A.M. Grudniak, M. Szwed, A. Klicka, . Samluk and K.I. Wolska. 2010. Oleanolic acid and ursolic acid affect peptidoglycan metabolism in Listeria monocytogenes. Anton, Leuven. 97: 11431146. Kuma ., M. Ralski, E. Walencka, B. Ralska and H. Wysokiska. 2007. Antimicrobial activity of diterpenoids from hairy roots of Salvia sclarea L.: salvipisone as a potential anti-biofilm agent active against antibiotic resistant Staphylococci. Phytomedicine 14: 3135. Lakato B., B. Kalikov, D. Hudecov. and L. Vareka. 2010. New effect and applications of thioflavins. Centr. Eur. J. Biol. 5: 143150. Landsdown A.B. 2006. Silver in health care: antibacterial effect and safety in use. Curr. Probl. Dermatol. 33: 1734. Leon L.L., C.C. Miranda, A.O. De Souza and N. Durn. 2001. Antleishmanial activity of the violacein extracted from Chromobacterium violaceum. J. Antimicrob. Chemother. 48: 449450. Levy S.B. 1998. The challenge of antibiotics resistance. Sci. Am. 278: 4653. Li Y., P. Leung, Q.W. Song and E. Newton. 2006. Antimicrobial effect of surgical masks coated with nanoparticles. J. Hosp. Infect. 62: 5863. Li Q., S. Mahendra, D.Y. Lyon, L. Brunet, M.V. Liga, D. Li and P.J. Alvarez. 2008. Antimicrobial nanomaterials for water disinfection and microbial control: potential applications and implications. Water Res. 42: 45914602. Li H.Q., L. Shi, Q. S. Li, P.G. Liu, Y. Luo, J. Zhao and H.L. Zhu. 2009. Synthesis of C(7) modified chrysin derivatives designing to inhibit beta-ketoacyl-acyl carrier protein synthetase III (FabH) as antibiotics. Bioorg. Med. Chem. 17: 62646269. Liu P.F., W.H. Zhu and C.M. Huang. 2009. Vaccines and photodynamic therapies for oral microbial-related diseases. Curr. Drug. Metab. 10: 9094. Liu J. 2005. Oleanolic and ursolic acids: Research perspectives. J. Ethnopharmacol. 100: 9294. Lok Ch-M., Ch-M. Ho, R. Chen, Q-Y. He, W-Y. Yu, H. Sun, Kwong-Hang, P. Tam, J-F. Chiu and Ch-M. Chi-Ming Che. 2006. Proteomic analysis of the mode of antimicrobial action of silver nanoparticles. J. Prot. Res. 5: 916924.

New antibacterial therapeutics and strategies

11

Maisch T., C. Bosi, R.M. Szeimies, N. Lehn and C. Abels. 2005. Photodynamic effect of novel XF porfyrin derivatives on prokaryotic and eukaryotic cells. Antimicrob. Agents Chemother. 49: 15421552. Males Z., A.H. Branter, K. Sovi, K.H. Pilepi and M. Plazibat. 2006. Comparative phytochemical and antimicrobial investigations of Hypericium perforatum L. subsp. perforatum and H. perforatum subsp. angustifolium (DC.) Gaudin. Acta Pharm. 56: 359367. Mason T.L. and B.P. Wasserman. 1987. Inactivation of red beet beta-glucan synthetase by native and oxidized phenolic compounds. Phytochemistry 26: 21972202. Minnock A., D.I. Vernon, J. Schofield., J. Griffith., J. Howard Parish and S.B. Brown. 1996. Photoinactivation of bacteria. Use of cationic water-soluble zinc phthalocyanine to photoinactivate both Gram-negative and Gram-positive bacteria. J. Photochem. Photobiol. B. Biol. 32: 15964. Monteiro D.R., L.P. Gorup, A.S. Takamiya, A.C. RuvolloFilho, E.R. de Camargo and D. Barros Barbosa. 2009. The growing importance of materials that prevent microbial adhesion: antimicrobial effect of medical devices containing silver. Int. J. Antimicrob. Agents 34: 103110. Morones J.R., J.L. Elechigerra, A. Camacho and J.T. Ramirez. 2005. The bacterial effect of silver nanoparticles. Nanotechnology 16: 23462353. Mourer M., H.M. Dibama, S. Fontanay, M. Grare, R.E. Duval, C. Finance and J.B. Regnouf-de-Vains. 2009. p-Guanidinoethyl calixarene and parent phenol derivatives exhibiting antibacterial activities. Synthesis and biological evaluation. Bioorg. Med. Chem. 17: 54965509. Myles D.C. 2003. Novel biologically active natural and unnatural products. Curr. Opin. Biotechnol. 14: 627633. Nakayama T., T. Hashimoto, K. Kajiyaand S. Kumazawa. 2000. Affinity of polyphenols for lipid bilayers. Biofactors 13: 147151. Nakahara K., S. Kawabata, H. Ono, K. Ogura, T. Tanaka, T. Ooshima and S. Hamada. 1993. Inhibitory effect of oolong tea polyphenols on glucosyltransfrases of mutant streptococci. Appl. Environ. Microbiol. 59: 968973. Narayanan K.B. and N. Sakthivel. 2010. Biological synthesis of metal nanoparticles by microbes. Adv. Colloid Sci. 156: 113. Neal A.I. 2008. What can be inferred from bacterium nanoparticle interactions about the potential consequences of environmental exposure to nanoparticles? Exotoxicobiology 7: 362371. Nisnevitch M., F. Nakonechny and Y. Nitzan. 2010. Photodynamic antimicrobial chemotherapy by liposome-encapsulated water-soluble photosensitizers. Bioorg. Chim. 36: 396402. Norman R.S., J.W. Stowe, A. Gole, C.J. Murphy and T.L. SaboAltwood. 2008. Targeted photothermal lysis of pathogenic bacteria, Pseudomonas aeruginosa, with gold nanorods. Nano. Lett. 8: 302306. Okuda T. 2005. Systematics and health effects of chemically distinct tannins in medical plants. Phytochemistry 66: 20122031. Pal S., Y.K. Tak and J.M. Song. 2007. Does the antibacterial activity of silver nanoparticles depend on the shape of the nanoparticle? A study of the Gram-negative bacterium Escherichia coli. Appl. Environ. Microbiol. 27: 17121720. Panacek A., L. Kvitek, R. Prucek, M. Kolar, R. Vecerova and N. Pizurova. 2006. Silver colloid nanoparticles: synthesis, characterization and their antibacterial activity. J. Phys. Chem. 110: 1624816243. Perni S., C. Piccirillo, J. Pratten, P. Prokopovich, W. Chrzanowski, P. Parkin and M. Wilson. 2009. The antimicrobial properties of light-activated polymers containing methylene blue and gold nanoparticles. Biomaterials 30: 8993.

Pissuwan D., C.H. Cortie, S.M. Valenzuela and M.B. Cortie. 2009. Functionalised gold nanoparticles for controlling pathogenic bacteria. Trends Biotechnol. 28: 207213. Pitsillides C.M., E.K. Joe, X Wei, R.R. Anderson and C.P. Lin. 2003. Selective cell targeting with light-absorbing microparticles with nanoparticles. Biophys. J. 84: 40234032. Pommier Y., E. Leo, H. Zhang and C. Marchand. 2010. DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chem. Biol. 28: 421433. Rai M., A. Yadav and A Gade. 2009. Silver nanoparticles as a new generation of antimicrobials. Biotech. Adv. 27: 7683. Rallis E. and E. Koumantaki-Mathioudaki. 2007. Treatment of Mycobacterium marinum cutaneous infections. Expert Opin. Pharmacother. 8: 29652978. Ren D., R. Zuo, A.F. Gonzalez Barrios, L.A. Bedzyk, G.R. Eldridge, M.E. Pasmore and T.K. Wood. 2005. Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant extract ursolic acid. Appl. Environ. Microbiol. 71: 40224034. Rios J.L. and M.C. Recio. 2005. Medical plants and antimicrobial activity. J. Ethnopharmacol. 100: 8084. Rosemary M.J., I. MacLaren and T. Pradeep. 2006. Investigations of the antibacterial properties of ciprofloxacin SiO2. Langmuir 22: 1012510129. Ryskova L., V. Buchta and R. Slezak. 2010. Photodynamic antimicrobial therapy. Centr. Eur. J. Biol. 5: 400406. Sacchettini J.C. and C.D. Poulter. 1997. Creating isoprenoid diversity. Science 277: 17881789. Saddiqe Z., I. Naeem and A. Maimoona. 2010. A review of the antibacterial activity of Hypericum perforatum L. J. Ethnopharmacol. 131: 511521. Saji M., S. Taguchi, K. Uchiyama, E. Osomo, N. Hayama and H. Ohkumi. 1995. Efficacy of gentian-violet in the eradication of methicillin-resistant Staphylococcus aureus from skin lesions. J. Hosp. Infect. 31: 225228. Sakanaka S., N. Shimura, M. Aizawa, M. Kim and T. Yamamoto. 1992. Preventive effect of green tea polyphenols against dental caries in conventional rats. Biosci. Biotechnol. Biochem. 56: 592594. Savluchinske-Feio S., M.J. Curto, B. Gigante and J.C. Roseiro. 2006. Antimicrobial activity of resin acid derivatives. Appl. Microbiol. Biotech. 72: 430436. Shahverdi A.R., A. Fakhimi, H.R. Shahverdi and S.M. Minaian. 2007. Synthesis and effect of silver nanoparticles on the antibacterial activity of different antibiotics against Staphylococcus aureus and Escherichia coli. Nanomedicine 3: 168171. Shang X., X. He, M. Li, R. Zhang, P. Fan, Q. Zhang and Z. Jia. 2010. The genus Scutellaria an ethnopharmacological and phytochemical review. J. Ethnopharmacol. 128: 279313. Sharma V.K., R.A. Yngard and Y. Lin. 2009. Silver nanoparticles: green synthesis and their antimicrobial activities. Adv. Colloid Interface Sci. 145: 8396. Simon-Deckers A., S. Loo, M. Mayne-Lhermite, N. HerlinBoime, N. Menguy, C. Reynaud, B. Gouget and M. Carriere. 2009. Size-, composition-, and shape-dependent toxicological impact of metal oxide nanoparticles and carbon nanotubes towards bacteria. Environ. Sci. Technol. 43: 84238429. Singh M., S. Singh, S. Prasada and I.S. Gambhir. 2008. Nanotechnology in medicine and antibacterial effect of silver nanoparticles. Digest J. Nanomat. Biostruct. 3: 115122. Smith E., E. Williamson, M. Zloh and S. Gibbons. 2005. Isopimaric acid from Pinus nigra shows activity against multidrugresistant and EMRSA strains of Staphylococcus aureus. Phytother. Res. 19: 538542. Soncin M., C. Fabris, A. Busetti, D. Dei, D. Nistri and G. Roncucci. 2002. Approaches to selectivity in the Zn (II)phthalocyanide-photosensitized inactivation of wild-type and

12

Kurek A. et al.

antibiotic-resistant Staphylococcus aureus. Photochem. Photobiol. Sci. 1: 815819. Sondi J. and B. Salopek-Sondi. 2004. Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gramnegative bacteria. J. Colloid Interface 275: 177182. Storhoff J.J., A.D. Lucas, V. Garimella, Y.P. Bao and U.R. Mller. 2004. Homogenous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticles probes. Nat. Biotechnol. 22: 883887. Suresh Babu K., T. Hari Babu, P.V. Srinvas, K. Hara Kishore, U.S. Murthy and J.M. Rao. 2006. Synthesis and biological evaluation of novel C(7) modified chrysin analogues as antibacterial agents. Bioorg. Med. Chem. Lett. 16: 221224. Tom R.T., V. Suryanarayanan, P.G. Reddy, S. Baskaran and T. Pradeep. 2004. Ciprofloxacin-protected gold nanoprticles. Langmuir 20: 19091914. Tomi N.S., B. Kranke and W. Aberer. 2004. A silver man. Lancet 363: 532 Tsuchiya H., M. Sato, M. Miyazaki, S. Fuijwara, S. Tanigaki, M. Ohyama, T. Tanaka, and M. Iinuma. 1996 Comparative study on the antibacterial activity of photochemical flavanones against meticillin-resistant Staphylococcus aureus. J. Ethnopharmacol. 50: 2734. Unno N., M. Suzuki, N. Yamamoto, K. Inuzuka, D. Sagara and M. Nishiyama. 2008. Indocyanine green fluorescence angiography for intraoperative assessment of blond flow: a feasibility study. Eur. J. Vasc. Endovasc. Surg. 35: 205207. Urs N.V.R.R. and J.M. Dunleavy. 1975. Enhancement of the bactericidal activity of peroxidase system by phenolic compounds (Xanthomonas phaseoli var. sojensis, soybeans). Phytopathology 65: 686690. Uzel A., K. Sorkun, O. Onag, D. Coglu, O. Genay and B. Salih. 2005. Chemical composition and antimicrobial activities of four different Anatolian propolis samples. Microbiol. Res. 160: 189195. Vaidyanathan R., S. Gopalram, K. Kalishwaralal, V. Deepak, S.R. Pandian and S. Gurunathan. 2010. Enhanced silver nanoparticle synthesis by optimization of nitrate reductase activity. Colooids Sur. B Biointerfaces 75: 335341. Valodkar M., A. Bhadoria, J. Pohnerkar, M. Mohan and S. Thakore. 2010. Morphology and antibacterial activity of carbohydrate-stabilized silver nanoparticles. Carbohydr. Res. 345: 17671773. Veigas B., D. Machado, J. Perdigao, I. Portugal, I. Couto, M. Viveiros and P.V. Baptista. 2010. Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis. Nanotechnology 21: 415101.

Vijaya K., S. Ananthan and R. Nalini. 1995. Antibacterial effect of teaflavin, polyphenon 60 (Camellia sinensis) and Euphorbia hirta on Shigella spp. a cell culture study. J. Ethnopharmacol. 49: 115118. Wainwright M. 2008. Dyes in the development of drugs and pharmaceuticals. Dyes Pigments 76: 582589. Wainwright M. 2010. Safe photoantimicrobials for skin and soft-tissue infections. Int. J. Antimicrob. Agents 36: 1418. Walencka E., S. Ralska, S. Wysokiska, M. Ralski, L. Kuma and B. Ralska. 2007. Salvipisone and aethiopinone from Salvia sclarea hairy roots modulate staphylococcal antibiotics resistance and express anti-biofilm activity. Planta Med. 73: 545551. Wang X., L.H. Liu, O. Ramstrm and M. Yan. 2009. Engineering nanomaterial surfaces for biomedical applications. Exp. Biol. Med. 234: 11281139. Wangoo N., K.K. Bhasin, R. Boro and C.R. Suri. 2008. Facile synthesis and functionalization of water-soluble gold nanoparticles for bioprobe. Anal. Chim. Acta 610: 142148. Wansi J.D., D.D. Chiozem, A.T. Tcho, F.A. Toze, K.P. Devkota, B.L. Ndjakou, J. Wandji and N. Sewland. 2010. Antimicrobial and antioxidant effects of phenolic constituents from Klainedoxa gaboniensis. Pharm. Biol. 48: 11241129. Wolska K.I., A.M. Grudniak, B. Fiecek, A. KraczkiewiczDowjat and A. Kurek. 2010 a. Antibacterial activity of oleanolic and ursolic acids and their derivatives. Centr. Eur. J. Biol. 5: 543553. Wolska K.I., A.M. Grudniak, A. Kraczkiewicz-Dowjat and A. Kurek. 2010 b. Various functions of selected bacterial pigments (in Polish). Post. Mikrobiol. 40: 105114. Wood S., D. Metcalf, D. Devine and R. Robinson. 2006. Erythrosine is a potential photosensitizer for the photodynamic therapy of oral plaque biofilms. J. Antimicrob. Chemother. 57: 680684. Wright G.D. 2010. Antibiotic resistance in the environment: a link to the clinic? Curr. Opin. Microbiol. 13: 589594. Yoon K-Y, J.H. Byeon, J.-H. Park and J. Hwang. 2007. Susceptibility constants of Escherichia coli and Bacillus subtilis to silver and copper nanoparticles. Sci. Tot. Environm. 373: 572575. Zharov V.P., E.I. Galanzha and W. Tuchin. 2007. Photothermal flow cytometry in vitro for detection and imaging of individual moving cells. Cytometry A 71: 191206. Zharov V.P., K.E. Mercer, E.N. Galitovskaya and M.S. Smeltzer. 2006. Photothermal nanotherapeutics for selective killing of bacteria targeted with gold nanoparticles. Biophys. J. 90: 619627. Zhang Y., F. Bao, J. Hu, S. Liang, Y. Zhang, G. Du, C. Zhang and Y. Chen. 2007. Antibacterial ligands and triterpenoids from Rostellularia procumbens. Planta Med. 73: 15961599.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 1317

ORIGINAL PAPER

Cloning, Expression and Identification by Immunohistochemistry of Humanized Single-Chain Variable Fragment Antibody against Hepatitis C Virus Core Protein
YONG-ZHI LUN1, 2, *, JUN CHENG2, YAN-WEI ZHONG2, ZENG-GUO YU1, QI WANG2, FANG WANG and JIE FENG1
1 Liaoning

Provincial University Key Laboratory of Biophysics, Medical College Dalian University, Dalian 116622, China 2 Institute of Infectious Diseases, Beijing Ditan Hospital, Beijing 100015, China Received 29 April 2010, revised 17 December 2010, accepted 14 January 2011
Abstract

Expression of single-chain variable fragment (scFv) antibodies on the surface of bacteriophage is widely used to prepare antibodies with pre-defined specificities. A phage antibody library containing the gene for scFv antibody against Hepatitis C virus core protein was panned with core protein immobilized on microtiter plate wells. After five rounds of panning 60 phage clones specific to core protein were obtained and one selected clone was sequenced. It was found that the specifically detected antigen consists of 774bp and is capable of encoding 257 amino acids in the patients but not in healthy persons. K e y w o r d s: Hepatitis C virus; core protein; phage display; single-chain variable fragment antibody Abbreviations: HRP, horseradish peroxidase; HCV, Hepatitis C virus; HCV core protein scFv antibody, scFv antibody against HCV core protein; MAb, monoclonal antibody; scFv,single-chain variable fragment.

Introduction Hepatitis C virus (HCV) was first described in 1989 as the putative viral agent of non-A non-B hepatitis. An estimated 170 million people are infected with HCV worldwide (Armstrong, 2003; Stoll-Keller et al., 2009). HCV is a member of the Flaviviridae family and has been recognized as the major causative agent of chronic liver disease, including chronic active hepatitis, cirrhosis and hepatocellular carcinoma (Di Bisceglie, 2000). It has recently been suggested that HCV core protein suppresses the antiviral cytotoxic T-lymphocyte response by interacting with the C1q complement receptor, thereby playing a key role in the induction and maintenance of chronic HCV infection and liver damage (Kittlesen et al., 2000; Large et al., 1999). The presence of serum HCV core protein is associated with active HCV viremia, and its detection is now used for clinical evaluations (Dickson et al., 1999; Tanaka et al., 2000). In addition, HCV core protein is highly conserved among the

various HCV genotypes (Houghton et al., 1991) and elicits a rapid Antibody response after the onset of the disease. Thus, antibody responses to HCV core protein may be considered to confer protection against HCV infection regardless of viral subtypes. The monoclonal antibodies (McAb) of HCV core protein could passively conduce to prevent HCV infection. However, the production periodicity of McAb made by hybridoma technique is relatively long. In addition, clinical testing has shown that murine monoclonal antibodies may evoke human anti-mouse antibody response. Phage display technology offers a means of cloning human anti-HCV antibodies coding gene of a defined specificity that may have potential therapeutic use (Canaan-Haden et al., 1995). We now utilize a semi-synthetic human single-chain Fv antibody library and solid-phase bound hepatitis C virus core protein to screen out the phage display antibody that recognizes the HCV core protein (Zhong et al., 2001), using HCV core protein as the immobilized antigen and proceeding immunohistochemistry.

* Corresponding author: Yong-Zhi Lun; e-mail: lunyz@163.com

14
Experimental
Materials and Methods

Lun Y.-Z. et al.

Materials. A recombinant HCV core protein from Virostat (USA) was employed. A human scFv antibody phage library in which the genes encoding VL and VH were amplified by PCR with degenerate primers and connected with a glycine linker [(Gly4Ser)3], was purchased from Novagen (USA). M13K07 phage was employed as helper (Pharmacia). Phagemids rescue. To rescue phagemids from the library, 5 ml of 2 TY broth containing 100mg/ml ampicillin and 1% glucose (2 TY-AMP-GLU) was inoculated with 10 l of Escherichia coli TG1 taken from the library stock and grown for 3 hrs at 37C. The bacteria were spun down, resuspended in 50 ml of 2 TY broth containing 100 mg/ml ampicillin (2 TY-AMP), and shaken until A 600 reached 0.5. The bacteria were inoculated with M13K07 phage (11010 PFU) and incubated for 30 mins at 37C without shaking. After pelleting the cells were resuspended in 200 ml of 2 TY broth containing 100 mg/ml ampicillin and 25 mg/ml kanamycin (2 TY-AMP-KAN), and shaken for 12 hrs at 37C. Phage particles were purified and concentrated using polyethylene glycol and resuspended in 2 ml of distilled water. Screening of HCV core protein scFv antibody clones. Delta surface plates (Nalge Nunclon International, Denmark) were coated with 1 ml of HCV core protein (80 g/ml) per well in a coating buffer (50 mmol/l carbonate/bicarbonate pH 9.6) overnight at 4C. After washing with Tris-borate-saline (TBS), the plates were incubated in 2% BSA in PBS for 2 hrs at 37C (blocking). The washing was repeated and the purified phage in 2% BSA (1 ml) was added. The plates were rotated gently for 10 mins, left undisturbed for 90 mins at 37C, and washed 20 times with PBS with 0.1% Tween 20 and 20 times with PBS. The bound phage particles were eluted from the plates with 1 ml of 100 mmol/l triethylamine per plate. The phage-containing elutate was immediately neutralized with 0.5 ml of 1.0 mol/l Tris-HCl pH 7.4 and stored at 4C. The phage was used to infect 10 ml of log-phase E. coli TG1 plated on TYE-AMP-GLU plates and grown overnight at 37C. The colonies were picked up into 2 ml of TYE-AMP-GLU per colony with 30% (v/v) glycerol and stored at 20C. The panning (amplification-adsorption-elution) was repeated 5 times, and 30 phage clones were picked up randomly from well-isolated colonies on the top-agar plates. Each clone was grown in 400 l of 2 TY-AMP-GLU at 37C overnight. Aliquots (20 l) of each clone were transferred to 400 l of 2TY-AMP and further cultured until A600 reached 0.5. After adding a helper phage

the cultures were incubated at 30C overnight. To collect samples for ELISA the supernatants after centrifugation at 12,000 r.p.m. for 1 min at 4C were saved. Identification of phage clones. Wells of 96-wellplates were coated overnight with 8 g HCV core protein in 100 l of coating buffer per well. After blocking for 2 hrs at 37C 50 l aliquots of culture supernatants and 50 l of 2% BSA were added per well for 1 hr at 37C. After washing with 0.05% Tween 20 in PBS a 1/5000 dilution of horseradish peroxidase (HRP)-labeled anti-M13 secondary antibody was added for 1 hr at 37C. The plates were washed with 0.05% Tween 20-PBS and a tetramethylbenzidine solution was added for 10 mins at 37C. The reaction was stopped with H2SO4 and A450 was read. ELISA. Wells of 96-well-plates were coated overnight with 8 g HCV core protein per well in the coating buffer. After blocking 100 l aliquots of diluted (1:50) culture supernatants were added per well for 1 hr at 37C. The plates were washed and loaded with the secondary antibody as described above. M13K07 phage served as negative control. DNA sequencing. Plasmid DNA was prepared from the culture of aselected positive clone using Wizard Plus Minipreps DNA Purification System (Promega) and sequenced in an ABI3700 automated DNA sequencer (Perkin Elmer). Expression of soluble HCV core protein scFv antibody in E. coli. To express the scFv antibody in soluble E-tagged form the selected clone was subcloned into the pCANTAB5E expression vector. Restriction digestion and subsequent 1% agarose gel electrophoresis confirmed the identity of the recombinant pCANTAB5E-scFv vector. Competent E. coli XL1-Blue was transformed with pCANTAB5E-scFv and induced with IPTG for 20 hrs. The culture was centrifuged at 10,000 r.p.m. and the supernatant was subjected to SDS-PAGE and Western blot analysis. Western blot analysis. The culture supernatant was diluted 1:1 with 2 SDS loading buffer, heated at 100oC for 10 mins, briefly centrifuged again, and 20 l of the supernatant was used for SDS-PAGE. After the run the gel was blotted onto a PVDF membrane (Millipore). The blot was blocked with 5% non-fat dry milk for 2 hrs, incubated with an antiE-tag MAb for 1.5 hr and with asecondary HRP-goat anti-mouse IgG antibody for another 1 hr, and stained with DAB and hydrogen peroxide. Immunohistochemistry. Paraffin-embedded liver tissue slices from patients with positive anti-HCV antibodies and HCV-RNA. were examined. After deactivating endogenous hyperoxidase the slices were submersed in a methanol solution (should be defined) with 0.5% hydrogen peroxide at room temperature for 50 mins, washed with PBS 3 times, and kept in 5%

ScFv antibody against HCV core protein

Table I The complementarity-determining regions (CDRs) and framework regions (FRs) of deduced amino acids sequence of ScFv against HCV core protein
CDR1 CDR2 CDR3 FR1 EVQLVESGGGLVRPGGSLRLSCAAS FR2 WVRQAPGKGLEWVS WYQQKPGQAPVLVIY FR3 FR4

15

H chain GFTFSSY- AISGSGGST- TRTKRF AMS YYADSVKG L chain CQGDSL- GKNNRPS RSYYAS

NSPDSSG- SELTQDPAVSNHVV VALGQTVRIT

RFTISRDNSKNTL- WGQGALVTVSR YLQMNSLRAEDT -AVYYCAR GIPDRFSGSSSGN- FGGGTKLTVLG TASLTITGAQAEDEADYYC

BSA overnight at 4C. Then the slices were incubated with the scFv antibody diluted 1:100 for 1 hr at 37C and overnight at 4C. Asheep HRP-anti-M13 antibody diluted 1:200 was dropped on tissue preparations and left to react for 40 min at 37C. The preparations were washed 3 times with PBS, afew drops of a DAB solution (9 mg DAB, 13.5 ml 0.01 M Tris-HCl (pH7.6), 1.5 ml 0.3 % CoCl2, and 15 ml 30% hydrogen peroxide) were added. After 10 min at room temperature the preparations were washed with PBS 3 times and 1% haematin was used to stain the cell nucleus. After astandard dehydratation procedure the preparations were observed under microscope. Negative controls consisted of PBS instead of the scFv antibody and liver tissue preparations from healthy persons. Results Identification of HCV core protein scFv-positive clones. After five rounds of panning (amplificationabsorption-elution) 60 clones were picked up and tested for HCV core protein scFv antibody by ELISA.

Twenty of these were found positive. Six of these showed a low cross-reaction with BSA (Fig. 1). One positive clone with the highest reaction with HCV core protein and the lowest reaction one with BSA was chosen for a confirmatory test with restriction digestion. The digestion with NcoI and NotI and subsequent gel electrophoresis proved the presence of a 774 bp insert corresponding to the scFv antibody gene (Fig. 2).

Fig. 2. Restriction map of plasmid DNA carrying HCV core protein scFv gene prepared from a single positive clone by NcoI/NotI digestion.
a, b: DNA fragment with HCV core protein scFv gene; M: DNA Marker DL2000 (Takara Co., Japan)

Fig. 1. Identification of positive clones. The binding activities of the phage antibodies from six clones infected by bound phage particles to coated 8 g HCV core protein and 20 g bovine serum albumin.
a-f: positive clones culture supernatant with scFv antibody against HCV core protein; g: helper M13K07 instead of phage antibodies, used as negative.

Fig. 3. Western blot analysis of the supernate protein derived from induced and non-induced E. coli XL1-Blue transformed by expression vector.
Supernate protein from non-induced E. coli XL1-Blue transformed with pCANTAB5E-HCV core protein-scFv (lane a) and supernate protein from induced E. coli XL1-Blue transformed with pCANTAB5E-HCV core protein-scFv (lane b).

16
A

Lun Y.-Z. et al.

1
Discussion

Fig. 4. Immunostaining of HCV core protein of different sections from liver tissues of healthy persons and patients with chronic hepatitis C, self-made anti-HCV core protein single chain antibodies used as primary antibody.
A: Immunohistochemistry of HCV core protein of liver tissue from health person; B: Immunohistochemistry of HCV core protein of liver tissue from patients with chronic hepatitis C, core protein was detected in the cytoplasm of some liver cells (arrowhead pointing).

Sequencing of HCV core protein ScFv gene. The nucleotide sequence of the selected clone was determined and submitted to GenBank (Acc. No AF271150). The corresponding amino acid sequence was deduced and complementarity-determining regions and framework regions were located according to the Kabat database (Table I). Expression of HCV core protein scFv in E. coli. The HCV core protein scFv antibody was expressed in E. coli and confirmed by Western blot analysis (Fig. 3). Anegative control consisting of E. coli infected with empty vector did not show any specific protein. These results indicated that the soluble form of human HCV core protein scFv antibody was successfully expressed in this system. Immunostaining of HCV core protein of liver tissue sections. Immunostaining of sections of liver tissues from and 17 patients with chronic hepatitis C and healthy persons gave positive results in the former but not latter group (Fig. 4). HCV core protein was mainly located in the cytomembrane of the hepatocytes.

The mature HCV protein is located in the cytoplasm of infected cells, in close vicinity to the perinuclear membranes and the endoplasmic reticulum, where it polymerizes in the presence of genomic RNA to form viral capsids (Reed and Rice, 2000). The HCV core protein is highly antigenic, induces specific cellular and humoral responses, and probably plays a pivotal role in the pathogenesis of HCV infection (Lai and Ware, 2000; Nelson et al., 1997). The availability of an anti-HCV core protein humanized scFv antibody allowed the development of an ELISA to detect HCV core antigen in peripheral blood of patients with HCV (Aoyagi et al., 1999). The major neutralizing epitope of HCV core protein lies within the first 45 aa of the protein, the major antigenic segment of core recognized both by murine and human antibodies. Noticeable, the recognized epitope (2937: QIVGGVYLL) has an unusual preponderance of hydrophobic residues, some of which are buried in a small hydrophobic core in the nuclear magnetic resonance structure of the peptide in solution, suggesting that the antibody may induce a structural rearrangement upon recognition (Menez et al., 2003). Phage libraries are a powerful tool for the selection of antibodies of important and useful specificities, particularly for humanized scFv antibodies (Marks et al., 1991; Hoogenboom et al., 1998; Lamarre and Talbot, 1997; Rondon and Marasco, 1997). It has many advantages. First, it is the only method to get specific antibody by passing the immunization step. It can mimic the maturation process of human antibody in vivo, so that it is possible to obtain a high affinity antibody from this selection. Second, a scFv antibody consisting of antigen-binding domains of heavy and light chain regions of immunoglobin connected by a flexible peptide linker is a small-size molecule compared with the full-length antibody. If an antibody library of human origin is used, the selected antibody is most suitable to human administration and is potentially applicable to clinical diagnosis and treatment of both infectious disease and cancer. Finally, as it contains no Fc fragment, its background in immunohistological study is very low. In contrast, a MAb against the recombinant HCV core protein prepared from hybridomas is of murine origin and hence immunogenic if used systemically in humans (Songsivilai et al., 1996). In order to overcome the disadvantages of an intact MAb applied in vivo and to offer an antibody with a stable genetic source, soluble scFv antibodies are currently generated by advanced recombinant phage antibody technique, which may provide novel targeting vehicle for diagnosis and treatment of diseases.

ScFv antibody against HCV core protein

17

In this study, we succeeded in cloning the HCV core protein scFv gene by means of the phage display library technique. The cloned gene was sequenced and expressed in E. coli. These results illustrate the feasibility of using the antibody-engineering technology that may prove useful in the future for diagnostics and therapy of hepatitis C infection.

Literature
Aoyagi K., C. Ohue and K. Iida. 1999. Development of a simple and highly sensitive enzyme immunoassay for hepatitis C virus core antigen. J. Clin. Microbiol. 37: 18021808. Armstrong G.L. 2003. Commentary: modeling the epidemiology of hepatitis C and its complications. Int. J. Epidemiol. 32: 725726. Canaan-Haden L., M. Ayala and M.E. Fernandez-de-Cossio. 1995. Purification and application of a single-chain Fv antibody fragment specific to hepatitis B virus surface antigen. Biotechniques 19: 606612. Di Bisceglie A.M. 2000. Natural history of hepatitis C: its impact on clinical management. Hepatology 31: 10141018. Dickson R.C., M. Mizokami and E. Orito. 1999. Quantification of serum HCV core antigen by a fluorescent enzyme immunoassay in liver transplant recipients with recurrent hepatitis C: clinical and virologic implications. Transplantation. 68: 1512. Hoogenboom H.R., A.P. de Bruine and S.E. Hufton. 1998. Anti-body phage display technology and its applications. Immunotechnology 4: 120. Houghton M., A. Weiner and J. Han. 1991. Molecular biology of the hepatitis C virus: implications for diagnosis, development, and control of viral disease. Hepatology 14: 381. Kittlesen D.J., K.A. Chianese-Bullock and Z.Q. Yao. 2000. Interaction between complement receptor gC1qR and hepatitis C virus core protein inhibits T-lymphocyte proliferation. J. Clin. Investig. 106: 12391249.

Hagedorn C.H. and C.M. Rice. 2000. The hepatitis C viruses. Springer-Verlag KG Berlin, Germany. Lamarre A. and P.J. Talbot. 1997. Characterization of phagedisplayed recombinant anti-idiotypic antibody fragments against coronavirus neutralizing monoclonal antibodies. Viral. Immunol. 10: 175182. Large M.K., D.J. Kittlesen and Y.S. Hahn. 1999. Suppression of host immune response by the core protein of hepatitis C virus: possible implications for hepatitis C virus persistence. J. Immunol. 162: 931938. Marks J.D., H.R. Hoogenboom and T.P. Bonnert. 1991. Byimmunization human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 222: 581597. Menez R., M. Bossus and B.H. Muller. 2003. Crystal structure of a hydrophobic immunodominant antigenic site on hepatitis C virus core protein complexed to monoclonal antibody 19D9D6. J. Immunol. 170: 19171924. Nelson D.R., C.G. Marousis and G.L. Davis. 1997. The role of hepatitis C virus-specific cytotoxic lymphocytes in chronic hepatitis C. J. Immunol. 158: 14731481. Reed K.E. and C.M. Rice. 2000. Overview of hepatitis C virus genome stucture, polyprotein processing, and protein properties. Curr. Top. Microbiol. Immunol. 242: 5584. Rondon U. and W.A. Marasco. 1997. Intracellular antibodies (intrabodies) for gene therapy of infectious disease. Annu. Rev. Microbiol. 51: 257283. Songsivilai S., T. Dharakul and R. Kunkitti. 1996. Molecular cloning and expression of hepatitis C virus core protein and production of monoclonal antibodies to the recombinant protein. Asian Pac J Allergy Immunol. 14: 3141. Stoll-Keller F., H. Barth and S. Fafi-Kremer. 2009. Development of hepatitis C virus vaccines: challenges and progress. Expert Rev. Vaccines 8: 333345. Tanaka E., C. Ohue and K. Aoyagi. 2000. Evaluation of a new enzyme immunoassay for hepatitis C virus (HCV) ore antigen with clinical sensitivity approximating that of genomic amplification of HCV RNA. Hepatology 32: 388. Zhong Y., J. Cheng and S. Shi. 2001. Screening and characterization of human phage antibody to hepatitis C core antigen (in Chinese). Zhonghua Gan Zang Bing Za Zhi 9: 217219.

18

Lun Y.-Z. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 1926

ORIGINAL PAPER

The Occurrence and Comparative Phenotypic Characteristics of Staphylococcus spp. from Healthy and Diseased, Household and Shelter Dogs, Based on Routine Biochemical Diagnostic Methods
ANDRZEJ KASPROWICZ1, ANNA BIAECKA1, JOANNA BIAECKA1, IZABELA GODZISZ2, WIESAW BARABASZ2, OLGA JAWORSKA3, NATALIA MAACHOWA4, 5 and JACEK MIDZOBRODZKI4*

for Microbiological Research and Autovaccines Ltd., Krakw, Poland of Microbiology, Agricultural University of Krakw, Krakw, Poland 3 Rescue Animal Shelter, Krakw Society for Animal Care, and Alvet Veterinary Clinic, Krakw, Poland 4 Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology Jagiellonian University, Krakw, Poland 5 Laboratory of Human Bacterial Pathogenesis, National Institute of Health, Hamilton, MT, USA
2 Department

1 Centre

Received 9 September 2010, revised 30 November 2010, accepted 6 December 2010

Abstract To determine the staphylococcal colonization pattern in healthy and diseased dogs, living in two particular environments, a number of microbiological samples were taken. Overall, twenty dogs, either healthy or with infected skin lesions, were examined. In each case bacterial swabs were collected from the nasal mucosa, ear, perineum, lumbo-sacralis triangle, and from the infection sites if such were present. A total number of 104 isolates representing different staphylococcal species were isolated and identified using routine biochemical methods applied in diagnostic laboratories. Among 17 isolated staphylococcal species, Staphylococcus intermedius was the most common species isolated from both healthy or diseased dogs living either in animal shelter or household environments. The pattern of Staphylococcus sp. colonization differs considerably for animals living in the two tested habitats. In particular, S. aureus MRSA and MSSA isolates were detected only in infected skin lesion samples from animals that dwelled in the animal shelter. As could be expected, S. intermedius was found to be a predominant causative agent in canine skin infections. In our study, we demonstrated that S. intermedius in its carrier-state, inhabits mainly the mucosal membrane of the nasal vestibule. It was also found in the samples taken from the skin, the lumbo-sacralis triangle and perineum, but was rarely isolated from the ears. K e y w o r d s: Staphylococcus spp. from dogs, diagnostic, phenotyping, biochemical methods

Introduction Staphylococcus species are considered to be one of the most widespread bacteria found in nature. Bacteria that constitute this genus, colonize a number of domestic animals, including dogs and cats. Usually they belong to the normal skin flora of these animals commonly present on skin and mucosal membranes (Stepanovic et al., 2001; Hauschild and Wojcik, 2007). In 1976 Hajek described a new staphylococcal coagulase-positive species Staphylococcus intermedius which colonized predominantly the skin and the mucosal membrane of the nasal vestibule in dogs (Hajek, 1976). Later studies revealed that S. intermedius was the most frequent species isolated from

healthy dogs. It comprised 40.3% of all isolated strains and was identified as a resident of the physiological bacterial flora of healthy dogs (Cox et al., 1988; Krl, 1998). Devriese and DePelsmaecker proved in their research that S. intermedius strains were predominantly isolated from nostrils and the rectum region of healthy dogs (Devriese and DePelsmaecker, 1987). These two ecological niches were proposed to be the source for colonization of other areas in healthy dogs by S. intermedius strains (Nagase et al., 2002). Usually occurring in healthy individuals, under favorable conditions S. intermedius can cause a variety of infections in dogs and cats (Biberstein et al., 1984, Kim et al., 2005). Dermatitis or inflammation of the skin is caused by the diverseness of allergens, irritation and infectious

* Corresponding author: J. Midzobrodzki, Dept. of Microbiol., Faculty of Biochem., Biophys. and Biotechnol., Jagiellonian University, Gronostajowa Str. 7, 30-387 Krakw, Poland; phone: +48-12-664-6371; fax: +48-12-664-6902; e-mail: jacek.miedzobrodzki@uj.edu.pl

20

Kasprowicz A. et al.

factors, or systematic diseases (Hendricks et al., 2002; Kizerwetter-wida et al., 2009). Pyoderma is a type of dermatitis. It occurs fairly often among dogs. In pyoderma, either flesh or deep skin infections can be observed. Commonly in both cases, S. intermedius is the main causative agent. Infective skin lesions usually show up in warm, moist and wrinkled skin regions, where there appear to be propitious conditions for bacterial colonization and progression of pyoderma (Allaker et al., 1993; Guardabassi et al., 2004). Notwithstanding the growing responsibility and microbiological awareness among dog owners and the increasing interest for the S. intermedius species among the veterinary society, this species still has not been adequately studied. Bearing this in mind, knowledge of the bacterial flora composition of the dogs skin would be extremely useful in the epidemiological study of a variety of a skin infections that occur in dogs. The main goal of this project was to determine the similarity, disparity and potential relationship between the different colonization patterns of the staphylococcal species characteristic for healthy and diseased dogs, living either in a rescue shelter or households. Commonly the diagnostics of bacterial strains isolated from dogs are based on phenotypic methods and these type of methods were considered in this study (Midzobrodzki et al., 2008). Although based on the fact that some staphylococcal species (S. intermedius and S. pseudintermedius) can be distinguished almost only by genetic methods, the further introduction of genetic based techniques in routine veterinary diagnostics is essential (Bannoehr et al., 2009; Devriese et al., 2009). Experimental
Materials and Methods

Fig. 1. Characeistics of all examined dogs

were caused by hypersensitivity, and may have had pus complications. The lesions were not only always exuding with pus or serum-pus, but also painful and strongly pruritic. However, there were no immunological changes, understood as autoaggression, such as lupus or pemphigus. There were no spontaneous bacterial infections either. Swabs were taken from each dog from both the left and right ear, the nasal vestibule, and perineum, as well as from the back, and in the case of the diseased dogs, also from the infection site (Fig. 2). All the isolated samples/strains were described in the following manner: (i) classification of the etiological agent causing from skin infections; (ii) characteristic of the isolated bacterial strain by standard phenotypic methods;

Bacterial strain isolation. Bacterial samples isolated from 20 healthy and diseased dogs were examined. The examined group of dogs was heterogeneous. It consisted of 20 mongrels, both male and female that weighed from 5 to 45 kg. Among the 20 dogs, 12 had skin lesions and the remaining 8 had none. The dogs living in an animal shelter had been staying there for a few weeks up to 3 years. A similar time range was for the dogs living in household environments. Five out of 7 sheltered dogs, and 7 out of 13 household dogs demonstrated skin lesions. In the 8 remaining dogs, no skin lesions were observed, as shown in Figure 1. Samples were taken from skin lesions found in sick dogs as well as from healthy dogs without skin changes. The samples were collected by a veterinarian. The material used for research was derived from skin lesions caused by flea allergy dermatitis. These lesions

Fig. 2. Different reservoir sites for staphylococcal strains in dogs

Staphylococcus spp. isolated from dogs

21

(iii) correlation between a particular isolation site and a staphylococcal species. Microbiological samples isolated from dogs were inoculated onto Columbia blood (supplemented with 5% sheep blood), BairdParker and Candida ID agar within 2 hours of isolation. After an incubation period of 48 h at 35C, all colonies were screened and staphylococcal-like colonies were isolated and plated on tryptic soy agar for 24 h at 35C. Pure isolates were then used for future experiments. A total number of 104 isolates was received from 20 examined dogs. Microscopic analysis. To confirm the purity identification of all the 104 isolates to Gram-positive cocci, Gram staining was performed (Beveridge, 2001). Biochemical identification. Throughout the biochemical analysis, two reference strains S. aureus ATCC25933 and S. epidermidis ATCC 12228 were tested alongside the canine isolates. All isolates were evaluated for catalase activity and furazolidone resistance. Bacterial identification was performed by a coagulase tube test (Biomed, Poland). Detection of the clumping factor with rabbit plasma was performed by PASTOREXTM STAPH-PLUS test (BIO-RAD). In order to confirm identification of staphylococcal species, ID32 STAPH (BioMerieux, Poland) analysis was done (Sasaki et al., 2007a; Weese et al., 2009). Results A total of 104 staphylococcal strains were isolated from healthy and diseased dogs living in either animal shelter or households. All strains demonstrated typical colony growth on blood and Baird-Parker selective agar. Coagulase-positive staphylococci produced black, shiny, convex colonies with entire margins and clear zones with or without an opaque zone around the colonies. Phenotypic characteristics of isolated strains. The free coagulase tube test revealed a positive reaction in 61 strains (59%), whereas no coagulation was observed in the remaining 43 (41%) strains. Although the production of the clumping factor was detected in 44 (42%) strains, 57 (55%) did not produce this factor, and for 3 (3%) strains the results were uncertain. The PASTOREXTM STAPH-PLUS test showed that only 39 among all strains (37.5%) have the ability to autoagglutinate. In terms of the ID32 STAPH method, 104 strains were identifiable, Table I. S. intermedius (46 strains) and S. aureus (11 strains) were the only two coagulase-positive staphylococcal species isolated among all the tested canine strains. The remaining strains belong to the coagulase-negative group. Domicile and Staphylococcus sp. variety. Table I presents the rate of occurrence of different staphylococcal species in swabs taken from the skin, ears, and

Table I Distribution of 104 strains of the Staphylococcus species in all examined dogs
Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-45 13 household-59 strains strains 18 (40.0 %) 3 (6.7%) 8 (17.8%) 0 2 (4.4%) 0 0 0 1 (2.2%) 3 (6.7%) 1 (2.2%) 3 (6.7%) 1 (2.2%) 1 (2.2%) 0 3 (6.7%) 0 1 (2.2%) 11 28 (47.4%) 0 0 4 (6.8%) 0 3 (5.1%) 5 (8.5%) 1 (1.7%) 8 (13.5%) 1 (1.7%) 0 1 (1.7%) 5 (8.5%) 1 (1.7%) 1 (1.7%) 0 1 (1.7%) 0 12

Staphylococcus spp. S. intermedius S. aureus (MSSA) S. aureus (MRSA) S. warneri S. gallinarum S. hominis S. chromogenes S. epidermidis S. haemolyticus S. lentus S. saprophyticus S. equorum S. xylosus S. cohni S. schleiferi S. simulans S. lugdunensis S. sciuri Total number of staphylococcal species

mucosal membrane of the nasal vestibule, from dogs living in the animal shelter or households. A total of 17 different species belonging to the Staphylococcus genus were found. Animals living in the shelter carried 11 different species, whereas 12 species were isolated from dogs living in household conditions. Regardless of living environments, S. intermedius isolates were the most common. It accounts for 40% and 47.4% of all isolated strains, respectively for the animal shelter and household environment. Based on the obtained results the difference between staphylococcal profiles and the various environments that they colonize was noticeable. Dogs from the animal shelter were carriers for such staphylococcal species, like S. gallinarum, S. saprophyticus, and S. simulans that were not isolated from any animal living in the household environment. On the other hand, such species as S. warneri, S. hominis, and S. chromogenes, were isolated only from dogs living in the households. A fact worth noticing was that 11 S. aureus strains (MSSA and MRSA) were isolated only from samples obtained from the shelter. Manifestation of particular staphylococcal species in samples isolated from the nasal vestibule are shown in Table II. In the group of 11 isolated species the most frequent, despite of habitat, was S. intermedius. Nevertheless, S. intermedius was detected more often in samples taken from dogs kept in households than in the animal shelter, 55.5% and 31.6% respectively.

22

Kasprowicz A. et al.
Table II Staphylococcal strain distribution in the nasal mucosa
Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-19 13 household-18 strains strains 6 (31.6%) 6 (31.6%) 2 (10.5%) 2 (10.5%) 1 (5.3%) 1 (5.3%) 1 (5.3%) 0 0 0 0 7 10 (55.5%) 0 1 (5.6%) 0 2 (11.1%) 0 0 1 (5.6%) 1 (5.6%) 1 (5.6%) 2 (11.1%) 7

Table IV Staphylococcal strain distribution in the lumbo-sacralis triangle region

Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-8 strains 6 (75.0%) 2 (25.0%) 0 0 0 0 0 0 0 2 13 household-12 strains 2 (16.7%) 0 3 (25.0%) 2 (16.7%) 1 (8.3%) 1 (8.3%) 1 (8.3%) 1 (8.3%) 1 (8.3%) 8

Staphylococcus spp. S. intermedius S. aureus S. lentus S. equorum S. haemolyticus S. sciuri S. cohni S. lugdunensis S. chromogenes S. xylosus S. warneri Total number of staphylococcal species

Staphylococcus spp. S. intermedius S. aureus S. xylosus S. haemolyticus S. cohni S. schleiferi S. hominis S. equorum S. chromogenes Total number of staphylococcal species

Table III Staphylococcal strain distribution in the perineum region

Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-19 13 household-12 strains strains 4 (33.3%) 2 (16.7%) 2 (16.7%) 1 (8.3%) 1 (8.3%) 1 (8.3%) 1 (8.3%) 0 0 0 0 0 7 4 (33.3%) 0 0 0 0 0 0 2 (16.7%) 2 (16.7%) 1 (8.3%) 2 (16.7%) 1 (8.3%) 6

Staphylococcus spp. S. intermedius S. aureus S. gallinarum S. saprophyticus S. equorum S. simulans S. lentus S. hominis S. warneri S. chromogenes S. haemolyticus S. epidermidis Total number of staphylococcal species

S. aureus strains were isolated mainly from the mucosal membrane of the nasal vestibule of dogs living in the shelter in the range of 31.6%. Adjacent to coagulasepositive species, coagulase-negative staphylococcal species were also present in the biological material. While, S. equorum, S. sciuri or S. cohni were found only in dogs from the shelter, S. lugdunensis, S. chromogenes, S. xylosus or S. warneri were presented in the samples taken from the animals living at home. This should be treated as a trend because the number of examined dogs was relatively low. S. intermedius was also the most prevalent species among isolates from the perineum region, Table III. Furthermore, it was the only staphylococcal species

shared among household and shelter dogs. The following species were detected in swabs taken from the perineum region of the sheltered animals: S. aureus, S. saprophyticus, S. gallinarum, S. equorum, S. simulans, and S. lentus. Subsequently, domestic dogs carried S. hominis, S. warnerii, S. chromogenes, S. haemolyticus, and S. epidermidis in the material from the same isolation region. From the lumbo-sacralis triangle region shown in Figure 2, 9 species of Staphylococcus were distinguished, Table IV. In comparison to the samples taken from shelter animals, the dogs living at home were characterized by a broad range of staphylococcal species, 2 and 8 species respectively. As mentioned above only two species were isolated from the lumbosacralis triangle samples from sheltered dogs: S. intermedius (75%) and S. aureus (25%). The above data demonstrated that S. intermedius in carrier-state, predominantly colonized nares of tested dogs. Over 50% of all animals, regardless of their living environment, sick or healthy carried strains of this species in the nasal vestibule. The next preferred region was the lumbo-sacralis triangle and perineum. S. intermedius, however was isolated more often from the sheltered dogs (75%) then from animals living in households (16.7%), Table IV. In both healthy and diseased dogs, the patterns of colonization were similar, as it is shown in Figure 3A and Figure 3B. The etiological factor for skin lesions of canine origin. The rate of occurrence of different staphylococcal species, isolated from 12 dogs with infection sites are listed in Figure 4. The most common species found in 7 out of 12 examined animals (58.3%) was S. intermedius. In 5 out of 7 dogs living in households it was the only staphylococcal species isolated from the skin lesion. Moreover, 7 additional Staphylococcus spp. were isolated, including: methicillin-resistant

Staphylococcus spp. isolated from dogs

23

Body site

earlier, 6 originated from animals living in the shelter and three from dogs living at home. Evidently, S. intermedius was the dominant species in each habitat, nevertheless it was isolated more repeatedly from animals living in households (71.4% of all animals). A greater variety of staphylococcal species were found in skin lesion samples taken from animals living in the shelter, where S. intermedius occurred in 40% of these animals. Among these species S. aureus (MRSA), S. simulans, S. equorum, S. xylosus, and S. cohni were identified. In skin infections of dogs living in household conditions, beside S. intermedius strains, only S. haemolyticus, S. chromogenes were found in skin infections. Discussion Normal animal skin is colonized by numerous bacterial species, which contribute to the physiological skin flora. Staphylococcus species are not out numbered among this flora. The most typical staphylococcal species isolated from canine skins are S. intermedius, S. xylosus, S. sciuri, S. capitis, S. chromogenes and S. lentus, by Nagase et al. (Nagase et al., 2002). At the same time other studies show a slightly different profile of isolated strains from dog skin at carrierstate: S. intermedius, S. aureus, S. simulans, S. heamolyticus, and S. saprophyticus (Hauschild and Wjcik, 2007). So far not many studies have been done to determine the staphylococcal colonization pattern based on a specific part of the body or living habitat conditions of the animals from which swabs were taken. In the recent study we took an effort to characterize the contribution of the different staphylococcal species in the colonization of dogs living in two different environments: the animal shelter and households. Our data confirm the general trend that S. intermedius strains are isolated at a higher rate from dogs that inhabit households, whereas S. aureus is isolated from dogs living at the shelter. These differences could be explained by distinctness in animal exposition to other

Fig. 3A. Distribuion of S. intermedius in the carrier-state at different body sites in sheltered and household dogs

Body site

Fig. 3B. Distribuion of S. intermedius in the carrier-state at different body sites in healthy and diseased dogs

S. aureus (MRSA), S. haemolyticus, S. chromogenes, S. simulans, S. equorum, S. xylosus, and S. cohni which appeared to be single cases. Staphylococcal species distribution in diseased dogs was also analyzed based on habitat, Figure 4. Among the 8 species mentioned

Fig. 4. Distribution of Staphylococcus species found in infected skin lisions of 12 examined dogs

24

Kasprowicz A. et al.

animals and people (Talan et al., 1989; Krl, 1998). S. aureus strains isolated during our research, seem to be an excellent example. The animals from the shelter living in small closed areas and are in constant contact with other animals and moreover with the personnel, who are one of the main carriers of S. aureus (Kloos and Musselwhite, 1975). Humans are colonized by MSSA or MRSA by a carriage rate of 2040% (Shopsin et al., 2000). These numbers grow even higher in the case of elderly persons or hospital personnel, where they can reach up to 90% (Szewczyk, 2005). Throughout our study, S. aureus strains were isolated only from dogs living in the animal shelter and comprise 24.5% of all strains isolated in these animals. Among this group we isolated both MSSA and MRSA strains. On the other hand our data confirm, that S. intermedius is present in carrier-state in dogs. Isolates of this species were the most common, regardless of habitat and dog health conditions. The most favorable place for bacterial colonization was the mucosal membrane of nostrils. It was a reservoir for nearly 55% of all S. intermedius isolates, followed by the lumbo-sacralis triangle region (almost 30%). Dermatitis is the most common type of infectious disease found in dogs (Ackerman, 1994). Dermatoses have a variety of etiological factors, where some of them are caused by particular bacterial strains. 90% of pyoderma in dogs is caused by S. intermedius strains infection (Craig, 2003), while S. aureus is one of the causative agents in skin lesions of nonpyodermal origin (Biberstein et al., 1984). Our data show that S. intermedius species seem to be the only species presented in microbiological samples from infected skin lesions of dogs living in both animal shelter and household environments. It was isolated from almost 60% of all diseased animals. Five out of seven of these dogs had only S. intermedius strains presented in the infected skin lesion. In the remaining two cases, S. intermedius strains were accompanied by other coagulase-negative strains. The achieved data enriches our knowledge of the colonization of dogs by not only staphylococcal coagulase-postive strains like S. aureus or S. intermedius but also by coagulase-negative strains. The presented results are also important for understanding the epidemiology of infectious animal diseases, in which bacteria from the staphylococcal genus play a crucial role. In the last few years, a new Staphylococcus species S. pseudintermedius was separated from the group previously considered to be S. intermedius species (Devriese et al., 2005; Wadyka et al., 2008). S. pseudintermedius can be easily misclassified as S. intermedius by routine biochemical methods used in standard diagnostics. Furthermore, it seems that all the isolates classified in our and other projects by routine

biochemical identification tests seem to be S. pseudintermedius. Therefore, the final microbiological identification must require the use of genetic methods (Sasaki et al., 2007a; Bannoehr et al., 2009). The number of dogs used in the project was twenty which was not very high. However they were used to show whether the similarity in lesions is because of same etiological factors in diseased dogs (twelve) and to recognize the staphylococcus species in healthy dogs at carrier state (eight). The staphylococcal species isolated from healthy and diseased dogs were compared to understand the colonization although disease was not studied. The main question was, do the carriage or the life conditions (house/shelter) effect the occurrence of disease? The less number of dogs taken in the project resulted from trouble in selection of animals. There were often abrasions or wounds present on the skin. Only the dogs with skin lesions were taken for the project. The idea was that the similarity in skin lesions is caused by staphylococci, the carriage in same area and the localization of dogs in environment. Thus the work was to be done with high precision. Dogs were taken from one acute shelter hostel and the skin lesions were clinically evaluated. All the samples were taken by same veterinary doctor. Analysis shown in the paper is an introduction on the general elaboration of carriage phenomenon in dogs living under different environments (house/shelter) and of isolated strains from skin lesions in part of dogs in the population. Thus showing the relation between diseased to healthy dogs and house to shelter conditions. A total of one hundred four bacterial strains were isolated from twenty dogs. Higher species heterogeneity was observed among bacteria in dogs from shelter and that this difference did not affect pathology, which is mainly caused by S. intermedius, independent of the living environment of dogs. So the etiological factor can be easily observed among the tested dogs and the number of dogs used were enough to give the phenomenon. Authors were interested neither in the numbers of dogs nor in possessed isolates, but in observation of differences in colonization and etiological factors according to dogs life environment. In conclusion, we described the isolation of various staphylococcal strains which were constituents of the normal biocenosis of the skin of dogs. We also reported staphylococci as etiological factors of wound infections in household or rescue shelter dogs, healthy or diseased. Our observations enriched by recent reports by other authors expand the knowledge to be more precise which brings focus to ecological phenomena and epidemiological pathways. A carriage phenomenon and transient colonization by such strains in dogs and/or their owners facilitate the transmission of staphylococci between humans and domestic animals

Staphylococcus spp. isolated from dogs

25

(Simoons-Smit et al., 2000; Nagase et al., 2002) with a particular share of staphylococci from poultry (Wieliczko et al., 2002). As it is reported the genomic similarity of strains isolated in veterinary pathology is particularly specific (Cuteri et al., 2004, Jakubczak et al., 2007). The dissemination of methicillin-resistant S. pseudintermedius in various animals and the confirmed presence of their resistance genes places them as potentially serious pathogens (Ruscher et al., 2009). They have to be precisely analysed by a number of validated and recommended methods (Cuteri et al., 2004; Maachowa et al., 2005). Recently elaborated molecular methods should be introduced to restriction analysis of the chromosomal DNA with the final aim of increasing the effectiveness in discriminating closely related strains (Krawczyk et al., 2007; Black et al., 2009). A need of such an investigation is additionally enhanced by single reports on human colonization by S. intermedius (Talan et al., 1989; Mahoudeau et al., 1997; Kikuchi et al., 2004) as well as recently reported infections caused by S. pseudintermedius (Van Hoovels et al., 2006; Sasaki et al., 2007b). Thus the elaboration of new procedures and diagnostic schemes for both veterinary and human bacteriology are an emerging challenge.
Acknowledgements The authors thank Miss Magorzata Wjcik from the Jagiellonian University for helping prepare this manuscript.

Literature
Ackerman L. 1994. Guide to Skin and Haircoat Problems in Dogs. Alpine Publications, Loveland CO, pp. 719. Allaker R.P., N. Garrett, L. Kent, W.C. Noble and D.H. Lloyd. 1993. Characterization of Staphylococcus intermedius isolates from canine pyoderma and from healthy carriers by SDS-Page of exoproteins, immunoblotting and restriction endonuclease digest analysis. J. Med. Microbiol. 39: 429433. Bannoehr J, Franco A, Iurescia M, Battisti A, Fitzgerald JR. 2009. Molecular diagnostic identification of Staphylococcus pseudintermedius. J. Clin. Microbiol. 47: 46971. Beveridge T.J. 2001. Use of the gram stain in microbiology. Biotech. Histochem. 76: 111118. Biberstein E.L., S.S. Jang and D.C. Hirsh. 1984. Species distribution of coagulase-positive staphylococci in animals. J. Clin. Microbiol. 19: 610615. Black C.C., S.M. Solyman, L.C. Eberlein, D.A. Bemis, A.M. Woron and S.A. Kania. 2009. Identification of predominant multilocus type, pulsed-field gel electrophoresis cluster, and novel staphylococcal chromosomal cassette in clinical isolates of mecA-containing, methicillin-resistant Staphylococcus pseudintermedius. Vet. Microbiol. 139: 333338. Cox H.U., J.D. Hoskins, S.S. Newman, C.S. Foi, G.H. Turnwald and A.F. Roy. 1988. Temporal study of staphylococcal species on healthy dogs. Am. J. Vet. Res. 49: 747751. Craig M. 2003. Diagnosis and Management of Pyoderma in the Dog. In Practice 25: 418425.

Cuteri V., M.L. Marenzoni, R. Mazzolla, N. Tosti, L. Merletti, S. Arcioni and C. Valente. 2004. Staphylococcus aureus: study of genomic similirity of strains isolated in veterinary pathology using amplified fragment length polymorphism (AFLP). Comp. Immunol. Microbiol. Infect. Dis. 27: 247253. Devriese L.A. and K. DePelsmaecker. 1987. The anal region as a main carrier site of Staphylococcus intermedius and Streptococcus canis in dogs. Vet. Rec. 121: 302303. Devriese L.A., K. Hermans, M. Baele and F. Haesebrouck. 2009. Staphylococcus pseudintermedius versus Staphylococcus intermedius. Vet. Microbiol. 133: 206207. Devriese L.A., M. Vancanney, M. Baele, M. Vaneechoutte, E. De Graef, C. Snauwaert, I. Cleenwerck, P. Dawyndt, J. Swings, A. Decostere and F. Haesebrouck. 2005. Staphylococcus pseudintermedius sp. Nov., a coagulase-positive species from animals. Int. J. Syst. Evol. Microbiol. 55: 15691573. Guardabassi L., M.E. Loeber and A. Jacobson. 2004. Transmission of multiple antimicrobial-resistant Staphylococcus intermedius between dogs affected by deep pyoderma and their owners. Vet. Microbiol. 98: 2327. Hajek V. 1976. Staphylococcus intermedius, a new species isolated from animals. Int. J. Syst. Bacteriol. 26: 401408. Hauschild T. and A. Wjcik. 2007. Species distribution and properties of staphylococci from canine dermatitis. Res. Vet. Sci. 82: 16. Hendricks A., H.J. Schuberth, K. Schueler and D. Lloyd. 2002. Frequency of superantigen-producing Staphylococcus intermedius isolates from canine pyoderma and proliferation-inducing potential of superantigens in dogs. Res. Vet. Sci. 73: 2737. Jakubczak A., P. Szweda, K. ukaszewska and J. Kur. 2007. Molecular typing of Staphylococcus aureus isolated from cows with mastitis in the east of Poland on the basis of polymorphism of genes coding protein A and coagulase. Pol. J. Vet. Sci.10: 199205. Kikuchi K., T. Karasawa, C. Piao, I. Itoda, H. Hidai, H. Yamaura, K. Totsuka, T. Morikawa and M.Takayama. 2004. Molecular confirmation of transmission route of Staphylococcus intermedius in mastoid cavity infection from dog saliva. J. Infect. Chemother. 10: 4648. Kim T.J., Y.R. Na and J.I. Lee. 2005. Investigation into the basis of chloramphenicol and tetracycline resistance in Staphylococcus intermedius isolates from cases of pyoderma in dogs. J. Vet. Med. B. Infect. Dis. Vet. Public. Health 52: 119124. Kizerwetter-wida M., D. Chrobak, M. Rzewuska and M. Binek. 2009. Antibiotic resistance patterns and occurence of mecA gene in Staphylococcus intermedius strains of canine origin. Pol. J. Vet. Sci. 12: 913. Kloos W.E. and M.S. Musselwhite. 1975. Distribution and persistence of Staphylococcus and Micrococcus species and other aerobic bacteria on human skin. Appl. Environ. Microbiol. 30: 381395. Krawczyk B., J. Leibner, W. Baraska-Rybak, A. Samet, R. Nowicki and J. Kur. 2007. ADSRRS-fingerprinting and PCR MP techniques for studies of intraspecies genetic relatedness in Staphylococcus aureus. J. Microbiol. Meth. 71: 114122. Krl J. 1998. Characterization of staphylococci isolated from healthy and infected dogs (in Polish). Zeszyty Naukowe Akademii Rolniczej, Wrocaw, Weterynaria LVIII, 344: 1747. Mahoudeau I., X. Delabranche, G. Prevost, H. Monteil and Y. Piemont. 1997. Frequency of isolation of Staphylococcus intermedius from humans. J. Clin. Microbiol. 35: 21532154. Maachowa N., A. Sabat, M. Gniadkowski, J. KrzysztoRussjan, J. Empel, J. Midzobrodzki, K. Kosowska-Shick, P.C. Appelbaum and W. Hryniewicz. 2005. Comparison of multiple-locus variable-number tandem-repeat analysis with pulsedfield gel electrophoresis, spa typing, and multilocus sequence

26

Kasprowicz A. et al.

typing for clonal characterization of Staphylococcus aureus isolates. J. Clin. Microbiol. 43: 30953100. Midzobrodzki J., N. Maachowa, T. Markiewski, A. Biaecka and A. Kasprowicz. 2008. Differentiation of Staphylococcus aureus isolates based on phenotypical characters (in Polish). Postpy Hig. Med. Dow. 62: 322327. Nagase N., A. Sasaki, K. Yamashita, A. Shimizu, Y. Wakita, S. Kitai and J. Kawano. 2002. Isolation and species distribution of staphylococci from animal and human skin. J. Vet. Med. Sci. 64: 245250. Ruscher C., A. Lubke-Becker, C.G. Wleklinski, A. Soba, L.H. Wieler and B. Walther. 2009. Prevalence of methicillinresistant Staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Vet. Microbiol. 136: 197201. Sasaki T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamata and K. Hiramatsu. 2007a. Reclassification of phenotypically identified Staphylococcus intermedius strains. J. Clin. Microbiol. 45: 27702778. Sasaki T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamata and K. Hiramatsu. 2007b. Methicillin-resistant Staphylococcus pseudintermedius in a veterinary teaching hospital. J. Clin. Microbiol. 45: 11181125. Shopsin B., B. Mathema, J. Martinez, E. Ha, M.L. Campo, A. Fierman, K. Krasinski, J. Kornblum, P. Acabes, M. Waddington, M. Riehman and B.N. Kreiswirth. 2000. Prevalence of methicillin-resistant and methicillin-susceptible Staphylococcus aureus in the community. J. Infect. Dis. 182: 359362.

Simoons-Smit A.M., P.H.M. Savelkoul, J. Stoof, T.M. Starink and C.M.J. Vandenbroucke-Grauls. 2000. Transmission of Staphylococcus aureus between humans and domestic animals in a houshold. Eur. J. Clin. Microbiol. Infect. Dis. 19: 150152. Stepanovic S., V. Dimitrijevic, D. Vukovic, I. Dakic, B. Savic and M. Svabic-Vlahovic. 2001. Staphylococcus sciuri as a part of skin, nasal and oral flora in healthy dogs. Vet. Microbiol. 82: 177185. Szewczyk E.M. 2005. Bacteriological diagnostics (in Polish). Wydawnictwo Naukowe PWN, Warszawa, pp 2023. Talan D.A., D. Staatz, A. Staatz and G..D. Overturf. 1989. Frequency of Staphylococcus intermedius as human nasopharyngeal flora. J. Clin. Microbiol. 27: 23932399. Van Hoovels L., A. Vankeerberghen, A. Boel, K. Van Vaerenbergh and H. De Beenhouwer. 2006. First case of Staphylococcus pseudintermedius infection in a human. J. Clin. Microbiol. 44: 46094612. Weese J.S., R. Poma, F. James, G. Buenviaje, R. Foster and D. Slavic. 2009. Staphylococcus pseudintermedius necrotizing fascilitis in a dog. Can. Vet. J. 50: 655656. Wieliczko A., J. Krl, T. Piasecki, M. Mazurkiewicz and Z. Staroniewicz. 2002. Occurence and characteristics of staphylococci isolated from poultry (in Polish). Med. Weter. 58: 348352. Wadyka B., M. Bita, A.J. Sabat, E. Bonar, S. Grzeszczuk, W. Hryniewicz and A. Dubin. 2008. A novel member of the thermolysin family, cloning and biochemical characterization of metalloprotease from Staphylococcus pseudintermedius. Acta Biochim. Pol. 55: 525536.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 2733

ORIGINAL PAPER

Comparison of Different PCR Methods for Detection of Brucella spp. in Human Blood Samples
HISHAM H. AL-AJLAN, ABDELNASSER S.S. IBRAHIM* and ALI A. AL-SALAMAH

Medical Unit, Department of Botany and Microbiology, Faculty of Science King Saud University, P.O. 2454, Riyadh 11451, Saudi Arabia Received 2 July 2010, revised 15 December 2010, accepted 18 December 2010
Abstract For detection of Brucella species by PCR four DNA extraction methods and four targets were compared using pure culture of Brucella melitensis and the best conditions were applied in clinical samples. It was found that the MagNA Pure LC method was the most efficient and sensitive method showing a positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and one ml water, respectively. Detection of Brucella spp. by conventional PCR was investigated using four different targets. The results indicated that The B4-B5 amplification method was the most sensitive one as it could amplify DNA extracted from as a low as 25 and 100 CFU/ml suspended in one ml water and blood, respectively. Furthermore real-time PCR was able to detect Brucella using DNA extracted from as low as 50 CFU/ml blood and 15 CFU/ml water, respectively. The best and optimum detection conditions were applied to the clinical samples. Evaluation of conventional PCR assays on blood specimens confirmed 72% of the results obtained by conventional blood culture methods with a specificity of 95%, while serum samples had a sensitivity of 54% and specificity of 100%. Real-time PCR was generally found to be more sensitive and specific for detecting Brucella spp. in blood and serum samples compared to conventional PCR. The real-time PCR done on blood specimens confirmed 77.5% of the results obtained by conventional blood culture methods with specificity of 100%, while 60% of serum samples were found to be positive with specificity of 100%. These results suggest that serum and blood analysis by conventional and real time PCR is a convenient and safe method for rapid and accurate diagnosis of brucellosis. K e y w o r d s: Brucella spp., brucellosis, detection, PCR methods for detection

Introduction Brucellosis is a major zoonotic disease that causes a serious health and economic problem worldwide (Elfaki et al., 2005). In spite of the growing number of countries declared Brucella-free, the disease remains one of the main zoonotic infections throughout many parts of the world with major economical and public health implications. About 500,000 new cases occur annually worldwide, with predominance in the Middle East, Mediterranean countries, South America and Central Asia (Godfroid, 2002; Sauret and Villissova, 2002). The causative organisms of brucellosis are Gram-negative facultative intracellular pathogens that may affect a range of different mammals including man, cattle, sheep, goats, swine, rodents and marine mammals and in most host species, the disease primarily affects the reproductive system with concomitant loss in productivity of animals affected (Cutler et al.,

2005). In man, infection is associated with protean manifestations and characteristically recurrent febrile episodes that led to the description of this disease as undulant fever (Abdoel et al., 2008). Currently, the diagnosis of brucellosis is based on microbiological and serological laboratory tests. However the diagnostic value of serological tests is unsatisfactory in the early stages of the disease due to low sensitivity, serological cross-reactions, and the inability to distinguish between active and inactive infection due to antibody persistence after therapy (Diaz and Moriyo, 1989; Navarro et al., 2002). Furthermore in patients with persistent or relapsing brucellosis, dependance on blood culture analysis is usually impeded by the low yield of microorganisms as a result of dormancy of brucellae in the mononuclear phagocytic cells (Elfaki et al., 2005). Blood cultures (which represent the gold standard of laboratory diagnosis) are among the most important tests used for the diagnosis of infectious

* Corresponding author: A.S.S. Ibrahim, Department of Botany and Microbiology, Faculty of Science, King Saud University, P.O. 2454, Riyadh 11451, Saudi Arabia; phone: +96 6597359415; e-mail: ashebl@ksu.edu.sa

28

Al-Ajlan H.H. et al.

diseases including brucellosis. However, contamination with skin type flora like coagulase negative staphylococcus could over grow the slow growing organisms like Brucella in addition to a serious threat to laboratory personnel (Yagupsky, 1999; 2004). Therefore, other diagnostic methods are needed to overcome such limitations of conventional approaches for the diagnosis of brucellosis. DNA-based methods such as gene probes and polymerase chain reaction (PCR) are attractive means for the confirmation of brucellosis. Because of the prevalence of brucellosis in Saudi Arabia, a precise diagnostic method should be established for the control of brucellae in this population. Different target genes, primer pairs, PCR techniques and extraction procedures have been previously investigated for Brucella detection, however, most of these assays have used Brucella DNA of pure cultures and only a few of these primers have been used in clinical animal, and human samples (Zerva et al., 2001; Abdoel et al., 2008; Bogdanovich et al., 2008; Hini et al., 2008) and there is no enough report about comparison of these assays. Therefore the aims of the current work were to compare different DNA extraction method for DNA purification from Brucella cells, compare different targets and PCR methods for detection of Brucella and apply it to clinical human samples Experimental
Material and Methods

Clinical samples and bacterial strains. A total of 200 clinical blood specimens were collected from the Armed Forces Hospitals (Riyadh, Saudi Arabia) including 160 blood samples obtained from patients with clinically proven or suspected systemic brucellosis infection and 40 control samples from healthy subjects without any clinical evidence or history of brucellosis. The diagnosis of brucellosis was confirmed by isolation and identification of Brucella spp. from blood culture. Blood (8 to 10 ml) was inoculated into BACTEC Plus aerobic/F blood culture bottle (enriched soybean-casein digest broth) and incubated for 28 days or until the bottles were positive. All blood cultures were evaluated in the BACTEC 9600 blood culture system (Becton Dickinson Diagnostic Instrument Systems), which detect microbial growth by continuous monitoring. One ml aliquots from bottles shown to contain Gram-negative coccobacilli bacteria were removed and stored at 80C until use. All isolated strains were identified in the lab. The reference strain used in this study was Brucella melitensis 16 M, which was obtained from the Central Veterinary laboratory (Weybridge, UK). It was propagated on chocolate agar (Oxoid) me-

dium and incubated at 37C in a humidified atmosphere supplemented with 5% CO2. Brain heart infusion broth (Oxoid) with 20% glycerol (Sigma) was used for the storage of bacterial strains at 80C. Preparation of bacterial cells suspensions. Freshly cultured Brucella melitensis was killed by the addition of 70% methanol in sterile saline (0.9% NaCl) and recovered by centrifugation at 5000 rpm for 5 min, washed twice with 5 ml of sterile distilled water then recovered by centrifugation at 5000 rpm for 5 min. The cells were serially diluted with sterile distilled water and adjusted to a 0.5 McFarland standard (which is approximately 1.5 108 CFU/ml). Different cell dilutions were prepared and suspended in either sterile distilled water or whole blood collected in EDTA Vacutainer from healthy individual with no evidence or history of brucellosis infection, to give a final cell count in the range of 25 to 105 CFU/ml. The inoculated whole blood samples and cells suspended in water were subsequently used for DNA extraction. Sterile water inoculated blood samples served as a negative control. Bacterial DNA extraction methods. Four different DNA extraction kits were used to extract the genomic DNA of Brucella melitensis according to the manufacturer instructions including QIAmp kit (Qiagen), GenomicPrep DNA Isolation Kit (Amersham Biosciences), Automated Nucleic Acid Purification system (MagNA Pure LC Systems), in addition to 10% Chelex-100 resin suspension (Bio-Rad Laboratories) where 0.2 ml cell suspension was mixed with 0.1 ml of a 10% Chelex-100 resin suspension (Bio-Rad Laboratories), and the mixture was boiled for 10 min. After centrifugation at 10000 rpm for 5 min, about 0.1 ml of supernatant was removed and used for PCR. Detection of Brucella melitensis by conventional PCR. The sensitivity of conventional PCR was investigated for detection of Brucella melitensis using a modification of previously reported methods (Navarro et al., 2002; Baddour and Alkhalifa, 2008) using four different primers pairs (TIB MOLBIOL, Berlin, Germany), specific to four different targets in Brucella spp. (Table I). The PCR reaction contained (25 l): reaction buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris HCl, pH 9.0), 200 M of each of dATP, dCTP, dGTP, and dTTP and 2.5 U of puReTaq DNA polymerase (Amersham-Pharmacia). For optimization of PCR conditions different concentrations of primers (525 pmol) and MgCl2 (1.54 mM), amplification at different temperature settings and cycling programs were used (Table I). Following PCR reaction, 10 l of the reaction mixture was mixed with 2 l of loading buffer ReddyRun (ABgene) and was run in 2 % agarose gel electrophoresed in Tris-borate-EDTA buffer (TBE) at 120 V for about 50 min and the amplified DNA bands were visualized in ethidium bromide staining and

1
gene encoding an outer membrane protein (omp-2) 600 905 193 F-5-GGTTGTTAAAGGAGAACAGC-3 F-5-TCGAGCGCCCGCAAGGGG-3 F-5-GCGCTCAGGCTGCCGACGCAA-3 R-5-GACGATAGCGTTTC AACTTG-3 R-5-AACCATAGTGTCTCCACTAA-3 R-5-ACCAGCCATTGCGGTCGGTA-3

Detection of Brucella spp. by different PCR methods

29

Table I Main characteristics of PCR methods used in the study

sequence 16S rRNA of B. abortus

photographed under UV light. 100 bp Superladder (ABgene) was used as DNA Marker. Sterile water instead of DNA was used as a negative control. Detection of Brucella melitensis by Real-time PCR. Detection of Brucella using Real-time PCR was investigated using modified of previously reported method (Redkar et al., 2001). The reaction mixture for the real time contained 2 l of 10x LightCycler-FastStart DNA master hybridization probes (Roche Diagnostics), 2.4 l MgCl2 (final concentration of 4 mM), 4 l Reagent mix (Brucella-specific primers and hybridization probes), and 6.6 l nucleases free water and 5 l of the tested DNA. Thermocycling conditions were as follows: one cycle of initial denaturation at 95C for 10 min, followed by 55 amplification cycles (temperature transition rate of 20C/s), each including denaturation (95C for 10 s), annealing (55C for 8 s), and extension (72C for 15 s). Fluorescence was measured continuously during the slow temperature rise to monitor the dissociation of the LightCycler Red 640-labeled sensor probe at the F2 channel. Water was used instead of DNA as a negative control. Results Sensitivity of the DNA extraction methods. Four different DNA extraction methods were evaluated for whole DNA purification from Brucella melitensis. Serial dilution of Brucella melitensis cells were suspended in either sterile water or whole blood to give a final cells count of 25 to 25000 CFU/ml. DNA was extracted and the purified DNA was used as a template for PCR reaction. The sensitivity and efficacy was measured as the minimum number of CFU required to produce DNA showing a positive PCR. The results for the approximate sensitivity of each method are shown in Tables II and III. It was found that the MagNA Pure LC method was the most efficient and sensitive method as it showed positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and
Table II Sensitivities of different DNA extraction methods. Serial dilution of the Brucella melitensis cells was prepared in one ml blood. Total DNA was extracted using different methods and the purified DNA was used as template in PCR
DNA extraction Count of Brucella cells (CFU/ml blood) 800 + + + 400 200 100 + + + + + + 50 25

JPF-JPR

F4-R2

ISP1-ISP2

IS6501

gene encoding a 31 kDa Brucella abortus antigen 223 F-5-TGGCTCGGTTGCCAATATCAA-3 R-5-CGCGCTTGCCTTTC AGGTCTG-3

B4-B5

PCR conditions: MgCl2 conc. (mM) Taq polymerase (IU) Annealing temp Extension time (s)

1.5, 2.5, 4 2.5 60 60

1.5 2.5 56 45

1.5 2.5 54 90

3 2.5 60 60

Product size (bp) Primer sequence

PCR target

Methods 25000 6000 MagNA Pure LC + + QIAmp silica column + + GenomicPrep Blood + + Chelex resin
+: Positive PCR, : Negative PC

Characteristic

30

Al-Ajlan H.H. et al.

one ml water respectively, followed by GenomicPrep Blood method and QIAmp silica column purification method respectively (Table II and III). However none of the extracted DNA using Chelex resin was able to give positive PCR reaction. Based on these results the MagNA Pure LC method was selected for further analysis. Detection of Brucella by conventional and real time PCR. Detection of Brucella melitensis by conventional PCR was investigated using four different targets. The results presented in Table IV and V and Figure 1 indicated that the B4-B5 amplification method was the most sensitive as it could amplify DNA extracted from as low as 25 and 100 CFU/ml suspended in one ml water and blood, respectively, followed by ISP1-ISP2 and F4-R2, respectively.

However, none of the bacterial DNA from whole blood or water gave a positive PCR using the JPRJPF method. Based on these results the B4-B5 method was used in analysis of the clinical samples. The sensitivity of the real-time PCR was determined using Brucella specific probes. The reaction was carried out using DNA extracted from serial dilution of bacterial cells suspended in blood and water. Real-time PCR was able to detect Brucella using DNA extracted from as low as 50 and 15 CFU suspended in one ml blood and water respectively (Fig. 2). Clinical samples. During the study period, 200 clinical blood specimens (160 patients and 40 controls) were tested for brucellosis by blood culture, optimum conventional PCR and real-time PCR. Among the 160 clinical samples tested, 89 specimens were

Fig. 1. Sensitivity of PCR using different targets for detection of Brucella sp.
Using B4-B5 and DNA extracted from and DNA extracted from serial dilutions of cells suspended in Blood (A) and water (B). Using ISP1-ISP2 and DNA extracted from serial dilutions cells suspended in blood (C) and water (D). Using F4-R2 and DNA extracted from cells suspended blood (E) and water (F). Lane 1: 100 bp Marker, 2: Negative control, 3: 25,000 CFU/ml, 4:6,000 CFU/ml, 5: 800 CFU/ml, 6: 400: CFU/ml, 7: 200 CFU/ml, 8: 100 CFU/ml, 9: 50 CFU/ml and 10: 25 CFU/ml

Detection of Brucella spp. by different PCR methods

31

Fig. 2. Detection of Brucella by real time PCR

Fluorescence is plotted against number of PCR cycles to monitor amplification of different cells counts Brucella suspended in blood (A) and water (B) 1: 800 CFU/ml, 2: 200 CFU/ml, 3:100 CFU/ml, 4: 50 CFU/ml, 525 CFU/ml, 6:15 CFU/ml, 7&8: Negative control

blood culture positive for Brucella and 71 were negative but 9 of them were positive for other bacteria (six coagulase negative staphylococci, one Staphylococcus aureus, one Klebsiella spp. and one Acinatobacter spp). One of the blood culture positive for coagulase
Table III Sensitivities of different DNA extraction methods. Serial dilution of the Brucella melitensis cells was prepared in one ml water. Total DNA was extracted using different methods and the purified DNA was used as template in PCR
DNA extraction Count of Brucella cells (CFU/ml water) 800 + + + + 400 + + + 200 + + + 100 + + + 50 + + 25 +

negative staphylococcus (detection after 33 h) was positive for Brucella by conventional PCR and light cycler PCR in blood, negative in serum and negative by blood culture. DNA was extracted from the 89 blood samples (which were found to be positive for Brucella by blood culture) and detection was carried
Table IV Sensitivities of four PCR methods for detection of Brucella suspended in blood determined by amplifying the DNA extracted from different cells dilutions
Methods B4-B5 ISP1-ISP2 F4-R2 JPF-JPR Count of Brucella cells (CFU/ml blood) 25000 6000 + + + + + + 800 + + + 400 200 100 + + + + + 50 25

Methods 25000 6000 MagNA Pure LC + + QIAmp silica column + + GenomicPrep Blood + + Chelex + +
+: Positive PCR, : Negative PC

+: Positive PCR, : Negative PC

32

Al-Ajlan H.H. et al.

Table V Sensitivities of four PCR methods for detection of Brucella suspended in water specimens determined by amplifying the DNA extracted from the dilution series
Methods B4-B5 ISP1-ISP2 F4-R2 JPF-JPR Count of Brucella cells (CFU/ml water) 25000 6000 800 400 200 100 50 25 + + + + + + + + + + + + + + + + + + +

+: Positive PCR, : Negative PC

Table VI Detection of Brucella in blood and serum samples by conventional PCR in comparison to blood culture method
Specimen Blood Culture Blood Serum Positive 89 (89) 64 (89) 48 (89) False pos. Sensitivity Specificity 0 (40) 2 (40) 0 (40) 100% 72% 54% 100% 95% 100%

Table VII Detection of Brucella spp. in blood and serum samples by real-time PCR in comparison to blood culture method
Specimen Blood culture Blood Serum Positive 89 (89) 69 (89) 54 (89) False pos. Sensitivity Specificity 0 (40) 0 (40) 0 (40) 100% 77.5% 60 % 100% 100% 100%

out using optimum conditions of conventional PCR and real-time PCR. The results of conventional PCR showed that 64 out of 89 blood samples and 2 of the 40 control samples (5%) were positive. In addition, 48 of the 89 serum samples were positive and none of the control samples were positive. The sensitivities of PCR detection in blood, serum and blood culture were 72, 54 and 100%, respectively, and the specificities were 95, 100, 100% respectively (Table VI). The results of detection of Brucella spp. using real-time PCR are shown in Table VII. It was found that 69 out of 89 blood samples were positive and 54 of the 89 serum samples (60%) were positive and none of the control samples were positive. The sensitivities for blood, serum and blood culture were 77.5, 60 and 100% with specificities of 100, 100, 100%, respectively. Discussion An accurate diagnosis of brucellosis is very important for treatment, control and eradication of brucellae and due to the prevalence of brucellosis in Saudi Arabia, an efficient and sensitive diagnostic

method should be established for the control of brucellae in this population (Elfaki et al., 2005). PCR offers an alternative choice over the conventionally available methods for an accurate diagnosis of brucellosis. However, sufficient nucleic with removal of inhibitory substances is essential for optimal detection of the microbial pathogens by PCR. The aim of this study was to optimize the DNA extraction and PCR conditions for detection of Brucella spp. and apply the optimum conditions in the clinical samples and compare it with blood culture approach. Therefore four different DNA extraction methods were evaluated to purify total DNA from Brucella melitensis. Although blood is known to possess substances inhibitory to PCR, the DNA purification methods used in this study (except chelex resin method) were successful in eliminating these inhibitors, the most sensitive and efficient one being the MagNA Pure LC method showing positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and one ml water respectively. The detection of bacterial DNA in blood specimens by PCR usually requires sensitive DNA amplifying method with sensitive primers and optimized PCR conditions because of the presence of human DNA and inhibitors in blood (Bricker, 2002; Bogdanovich et al., 2004). With the aim of finding the most efficient and sensitive methods for detection of Brucella DNA in blood specimens, four DNA amplifying methods were evaluated using four primers pairs including B4-B5, ISP1-ISP2, F4-R2 and JPF-JPR. The results indicated that the detection limit varied between 25 to 800 CFU/ml, depending on the amplifying method (except JPF-JPR method). The B4-B5 amplification method was the most sensitive one as it could amplify DNA extracted from as a low as 25 and 100 CFU/ml suspended in one ml water and blood respectively, followed by ISP1-ISP2 and F4-R2, respectively. This result is consistent with that previously reported by Elfeki et al. (2005) where PCR using primers B4-B5 was the most sensitive one for detection of Brucella spp. However in another study by Navarro et al. (2002) for comparison of three PCR methods for detection of Brucella, F4/R2 was the most sensitive primers. Furthermore the sensitivity of the real-time PCR was determined using Brucella specific probes. The reaction was carried out using DNA extracted from serial dilution of bacterial cells suspended in blood and water. Real-time PCR was even more sensitive than conventional PCR as it was able to detect Brucella spp. using DNA extracted from as low as 50 CFU /ml blood 15 CFU/ml water. The best DNA extraction method was used to extract DNA from the clinical samples and optimum conventional PCR conditions, RT-PCR and blood culture were compared for detection of Brucella spp. in the clinical blood samples. It was found that 72%

Detection of Brucella spp. by different PCR methods

33

and 54% of the positive blood culture was detected by PCR with specificity of 95% and 54% in blood and serum, respectively. The use of PCR for the detection of Brucella DNA in blood samples of certain groups of patients with brucellosis has been previously studied with sensitivity in the range of 50% to 100% (Mattar et al., 1996; Navarro et al., 1999; Zerva et al., 2001). Several systems of real-time PCR have been developed. They are user-friendly, rapid, and free of contamination. Moreover, these PCRs overcome the conventional PCR by allowing quantification of the targeted copies in the specimen (Newby et al., 2003; Probert et al., 2004). Evaluation of the real-time PCR for detection of Brucella spp. in the clinical blood samples showed excellent specificity and good sensitivity. The real-time PCR confirmed 77.5% of the results obtained with the blood culture assays with specificity of 100%. In this study it appears that the real-time PCR has greater sensitivity and specificity than conventional PCR. Conclusions. In conclusion comparison of blood culture, conventional PCR conditions and RT-PCR for detection for detection of Brucella spp. in the clinical blood samples indicated that PCR amplification technology is promising method for the detection of Brucella in clinical samples with high sensitivity and specificity close to that reported by conventional blood culture. Although the PCR detection of Brucella spp. using peripheral blood is not without difficulties, it presents considerable advantages. Compared to standard bacteriological methods, the PCR assays are safer and more rapid to perform. Therefore, these assays may be important diagnostic tools to detect Brucella spp.
Acknowledgment This work was financially supported by Deanship of Scientific Research, King Saud University. The authors are gratefully acknowledged for this support

Literature
Abdoel T., I.T. Dias, R. Cardoso and H.L. Smit. 2008. Simple and rapid field tests for brucellosis in livestock. Vet. Microbiol. 130: 312319. Baddour M.M. and D.H. Alkhalifa. 2008. Evaluation of three polymerase chain reaction techniques for detection of Brucella DNA in peripheral human blood. Can. J. Microbiol. 54: 352357.

Bogdanovich T., M. Skurnik, P.S. Lubeck, P. Ahrens and J. Hoorfar. 2004. Validated 5 nuclease PCR assay for rapid identification of the genus Brucella. J. Clin. Microbiol. 42: 22612263. Bricker B.J. 2002. PCR as a diagnostic tool for brucellosis. Vet. Microbiol. 90: 435446. Cutler S.J., A.M. Whatmore and N.J. Commander. 2005. Brucellosis new aspects of an old disease. J. Appl. Microbiol. 98: 1270128.1 Diaz R. and I. Moriyo. 1989. Laboratory techniques in the diagnosis of human brucellosis. In: Brucellosis: Clinical and Laboratory Aspects (Young, E.J. and Corbel, M.J., Eds.), pp. 7383. CRC Press, Boca Raton, FL. Elfaki M.G., T. Uz-Zamana, A.A. Al-Hokailb and S.M. Nakeeba. 2005. Detection of brucella DNA in sera from patients with brucellosis by polymerase chain reaction. Diagnos. Microbiol. and Infect. Dis. 53: 17. Godfroid J. 2002. Brucellosis in Wildlife. Rev. Sci. Tech. Int. Epiz. 21: 277286. Hini V., I. Brodard, A. Thomann, . Cvetni, P.V. Makaya, J. Frey and C. Abril. 2008. Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and real-time PCR systems. J. Microbiol. Methods. 75: 375378. Mattar G.M., I.A. Khneisser and A.M. Abdelnoor. 1996. Rapid laboratory confirmation of human brucellosis by PCR analysis of a target sequence on the 31-Kilodalton Brucella antigen DNA. J. Clin. Microbiol. 34: 477478. Navarro E., J. Escribano, J.A. Fernandez and J. Solera. 2002. Comparison of three different PCR methods for detection of Brucella spp. in human blood samples. FEMS Immun. Med. Microbiol. 34: 147151. Navarro E., J.A. Fernandez and J. Solera. 1999. PCR assay for diagnosis of human brucellosis. J. Clin. Microbiol. 37: 16541655. Newby D.T., T.L. Hadfield and F.F Roberto. 2003. Real-time PCR detection of Brucella abortus: a comparative study of SYBR Green I, 5-exonuclase, and hybridization probe assays. Appl. Environ. Microbiol. 69: 47534759. Probert W.S., K.N. Schrader, N.Y. Khuong, S.L. Bystrom and M.H. Graves. 2004. Real time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol. 42: 12901293. Redkar R., S. Rose, B. Bricker and V. Del Vecchio. 2001. Realtime detection of Brucella abortus, Brucella melitensis and Brucella suis. Mol. Cell. Prob. 15: 43 52 Sauret J.M. and N. Villissova. 2002. Human brucellosis. J. Am. Board. Pract. 15: 401406. Yagupsky P. 1999. Detection of Brucella in blood cultures. J. Clin. Microbiol. 37: 34373342 Yugupsky P. 2004. Use of the BACTEC MYCO/F LYTIC medium for detection of Brucella melitensis bacteremia. J. Clin. Microbiol. 42: 22072208. Zerva L., K. Bourantas, S. Mitka, A. Kansouzidou and N.J. Legakis. 2001. Serum is the preferred clinical specimen for diagnosis of human brucellosis by PCR. J. Clin. Microbiol. 39: 16611664.

34

Al-Ajlan H.H. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 3541

ORIGINAL PAPER

Antibiofilm Activity of Selected Plant Essential Oils and their Major Components
ALEKSANDRA BUDZYSKA 1, MARZENA WICKOWSKA-SZAKIEL 1, BEATA SADOWSKA 1, DANUTA KALEMBA 2 and BARBARA RALSKA1*
1 Institute 2 Institute

of Microbiology, Biotechnology and Immunology, University of d, Poland of General Food Chemistry, Technical University of d, Poland Received 14 October 2010, accepted 15 December 2010
Abstract

The aim of the study was to examine the antibiofilm activity of selected essential oils (EO): Lavandula angustifolia (LEO), Melaleuca alternifolia (TTO), Melissa officinalis (MEO) and some of their major constituents: linalool, linalyl acetate, "-terpineol, terpinen-4-ol. Biofilms were formed by Staphylococcus aureus ATCC 29213 and Escherichia coli NCTC 8196 on the surface of medical biomaterials (urinary catheter, infusion tube and surgical mesh). TTC reduction assay was used for the evaluation of mature biofilm eradication from these surfaces. Moreover, time-dependent eradication of biofilms preformed in polystyrene 96-well culture microplates was examined and expressed as minimal biofilm eradication concentration (evaluated by MTT reduction assay). TTO, "-terpineol and terpinen-4-ol as well as MEO, showed stronger anti-biofilm activity than LEO and linalool or linalyl acetate. Among the biomaterials tested, surgical mesh was the surface most prone to persistent colonization since biofilms formed on it, both by S. aureus and E. coli, were difficult to destroy. The killing rate studies of S. aureus biofilm treated with TTO, LEO, MEO and some of their constituents revealed that partial (50%) destruction of 24-h-old biofilms (MBEC50) was achieved by the concentration 48 MIC after 1 h, whereas 24 MIC was enough to obtain 90% reduction in biomass metabolic activity (MBEC90) after just 4 h of treatment. A similar dose-dependent effect was observed for E. coli biofilm which, however, was more susceptible to the action of phytochemicals than the biofilms of S. aureus. It is noteworthy that an evident decrease in biofilm cells metabolic activity does not always lead to their total destruction and eradication. K e y w o r d s: biofilm eradication, biomaterial-associated infections, essential oils

Introduction A frequent complication while using artificial devices in medical practice (BAI, biomaterial-associated infections) are infections dependent on microbial adhesion and biofilm formation. They should be considered a serious health problem requiring a rapid solution. Very often BAI are a consequence of direct biomaterial contamination during implantation but they can also be caused by haematogenous spread of bacteria from an infection site anywhere within the human body. A similar medical problem is posed by wound-associated chronic infections, which are also often characterized as having a biofilm nature. The biofilm mode of growth results in an increased bacterial resistance against classical antimicrobial treatment and host immune factors (Bryers, 2008; James et al., 2008; Dai et al., 2010; Hoiby et al., 2010).

Thus, the search for alternative therapies is a necessity and using, for example, natural plant/animal products and/or their combinations with antibiotics or synthetic counterparts seems to be one of the promising solutions (Drig et al., 2010). Higher plants evolved through developing mechanisms for avoiding the effects of microbial attack based on the production of protective substances, usually their secondary metabolites. Compounds with strong bacteriostatic or bactericidal activity belong mostly to phytoalexins and, within this group, essential oils are the most important members (Gibbons, 2008). Essential oils are complex mixtures of chemical substances, at least one of which shows antimicrobial activity. They consist mainly of monoterpenes, sesquiterpenes, diterpenes and other aromatic or aliphatic compounds (Kalemba and Kunicka, 2003; Bakkali et al., 2008; Reichling et al., 2009). Essential oils of several plants

* Corresponding author: B. Ralska, Department of Immunology and Infectious Biology, Institute of Microbiology, Biotechnology and Immunology, University of d; Banacha 12/16, 90-237 d, Poland; e-mail: rozab@biol.uni.lodz.pl

36

Budzyska A. et al.

are widely used in ethnomedicine for their antimicrobial and anti-inflammatory properties but their antibiofilm activity has not been so far studied extensively (Carson et al., 2006; Fabian et al., 2006; Cavanagh and Wilkinson, 2002; Karpanen et al., 2008; Warnke et al., 2006; Chao et al., 2008; Gursoy et al., 2009; Hossainzadegan and Delfan, 2009). Essential oils derived from Melaleuca alternifolia, Lavandula angustifolia, Melissa officinalis and their major constituents were selected for the present study. Tea tree oil (TTO) is an essential oil from the leaves of the Australian M. alternifolia tree, a member of the botanical family Myrtaceae. The oil from the leaves is used medicinally, being effective against bacterial, viral and fungal organisms as well as having immunostimulatory activity. It is also known that it can alleviate inflammation and may help wound healing (Carson et al., 2006). Essential oils distilled from members of the genus Lavandula have been applied both cosmetically and therapeutically for centuries with the most commonly used species being L. angustifolia, L. latifolia, L. stoechas and L. intermedia. The claims made for lavender oil include its antibacterial, antifungal, smooth muscle relaxing, sedative, antidepressive properties (Cavanagh and Wilkinson, 2002; Roller et al., 2009). Melissa is commonly used in Europe as a tea, liquid extract, and topical preparation. Melissa essential oil (lemon balm) is also a common antibacterial and antifungal agent (Mimica-Dukic et al., 2004). The attention of our study was focused on the possibility of using essential oils in the fight against biofilms of two members of the alert pathogens group. These were Gram-positive staphylococci, Staphylococcus aureus and Gram-negative enteric bacteria Escherichia coli, since the epidemiological data on the incidence of infection with their participation sound serious. Moreover, these strains were chosen because the known differences in the cell wall structures between Gram-positive and Gram-negative bacteria imply the extent of their susceptibility to various antimicrobial agents (Gibbons, 2008; Fabian et al., 2006; Chao et al., 2008). Experimental
Materials and Methods

Biomaterials, bacteria, phytochemicals. The following biomaterials/culture surfaces were used: short term urine drainage catheter of Nelaton type (Bicakcilar, Turkey), infusion tube (Polfa Lublin, Poland) (both 0.5 cm in length); surgical mesh support for muscle/fascia (Tricomed, d, Poland) (0.50.5 cm); 96-well polystyrene tissue culture microplates (Nunc, Denmark). Eradication of Staphylococ-

cus aureus ATCC 29213 and Escherichia coli NCTC 8196 biofilms by essential oils (EO) and some of their main components was evaluated. There were oils of Melaleuca alternifolia (tea tree oil, TTO), Lavandula angustifolia (lavender essential oil, LEO), Melissa officinalis (Melissa essential oil, MEO or lemon balm) and "-terpineol, terpinen-4-ol, linalool, linalyl acetate. All essential oils were purchased from Pollena Aroma, Poland and the isolated compounds of EO were purchased from SAFC, USA, via Sigma, USA. Evaluation of bacterial susceptibility to essential oils and their major constituents. MIC (minimal inhibitory concentration) of phytochemicals was determined by the standard CLSI (Clinical Laboratory Standards Institute) microdilution method, with minor modifications (Budzyska et al., 2009). Essential oils/ components were initially diluted in 96% ethanol (1:1 v/v), and later in Mueller-Hinton Broth (MHB, Sigma) with 0.5% Tween 20 (Sigma). The tested concentrations of phytochemicals (range 6.750.024%) were deposited in triplicate, in a volume of 100 l in the wells of flat-bottomed polystyrene 96-well microplates (Nunc, Denmark). Then, 100 l of bacterial suspension with a density of 106/ml in MHB/0.5% Tween 20 was added to each well. The positive control was a suspension of bacteria in 200 l of MHB/0.5% Tween 20, and a negative control was the medium without bacteria. After 24 h incubation at 37C, the absorbance at A600 (Victor 2, Wallac, Finland) was determined. The concentration at which the A600 of the wells did not exceed the value of absorbance of the control medium was accepted as the MIC. The lowest concentration of essential oils/components, bactericidal to 99.9% of the original inoculum (MBC, minimal bactericidal concentration) was determined from broth dilution MIC tests, by subculturing 100 l (from the wells of MIC, 2 MIC, 4 MIC, 8 MIC) to the broth medium without any antimicrobial agents. No visible growth after subsequent 24 h incubation means MBC on condition that the concentration is not higher than the 4-fold value of MIC. Antimicrobial substances oxacillin and ofloxacin (Sigma, USA) were accepted as a reference. Surface colonization and biofilm eradication. Fragments of biomaterials (three pieces of each type) were incubated with bacterial suspension in tryptic soy broth (TSB) supplemented with glucose (TSB/0.25% Glc) for 24 h at 37C. Colonized surfaces, after their washing with phosphate-buffered saline (PBS), were transferred to the wells of a 96-well tissue culture microplate containing dilutions of essential oils/components and were incubated for the next 24 h at 37C. Then, biomaterial fragments were rinsed with PBS and transferred to a new 96-well microplate containing TSB with 1% TTC (2,3,5-triphenyltetrazolium chloride) for 24 h incubation at 37C, as previously

Antibiofilm activity of plant essential oils

37

described (Ralska et al., 1998). TTC is a redox indicator used to differentiate between metabolically active and inactive cells; the colorless compound is enzymatically reduced to red TPF (1,3,5-triphenylformazan) in living cells due to the activity of various dehydrogenases. The presence/reduction of biofilm biomass was evaluated by comparing the color intensity of biofilm deposit on biomaterials treated and untreated with phytochemicals, according to arbitrarily fixed scale (4+, 3+, 2+, 1+, ). The experiments were performed twice to confirm reproducibility of the results. The results of the semi-quantitative method were compared with those of a standard biomass quantification method by CFU determination. The fragments of colonized biomaterials treated with phytochemicals, which were scored by TTC assay as (+) and (), were removed from the wells and rinsed in PBS. Then, they were placed in 1 ml of sterile broth medium and the remaining bacterial deposit was removed by ultrasonic disruption for 5 min. One hundred l of the sonicate was spread onto two agar plates for overnight incubation and CFU counting. Time-dependent biofilm eradication. Time-dependent inhibitory concentration of phytochemicals for biofilms preformed in a polystyrene 96-well culture microplate, used at concentrations from MIC to 8 MIC was determined. Mature (24-h old) biofilms of S. aureus ATCC 29213 and E. coli NCTC 8196 were exposed to the action of essential oils/components for 1, 4, 6 and 24 h co-incubation at 37C. The essential oils/components concentrations causing 50% or at least 90% reduction in biomass metabolic activity (MBEC50 and MBEC90) at each time point were determined using MTT-reduction assay, as described earlier (Walencka et al., 2005; 2007). MBEC50 means that A550 of the sample dropped below the half value of the positive control (A550 = 1.5) and MBEC90 means that A550 of the sample was close to the value of the negative control (A550 = 0.2). To avoid interference between the phytochemicals red-ox potency and MTT, before its application, the fluid above the biofilm was aspirated and removed. In this assay, pale-yellow MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) is reduced to purple formazan by living, respiratory active cells. A solubilizer was added to dissolve the formed formazan product into a colored solution whose absorbance was quantified (550 nm (Victor 2, Wallac, Finland). The experiments were performed in duplicate to confirm reproducibility of the results. Mean A550 S.D. values were presented. Evaluation of viability of bacterial cells treated with essential oils. The potential effect of essential oil on bacterial cell membranes was assessed using EO-mediated SYTO 9 and propidium iodide uptake (LIVE/DEAD BacLight Bacterial Viability kit, Molecular Probes, Invitrogen, Poland). Cell suspensions of

S. aureus ATCC 29213 and E. coli NCTC 8196 in PBS (1.0 106 CFU/ml) were incubated with 4 MIC, 2 MIC or MIC) of EO at 37C for 4 h, with shaking. After the incubation, the bacteria were washed with 5ml sterile PBS and stained using the LIVE/DEAD kit, according to the manufacturers recommendations. The cells with LIVE/DEAD and no EO served as negative controls. After the incubation all the samples were washed and resuspended in PBS, and a drop of each suspension was examined with a confocal scanning laser microscope for green/red fluorescence to visualize SYTO 9 and propidium iodide, respectively. Six areas of each of the triplicate samples were photographed with an integrated Hamamatsu digital camera (C474295; Nikon UK). Results The minimal inhibitory concentration (MIC) of selected essential oils and their major constituents was determined using the broth microdilution method and defined as the lowest concentration able to inhibit visible microbial growth. The essential oil of Melaleuca alternifolia (TTO), "-terpineol and terpinen-4-ol, as well as the essential oil of Melissa officinalis (MEO), showed stronger antibacterial activity than the essential oil of Lavandula angustifolia (LEO) and its major components, such as linalool and linalyl acetate. Their MICs values against Staphylococcus aureus and Escherichia coli are presented in Table I. The experiments performed to check whether the tested phytochemicals are bactericidal showed that MBC values did not exceed the obligatory 4 x MIC, since more than 99% of the bacterial inoculum was killed even by MIC or 2 MIC. One exception was the S. aureus culture which was killed by 8 MIC of linalool one of the components from the lavender and melissa essential oils. The data on this set of experiments are presented in Table I. The answer to the question whether TTO, LEO, MEO are bacteriostatic or bactericidal was also provided by the experiments for EO-mediated SYTO 9/PI uptake, evaluated by fluorescent confocal microscopy. As assessed by the emission of green/red fluorescence, non-treated S. aureus or E. coli cells, showed only green fluorescence (live with undamaged cell wall), except for very few red cells. However, EO-treated cells exhibited increased uptake of propidium iodide (leaking cell wall and membrane), proportional to the increase in the compound concentration. All bacterial cells from planktonic cultures treated with EO at the concentration of 24 MIC, exhibited red fluorescence (data not shown). In the further experiments, essential oils/compounds were shown to possess the bactericidal activity against

38

Budzyska A. et al.

Fig. 1. Time- and concentration-dependent effect of essential oils on biofilm viability, determined by MTT-reduction assay.
A1, A2, A3 (S. aureus), B1, B2, B3 (E. coli) biofilms exposed to tea tree oil (A1, B1), lavender oil (A2, B2), or lemon balm (A3, B3). A550 mean S.D.

mature S. aureus and E. coli biofilms formed earlier on the surface of polystyrene culture microplate wells. The time-dependent inhibitory concentration of phytochemicals for biofilms preformed in the polystyrene 96-well culture microplate was determined by MTT reduction assay. All biocides were used for this pur-

pose at MIC up to 8 MIC. There was only a small difference between planktonic and biofilm biocidal concentrations, usually not exceeding 24-fold higher values. Killing rate studies of S. aureus biofilm eradication by TTO and its constituents revealed that partial (50%) destruction of 24-h-old biofilms (MBEC50)

Antibiofilm activity of plant essential oils

Table I Bacteriostatic and bactericidal activity of essential oils/consituents against planktonic and biofilm cultures of Staphylococcus aureus and Escherichia coli
Essential oil/component TTO "-terpineol Terpinen-4-ol LEO Linalool Linalyl acet. MEO Bacteria S. aureus E. coli S. aureus E. coli S. aureus E. coli S. aureus E. coli S. aureus E. coli S. aureus E. coli S. aureus E. coli MIC (planktonic), MBC (planktonic) MBEC90 (4 hours), MBEC90 (24 hours), % v/v % v/v % v/v % v/v 0.39 0.19 0.19 0.097 0.19 0.048 0.78 0.19 0.19 0.097 0.19 0.19 0.097 0.048 0.78 0.19 0.78 0.097 0.78 0.19 1.56* 0.19 1.56 0.39 0.78 0.19 0.19 0.097 0.78 0.19 0.38 0.19 0.19 0.097 1.56 0.19 0.78 0.78 >1.56 >1.56 >0.78 0.19 0.78 0.19 0.38 0.19 0.19 0.048 1.56 0.19 0.78 0.19 0.19 0.19 0.38 0.19

39

TTO Tea Tree oil (Melaleuca alternifolia); LEO lavender oil (Lavandula angustifolia) MEO Lemon balm oil (Melissa officinalis); MIC minimal inhibitory concentration MBC minimal bactericidal concentration, value not exceded 4 MIC; * exception linalool which is not bactericidal for S. aureus, MBC = 8 MIC MBEC90 minimal biofilm eradication concentration causing 90% reduction of biomass metabolic activity, measured after 4 or 24 h of compounds application on the biofilm culture

was achieved by the concentration of 48 MIC just after 1 h, whereas 2 MIC was enough to obtain TTO MBEC90 after 4 h of treatment. Effective MBEC90 of LEO and its constituents was as high as 48 MIC. The time-dependent activity of MEO was comparable to TTO. With few exceptions, the tested phytochemicals reduced the metabolic activity of bacterial cells in biofilms after 24 h exposure at concentrations close to MICs. A similar dose- and time-dependent effect was observed for E. coli biofilm, however, surprisingly, it was more susceptible to the action of phytochemicals than the S. aureus biofilms, similarly to what was observed for planktonic cultures. (Table I, Fig. 1). Among the medical biomaterials tested, surgical mesh was the surface most prone to persistent colonization, since biofilms formed on it by both bacterial strains were more difficult to eradicate by the tested compounds. Modified Richards method was used to detect the presence or eradication of biofilm, as described earlier (Ralska et al., 1998). The obtained visual results scored by TTC assay as (+) and (), were compared with the data from the standard biomass quantification method by bacterial dislodgement and CFU determination. Only TTO and terpinen-4-ol used at MIC 2 MIC caused visible biofilm eradication (TTC reduction) from the surface of urological catheter and infusion tube, evaluated later as greater than 90% decrease in the number of live bacteria (CFU). However, the use of higher concentrations (48 MIC) of these and other compounds (MEO,

LEO, "-terpineol, linalool, linalyl acetate) was necessary to achieve such an effect on the surface of surgical mesh. In all cases it was proved that indeed TTC score () means that the lack of metabolically active cells is equal to the lack of viable bacteria, since the CFU counting method used for the measurement of biofilm survival showed its total eradication (data not shown). Our study leads to the conclusion that essential oils and some of their major constituents are able to efficiently reduce biofilms of both S. aureus and E. coli on biomaterial surfaces. However, a satisfactory effect is strongly dependent on the surface structure and properties. The example of TTO antibiofilm activity is presented in Fig. 2.

Fig. 2. Image of infusion tube colonized by S. aureus biofilm: A, B treated for 24 h with TTO, respectively at MIC or MIC.
C(+) not treated positive control, C() not colonized negative control. TTC-reduction assay scored according to an arbitrarily fixed scale as described in Material and Methods.

40
Discussion

Budzyska A. et al.

In the present study, the in vitro strong effects of Melaleuca alternifolia (TTO), Lavandula angustifolia (LEO), Melissa officinalis (MEO) essential oils and some of their main constituents ("-terpineol, terpinen4-ol, linalool, linalyl acetate) on the biofilms of Grampositive S. aureus and Gram-negative E. coli were shown. Remarkably, the in vitro activity of the oils against the biofilm of both strains tested was equal to or only slightly lower than that against bacterial planktonic culture (Table I). This is worth emphasizing because the biofilm resistance to classical chemotherapeutics is typically 1001000 times higher (Bryers, 2008, Hoiby et al., 2010). It is a promising observation since plant-derived compounds have gained a general interest in the search to identify alternatives for the control of infections, especially those connected with the use of artificial medical devices. Research on this topic is focused on natural or synthetic substances, which have potent broad-spectrum microbicidal and antibiofilm activities and pose a low risk for the development of resistance. It is accepted that there are two main reasons why essential oils do not create resistant strains of bacteria: they are complex and comprise numerous compounds in variable proportions depending on the plant chemotype. Hence, even if bacteria did figure out an oils effective components, they would have to start all over with the next set (Bakkali et al., 2008; Reichling et al., 2009). In the present study we demonstrated that essential oils, not only of M. alternifolia well known in this respect from other studies (Brady et al., 2006; Kwieciski et al., 2009; Karpanen et al., 2008), but also of M. officinalis and L. angustifolia have antibiofilm potency. According to our knowledge, this is the first report concerning such activity of MEO and LEO. Both S. aureus and E. coli biofilms were eradicated efficiently by MEO. However, this effect was more time-dependent than the activity of TTO and LEO. The antibacterial, antifungal and antioxidant properties of M. officinalis essential oil, but not antibiofilm activity, have been earlier described. The main constituents of MEO are citrals (geranial + neral, 39.9%), citronellal (13.7%), limonene (2.2%), geraniol (3.4%), $-caryophyllene (4.6%), $-caryophyllene oxide (1.7%), and germacrene D (2.4%) (Mimica-Dukic et al., 2004). Our further research will be devoted to examining the activity of individual components. However, it is also possible that they can be more active when they are in their natural proportions in the native oil. The main chemical components of lavender oil the second active in our experiments are a-pinene, limonene, 1,8-cineole, cis-ocimene, transocimene, 3-octanone, camphor, linalool, linalyl acetate, caryophyllene, terpinen-4-ol and lavendulyl acetate

(Roller et al., 2009; Cavanagh and Wilkinson, 2002). Three of these components linalool, linalyl acetate, terpinen-4-ol were tested for antibiofilm activity since they are also major constituents of active TTO. Among them, terpinen-4-ol seems to have the most potent activity, causing more than 90% reduction in biofilm metabolic activity (MBEC90) after just 4 h of exposure. Our results on TTO antibiofilm activity are slightly different from those published by Brady et al. (2006). The authors showed that biofilms formed by MSSA and MRSA isolates were completely eradicated following an exposure to 5% TTO for 1 h. In our study, S. aureus biofilm was also eradicated in such a short time but only by 66%. However, the concentration of TTO used was much lower 3.1% (8 MIC). On the other hand, total eradication of S. aureus biofilm was achieved not earlier than after 4 h but the concentration of TTO needed for that was only 0.78% (2 MIC). Similarly to our results, TTO activity against S. aureus biofilms was reported by Kwieciski et al. (2009). Usually plant-derived compounds show considerable activity against Gram-positive bacteria but not against Gram-negative species or yeast, which have evolved significant permeability barriers (Bakkali et al., 2008; Gibbons, 2008; Reichling et al., 2009; Amalradjou et al., 2010). Thus, it is worth emphasizing that in our experiments the Gram-negative bacteria were very susceptible to damage by all the essential oils used. For example, the potent and very fast antibiofilm activity of TTO was noticed for E. coli which was eradicated within 1 h exposure to concentration 0.78%. It is noteworthy that the evident decrease in biofilm cells metabolic activity measured by MTT-reduction assay (biofilms in microplate wells), is not equal to their total destruction and eradication from the surface of the real medical biomaterials. We, like some other authors, have defined a drug concentration resulting in 90 biomass reduction measured by MTT staining as the MBEC (minimal biofilm eradication concentration). This method indeed has shown excellent applicability as it is able to detect dose-dependent and time-dependent differences in the effect of antimicrobials. But, contrary to other investigators, we have not found a strong correlation between the amount of biofilm mass exposed to essential oils, quantified with TTC staining on medical biomaterials and the metabolic activity quantified with MTT in the wells of microplate. A great advantage of the TTC reduction method is the fact that the metabolic reduction of colorless TTC into red-colored formazan by bacteria adhering to the surface of a synthetic implant occurs regardless of the type, shape or color of the biomaterial. However, this method is only semi-quantitative and requires confirmation using a more objective evaluation method, which was done in our study. This

Antibiofilm activity of plant essential oils

41

suggests that research on given compounds antibiofilm activity should be conducted using simultaneously at least two independent methods. It is well known that the growth conditions and the type of surface may affect the architecture of a biofilm which can influence the cells sensitivity to antimicrobial agents (Bryers, 2008; Flemming et al., 2009; Hoiby et al., 2010). However, our results encourage the exploration of the other essential oils and their constituents showing the most potent antibiofilm activity since the oils used in this study have superior antimicrobial activity in S. aureus and E. coli biofilms, compared with conventional antibiotics. Literature
Amalaradjou M.A.R., A. Narayanan, S.A. Baskaran and K. Venkitanarayanan. 2010. Antibiofilm effect of trans-cinnamaldehyde on uropathogenic Escherichia coli. J. Urology. 184: 358363. Bakkali F., S. Averbeck, D. Averbeck and M. Idaomar. 2008. Biological efects of essential oils A review. Food Chem. Toxicol. 46: 446475. Brady A., R. Loughlin, D. Gilpin, P. Paddy Kearney and M. Tunney. 2006. In vitro activity of tea-tree oil against clinical skin isolates of meticillin-resistant and -sensitive Staphylococcus aureus and coagulase-negative staphylococci growing planktonically and as biofilms. J. Med. Microbiol. 55: 13751380. Bryers J.D. 2008. Medical biofilms. Biotechnol. Bioeng. 100: 117. Budzyska A., M. Wickowska-Szakiel, D. Kalemba, B. Sadowska and B. Ralska. 2009. The optimization of methods utilized for testing the antibacterial activity of essential oils (in Polish). Med. Dow. Mikrobiol. 61: 281281. Carson C.F., K.A. Hammer and T.V. Riley. 2006. Melaleuca alternifolia (Tea Tree) oil: a review of antimicrobial and other medicinal properties. Clin. Microbiol. Rev. 19: 5062. Cavanagh H.M.A. and J.M. Wilkinson. 2002. Biological activities of lavender essential oil. Phytotherapy Res. 16: 301308. Chao S., G. Young, C. Oberg and K. Nakaoka. 2008. Inhibition of methicillin-resistant Staphylococus aureus (MRSA) by essential oils. Flavour and Fragrance J. 23: 444449. Dai T.,Y-Y. Huang,K.S. Sharma, T.J. Hashmi, B.D. Kurup and R.M. Hamblin. 2010. Topical antimicrobials for burn wound infections. Recent Patents on Anti-Infective Drug Discovery 5: 124151. Drig A., I. Kouskoumvekaki, R.M. Vejborg and P. Klemm. 2010. Chemoinformatics-assisted development of new antibiofilm compounds. Appl. Microbiol. Biotechnol. 87: 309317. Fabian D., M. Sabol, K. Domaracka and D. Bujnakova. 2006. Essential oils their antimicrobial activity against Escherichia coli and effect on intestinal cell viability. Toxicology in vitro 20: 14351445.

Flemming K., C. Klingenberg, J.P. Cavanagh, M. Sletteng, W. Stensen, J.S. Svendsen and T. Flgstad. 2009. High in vitro antimicrobial activity of synthetic antimicrobial peptidomimetics against staphylococcal biofilms. J. Antimicrob. Chemother. 63: 136145. Gibbons S. 2008. Phytochemicals for bacterial resistance strengths, weaknesses and opportunities. Planta Med. 74: 594602. Gursoy U.K., M. Gursoy, O.V. Gursoy, L. Cakmakci, E. Kononen and V-J. Uitt. 2009. Antibiofilm properties of Satureja hortensis L. essential oil against periodontal pathogens. Anaerobe, 15: 164167. Hoiby N., T. Bjarnsholt, M. Givskov, S. Molin and O. Ciofu. 2010. Antibiotic resistance of bacterial biofilm. Int. J. Antimicrob. Agents 35: 322332. Hossainzadegan H. and Delfan B. 2009. Evaluation of antibiofilm activity of dentol. Acta Med. Iranica. 47: 3540. James G.A., E. Swogger, R. Wolcott, E. Pulcini, P. Secor, J. Sestrich, J.W. Costerton and P.S. Stewart. 2008. Biofilms in chronic wounds. Wound Repair Regen. 16: 3744. Kalemba D. and A. Kunicka. 2003. Antibacterial and antifungal properties of essential oils. Curr. Med. Chem. 10: 81329. Karpanen T.J., T. Worthington, E.R. Hendry, B.R. Conway and P.A. Lambert. 2008. Antimicrobial efficacy of chlorhexidine digluconate alone and in combination with eucalyptus oil, tea tree oil and thymol against planktonic and biofilm cultures of Staphylococcus epidermidis. J. Antimicrob. Chemother. 62, 10311036. Kwieciski J., S. Eick and K. Wjcik. 2009. Effects of tea tree (Melaleuca alternifolia) oil on Staphylococcus aureus in biofilms and stationary growth phase. Int. J. Antimicrob. 33: 343347. Mimica-Dukic N., B. Bozin, M. Sokovic, and N. Simin. 2004. Antimicrobial and antioxidant activities of Melissa officinalis L. (Lamiaceae) essential oil. J. Agric. Food Chem. 52: 24852489. Reichling J., P. Schnitzler, U. Suschke and R. Saller. 2009. Essential oils of aromatic plants with antibacterial, antifungal, antiviral, and cytotoxic properties an overview. Forsch Komplementmed. 16: 7990. Roller S., N. Ernest and J. Buckle. 2009. The antimicrobial activity of high-necrodane and other lavender oils on methicillin-sensitive and -resistant Staphylococcus aureus (MSSA and MRSA). J. Altern. Complement Med. 15: 275279. Ralska B., B. Sadowska, M. Wickowska and W. Rudnicka. 1998. Detection of biomaterial-associated bacterial biofilm (in Polish). Med. Dow. Mikrobiol. 50: 115122. Walencka E., B. Sadowska, S. Ralska, W. Hryniewicz and B. Ralska. 2005. Lysostaphin as a potential therapeutic agent for staphylococcal biofilm eradication. Pol. J. Microbiol. 54: 191200. Walencka E., S. Ralska, H. Wysokiska, M. Ralski, . Kuma and B. Ralska. 2007. Salvipisone and aethiopinone from Salvia sclarea hairy roots modulate staphylococcal antibiotic resistance and express antibiofilm activity. Planta Med. 73: 545551. Warnke P.H., E. Sherry, P.A.J. Russo, Y. Acil, J. Wiltfang, S. Sivananthan, M. Sprengel, J.C. Roldan, S. Schubert, J.P. Bredee and others. 2006. Antibacterial essential oils in malodorous cancer patients: Clinical observations in 30 patients. Phytomedicine 13: 463467.

42

Budzyska A. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 4349

ORIGINAL PAPER

Competitiveness of Rhizobium leguminosarum bv. trifolii Strains in Mixed Inoculation of Clover (Trifolium pratense)
JERZY WIELBO*, MONIKA MAREK-KOZACZUK, DOMINIKA KIDAJ and ANNA SKORUPSKA

Department of Genetics and Microbiology, Maria Curie-Skodowska University Lublin, Poland Received 10 April 2010, revised 10 January 2011, accepted 14 January 2011
Abstract Rhizobium leguminosarum bv. trifolii (Rlt) establishes beneficial root nodule symbiosis with clover. Twenty Rlt strains differentially marked with antibiotic-resistance markers were investigated in terms of their competitiveness and plant growth promotion in mixed inoculation of clover in laboratory experiments. The results showed that the studied strains essentially differed in competition ability. These differences seem not to be dependent on bacterial multiplication in the vicinity of roots, but rather on complex physiological traits that affect competitiveness. The most remarkable result of this study is that almost half of the total number of the sampled nodules was colonized by more than one strain. The data suggest that multi-strain model of nodule colonization is common in Rhizobium-legume symbiosis and reflects the diversity of rhizobial population living in the rhizosphere K e y w o r d s: clover growth promotion, competitiveness, mixed inoculation, rhizobia

Introduction Biological nitrogen fixation (BNF) is a process in which atmospheric dinitrogen is reduced to forms available to plants and is provided by free-living bacteria or bacteria symbiotically associated with leguminous plants, commonly known as rhizobia. Rhizobia belong to different taxonomic families of "-proteobacteria such as Rhizobiaceae, Phylobacteriaceae and Bradyrhizobiaceae, and to $-proteobacteria such as the recently described Burkholderia spp. (reviewed by Perret et al., 2000; Masson-Boivin et al., 2009). Significance of rhizobial symbioses in agriculture stems from providing an extra source of nitrogen for plant growth, supplementing low nitrogen level in the soil and replacing nitrogenous fertilizer (Peoples et al., 1995; Ramos et al., 2001). Rhizobium leguminosarum bv. trifolii (Rlt) induces and colonizes nodules elicited on roots of clover (Trifolium spp.). The symbiosis between rhizobia and legumes is a multi-step process including the exchange of molecular signals between the microsymbiont and

its host (reviewed by, Perret et al., 2000; Spaink, 2000; Jones et al., 2007). Initially, flavonoids released by plants attract bacteria to the roots and induce synthesis of bacterial Nod factors that are lipochitooligosaccharide signals that trigger several plant responses, such as root hair curling and differentiation of plant meristems leading to the formation of root nodules. Nodules are colonized by rhizobia via tubular structures known as infection threads in which rhizobia multiply. After releasing from infection threads bacteria surrounded by peribacteroid membranes colonize nodule tissue forming symbiosomes in which bacteria are converted into bacteroids. Bacteroids localized in the symbiotic zone of mature nodules reduce atmospheric dinitrogen into forms, which are easily assimilated by plants (Vasse et al., 1990; Timmers et al., 2000). Competition for nodulation is a quantitative phenotype, which determines the ability of Rhizobium strains to dominate in the nodules of a given legume host in competition with other strains present in the root rhizosphere (Dowling and Broughton, 1986). Soil populations of Rhizobium usually consist of numerous strains,

* Corresponding author: J. Wielbo, Department of Genetics and Microbiology, Maria Curie-Skodowska University, Akademicka 19 st., 20-033 Lublin, Poland; e-mail: jerzy.wielbo@poczta.umcs.lublin.pl

44

Wielbo J. et al.

which compete with each other during the phase of vegetative growth in the soil, as well as during several stages of plant colonization and nodule formation (Wilson et al., 1998; Stuurman et al., 2000; Duodu et al., 2009). Rhizobial strains are genetically and metabolically diverse, reveal significant differentiation in competitive fitness to infect and occupy nodule of the host plant and differ in the symbiotic activities (Maier and Triplett, 1996; Wielbo et al., 2007; Depret and Laguerre, 2008). To investigate the competition between rhizobial strains, numerous molecular markers were developed and employed. Spontaneous or acquired antibiotic resistance markers are commonly used due to feasibility of detection and a broad differentiation allowing simultaneous identification a number of strains (Sharma et al., 1991; Cresswell et al., 1994; Sessitsch et al., 1998; Wilson et al., 1998; Stuurman et al., 2000). In this work, we investigated the competition ability of 20 Rlt strains originating from clover root nodules under laboratory conditions. The results showed that in most cases simultaneous inoculation of plants with a mixture of rhizobial strains carrying different antibiotic resistance markers resulted in nodule colonization by more than one strain. The commonly observed nodule colonization by multiple strains that differ in respect to the efficiency of plant growth promotion may have significant impact on overall symbiosis in the soil. Experimental
Materials and Methods

Table I Relevant characteristics of Rhizobium leguminosarum bv. trifolii strains used in this study
Group I K416 Tm K411 RfR K36 StrR KO27 TcR
R

Group II K417 Rf K108 TmR KO17 TcR K71 StrR

R

Group III K38 Rf K413 NalR KO18 TcR K91 StrR

R

Group IV K29 Tc K87 StrR K322 NalR K810 Rf R

R

Group V K313 TcR K312 StrR K415 RfR K107 TmR

The spontaneous mutants were isolated in the case of RfR rifampicin resistance, StrR streptomycin resistance and TmR trimethoprim resistance. TcR tetracycline resistant strains were obtained by introducing pJBA21Tc plasmid. NalR natural nalidixic acid resistance.

Rhizobium leguminosarum bv. trifolii strains. 20 Rlt strains used in this study were obtained from nodules of clover (Trifolium pratense) cultivated in arable sandy loam soil in the region of Lublin, Poland. Rifampicin, streptomycin and trimethoprim-resistant spontaneous mutants were obtained as follow: from overnight cultures of Rlt isolates grown in liquid TY medium (Sambrook et al., 1989) with constant shaking, about 5 109 cfu/ml of the given culture was plated on TY agar medium supplemented with rifampicin, streptomycin or trimethoprim (40 g/ml, 200 g/ml, 200 g/ml, respectively). Single colonies resistant to appropriate antibiotic were isolated. Nalidixic acid for selection of naturally resistant strains was used in the concentration of 150 g/ml. Tetracycline resistant Rlt strains were obtained by introducing pJBA21Tc plasmid via triparental conjugation (Wielbo and Skorupska, 2001). Each of 20 strains was resistant to one of the following antibiotics: rifampicin, streptomycin, tetracycline, trimethoprim and nalidixic acid (Table I).

Plant tests. Red clover seeds (Trifolium pratense L. cv. Dajana) were surface-sterilized, germinated on TY agar medium, and then transferred onto agar slants with nitrogen-free Fhraeus medium (Vincent, 1970). Clover seedlings were inoculated with 200 l single strain suspension in water, which was scratched from TY agar medium plate, or with 200 l mixture of four strains differently tagged with antibiotic-resistance marker (1:1:1:1 v/v). In both cases the bacterial suspensions contained about 1.0109 cfu/ml. Plants were grown in a greenhouse under natural light supplemented with artificial light (14 h day/10 h night, at 24/19C). After 5 weeks, clover plants were harvested and nodules were counted. The efficiency of symbiotic nitrogen fixation was estimated by weighing fresh mass of shoots and roots. For each experimental group 20 plants were used and two independent experiments were conducted. Estimation of rhizobial competitiveness. Ten clover plants were randomly chosen from each experimental group inoculated with a mixture of four strains and wet masses of shoots and roots were estimated. Root nodules were surface-sterilized and the content of individual nodules was plated on TY agar medium. Colonies derived from individual nodules were used for preparation of water suspension an OD550 of 0.05 (~ 5 107 cfu/ml). 20 l of each suspension was spotted on a set of TY agar medium plates containing one of four antibiotics, depending on antibiotic resistance markers carried by strains in a particular mixture. Bacteria were grown for three days at 28C. Detectable growth on only one plate from a set was interpreted as the presence of pure culture in the nodule, whereas the growth on more than one plate from a set was interpreted as mixed colonization of nodule. Rhizobial growth assay. 5 ml Fhraeus medium supplemented with appropriate amount of TY medium was inoculated with 50 l of overnight culture of Rlt strains growing in TY medium, and incubated for 2 days at 28C. Bacterial growth was measured by monitoring OD550. For all tested strains the experiment was conducted in triplicate.

Competitiveness of Rhizobium leguminisarum strains

45

Fig. 1. Competition ability of R. leguminosarum bv. trifolii strains in the mixed inoculation of clover measured as relative competition ratio (RCR) (see Results). RCR equal 1 number of nodules colonized by strain most rarely found in the sampled nodules of a given group (IV).

Results To study nodulation competitiveness, twenty Rlt strains were divided into five groups (IV). Strains were assigned to groups randomly, and four strains belonging to the same group differed from each other with respect to the antibiotic resistance markers they were carrying (Table I). Clover seedlings were inoculated with individual strains or with a mixture of four strains belonging to a given group. After 5 weeks, samples of nodules were taken and rhizobia were recovered from nodules by selection on TY medium supplemented with an appropriate antibiotic. In the case of groups II, III and V, all four strains used for clover inoculation were recovered from the nodules, whereas in the case of groups I and IV, three of four strains used for inoculation were found in the sampled nodules. For Rlt strains assigned to a given group the relative competition ratio (RCR) was calculated as follow: (a) the number of nodules occupied by the

least frequently found strain was normalized to 1; (b) RCR for the three other strains were calculated by dividing the number of nodules colonized by a particular strain by the number of nodules occupied by the least frequent strain; (c) if a strain was absent in all tested nodules, the RCR was 0 (Fig. 1A, B, C, D, E). As regards their high relative competition value, K411 (group I), K417, K71 (group II), K38, K413 (group III), K87 (group IV) and K415 (group V) strains can be considered competitive. On the other hand, KO27 and K810 strains were not recovered from the sampled nodules and they were considered uncompetitive. Based on the antibiotic resistance selection of Rlt strains recovered from clover nodules, it has been found that nodules occupied by only one strain comprised at average 56 7% (Fig. 2 A, B, C, D, E). The others nodules were occupied by two or three strains that were distinguished by different antibiotic markers. Two-strain nodule occupancy ranged from 28% to

Fig. 2. Distribution of nodules infected by one, two or three strains in particular groups of R. leguminosarum bv. trifolii strains.

46

Wielbo J. et al.
Table II Symbiotic activity of R. leguminosarum bv. trifolii strains
Rlt strain number K 416 K 411 K 36 KO27 Mixed inoculation (I) K 417 K 108 KO17 K 71 Mixed inoculation (II) K 38 K 413 KO18 K 91 Mixed inoculation (III) K 29 K 87 K 322 K 810 Mixed inoculation (IV) K 313 K 312 K 415 K 107 Mixed inoculation (V) Inoculation by individual strains Inoculation by a mixture of strains No of nodules/plant Fresh mass Fresh mass Fresh mass of shoots/plant (mg) of roots/plant (mg) of plant/nodule (mg) 22.7 1.3 a 29.7 10.2 a 18.5 3.6 a 32.3 5.3 a 23.7 7.4 a 25.6 11.6 a 26.5 10.0 a 12.6 4.2 a 13.7 3.8 a 10.5 6.3 a 16.0 0.9 a 39.4 7.0 b 43.3 7.1 b 40.0 12.5 b 24.9 6.3 ab 12.1 2.0 a 12.4 4.1 a 18.8 8.2 ab 21.8 5.5 b 10.4 2.5 a 23.7 10.5 ab 13.3 2.1 a 22.8 5.0 b 27.4 8.1 b 25.7 6.1 b 19.0 7.9 a 23 9.6 a 9.0 8.9 12.8 9.2 8.1 10.2 14.3 12.7 13.0 8.8 10.1 9.8 11.0 16.6 6.5 12.2 13.4 12.7 7.5 10.9 17.7 14.4 10.4 16.4 10.3 12.1 2.8 a 8.9 1.8 b

Group I of Rlt strains 5.4 1.5 a 26.3 3.5 a 6.8 0.7 a 31.3 9.4 a 4.3 1.0 a 36.8 2.1 a 6.6 2.3 a 28.6 6.6 a 7.4 2.2 a 36.2 8.3 a Group II of Rlt strains 7.0 0.7 b 45.8 9.3 ab 5.4 0.7 ab 50.9 8.5 b 3.6 0.4 a 33.4 1.9 a 3.7 0.6 a 34.2 8.6 a 4.7 1.9 ab 30.5 10.0 a Group III of Rlt strains 5.2 2.0 a 36.6 4.1 a 8.6 2.1 a 44.3 2.5 a 10.2 0.9 a 68.5 7.3 b 5.8 2.7 a 56.6 3.0 c 9.0 2.8 a 33.9 3.4 a Group IV of Rlt strains 3.6 1.2 a 31.2 7.0 a 2.8 0.7 a 24.6 9.4 a 4.2 1.8 a 34.6 9.2 a 6.8 1.6 b 29.5 4.5 a 3.3 0.9 a 25.2 7.1 a Group V of Rlt strains 3.8 1.5 a 44.1 12.9 a 3.4 1.0 a 35.0 7.0 a 6.2 1.2 ab 41.3 0.9 a 5.1 1.6 ab 55.3 10.4 a 6.8 0.4 b 44.7 7.0 a Average values 6.2 2.3 a 34.1 7.2 a 5.4 1.9 a 39.4 11.4 a

Values are the mean standard deviation of 20 clover plants in experiment. Means within the same column and followed by the same letter are not significantly different (P>0.05).

40%, and three-strain nodule occupancy from 3% to 16% of nodules, depending on the group of strains (IV) used for clover inoculation (Fig. 2 A, B, C, D, E). Nodules simultaneously colonized by all four strains were not detected. The obtained results showed that nodule colonization by more than one strain was prevalent, at least in competition experiments conducted under laboratory conditions. Rlt strains used in competition experiments were characterized with regard to the symbiotic properties such as nodulation ability and plant growth promotion (Table II). The tested strains varied both in the number of nodules elicited and in the impact on fresh mass of clovers. In the case of some strains the differences in nodule number and shoot and root mass were statistically significant. It is worth noting that plants

inoculated with a mixture of four strains showed intermediary values of symbiotic parameters, which can reflect averaged effects of individual strains on symbiosis. In almost all cases, fresh mass of total plant per nodule was lower in the mixed inoculation in comparison to the same parameter in clover inoculation by individual strains (Table II). The differences observed in the nodule colonization ability of Rlt strains might result from some physiological differences between the strains, for instance, in the growth rate. In the competition experiment, the mixtures of strains used as inocula were prepared by mixing equal volumes of four bacterial water suspensions with the same OD550, which should minimize the effect of possible differences in the initial cell density. In addition, growth of rhizobia was

Competitiveness of Rhizobium leguminisarum strains

47

assayed in the medium composed of nitrogen-free Fhraeus medium used in plant tests supplemented with 1%, 2%, 5%, 10% or 20% TY medium. It was assumed that addition of some amount of TY to the plant medium allows for the growth of bacteria while simultaneously resembling the plant growth medium. Rhizobia were grown in these media for 2 days and OD550 was measured. The results showed that Rlt strains used in the competition experiments grow weakly and only in Fhraeus medium supplemented with 10% or 20% of TY, reaching OD550 values from 0.13 to 0.2 (data not shown). Differences in growth of strains on Fhraeus medium supplemented with 10% TY, as well as on medium supplemented with 20% TY were observed, however, the analysis of variance indicated that these differences were statistically insignificant (data not shown). In conclusion, the possible differences in the initial growth of Rlt strains on plant medium at the time of inoculation could not essentially affect their competitiveness. Discussion Local population of R. leguminosarum specific for a given legume host is composed of numerous strains characterized by great variability in genetic and metabolic traits (Lakzian et al., 2002; Wielbo et al., 2010). Rhizobial competitiveness is a complex process dependent on genetic and overall metabolic status of bacteria (Wielbo et al., 2007), susceptibility to plant molecular signals (Mabood et al., 2008; Maj et al., 2010), motility of bacteria (Mellor et al., 1987), production of/ resistance to bacteriocins (Wilson et al., 1998) or even distribution of bacteria in the soil (Lopez-Garcia et al., 2002). Several studies indicate that both the legume hosts and microsymbionts affect the outcome of rhizobial competition (Kiers et al., 2006; Depret and Laguerre, 2008; Rangin et al., 2008). All these and other variables characterizing individual strains influence their overall competition abilities. As a result, appreciable variability in rhizobial competitiveness is observed, both in highly controlled experiments under laboratory conditions, and in experiments carried out in the soil (Maier and Triplett, 1996; Svenning et al., 2001; Wielbo et al., 2007; Duodu et al., 2009; Sachs et al., 2009). The strains compete with each other on the level of root adsorption, root hair infection, growth inside the infection threads, nodule tissue colonization and survival after release into the soil, where they constitute part of population capable of symbiotic interactions (Duodu et al., 2005; Silva et al., 2007; Rangin et al., 2008; Sachs et al., 2009). Less competitive rhizobia comprising another part of the population may be eliminated from nodule infection (Streeter,

1994). Finally, nonsymbiotic rhizobia constitute the fraction that lost the nodulation genes but is still able to colonize root surfaces and can play an important role in competition (Sachs et al., 2009). In several studies, the competition between rhizobia was commonly investigated in a two-strain competition assay under controlled conditions. In this assay both strains were tagged with different markers such as antibiotic resistance genes (Bromfield, 1984), lux (Cresswell et al., 1994) or gfp reporter genes (Stuurman et al., 2000) and occupancy of both strains was easily determined in the nodule. The drawback of this method is the extreme simplification of the model, which does not reflect native conditions. The second most frequently used method for rhizobial competition analysis was to use a single marked strain vs. the entire unmarked soil population composed of numerous strains. Major drawback of this approach is lack of any information about the unmarked strains possibly present in the nodules. Recently, the competitiveness of unmarked rhizobial strains was studied by molecular identification of particular genotypes occupying the nodules (Svenning et al., 2001). In the present work, the two methods have been combined, and clover plants were inoculated by four differently marked strains. It allowed determining the differences in competitive ability of the individual strains, and the predominance of nodules occupied by more than one strain, in the case of a mixed inoculation. It is worth noting that infection by several strains negatively affected plant growth promotion when compared to single-strain infection. Past studies showed mixed colonization of infection threads and nodules (Bromfield, 1984) in a twostrain competition assay (Stuurman et al., 2000; Gage, 2004). Expanding the competition test to clover inoculation by four strains, we demonstrated the possibility of single clover nodule colonization by three different strains. The percent of nodules colonized by three strains was relatively low and ranged from 3 to 16% of the sampled nodules. Nodules colonized by four strains were not found. It is possible that the number of the sampled nodules should have been greater to allow detection of nodules occupied by all four strains. On the other hand, the limited space available in the infection threads and/or in young nodules might restrict the growth of rhizobia, and this might also explain why four strain nodule colonization was not observed. The most important finding from the presented study is that almost half of the total number of the sampled nodules was colonized by more than one strain. It suggests that multistrain model of nodule colonization is predominant also in the soil environment, and reflects the complexity and diversity of rhizobial population in the rhizosphere.

48

Wielbo J. et al.

The comparison of symbiotic efficiencies of clover inoculation by individual strains vs. a mixture of strains was not conclusive. Whereas, significant differences between the averaged data of shoots and roots masses in single strain inoculation and in the mixed inoculation have not been found, significant difference in ratios of fresh mass of the entire plant to nodule number was evident when these two types of inoculations were compared (Table II). A possible explanation for this result might be that the concentration of several Nod factors produced by particular strains in the mixed inoculation is substantially greater than in a single strain inoculation. Nod factors stimulate nodule organogenesis (Perret et al., 2000; Spaink, 2000) and that nodule number increase was not accompanied by increased plant growth probably due to the relatively short timeframe of the experiment. This observation is consistent with our previous studies, in which treatment of clover seeds with Nod factors under controlled conditions enhanced the growth of clover only when a Nod factor was applied in appropriate concentration (Maj et al., 2009). In summary, our data revealed that R. leguminosarum strains investigated in the experimental competition model were greatly differentiated with respect to competitiveness for nodule occupancy. In the mixed inoculation of clover plants, nodule coinfection by two or three strains was commonly observed. The prevalence of nodule coinfection by native soil population is yet to be determined.
Acknowledgements The research reported in this paper was funded in part by a grants of Ministry of Sciences and Higher Education of Poland nr N N304 026734 and N N301 028734.

Literature
Bromfield E.S.P. 1984. Variation in preference for Rhizobium meliloti within and between Medicago sativa cultivars grown in soil. Appl. Environ. Microbiol. 48: 12311236. Cresswell A., L. Skot and A.R. Cookson. 1994. The construction, detection and use of bioluminescent Rhizobium leguminosarum biovar trifolii strains. J. Appl. Bacteriol. 77: 656665. Depret G. and G. Laguerre. 2008. Plant phenology and genetic variability in root and nodule development strongly influence genetic structuring of Rhizobium leguminosarum biovar viciae populations nodulating pea. New Phytol. 179: 224235. Dowling D.N. and W.J. Broughton. 1986. Competition for nodulation of legumes. Annu. Rev. Microbiol. 40: 131157. Duodu S., C. Brophy, J. Connolly and M.M. Svenning. 2009. Competitiveness of native Rhizobium leguminosarum bv. trifolii strain for nodule occupancy is manifested during infection. Plant Soil 318: 117126. Duodu S., T.V. Bhuvaneswari, J. Gudmundsson and M.M. Svenning. 2005. Symbiotic and saprophytic survival of three unmarked Rhizobium leguminosarum biovar trifolii strains introduced into the field. Environ. Microbiol. 7: 10491058.

Gage D.J. 2004. Infection and invasion of roots by symbiotic nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol. Mol. Biol. Rev. 68: 280300. Jones K.M., H. Kobayashi, B.W. Davies, M.E. Taga and G.C. Walker. 2007. How symbionts invade plants: the Sinorhizobium-Medicago model. Nature 5: 619633. Kiers E.T., R.A. Rousseau and R.F.Denison. 2006. Measured sanctions: legume hosts detect quantitative variation in rhizobium cooperation and punish accordingly. Evol. Ecol. Res. 8: 10771086. Lakzian A., P. Murphy, A. Turner, J.L. Beynon and K.E. Giller. 2002. Rhizobium leguminosarum bv. viciae populations in soils with increasing heavy metal contamination: abundance, plasmid profiles, diversity and metal tolerance. Soil Biol. Biochem. 34: 519529. Lopez-Garcia S.L., T.E.E. Vazquez, G. Favelukes and A.L. Lodeiro. 2002. Rhizobial position as a main determinant in the problem of competition for nodulation in soybean. Environ. Microbiol. 4: 216224. Mabood F., W.J. Jung and D.L. Smith. 2008. Signal in the underground: microbial signaling and plant productivity. In: Nautiyal C.S., P.E. Dion and V.L. Chopra (eds.). Molecular mechanisms of plant and microbe coexistence. Springer-Verlag, Berlin, Heidelberg. Maier R.J. and E.W. Triplett. 1996. Toward more productive, efficient, and competitive nitrogen-fixing symbiotic bacteria. Crit. Rev. Plant Sci. 15: 191234. Maj D., J. Wielbo, M. Marek-Kozaczuk and A. Skorupska. 2009. Pretreatment of clover seeds with Nod factors improves growth and nodulation of Trifolium pratense. J. Chem. Ecol. 35: 479487. Maj D., J. Wielbo, M. Marek-Kozaczuk and A. Skorupska. 2010. Response to flavonoids as a factor influencing competitiveness and symbiotic activity of Rhizobium leguminosarum. Microbiol. Res. 165: 5060. Masson-Boivin C., E. Giraud, X. Perret and J. Batut. 2009. Establishing nitrogen-fixing symbiosis with legumes: how many rhizobium recipes? Trends Microbiol. 17: 458466. Mellor H.Y., A.R. Glenn and M.J. Dilworth. 1987. Symbiotic and competitive properties of motility mutants of Rhizobium trifolii TA1. Arch. Microbiol. 148: 3439. Peoples M.B, J.K. Ladha and D.F. Herridge. 1995. Enhancing legume N2 fixation through plant and soil management. Plant Soil 174: 83101. Perret, X., C. Staehelin and W.J. Broughton. 2000. Molecular basis of symbiotic promiscuity. Microbiol. Mol. Biol. Rev. 64: 180201. Ramos M.G., M.A. Villatoro, S. Urquiaga, B.J. Alves and R.M. Boddey. 2001. Quantification of the contribution of biological nitrogen fixation. J. Biotechnol. 91: 105115. Rangin, C., B. Brunel, J.-C. Cleyet-Marel and G. Bena. 2008. Effects of Medicago truncatula Genetic Diversity, Rhizobial Competition, and Strain Effectiveness on the Diversity of a Natural Sinorhizobium Species Community. Appl. Environ. Microbiol. 74: 56535661. Sachs J.L., S.W. Kembel, A.H. Lau and E.L. Simms. 2009. In situ phylogenic and diversity of wild Bradyrhizobium communities. Appl. Environ. Microbiol. 75: 47274735. Sambrook, J., E.F. Fritsch and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sessitsch A., G. Hardarson, W.M. de Vos and K.J. Wilson. 1998. Use of marker genes for competition studies of Rhizobium. Plant Soil 204: 3545. Sharma P.K., R.C. Anand and K. Lakshminarayana. 1991. Construction of Tn5 tagged mutants of Rhizobium spp. (Cicer) for ecological studies. Soil Biol. Biochem. 23: 881885.

Competitiveness of Rhizobium leguminisarum strains

49

Silva C., F.L. Kan and E. Martnez-Romero. 2007. Population genetic structure of Sinorhizobium meliloti and S. medicae isolated from nodules of Medicago spp. in Mexico. FEMS Microbiol. Ecol. 60: 477489. Spaink H.P. 2000. Root nodulation and infection factors produced by rhizobial bacteria. Annu. Rev. Microbiol. 54: 25288. Streeter J.G. 1994. Failure of inoculant rhizobia to overcome the dominance of indigenous strains for nodule formation. Can. J. Microbiol. 40: 513522. Stuurman N., C. Pacios Bras, H.R.M. Schlaman, A.H.M. Wijfjes, G. Bloemberg and H.P. Spaink. 2000. Use of green fluorescent protein color variants expressed on stable broad-hostrange vectors to visualize rhizobia interacting with plants. Mol. Plant-Microbe Interact. 13: 116311699. Svenning M.M., J. Gudmundsson, I.L. Fagerli and P. Leinonen. 2001. Competition for nodule occupancy between introduced strains of Rhizobium leguminosarum bv. trifolii and its influence on plant production. Ann. Bot. 88: 781787. Timmers A.C., E. Soupne, M.C. Auriac, F. de Billy, J. Vasse, P. Boistard and G. Truchet. 2000. Saprophytic intracellular rhizobia in alfalfa nodules. Mol. Plant-Microbe Interact. 13: 12041213.

Vasse J., F. de Billy, S. Camut and G. Truchet. 1990. Correlation between ultrastructural differentiation of bacteroids and nitrogen fixation in alfalfa nodules. J. Bacteriol. 172: 42954306. Vincent J.M. 1970. A manual for the practical study of root nodule bacteria. International biological program handbook no.15. Blackwell Scientific Publications Ltd, Oxford, UK. Wielbo J. and A. Skorupska. 2001. Construction of improved vectors and cassettes containing gusA and antibiotic resistance genes for studies of transcriptional activity and bacterial localization. J. Microbiol. Methods 45: 197205. Wielbo J., M. Marek-Kozaczuk, A. Kubik-Komar and A. Skorupska. 2007. Increased metabolic potential of Rhizobium spp. is associated with bacterial competitiveness. Can. J. Microbiol. 53: 957967. Wielbo J., Marek-Kozaczuk M., Mazur A., Kubik-Komar A. and A. Skorupska. 2010. Genetic and metabolic divergence within a Rhizobium leguminosarum bv. trifolii population recovered from clover nodules. Appl. Environ. Microbiol. 76: 4593 4600. Wilson R.A., B.A. Handley and J.E. Beringer. 1998. Bacteriocin production and resistance in a field population of Rhizobium leguminosarum bv. viciae. Soil Biol. Biochem. 30: 413417.

50

Wielbo J. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 5158

ORIGINAL PAPER

Selection and Adaptation of Saccharomyces cerevisae to Increased Ethanol Tolerance and Production
JAN FIEDUREK*, MARCIN SKOWRONEK and ANNA GROMADA

Department of Industrial Microbiology, Maria Curie-Skodowska University, Lublin, Poland Received 2 August 2010, revised 12 January 2011, accepted 20 January 2011
Abstract A total of 24 yeast strains were tested for their capacity to produce ethanol, and of these, 8 were characterized by the best ethanol yields (73.1181.78%). The most active mutant Saccharomyces cerevisiae ER-A, resistant to ethanol stress, was characterized by high resistance to acidic (pH 1.0 and 2.0), oxidative (1 and 2% of H2O2), and high temperature (45 and 52C) stresses. During cultivation under all stress conditions, the mutants showed a considerably increased viability ranging widely from about 1.04 to 3.94-fold in comparison with the parent strain S. cerevisiae ER. At an initial sucrose concentration of 150 g/l in basal medium A containing yeast extract and mineral salts, at 30C and within 72 h, the most active strain, S. cerevisiae ER-A, reached an ethanol concentration of 80 g/l, ethanol productivity of 1.1 g/l/h, and an ethanol yield (% of theoretical) of 99.13. Those values were significantly higher in comparison with parent strain (ethanol concentration 71 g/l and productivity of 0,99 g/l/h). The present study seems to confirm the high effectiveness of selection of ethanolresistant yeast strains by adaptation to high ethanol concentrations, for increased ethanol production. K e y w o r d s: adaptation to high ethanol concentration, ethanol tolerance, fermentation, yeast

Introduction Bio-ethanol production by yeast is a growing industry due to energy and environmental demands (Schubert, 2006). Saccharomyces cerevisiae and related yeast species have been extensively used in fermentation, wine-making, sake-making and brewing processes. Successful performance of alcoholic fermentations, however depends on the ability of the yeast strains used to cope with a number of stress factors occurring during the process (Van Uden, 1985; Viegas et al., 1989; Hirasawa et al., 2007), including osmotic pressure imposed by the initial high sugar concentration and stress induced by fermentation end-products or sub-products such as ethanol or acetate. Among these, the stress induced by increasing amounts of ethanol, accumulating to toxic concentrations during ethanol fermentation, is the major factor responsible for reduced ethanol production yields and, ultimately, for stuck fermentations (Gibson et al., 2007). Thus, yeast strains that can endure stress imposed by high ethanol concentrations are highly desirable. Throughout the years many efforts have been made to characterize the mechanisms underlying ethanol stress

tolerance, aiming to increase ethanol productivity (Van Uden, 1985; You et al., 2003; Alper et al., 2006; Hirasawa et al., 2007). To overcome fermentation problems, sophisticated refinements of fermentation processes, involving extractive fermentation (Jones et al., 1993; Da Silva et al., 1999), cell immobilization (de Vasconcelos et al., 2004; Verbelen et al., 2006), and recycling or retention by membranes (Nishiwaki and Dunn, 1998; Wang and Lin, 2010), were employed with a view to obtaining a large quantity of fermenting biomass as well as removing the inhibitory ethanol product. Successful engineering of yeast transcription machinery for this purpose was also reported (Alper et al., 2006). The present study was conducted to select the best ethanol-producing yeast strains from our collection, to improve yeast fermentation performance by adaptation, and to optimize the conditions for alcohol production from sucrose. There are, to our knowledge, only a few studies that describe the creation of ethanol-tolerant S.cerevisiae mutants using adaptation and ethanol stress as the selection pressure (Brown et al., 1982; Remize et al., 1999; Stanley et al., 2010).

* Corresponding author: J. Fiedurek, Department of Industrial Microbiology, Maria Curie-Skodowska University, Akademicka 19, 20-033 Lublin, Poland; phone: +48 81537 59 33; fax: +48 81537 59 60; e-mail: janek@poczta.umcs.lublin.pl

52
Experimental
Material and Methods

Fiedurek J. et al.

Microorganisms and media. The strains of the yeast listed in Table I were maintained at 4C on malt agar slants. For inoculum preparation selected strains were cultivated on a growth medium A containing glucose, 2%; bactopepton, 2% and yeast extract, 1%. Fermentations were performed using a basal medium A containing: sucrose, 15.0%; yeast extract, 1.0%; (NH4)2SO4, 0.3% and KH2PO4, 0.1%. Adaptation for increased ethanol production. Enrichments for increased ethanol production were carried out according to the method of Dinh et al., (2008) with some modifications. The cultivation of the S. cerevisiae ER strain was carried out in malt medium containing ethanol and then the culture was transferred to a fresh medium containing the same ethanol concentration. Adapted cultures were grown in culture tubes (18 by 150 mm) containing 10 ml of

that medium and were incubated at 30C without agitation. After that, the culture was transferred to a medium containing a higher ethanol concentration, followed by repetitive cultivations. The initial ethanol concentration was set at 5.0% (w/v) and it was changed gradually from 6.0 to 15.0%. New derivatives of S. cerevisiae were isolated from the adapted cultures after 10 months of serial transfers into media with high concentrations of ethanol. At the end of this period, two clones were selected for further study; these clones were designated as strain ER-A and ER-M. The adaptation of the yeast was evaluated by measuring the optical density of the culture at OD600. Viability in ethanol was determined by maintaining yeast cells of S. cerevisiae ER in malt medium supplemented with 515% ethanol for 48 h at 30C, plating them on malt agar plate, and subsequently counting the number of colonies formed. Control cultures were maintained in the same medium without ethanol. Inoculum preparation. For the preparation of inoculum, yeast strains were transferred from agar

Table I Screening yeast strains for efficient ethanol production

Sucrose concentration (%) Strain Candida shaetaceae ATCC 22994 Candida utilis CCY 293818 Kluyveromyces fragilis IPF Kluyveromyces marxianus CCY 5021 1 Saccharomyces bayanus S-21 1 Saccharomyces owiformis 2 Saccharomyces carlsbergensis FD 3 Saccharomyces cerevisiae Anker Saccharomyces cerevisiae A364A Saccharomyces cerevisiae DBY 747 4 Saccharomyces cerevisiae ER 4 Saccharomyces cerevisiae GM 3 Saccharomyces cerevisiae Hammer 1 Saccharomyces cerevisiae JA 2 Saccharomyces cerevisiae PG 1 Saccharomyces cerevisiae J 1 Saccharomyces elipsoideus Sz.o. Saccharomyces fragilis II 11 Saccharomyces fragilis 1154 Saccharomyces fragilis S-24 Saccharomyces fragilis S-25 1 Saccharomyces mellis 1 Saccharomyces muciparus CCM 21251 1 Saccharomyces rouxii 15 40 15 40 15 40 Catalase activity (U) 8.67 8.70 8.07 4.38 4.25 3.78 4.31 2.58 1.83 6.81 3.78 5.20 3.22 8.41 4.06 5.81 3.81 4.71 9.07 9.84 6.88 3.71 8.54 7.53 6.61 7.13 10.00 4.69 1.89 5.34 4.48 6.03 2.08 6.64 3.08 9.04 6.75 5.34 5.09 4.84 4.29 4.90 7.72 5.91 8.05 3.78 7.72 8.71 Ethanol (% w/v)a 0.70 2.00 5.00 3.10 6.60 6.00 6.48 5.80 3.80 6.40 6.60 5.80 5.80 5.90 6.00 1.10 6.48 5.00 3.80 3.10 5.10 0.70 4.10 0.60 0.40 0.70 3.00 4.30 7.60 7.00 6.49 8.10 2.80 6.80 9.75 6.00 9.20 7.20 6.80 2.40 5.64 2.20 6.20 3.20 6.20 0.80 3.00 0.20 Ethanol yield (% of theoretical) 8.67 24.78 61.96 38.41 81.78 74.35 80.30 71.87 47.09 79.30 81.78 71.87 71.87 73.11 74.35 13.63 80.30 61.96 47.09 38.41 63.20 8.67 50.80 7.43 1.86 3.25 13.94 19.98 35.32 32.53 30.16 37.64 13.01 31.60 45.31 27.88 42.75 33.46 31.60 11.15 26.21 10.22 28.81 14.87 28.81 3.72 13.94 0.93

The strains were incubated in 50 ml conical flasks, each containing 20 ml of basal medium A containing 15% or 40% of sucrose during 72 h. a Values are averages of 3 replicate determinations with standard deviations of < 5% 1 Wine yeasts; 2 Brewing yeasts; 3 Bakers yeast; 4 Distillery yeast

S. cerevisae adaptation for increased ethanol levels

53

slants into 50-ml Erlenmeyer flasks containing 10 ml of sterile liquid growth medium A, which were cultured at 30C on a rotary shaker (Shaker Orbit The LAB-LINE Instruments Inc, Melrose Park, Illinois, USA) at 150 rpm for 24 h. Ethanol fermentations. Fermentations with the selected strain were conducted in 300-ml Erlenmeyer flasks containing 100 ml of basal medium A (pH 5.5). The flasks were inoculated with 10% v/v seed culture. Fermentations were carried out for 72 h at 30C (if not indicated otherwise) in a shaker at 90rpm. Ethanol evaporation was prevented by rubber stoppers, with fermentative tubes filled with 50% H2SO4. The fermentation parameters were corrected by ethanol, sucrose and biomass withdrawn during sampling. Overall biomass as well as ethanol yields and sucrose consumption were calculated from end-of-batch data, where the peak ethanol concentration was recorded. Other methodological details are given in tables and figures. Assays. Biomass was estimated from optical density at 600 nm. Dry mass was calculated by referring to a standard curve of cell mass versus absorbance (Hughest et al., 1984). Ethanol was quantified using the Gonchar et al. (2001) method in own modification using o-dianisidine instead of 3,3,5,5,-tetramethylbenzidine (TMB) as chromogen. Extracellular catalase activity was measured spectrophotometrically by observing the decrease in light absorption at 525 nm during decomposition of H2O2 by the enzyme (Fiedurek and Gromada, 1997). One unit (U) of catalase activity was defined as the amount of enzyme catalysing the decomposition of 1 mol hydrogen peroxide per min at 30C. Fermentations were performed in 2 replicate cultures, and analyses were carried out in duplicate. The data given here are the averages of the measurements. Measurement of respiration. Cell suspensions, prepared as described above, were used to measure the rate of yeast respiration at various medium pH, either in the absence or in the presence of ethanol. Other methodological details are given in the tables and figures. Oxygen concentration in the culture medium was measured by a polarographic dissolved oxygen sensor (Ingold, CH Industrie Nord, Urdorf, Switzerland). The readings were expressed as percentage of the initial level of saturation (100%). Results Production of ethanol during fermentation is limited by the inability of yeast to grow at high ethanol levels, which is why a great deal of effort has been devoted to creating yeast strains that would tolerate high ethanol levels, and be able to continue the fermentation to produce higher concentrations of alcohol.

The development of such strains would have the major advantage of saving the energy involved in distilling and refining ethanol. A total of 24 yeast strains were tested for their capacity to produce ethanol, and of these, 8 were characterized by the best ethanol yields (73.1181.78%). Ethanol production, catalase activity, and ethanol yield were monitored on synthetic medium A. The effects of increasing sucrose concentration from 15 to 40% on ethanol yield, catalase activity and biomass of the yeast strains were examined. Along with the increase in sucrose concentration from 15 to 40%, a decrease in biomass and ethanol yield was observed. On the other hand, the increase enhanced extracellular catalase production, probably as an effect of stress conditions. Among the 24 strains, 13 (54.2%) were characterized by high catalase activity when grown on a medium with a high sucrose concentration (40%) (Table I). The increase in sucrose concentration in the medium (from 15 to 40%) caused a significant (1.02 to 3-fold) reduction in biomass production. For further selection an industrial strain of Saccharomyces cerevisiae ER characterized by high ethanol tolerance, higher cell viability especially during very high gravity fermentation, and working under a wide range of temperatures (3540C) was used. This strain was used for preparation of inocula for adaptation with high concentrations of ethanol (5 to 15%) in order to select ethanol-tolerant yeast. New derivatives of S. cerevisiae were isolated from adapted cultures after 10 months of serial transfers. During this period about 120 subsequent transfers were performed. At the end of this period, a two clones were selected from enrichment for further study; those clones, designated as strain S. cerevisiae: ER-A and ER-M, were able to grown at 15% of ethanol in the medium (data not shown). When subjected to a stepwise increase in ethanol concentration with repetitive cultivations, the yeast cells S. cerevisiae ER-A adapted to the high ethanol concentration showed better biomass accumulation in the medium containing the same ethanol concentration, in comparison to the cells of the parent strain (Table II). This strain was used for further study. The most active mutant, S. cerevisiae ER-A, resistant to ethanol stress, was characterized by high resistance to acidic (pH 1.0 and 2.0), oxidative (1 and 2% of H2O2) and high temperature (45 and 52oC) stresses. The viability of mutants during cultivation under all the mentioned stress conditions increased about 1.04 to 3,94-fold in comparison with the parent strain S. cerevisiae ER. It is worth noting, that mutant of S. cerevisiae ER-A resistant to ethanol stress, generally showed a better adaptation to higher ethanol concentration, as expressed by the increased (about 4-fold) viability at 20% of ethanol in comparison to its 10%

54

Fiedurek J. et al.
Table II Effect of ethanol concentration on biomass production
Ethanol (% w/v) Dry matter (g/l)a after Relative to the parent-type (-fold) 48 h

slowly, reaching 10.7% after 20 min. The higher concentration (10%) of ethanol significantly reduced oxygen consumption; in these conditions, more than half of the initial dissolved oxygen content remained
Table IV Effect of externally added ethanol at concentration 015% on CO2 and biomass production by parent and adapted strain of Saccharomyces cerevisiae MR-A
Relative metabolic rate (%)a, b Dry matter Mixing Mixing (g/l)b (90 rpm) (180 rpm) Saccharomyces cerevisiae ER (parent) Control (none) 39.13 73.90 2.33 5 21.74 39.13 1.73 10 4.35 4.35 1.36 11 0 4.30 1.10 12 0 0 0.58 13 0 0 0.39 14 0 0 0.28 15 0 0 0.19 Saccharomyces cerevisiae ER-A Control (none) 43.48 100.00 2.46 5 30.43 52.17 2.25 10 5.43 13.44 1.50 11 4.43 13.00 1.35 12 0 4.35 0.70 13 0 0 0.53 14 0 0 0.44 15 0 0 0.34 Ethanol (% w/v)
a

48 h 24 h 24 h Saccharomyces cerevisiae ER (parent) Control (none) 2.33 3.04 11 1.10 1.67 12 0.58 1.11 13 0.41 0.63 14 15 0.19 0.22 Saccharomyces cerevisiae ER-A Control (none) 2.42 2.74 1.04 11 1.35 1.67 1.23 12 0.65 1.24 1.12 13 0.53 0.87 1.29 14 0.44 0.77 1.42 15 0.30 0.36 1.58

0.90 1.00 1.12 1.38 1.64 1.64

The strains were incubated in 50 ml conical flasks, each containing 20 ml of basal medium A with ethanol (1115%) during 2448 h. a Values are averages of 6 replicate determinations with standard deviations of < 6%

Table III Effect of abiotic stresses on surviving cells of Saccharomyces cerevisiae ER

Stress conditions Low pH (2.0) Low pH (1.0) Oxidative stress (1% H2O2) Oxidative stress (2% H2O2) High temperature (45oC) High temperature (52oC) Ethanol (10%) Ethanol (15%) Ethanol (20%) Surviving cells (%)a Parent 81.99 3.85 80.90 72.0 47.59 26.34 89.25 61.02 10.00 ER-A 93.70 7.14 100.0 96.50 69.85 43.17 90.37 77.93 39.40 Relative to the wildtype (-fold) 1.14 1.85 1.24 1.34 1.46 1.64 1.04 1.28 3.94

Relative metabolic rate (%) was calculated by counting the number of bubbles of CO2 released from fermentative tubes during 60 min. Maximal amount of bubbles formed during culture of the adapted strain ERA was defined as 100%. The strains were incubated in 50 ml conical flasks, each containing 20 ml of basal medium A with ethanol (515%) during 24 h b Values are averages of 6 replicate determinations with standard deviations of < 5%

The strains were incubated in 50 ml conical flasks, each containing 20 ml of basal medium during 24 h of stress conditions. Low pH media were obtained by adding 0.1 M HC1. a Values are averages of 4 replicate determinations with standard deviations of < 4%

Table V Effect of (NH4)2SO4 concentration on ethanol production

Medium Ethanol (% w/v) Ethanol yield (% of theoretical) Dry matter (g/l) 5.38 6.75 5.04 6.23

concentration (Table III). A similar trend was also observed for oxidative (1 and 2% of H 2O2) and high temperature (45 and 52C) stress, when higher numbers of cells survived in more drastic stress conditions. Measurements of oxygen consumption at 30C and pH 4.5 showed that ethanol inhibited the respiration rate of yeast. In the absence of added ethanol, the oxygen concentration decreased gradually over the first 15 min to the level of about 6%. When the experiment was repeated in the presence of 5% (w/v) ethanol, the respiration rate of the yeast cells was markedly inhibited, and the oxygen concentration fell more

Saccharomyces cerevisiae ER (parent)a Basal medium A 6.30 78.06 Modified basal medium A with (NH4)2SO4 1,0% 7.10 87.98 Saccharomyces cerevisiae ER-A a Basal medium A 7.20 89.22 Modified basal medium A 8.00 99.13 with (NH4)2SO4 1,0%

Fermentation conditions: inoculation: 2 107 cells/ml, time fermentation 72 h at 30C in shaker 90rpm. The strain was incubated in 50 ml conical flasks, each containing 20 ml of basal medium A containing 0.3 and 1.0% of with (NH4)2SO4. a Values are averages of 6 replicate determinations with standard deviations of < 5%

S. cerevisae adaptation for increased ethanol levels

55

a)

b)

Fig. 1. Effect of ethanol concentration in the medium on the oxygen consumption of Saccharomyces cerevisiae ER strain (a) and Saccharomyces cerevisiae ER-A strain (b). The values shown represent the mean of three experiments. Error bars represent standard deviations.

in the medium after 20 min from the beginning of the experiment (Fig. 1a). The adapted cells of S. cerevisiae ER-A consumed more oxygen than the parent strain in media with all the tested ethanol concentrations (Fig. 1b). After 20 min of respiration, the levels of oxygen concentration in media with 5% and 10% ethanol were lower by 10.7% and 13.2%, respectively, as compared with values for the parent strain. The effect of 515% ethanol externally added to basal medium A on CO2 production by the parent and the adapted strain of S. cerevisiae ER-A was exam-

ined. In comparison with the parent strain, the metabolic activity of adapted cells of S. cerevisiae ER-A showed higher resistance to inhibition by ethanol when the cells were grown with 5 and 10% (w/v) ethanol. The higher concentration (11%) of ethanol completely inhibited metabolic activity of the parent strain when culture was carried out in a shaker at 90 rpm, and adapted cells showed insignificant activity in these conditions. Under a higher mixing rate (180 rpm), at 11% of ethanol, adapted cells of S. cerevisiae ER-A were characterized by an about 3-fold higher

56

Fiedurek J. et al.

metabolic activity than the parent strain. A further increase in ethanol concentration in basal medium A to 12% completely inhibited metabolic activity of the parent strain, and the adapted strain showed very small this activity in these conditions (Table IV). Table V compares ethanol production by the parental and the mutant strain of S. cerevisiae ER-A in basal and modified medium A. The highest ethanol yields for the two strains were obtained on modified medium A, containing 15% of sucrose, 1% of yeast extract, 1% of (NH4)2SO4 and 1% of KH2PO4, using a very simple fermentation system (shake flask). Considerably better results were achieved for mutant S. cerevisiae ER-A, which was characterized by an ethanol yield of 99.13% and an ethanol concentration of 8.0%; the respective values for the parental strain were 87.98 % and 7.1%. Discussion Tolerance to high ethanol and sucrose concentrations is an important property of industrial microorganisms. The accumulation of ethanol during cultivation causes stress to yeast cells, leading to a decrease in cell growth and production of target products. Thus, understanding the process of adaptation of yeast to high ethanol concentrations is important as it may lead to the construction of yeast strains able to grow well at high ethanol concentrations. Such ethanol-tolerant yeasts are highly desirable for the production of useful compounds. Improving ethanol tolerance in yeast should, therefore, reduce the impact of ethanol toxicity on fermentation performance (Dinh et al., 2008; Stanley et al., 2010). Stanley et al. (2010) obtained ethanol-tolerant yeast mutants by subjecting mutagenised and non-mutagenised populations of S. cerevisiae W303-1A to adaptive evolution using ethanol stress as a selection pressure. Mutants CM1 (chemically mutagenised) and SM1 (spontaneous) had increased acclimation and growth rates when cultivated in sub-lethal ethanol concentrations, and their survivability in lethal ethanol concentrations was considerably improved compared with the parent strain. Those authors suggested that the increased ethanol tolerance of the mutants was due to their elevated glycerol production rates and the potential of these to increase the ratio of oxidised and reduced forms of nicotinamide adenine dinucleotide (NAD+/NADH) in an ethanol-compromised cell, stimulating glycolytic activity. The viability of the adapted S. cerevisiae ER-A was always higher than for the parental strain, for all the stress conditions used (Table III). For example, the viable population (expressed as a percentage of the initial population) of the ER- culture after 24h in

20% (w/v) ethanol was 39.40%, respectively, compared with 10.0% for the parent. Similar viability characterized SM1 and CM1 cultures obtained by Stanley et al. (2010) under lethal ethanol stress conditions (12% (w/v) ethanol, after 12 h) 52% and 44%, respectively, compared with 5% for the parent. Some researchers have analyzed phenomena associated with adaptation of yeast cells to high ethanol concentrations. Lloyd et al. (1993) found that yeast previously grown in the presence of 5% ethanol could grow in the medium containing 10% ethanol, whereas yeast inoculated directly into a medium containing 10% ethanol failed to grow. Ismail and Ali (1971) reported that no increase in the tolerance of yeast to a high ethanol concentration was observed after ten successive transfers to an environment containing a high ethanol concentration. Therefore, it is expected that exposing yeast cells to a stepwise increase in the level of ethanol stress should be effective for obtaining ethanol-tolerant yeast strains. The results presented above confirmed that an adapted strain resistant to ethanol stress generally showed better adaptation to other stress conditions, as expressed by the increased survival of the mutant of S. cerevisiae ER-A during cultivation under acidic (pH 1.0 and 2.0), oxidative (1 and 2% of H2O2), and high temperature (45 and 52C) stresses. It is worth noting that in the more drastic stress conditions, the ethanol-tolerant mutant was characterized by a higher survival rate. This is in accordance with data presented by Ogawa et al. (2000), who showed that several genes were highly expressed only in the ethanol-tolerant mutant but not in the parent strain. The ethanol-tolerant mutant also exhibited resistance to other stresses including heat, high osmolarity, and oxidative stress in addition to ethanol tolerance. These results indicate that the mutant exhibits multiple stress tolerances due to elevated expression of stress-responsive genes, resulting in accumulation of high amounts of stress protective substances such as catalase, glycerol, and trehalose (Ogawa et al., 2000). The ability of one stress condition to provide protection against other stresses is referred to as cross-protection. Several studies have shown that adaptation to acid stress confers resistance to a wide range of stress conditions including heat, salt, crystal violet, and polymyxin B (Lee et al., 1995; Bearson et al., 1997). However, adaptation to other stresses does not typically induce significant acid tolerance. This implies that acid exposure may be treated by microorganisms as a more general stress indicator, whereas salt and H2O2 may be more specific stress signals. A number of specific selection schemes have been elaborated to improve the biosynthetic capacity of production strains. Thus the acid tolerance of Leuconostoc oenos was examined in cells surviving at pH

S. cerevisae adaptation for increased ethanol levels

57

2.6, which is lower than the acid limit of growth (about pH 3.0). The acid-resistant mutant L. oenos, was found to be able to grow in acidic media and characterized by a high H +ATPase activity at low pH. Such strains may be an important part of the technology of modern commercial wine production (Drici-Cachon et al., 1996). Accumulation of a large amounts of metabolic end-products during the fermentation period, especially in case of industrial amino acid fermentation, builds up a high osmotic strength which affects both growth and production. Enhanced l-treonine production by salt tolerant mutants of E. coli was achieved (Drici-Cachon et al., 1996). Some mutants have been described in E. coli which are more resistant to cell lysis in the presence of ethanol (Fried and Novick 1973; Ingram et al., 1980). In this respect, our results obtained in ethanol production can be compared with data provided by Ortiz-Zamora et al. (2008), who isolated and selected yeast strains from alcoholic fermentations of natural sources. These strains were exposed several times to high concentrations of glucose and ethanol in order to select ethanol- and glucosetolerant yeast; 10 were obtained that adapted best to these conditions. Some of these strains demonstrated the highest adaptation to both ethanol (57%w/v) and glucose (20%w/v). The maximum yield obtained was 0.46g/g (90% theoretical yield) in a 20-L bioreactor with cane molasses. Araque et al. (2008) selected thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production, which were able to grow and ferment glucose in the temperature range 3545C. All the strains grew (in agar plates) at 35 and 40C, only two strains grew at 42C, and no strain grew at 45C. Glucoseto-ethanol conversion yield was between 50% and 80% of the theoretical value. The ethanol yields by SSF using the selected strain were higher than those obtained using the control yeast. The selected strain, S. cerevisiae ER-A, showed an ability to grow and ferment sucrose at ethanol concentrations in the medium of 15 and 12% (w/v), respectively (Tables II and IV). Its resistance to ethanol, externally added to the medium, was significantly higher than for the parent strain. An increase in the rate of mixing from 90 to 180 rpm correlated with a simultaneous increase in the relative fermentation rate (%) both for the parent and the adapted strain, probably as an effect of a higher mass transfer. The effect of ethanol on yeast growth and fermentation has been studied by Brown et al. (1981).These authors showed complex kinetics which resulted from both an inhibition of the growth rate itself and also a reduction in cell viability. The growth and viability effects had different inhibition constants. Contrary to our data, ethanol was less inhibitory toward fermentation than toward growth in sake yeast.

Some data suggest that an improvement in ethanol tolerance leads to an increase in both ethanol production rate and the total amount of ethanol produced (Jimnez and Bentez, 1988). The adapted S. cerevisiae ER-A reached an ethanol concentration of 80 g/l, an ethanol productivity of 1.1 g/l/h, and an ethanol yield (% of theoretical) 99.13. Those values were significantly higher in comparison with the parent strain (ethanol concentration of 72.9 g/l and productivity of 1,01 g/l/h). The studies presented above seem to confirm the high effectiveness of selection of resistant yeast strains by adaptation to high ethanol concentrations for increased ethanol production. Additionally, better adaptation of these mutants to abiotic stresses can affect yeast growth and ethanol productivity. The advantage gained in direct screening is to reduce in a very specific way the number of cultures isolated from the plates, which would normally require testing of productivity via shake flask cultures. This is a significant contribution to make screening of ethanol-producing yeast more efficient. The ethanol tolerant strain was stable in the subsequent subcultures in the absence of stress during 6 months. It can be concluded from the present results that the adapted strain S. cerevisiae ER-A showed, at this stage of our studies, a moderate fermentation activity, which gave reasonable ethanol yields from sucrose. Further improvements to the isolated yeast strain and the growth conditions are necessary to utilize the strain for larger-scale fermentation.
Acknowledgements The authors wish to thank Prof. Jzef Kur (Department of Microbiology Chemical Faculty, Gdask University of Technology, Poland) for supplying yeast strain Saccharomyces cerevisiae ER (Ethanol Red). This work was financially supported by Research Program BW/BiNoZ/UMCS.

Literature
Alper H., J. Moxley, E. Nevoigt, G.R. Fink and G. Stephanopoulos. 2006. Engineering yeast transcription machinery for improved ethanol tolerance and production. Science 314: 15651568. Araque E., C. Parra, M. Rodrguez, J. Freer and J. Baeza. 2008. Selection of thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production. Enzyme Microb. Technol. 43: 120123. Bearson S., B. Bearson and J.W. Foster. 1997. Acid stress responses in enterobacteria. FEMS Microbiol. Lett. 147: 173180. Brown S.W., S.G. Oliver, D.E.F. Harrison andR.C. Righelato. 1981. Ethanol inhibition of yeast growth and fermentation: Differences in the magnitude and complexity of the effect. J. Appl. Microbiol. Biotechnol. 11: 153155. Brown S.W. and S.G. Oliver. 1982. Isolation of ethanol-tolerant mutants of yeast by continuous selection. Eur. J. Appl. Microbiol. Biotechnol. 16: 119122.

58

Fiedurek J. et al.

Da Silva F.L.H., M.I. Rodrigues and F. Maugeri. 1999. Dynamic modeling simulation and optimization of an extractive continuous alcoholic fermentation process. J. Chem. Technol. Biotechnol. 74: 176182. Dinh T.N., K. Nagahisa, T. Hirasawa, C. Furusawa and H. Shimizu. 2008. Adaptation of Saccharomyces cerevisiae cells to high ethanol concentration and changes in fatty acid composition of membrane and cell size. PLoS ONE 3(7):e2623. doi: 10.1371/journal.pone.0002623. Drici-Cachon Z., J. Guzzo, J.F. Cavin and C. Divies. 1996. Acid tolerance in Leuconostoc oenos. Isolation and characterization of an acid-resistant mutant. Appl. Microbiol. Biotechnol. 44: 785789. Fried V.A. and A. Novick. 1973. Organic solvents as probes for the structure and function of the membrane: effects of ethanol on the wild and ethanol resistant mutant of Escherichia coli K-12. J. Bacteriol. 114: 239248. Gibson B.R., S.J. Lawrence, J.P. Leclaire, C.D. Powell and K.A. Smart. 2007. Yeast responses to stresses associated with industrial brewery handling. FEMS Microbiol. Rev. 31: 53569. Gonchar M.V., M.M. Maidan, H.M. Pavlishko and A. Sibirny. 2001. A new oxidase-peroxidase kit for ethanol assays in alcoholic beverages. Food Technol. Biotechnol. 39: 3742. Fiedurek J. and A. Gromada. 1997. Selection of biochemical mutants of Aspergillus niger with enhanced catalase production. Appl. Microb. Biotechnol. 47: 313316. Hirasawa T., K. Yoshikawa, Y. Nakakura, K. Nagahisa, C. Furusawa, Y. Katakura, H. Shimizu and S. Shioya. 2007. Identification of target genes conferring ethanol stress tolerance to Saccharomyces cerevisiae based on DNA microarray data analysis. J. Biotechnol. 131: 3444. Hughest D.B., N.J. Tudroszen and C.J. Moye. 1984. The effect of temperature on the kinetics of ethanol production by a thermotolerant strain of Kluyveromyces marxianus. Biotechnol. Lett. 6: 16. Ingram L.O., N.S. Vreeland and L.C. Eaton. 1980. Alcohol tolerance in Escherichia coli: a proposed common mechanism for changes induced by ethanol. Pharmacol. Biochem. Behav. 13: 191195. Ismail A.A. and M.M. Ali. 1971. Selection of high ethanol-yielding Saccharomyces I. Ethanol tolerance and the effect of training in Saccharomycess cerevisiae Hansen. Folia Microbiol. 16: 346369. Jimnez J. and T. Bentez. 1988. Selection of ethanol-tolerant yeast hybrids in pH-regulated continuous culture. Appl. Environ. Microbiol. 54: 917922. Jones T.D., J.M. Havard and A.J. Daugulis. 1993. Ethanol production from lactose by extractive fermentation. Biotechnol. Lett. 15: 871876.

Lee I.S., J. Lin, H.K. Hall, B. Bearson and J.W. Foster. 1995. The stationary-phase sigma factor sS (RpoS) is required for a sustained acid tolerance response in virulent Salmonella typhimurium. Mol. Microbiol. 17: 155167. Lloyd D., S. Morrell, H.N. Carlsen, H. Degn, P.E. James and C.C. Rowlands. 1993. Effects of growth with ethanol on fermentation and membrane fluidity of Saccharomyces cerevisiae. Yeast 9: 825833. Nishiwaki A. and I.J. Dunn. 1998. Analysis of a two-stage fermentor with recycle for continuous ethanol production. Chem. Eng. Commun. 168: 207227. Ogawa Y., A. Nitta, H. Uchiyama, I. Takesh, H. Shimoi and K. Ito. 2000. Tolerance mechanism of the ethanol-tolerant mutant of sake yeast. J. Biosc. Bioeng. 90: 313320. Ortiz-Zamora O., R. Corts-Garca, M. Ramrez-Lepe, J. Gmez-Rodrguez and M.G. Aguilar-Uscanga. 2008. Isolation and selection of ethanol-resistant and osmotolerant yeasts from regional agricultural sources in Mexico. J. Food. Process. Engin. 32: 775786. Remize F., J.L. Roustan, J.M. Sablayrolles, P. Barre P and S. Dequin. 1999. Glycerol overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes in by-product formation and to a stimulation of fermentation rate in stationary phase. Appl. Environ. Microbiol. 65: 143149. Schubert C. 2006. Can biofuels finally take center stage? Nat. Biotechnol. 24: 777784. Stanley D., S. Fraser, P.J. Chambers, P. Rogers and G.A. Stanley. 2010. Generation and characterisation of stable ethanol-tolerant mutants of Saccharomyces cerevisiae. J. Ind. Microbiol. Biotechnol. 37: 139149. Van Uden N. 1985. Ethanol toxicity and ethanol tolerance in yeasts. Ann. Rep. Ferm. Process. 8: 1158. de Vasconcelos J.N., C.E. Lopes and F.P. de Franca. 2004. Continuous ethanol production using yeast immobilized on sugar-cane stalks. Braz. J. Chem. Eng. 21: 357365. Verbelen P.J., D.P. De Schutter, F. Delvaux, K.J. Verstrepen and F.R. Delvaux. 2006. Immobilized yeast cell systems for continuous fermentation applications. Biotechnol. Lett. 28: 15151525. Viegas C.A., M.F. Rosa, I. Sa-Correia and J.M. Novais. 1989. Inhibition of yeast growth by octanoic and decanoic acids produced during ethanolic fermentation. Appl. Environ. Microbiol. 55: 2128. Wang F.S. and H.T. Lin. 2010. Fuzzy optimization of continuous fermentations with cell recycling for ethanol production. Ind. Eng. Chem. Res. 49: 23062311. You K.M., C.L. Rosenfield and D.C. Knipple. 2003. Ethanol tolerance in the yeast Saccharomyces cerevisiae is dependent on cellular oleic acid content. Appl. Environ. Microbiol. 69: 1499503.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 5963

ORIGINAL PAPER

Cytotoxicity of Aspergillus Fungi Isolated from Hospital Environment

AGNIESZKA GNIADEK1, ANNA B. MACURA2 and MACIEJ GRKIEWICZ3

of Medical and Environmental Nursing, Faculty of Health Sciences Jagiellonian University Medical College, Krakw, Poland 2 Department of Mycology, Chair of Microbiology, Jagiellonian University Medical College, Krakw, Poland 3 Department of Epidemiology and Population Research, Jagiellonian University Medical College, Krakw, Poland Received 18 May 2010, revised 10 January 2011, accepted 14 January 2011
Abstract The majority of mycotoxins produced by Aspergillus fungi are immunosuppressive agents, and their cytotoxicity may impair defense mechanisms in humans. The objective of the study was evaluation of the cytotoxicity of fungi isolated from an environment where inpatients with impaired immunity were present. The materials comprised 57 fungal strains: Aspergillus fumigatus, Aspergillus niger. Aspergillus ochraceus, Aspergillus flavus, Aspergillus versicolor and Aspergillus ustus isolated from hospital rooms in Cracow. The cytotoxicity of all the strains was evaluated using the MTT test (3-(4,5-dimethylthiazol-2-yl) 2,5 diphenyltetrazolium bromide). To emphasize the differences in cytotoxicity among the particular strains, variance analysis (ANOVA) and Tukeys difference test were used. Out of 57 Aspergillus strains tested, 48 (84%) turned out to be cytotoxic. The cytyotoxicity was high (+++) in 21 strains, mainly in A. fumigatus. The least cytotoxic were A. niger fungi, this being statistically significant (p<0,05). To protect a patient from the adverse effects of mycotoxins, not only his or her immunity status should be evaluated but also the presence of fungi in hospital environment and their cytotoxicity should be monitored (possible exposure). K e y w o r d s: Aspergillus sp., cytotoxicity, environment

1 Department

Introduction There is evidence that a number of Aspergillus fungi present in hospital environment produce toxins (Burr, 2001; Ben-Ami et al., 2009; Klich et al., 2009). Their secondary metabolites such as ochratoxin A, aflatoxins, trichotecins or sterigmatocystine are toxic for various cellular structures and interfere with key processes like RNA and DNA synthesis (Ciegler and Bennet, 1980). Depending on fungal species and/or strain, mycotoxins differ in their specificity and influence on target cells, cellular structures and processes in them (Steyn, 1995; Pitt, 2000). It should be also kept in mind that not all moulds produce mycotoxins, and their production depends on culture medium, life cycle and environmental conditions (Pitt et al., 2000; Kelman et al., 2004). To assess the ability of a given strain to produce mycotoxins, the presence of other moulds in the environment should be taken into account as well as their influence on mycotoxin production intensity. It has been documented that the fungi incubated in monocultures in laboratory setting

lose their mycotoxin production potential (Fischer and Dott, 2003; Jarvis and Miller, 2005). The ability of fungi to produce mycotoxins is hard to evaluate because there is a no possibility to analyze the mycotoxins produced in the tissues of living organisms. The relationship between disease (or predisposition to it) and the level of exposure (detection of pathogenic spores) as well as symptoms and signs characteristic of experimental lesions produced by mycotoxins may contribute to establishing the noxiousness of fungi to human health. The objective of the study was evaluation of the cytotoxicity of Aspergillus fungi isolated from hospital environment. Experimental
Materials and Methods

The materials comprised mould strains belonging to the Aspergillus genus, isolated from the environment, mainly from indoor air in hospital rooms at a number of hospitals in Krakw in the years 20072008.

* Corresponding author: A. Gniadek, PhD, Department of Medical and Environmental Nursing, Faculty of Health Sciences, Jagiellonian University Medical College, 12 Michaowskiego str., 31-126 Krakw, Poland; phone: (+48 12) 6336259; fax: (+48 12) 429482; e-mail: mxgniade@cyf-kr.edu.pl

60

Gniadek A. et al.

Primarily, the mycological flora was evaluated in hospital ward environment (neonatal intensive care unit, medical intensive therapy unit, the wards of chemotherapy and radiotherapy). The fungi were sampled using a MAS 100 device (Merck) from the indoor air in various hospital rooms. The species of particular strains were detected on the basis of thorough macroscopic and microspocic analysis. Out of all of the fungi isolated, 57 Aspergillus strains were randomly chosen for further examination. The chosen strains belonged to six species: A. fumigatus (21 strains), A. niger (14 strains), A. ochraceus (13 strains), A. flavus (5 strains), A. versicolor (3 strains) and A. ustus (a single strain). The fungi were divided into groups: each group comprised different species. The cytotoxicity test MTT (3-(4,5-dimethylthiazol-2-yl) 2,5 diphenyltetrazolium bromide) was performed separately for each strain. To evaluate the total cytotoxicity of the fungi, swine kidney cells (SK) were used because they are sensitive to most mycotoxins. The test is based on the reduction of yellow MTT tetrazolium salt to violet formazan, insoluble in water. The reduction occurs in the presence of intact SK, not damaged by mycotoxins. The intensity of reaction is proportional to the amount of metabolically active SK. When the SK are infected with moulds producing mycotoxins, their mitochondria fail to reduce tetrazolium salt into formazan. Therefore, when the SK are damaged by mycotoxins, the reaction is less intensive or does not occur, which can be measured photometrically as more or less intensive change of colour. Thus, the reduction or the absence of the reaction gives evidence of cytotoxicity of the fungal strain tested. (Hanelt et al., 1994). The analysis comprised the evaluation of a test sample (Petri dish with the mould on Czapek medium) and a control sample (Petri dish with Czapek medium). The SK were grown in medium containing antibiotics (penicillin and streptomycin, Sigma Aldrich) and calf fetal serum (Sigma Aldrich) in the Hera Cell incubator with carbon dioxide, manufactured by Heraeus (5% CO2, 37C, 98% humidity). The number of SK was 2.2 105. The ranges of testing concentrations were prepared in ratio 1:2 and amounted from 31.251 to 0.061 cm2/ml. The value was expressed in terms of cm2/ml, where the area of the Petri dish from which the moulds were extracted together with the medium, was measured in square centimetres. The quantitative evaluation of cytotoxicity was performed using a microslide spectrophotometer (Elisa Digiscan reader, Asys Hitech GmbH, Austria) and the programme MikroWin 2000 (Mikrotek Laborsysteme GmbH, Germany). The readings were made at the wave-length of 510 nm. All of the absorption values below 50% of the threshold activity were considered as toxic. So, the borderline toxic concentration was evaluated on the basis of the dilution i.e. the mean

inhibitory concentration IC50 was equal to the smallest sample (in cm2/ml) which was toxic to the SK. The cytotoxicity was considered as low (+) when the values were within the range of 31.251>15.625> 7.813 [cm2/ml], intermediate (++) for the values > 3.906 > 1.953> 0.977 [cm2/ml], and high (+++) for > 0.488 > 0.244> 0.122> 0.061. The lack of cytotoxicity was reported when the absorption value exceeded 31.251 [cm2/ml] (Gareis, 1994). The cytotoxicity was tested in the Department of Physiology and Toxicology, Institute of Experimental Biology at the Casimirus the Great University in Bydgoszcz, Poland. To evaluate differences among the particular groups of fungi, the fungi were divided into four groups. The first group I (21 strains) comprised fungi belonging to the A. fumigatus species, the second group II (14 strains) A. niger, the third group III (13 strains) A. ochraceus, and the fourth group IV (9 strains) comprised the remaining strains (A. flavus, A. veriscolor and A. ustus). Descriptive statistics were used, and the mean values and standard deviations were calculated. To show the differences of cytotoxicity of the species tested ANOVA test was used. As the mean toxicities were different in particular groups, the Tuckeys post hoc test was used to find out between which groups the differences were significant. The value of p< 0,05 was assumed as the borderline of significance (Armitage, 1971). Results The amounts of fungi and fungal species varied from one room to another. The mean numbers of fungi in the particular wards varied from 5 to 2370 c.f.u. m3. The fungi were most abundant in the neonatal intensive care unit: the mean number of colonies on a single Petri dish reflected 530 c.f.u. m3 in the indoor air. The lowest number of fungi was detected in the chemotherapy ward: 29 c.f.u.m3 (Table I). The dominating genera were Penicillium, Cladosporium and Aspergillus. The highest percentage of Aspergillus was isolated in the neonatal intensive care unit: 38%. The moulds were the most abundant in this environment. The lowest percentage of Aspergillus was detected in air-conditioned intensive therapy ward: 22%. The total number of Aspergillus strains isolated was too high to evaluate cytotoxicity in all of them. The strains chosen to cytotoxicity test originated from three hospital wards because it was assumed that strains from the same ward might be similar genotypically. Out of the 57 Aspergillus strains tested, 48 (84%) turned out to be cytotoxic. They belonged to the following species: A. fumigatus 19/21, A. niger 8/14, A.ochraceus 12/13, A. flavus 5/5, A. versicolor 3/3,

Cytotoxicity of Aspergillus sp.

Table I Results of cytotoxicity tests
Number Numbers of fungal colonies c.f.u.m3 of samples Minimum Maximum Mean Median 130 130 30 48 5 5 50 5 360 130 2370 170 39,5 29 530 40 17,5 20 260 30 Percentage of fungi A 32% 29% 38% 22% C 9% 8% 18% 17% P 31% 29% 32% 38% I 28% 34% 12% 23% Number of Aspergillus strains examined for cytotoxicity 16 20 12 9

61

Ward Radiotherapy Chemotherapy Neonatal ICU Intensive therapy

Number of strains with documented cytotoxicity 12 16 12 8

ICU intensive care unit, A Aspergillus sp., C Cladosporium sp., P Penicillium sp., I other fungal

Table II Distribution of fungal species in relation to their cytotoxicity

No 1 2 3 4 5 6 Species Aspergillus fumigatus Aspergillus niger Aspergillus ochraceus Aspergillus flavus Aspergillus veriscolor Aspergillus ustus Total N (%) 21 (37%) 14 (25%) 13 (23%) 5 (8%) 3 (5%) 1 (2%) 57 (100%) Cytotoxicity None 2 6 1 0 0 0 9 + 1 3 3 2 0 1 10 ++ 7 3 2 2 3 0 17 +++ 11 2 7 1 0 0 21

N Total number of fungi; (+) low cytotoxicity; (++) intermediate cytotoxicity; (+++) high cytotoxicity

genicity within the particular fungal species (p = 0,03; p< 0,05). The least cytotoxic was the Aspergillus niger species: its mean value 32.71 and SD 27.97 were the highest among the fungi tested. The Tuckeys post hoc test, performed following ANOVA, revealed that the cytotoxicity of A. niger is significantly lower than those of A. fumigatus and A. ochraceus (p<0,05). The cytotoxicity of the other Aspergillus fungi (group IV) did not differ significantly from the three species mentioned above, which may be a result of too small number of fungi in the samples. Moreover, the confidence interval was calculated for each of the species tested; these are presented in Fig. 1. Discussion Moulds can grow mainly in the environment in which humidity exceeds 45%, the temperature is within the range of 5C35C (optimum 1827C). and water activity above 0.8. Such environment is conducive to the production of secondary metabolites mycotoxins. Penicillium and Aspergillus are dominating mould species in the rooms where water activity is around 0.85 (Jarviss, 2003). The Aspergillus genus is the most pathogenic to living organisms, however, it globally produces less mycotoxins than Stachybotrys even though the former dominates in the environment. This may not be true in all the Aspergillus species, because sterigmatocystein produced by A. versicolor may contribute to 1% of its biomass when water activity is equal to one (Fog Nielsen, 2003). We managed to isolate only three A. versicolor strains and to evaluate their cytotoxicity, which was intermediate in all cases. Such a small number of isolates resulted from the fact that this fungal species is rarely isolated indoor and is present mainly in colder regions such as mountains or polar areas. The species most frequently isolated from indoor air are A. fumigatus and A. niger. Just these two species were most often isolated in our study and examined for cytotoxicity. It is reported in many papers that A. fumigatus is the most pathogenic Aspergillus species (Bennett,

and a single strain A. ustus. Only nine strains were not cytotoxic (16%). The absorption value > 31.251 [cm2/ml] (lack of cytotoxicity) was most frequently found in A. niger (six strains). Twenty one strains tested revealed high cytotoxicity (+++), most often A. fumigatus (11 strains), and A. ochraceus (7 strains). Intermediate cytotoxicity was found in seventeen strains, mainly A. fumigatus. Ten strains revealed low cytotoxicity, mainly A. niger and A. ochraceus (Table II). The ANOVA test revealed differences of the patho-

Fig. 1. Intervals of confidence 95% CI and mean value of Aspergillus cytotoxicity estimated as difference between reference level equal to 50 and measured value of IC 50 cm 2/ml.
Legend: the squares at the middle represent the mean value of the estimated cytotoxicity, and the vertical lines represent the size of the confidence interval of the estimated cytotoxicity.

62

Gniadek A. et al.

2009; Krishnan et al., 2009; Albrecht et al., 2010). This finding was confirmed by Kamei et al. (2002) who analyzed the virulence of A. fumigatus, A. flavus, A.niger and A. terreus and their influence on murine macrophages. The macrophages treated with 1% A. fumigatus filtrate were seriously damaged, up to necrobiosis while the damage caused by similar filtrates of A. niger was lighter and that caused by A. flavus and A. terreus was almost undetectable. Those data are consistent with our findings because A. fumigatus was the most frequently highly cytotoxic (+++) as compared with other species, and only two strains out od 21 were not toxic to SK. On the other hand, only eight out of fourteen A. niger strains were cytotoxic, but their toxicity was the lowest as compared with other species. All of the A. flavus strains were cytotoxic in our study. Only five strains were tested, perhaps too few to come to a conclusion. The MTT test focused on in vitro influence of fungi on living cells is performed with swine, sheep or lamb cell cultures. Stec et al. (2007) investigated the influence of mycotoxins such as aflatoxin B, ochratoxin, patuline, citrinine and zelarenon on various cell cultures. They found out that SK fibroblasts were most sensitive to mycotoxins, however, the intensity of the yellow tetrazolium salt reduction to formazan depended on the kind of toxin. It appears that the choice of SK in our study was appropriate, and it could be expected that the majority of strains isolated in our study might by pathogenic to living organisms. In further trials carried out by Stec et al. (2007) cell cultures responded in different ways to treatment with various mycotoxins. Therefore, it appears essential to determine the kind of mycotoxins produced by highly mycotoxic fungi. It is not always possible. In our previous study (Gniadek and Macura, 2003) performed in 2001 with 21 A. flavus strains isolated from the environment at social welfare homes were examined for aflatoxins B1, B2, G1 and G2 using high performance liquid chromatography HPLC. Aflatoxins were not detected in any of the strains tested. The strains were not tested using MTT, however we were not sure that they were not pathogenic. The isolated A. flavus strains could produce the so called masked mycotoxins, e.g. aflatrem, aspergillic acid, cyclopiaze acid, kojic acid, maltoryzin, paspalicin or highly toxic sterigmatocystine. It should be kept in mind that fungi are able to produce mycotoxins in presence of other fungi (toxic metabolites are released only in a cross-reaction with toxins secreted by other fungi). (Fischer et al., 2000). Such a conclusion may be confirmed by the findings of Murtoniemi et al. (2005), who examined the influence of cytotoxicity of various fungi (Stachybotrys chartarum, Streptomyces californicus, A. veriscolor and Penicillium spinulosum) isolated from wet plaster bars on murine macrophages. They have shown that

some microcultures, after prolonged growth on wet cardboard sheets, were mutually stimulated or caused a synergic growth of cytotoxic fungi (especially S. chartarum and A.versicolor), but they did not cause inflammatory reaction in the cells tested. Variable environmental conditions may stimulate fungi to produce mycotoxins, e.g. gliotoxin produced by A. fumigatus (Ben-Ami et al., 2009; Kwon-Chung and Sugui, 2009). This substance inhibits T-cell activity, stimulates macrophage apoptosis and is included into pathogenesis of severe allergic rhinitis, bronchial asthma and allergic alveolitis in form of farmers lung, bakers lung as well as allergic broncho-pulmonary alveolitis (ABPA). The study carried out by Watanabe et al. (2004) gives evidence that a good access to oxygen stimulated A. fumigatus to produce toxic gliotoxins and increased the general cytotoxicity of the fungi. The conditions in the rooms in our study were conducive to fungal growth: the mean temperature was 24C, and humidity around 40%. The indoor environment is an active ecosystem that changes in the course of time and as a result of changing temperature and humidity, and in the presence of other microorganisms. The toxin production by moulds is influenced by those factors and depends also on the fungal culture age, the stage of sporulation and the access to nutrients (Kelman et al., 2004). The examination of the environment of a patient diagnosed with a mycotoxin infection is most often performed after the initial phase of the disease and may not reflect the exposure to harmful substances present in the course of the disease (Gniadek et al., 2005; Hardin et al., 2003). On the basis of the measurements of environmental factors which appeared after the infection, the real exposure at the onset of the disease may be only estimated. Therefore, it is a reasonable prophylactic measure to monitor mycological cleanness of the environment where immunocompromised patients are present and to evaluate the cytotoxicity of the fungi known as pathogenic. Conclusions. 1. The majority of the fungi Aspergillus in the environment of the rooms tested were cytotoxic and most often (p< 0,05) were non- A. niger. 2. To protect patients from harmful influence of mycotoxins, the immunity status of the patients should be evaluated and the presence of fungi in the environment should be monitored, including their cytotoxicity testing (possible exposure). Literature
Albrecht D., R. Guthke, A.A. Brakhage and O. Kniemeyer. 2010. Integrative analysis of the heat shock response in Aspergillus fumigatus. BMC Genomics. 15: 1132.

Cytotoxicity of Aspergillus sp.

63

Armitage P. 1971. Statistical Methods in Medical Research. Blackwell Scientific Publications. Oxford. p. 189207 Ben-Ami R., R.E. Lewis, K. Leventakos and D.P. Kontoyiannis. 2009. Aspergillus fumigatus inhibits angiogenesis through the production of gliotoxin and other secondary metabolites. Blood. 114: 53935399. Bennett J.W. 2009. Aspergillus: a primer for the novice. Med. Mycol. 47 (Suppl. 1): S512. Burr M.L. 2001. Health effects of indoor moldes. Rev. Environ. Health. 16: 97103. Ciegler A. and J.W. Bennet. 1980. Mycotoxins and mycotoxicosis. Bioscience 30: 512513. Fischer G. and W. Dott. 2003. Relevance of airborne fungi and their secondary metabolites for environmental, occupational and indoor hygiene. Arch. Microbiol. 179: 7582. Fischer G., T. Mller, R. Schwalbe, R. Ostrowski and W. Dott. 2000. Species-specific profiles of mycotoxins produced in cultures and associated with conidia of airborne fungi derived from biowaste. Int. J. Hyg. Environ. Health. 203: 105116. Fog Nielsen K. 2003. Mycotoxin production by indoor molds. Fungal Genet Biol. 39: 103117. Gareis M. 1994. Cytotoxicity testing of samples originating from problem buildings. [In:] Fungi and Bacteria in Indoor Air Environments: Health Effects, Detection and Remediation. E. Johanning (ed.), Eastern New York Occupational Health Program, Saratoga Springs, New York, USA, Proceedings. 139144. Gniadek A. and Macura A.B. 2003. The presence of fungi in the environment of social welfare homes and the mycotoxins threat (in Polish). Ann. Univ. Maria Sklodowska. Sect. D. Med. 58 (Suppl 13): 416421. Gniadek A., A.B. Macura, E. Oksiejczuk, E. KrajewskaKuak and C. ukaszuk. 2005. Fungi in the air of selected social welfare homes in the Maopolskie and Podlaskie provinces a comparative study. Int. Biodeterior. Biodegrad. 55: 8591. Hanelt M., M. Gareis and B. Kollarczik. 1994. Cytotoxicity of mycotoxins evaluated by the MTT-cell culture assay. Mycopathologia 128: 167174.

Hardin B.D., B.J. Kelman and A. Saxon. 2003. Adverse human health effects associated with molds in the indoor environment. J. Occup. Environ. Med. 45: 470478. Jarvis B.B. 2003. Analysis for mycotoxins: the chemists perspective. Arch. Environ. Health. 58: 479483. Jarvis B.B. and J.D. Miller. 2005. Mycotoxins as harmful indoor air contaminants. Appl. Microbiol. Biotechnol. 66: 367372. Kamei K., A. Watanabe, K. Nishimura and M. Miyaji. 2002. Cytotoxicity of Aspergillus fumigatus Culture Filtrate Against Macrophages. Nippon Ishinkin Gakkai Zasshi. 43: 3741. Kelman B.J., C.A. Robbins, L.J. Swenson and B.D. Hardin. 2004. Risk from inhaled mycotoxins in indoor office and residential environments. Int. J. Toxicol. 23: 310. Klich M.A., S. Tang and D.W. Denning. 2009. Aflatoxin and ochratoxin production by Aspergillus species under ex vivo conditions. Mycopathologia 168: 185191. Krishnan S., E.K. Manavathu and P.H. Chandrasekar. 2009. Aspergillus flavus: an emerging non-fumigatus Aspergillus species of significance. Mycoses. 52: 206222. Kwon-Chung K.J. and J.A. Sugui. 2009. What do we know about the role of gliotoxin in the pathobiology of Aspergillus fumigatus? Med. Mycol. 47 (Suppl. 1): S97103. Murtoniemi T., P. Penttinen, A. Nevalainen and M.R. Hirvonen. 2005. Effects of microbial cocultivation on inflammatory and cytotoxic potential of spores. Inhal. Toxicol. 17: 681693. Pitt J.I. 2000. Toxigenic fungi: which are important? Med. Mycol. 38 (Suppl. 1): 1722. Pitt J.I., J.C. Basilico, M.L. Abarca and C. Lpez. 2000. Mycotoxins and toxigenic fungi. Med. Mycol. 38 (Suppl. 1): 4146. Stec J., M. Szczotka and J. Kumak. 2007. Cytotoxicity of feedborne mycotoxins to animal cell lines in vitro using MTT assay. Bull. Vet. Inst. Pulawy 51: 679684. Steyn P.S. 1995. Mycotoxins, general view, chemistry and structure. Toxicology Letters 82/83: 843851. Watanabe A., K. Kamei, T. Sekine, H. Higurashi, E. Ochiai, Y. Hashimoto and K. Nishimura. 2004. Cytotoxic substances from Aspergillus fumigatus in oxygenated or poorly oxygenated environment. Mycopathologia 158: 17.

64

Gniadek A. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 6571

ORIGINAL PAPER

Production and Partial Characterization of High Molecular Weight Extracellular "-amylase from Thermoactinomyces vulgaris Isolated from Egyptian Soil
M.I. ABOU DOBARA, A.K. EL-SAYED, A.A. EL-FALLAL and N.F. OMAR*

Botany Department, Faculty of Science, Mansoura University (Damietta Branch), Egypt Received 14 July 2010, revised 15 January 2011, accepted 20 January 2011
Abstract Optimizing production of "-amylase production by Thermoactinomyces vulgaris isolated from Egyptian soil was studied. The optimum incubation period, temperature and initial pH of medium for organism growth and enzyme yield were around 24 h, 55C and 7.0, respectively. Maximum "-amylase activity was observed in a medium containing starch as carbon source. The other tested carbohydrates (cellulose, glucose, galactose, xylose, arabinose, lactose and maltose) inhibited the enzyme production. Adding tryptone as a nitrogen source exhibited a maximum activity of "-amylase. Bactopeptone and yeast extract gave also high activity comparing to the other nitrogen sources (NH4Cl, NH4NO3, NaNO3, KNO3, CH3CO2NH4). Electrophoresis profile of the produced two "-amylase isozymes indicated that the same pattern at about 135145 kDa under different conditions. The optimum pH and temperature of the enzyme activity were 8.0 and 60C, respectively and enzyme was stable at 50C over 6 hours. The enzyme was significantly inhibited by the addition of metal ions (Na+, Co2+ and Ca2+) whereas Cl seemed to act as activator. The enzyme was not affected by 0.1 mM EDTA while higher concentration (10 mM EDTA) totally inactivated the enzyme. K e y w o r d s: Thermoactinomyces vulgaris, high molecular weight "-amylase

Introduction Enzymes produced by thermophilic bacteria have been highlighted for their potential as biocatalysts in biotechnology. The importance of this was referred to the general relationship between enzyme thermostability and the thermophilicity of the host bacterium (Herbert, 1992). The "-amylase (EC 3.2.1.1) is a well-known endoamylase that hydrolyzes starch by randomly cleaving internal a- 1,4 glucosidic linkages. The spectrum of "-amylase applications has widely used in many fields, such as starch saccharification, textile, food, brewing, distilling industries, medical and analytical chemistries (Pandey et al., 2000). Despite this, interest in new and improved "-amylase is growing vastly. Therefore, the search for thermostable Ca2+ independent "-amylase (Tonkova, 2006) is continuous. Enzymes of the thermophilic actinomycetes Thermoactinomyces species, especially their "-amylase (Ito et al., 2007), have attracted much interest because of their activity at high temperature. The advantages for using thermostable "-amylases in industrial processes include

the decreased risk of contamination, the increased diffusion rate and the decreased cost of external cooling. In addition, the stability of biocatalysts is often a limiting factor in the selection of enzymes for industrial applications due to the elevated temperature or extreme pH of many biotechnological processes. The aim of the investigations was to determine the optimum conditions for production of highly active and industrial stable "-amylase by an Egyptian isolate of the thermophilic actinomycete Thermoactinomyces vulgaris and to investigate the enzyme properties. Experimental
Materials and Methods

T. vulgaris strain. T. vulgaris strain was isolated from fertile soil samples collected from Egypt at 50C and identified according to Bergeys Manual of Systematic Bacteriology (Lacey and Cross, 1989). The culture was maintained on Czapek-yeast-casein (CYC) agar slants.

* Corresponding author: N.F. Omar, Botany Department, Faculty of Science, Mansoura University (Damietta Branch), New Damietta, Egypt. P.O. Box 34517; e-mail: noha_omar15@yahoo.com

66

Abou Dobara M.I. et al.

Production of "-amylase. The organism was grown in conical flasks containing starch-nitrate medium (Waksman, 1959) as a basal medium with pH adjusted to 7.5. The medium (20 ml taken in 250 ml Erlenmeyer flasks) was inoculated with 1 ml of spore suspension of pure colonies of the organism and incubated at 50C with shaking (150 rpm) for 72 hours. The initial pH of the medium (4.010.0), temperature of incubation (3060C), and incubation period (1296 h) were tested for "-amylase production. Different carbon sources (1%) and nitrogen sources (equimolecular nitrogen amounts equivalent to the nitrogen content of the basal medium) were used for optimization of nutritional factors. The various tested carbon sources were: starch, cellulose, glucose, galactose, xylose, arabinose, lactose and maltose. The nitrogen sources were included NH4Cl, NH4NO3, NaNO3, KNO3, ammonium acetate, bactopeptone, yeast extract and tryptone were tested. On the compilation of the previous experiments, the cell-free enzyme supernatant was obtained by centrifugation at 8000g for 20 min. Experiments were carried out in triplicate and the results were treated statistically and standard errors are shown. "-Amylase assay. The amylase assay was based on the reduction in blue colour intensity resulting from starch hydrolysis (Palanivelu, 2001). The reaction mixture consisted of 0.4 ml of diluted enzyme, 0.5 ml of 0.1% soluble starch and 1 ml of phosphate buffer (0.1 M, pH 7) was incubated at 50C for 10 minutes. The reaction was stopped by adding 0.5 ml of 0.1 N HCl and the colour was developed by adding 0.5 ml of (2% KI in 0.2% I2) solution. The optical density (OD) of the blue colour solution was determined using a Unico 7200 SERIES spectrophotometer at 690 nm. One unit of enzyme activity is defined as the quantity of enzyme that caused 20% reduction of blue colour intensity of starch iodine solution at reaction incubation temperature in 1 min per ml. Intracellular protein content of T. vulgaris. The harvested mycelia of T. vulgaris strain were used for determination of intracellular protein. Washed pellets were dissolved in 20 ml of NaOH (1 M), and boiled for 20 minutes. Dilution of clarified solution was used to determine the intracellular protein concentration using Bradford method (1976). Bovine serum albumin was used as standard. Physicochemical properties of "-amylase. Enzyme activity at various temperatures and pH was studied by incubating reaction mixtures at different temperatures (3080C) and Tris-HCl buffer (pH 4.09.0). Enzyme stability at various temperatures was also studied by pre-incubating cell-free supernatants for different time (16 h) at various temperatures (50C80C). The effect of metal salts (NaCl, CoCl2 and CaCl2) and EDTA on activity was determined by adding of

different concentrations of each salt to the standard assay. Activities were expressed as a percentage of the maximal activity. Ammonium sulphate precipitation of the enzyme. The supernatant of culture was brought to 70% ammonium sulphate saturation in an ice bath. The precipitated protein was collected by centrifugation at 3000g at 4C and dissolved in 12 pellet volumes of phosphate buffer (0.1 M, pH 7.0). The enzyme solution was dialyzed overnight at 4C against the same buffer then concentrated over sucrose bed. The final enzyme solution was taken for polyacrylamide gel electrophoresis (PAGE). Electrophoresis and molecular weight determination. Nondenaturing PAGE was carried out by omitting SDS from the method of Laemmli (1970) with 10% polyacrylamide. The reference pre-stained protein marker (Molecular weights 10 to 170 kDa, SM 0671, Fermentas) was used. Amylase activity of proteins was detected according to Garcia-Gonzalez et al., (1991) by incubating the gels at 50C for 20 min in 0.2 M phosphate buffer (pH 7.0) containing 2% starch and then immersing in staining solution (KI 13 g/l and I2 6 g/l). The gel was destained with distilled water. The stain was stable for only a few minutes. Statistical analysis. Data were statistically analyzed for variance and the least significant difference (LSD at 0.01 level) using one-way analysis of variance (ANOVA). A software system SPSS version 15 was used. Results The production of "-amylase by T. vulgaris increased significantly during the growth of the organism, with the maximum production after 24 hours (1.03 0.09 U/ml). After 36 hours the activity was reduced rapidly by 72.8% (Fig. 1). Although there was

Fig. 1. Effect of incubation period on growth and "-amylase production by T. vulgaris grown in starch-nitrate medium containing 1.0 % starch.

Extracellular "-amylase from Thermoactinomyces vulgaris

67

Fig. 4. Effect of pH on growth and "-amylase production by T. vulgaris grown in starch-nitrate medium containing 1.0 % starch
( ) denotes the final pH.

Fig. 2. Active-PAGE of "-amylase profile of T. vulgaris grown in starch-nitrate medium containing 1.0 % starch after 24 hours (A), and 72 hours (B).
Arrows indicate the position of the two "-amylase isozymes of approximate size between 135145 kDa.

a significant increase in the production after 72 hours, the "-amylase profile; on active PAGE didnt differ from that at 24 hours (Fig. 2) as they produce two "-amylase isozymes with approximate molecular weight 135145 kDa. The optimum temperatures for the production of "-amylase were in the range 45C to 55C with non significant difference in this range. Below 45C, the organism could grow weakly but no activity could be detected (Fig. 3). Maximum production occurred in the pH range of 6.0 to 7.0 (3.5 U/ml), increasing the pH above 7.0 induced a significant decrease in the yield. At pH 10.0

and below pH 6, the production of the enzyme was completely inhibited (Fig. 4). T. vulgaris was able to grow well using different carbon sources (1% w/v), namely, starch, cellulose, glucose, galactose, xylose, arabinose, lactose and maltose. However, the used carbon sources other than starch induced an extremely significant decrease in the enzyme yield (Table I). Although different carbon sources affected the quantity of the enzyme production, it didnt affect its isozymal pattern as they produced the same two "-amylase isozymes of approximate molecular weight 135145 kDa (data not shown). Tryptone, bactopeptone, yeast extract and NH4Cl caused a highly significant increasing in enzyme production comparing with KNO3 of the basal medium (Table II). The highest production of "-amylase (93.81 0.20 U/ml) was recorded with tryptone and the lowest (1.860.16) was recorded with NaNO3. The different used nitrogen sources (NH4Cl, NH4NO3, NaNO3, KNO3, ammonium acetate, bactopeptone, yeast
Table I Effect of carbon sources on growth and "-amylase production by T. vulgaris grown in starch-nitrate medium containing different carbon sources instead of starch
Carbon sources (1.0%) (w/v) Starch Glucose Galactose Xylose Arabinose Lactose Maltose Cellulose
standard error

Amylase (U/ml) 3.43 0.02 0.04 0.02 0.02 0.01 0.10 0.06 0.07 0.02 0.11 0.02 0.36 0.05 0.05 0.03

Intracellular protein (mg/ml) 1.06 0.04 0.78 0.02 0.86 0.08 0.76 0.02 0.76 0.01 0.63 0.02 0.71 0.04 0.52 0.01

Fig. 3. Effect of temperature on growth and "-amylase production by T. vulgaris grown in starch-nitrate medium containing 1.0% starch.

68

Abou Dobara M.I. et al.

Table III Effect of various EDTA concentrations on "-amylase activity. The enzyme activities are represented relative to the control activity
Concentration of EDTA (mM) 0.001 0.01 0.1 0.5 1 5 10
standard error

Table II Effect of nitrogen sources on growth and "-amylase production by T. vulgaris grown in starch-nitrate medium containing different nitrogen sources instead of KNO3
Nitrogen sources Ammonium acetate Tryptone Yeast extract Bactopeptone NH4Cl NH4NO3 NaNO3 KNO3
standard error

Final PH 6.71 6.75 6.87 6.64 6.46 6.40 6.81 6.73

Amylase (U /ml) 1.06 0.15 1.10 0.12 0.72 0.03 0.93 0.07 0.66 0.06 0.95 0.03 0.80 0.01 0.53 0.02

Intracellular protein (mg/ml) 6.46 0.11 93.81 0.20 45.29 0.08 63.05 0.63 21.56 3.64 6.34 0.17 1.86 0.16 3.54 0.01

Amylase relative activity (%) 99.62 4.46 104.36 1.70 108.85 0.10 53.59 0.52 18.81 5.78 1.12 0.70 0.00 0

extract and tryptone) didnt have any effect on the enzyme electrophoretic profile. The "-amylase profile had the same previous pattern of two "-amylase isozymes at about 135145 kDa (data not shown). Physicochemical properties of "-amylase. The "-amylase activity couldnt be detected at pH 4.0 but it increased significantly with the increase of the pH until it reaches its optimum point at pH 8.0 (Fig. 5). The optimum activity occurred at temperature range between 50C and 60C, with an optimum point of 60C (Fig. 5). The minimum level of the activity (54.4 2.3 U/ml) was occurred at 80C. The enzyme was stable at 50C retaining about 80% of its activity over 6 hours incubation period, but at higher temperature the activity of the enzyme declined (Fig. 6). At 60C and 70C, the enzyme has a half-life of about one hour. However, at 80C it retained more than 20% of its activity up to 4 hours. At 90C the enzyme lost its activity rapidly.

The enzyme was significantly influenced by the different metal salts including NaCl, CoCl2 and CaCl2 (Fig. 7). CoCl2 induced significant inhibition of the enzyme activity. An amount of 1 mM of NaCl and CaCl2 caused extremely significant decrease in enzyme

Fig. 6. Effect of temperature on the stability of "-amylase.

The enzyme activities are represented relative to the maximal value.

Fig. 5. Effect of temperature and pH on "-amylase activity.

The enzyme activities are represented relative to the maximal value.

Fig. 7. Effect of various metal salts concentrations on "-amylase activity.

The enzyme activities are represented relative to the control activity.

Extracellular "-amylase from Thermoactinomyces vulgaris

69

activity by about 80% and 70% respectively. However, increasing of their concentration up to 10 mM of NaCl and CaCl2 resulted in retaining 60.8% and 63.4% of its activity respectively. The enzyme activity was not affected by 0.001, 0.01 and 0.1 mM EDTA but it was totally inactivated by 10 mM EDTA (Table III). On the other hand, 0.5 mM EDTA was found to decrease the activity to 53.6% comparing with the control (96.6 Uml1). Discussion "-Amylases have been isolated from diversified sources including plants, animals, and microbes, where they play a dominant role in carbohydrate metabolism. In spite of the wide distribution of "-amylase, microbial sources are used for the industrial production. This is due to their advantages such as cost effectiveness, consistency, less time and space required for production, and ease of process modification and optimization (Lonsane and Ramesh, 1990). Growth expressed as intracellular protein and "-amylase production by the thermophilic actinomycete Thermoactinomyces vulgaris reached maximum values after 24 hrs, after which, the activity was reduced rapidly by 72.8%. This might be corresponding to the rapid autolysis of Thermoactinomyces species (Lacey, 1971). However, it increased significantly at 60 and 72 hours. After 72 hrs, the production decreased gradually and reached its minimum recorded level at 96 hours. As the isozymal pattern was the same at 24 hrs and 72 hrs, the observed peaking and troughing of the production can be attributed to differential inhibition by products of substrate hydrolysis rather than the isozymes down or over expression. In support, studies on both glucoamylase and "-amylase indicate that inhibition does not occur below a critical concentration of product (Wang et al., 2006). These results indicated that the production of extracellular "-amylase by T. vulgaris was growth associated and this is in agreement with other investigators (Kuo and Hartman, 1966; Shimizu et al., 1978; Murthy et al., 2009; Asoodeh et al., 2010). The influence of temperature on amylase production is related to the growth of the organism. The present results revealed an optimum yield of "-amylase at 45C to 55C. In spite of the relative good growth of the organism at 40C, "-amylase activity couldnt be detected. This referred to the action of protease; that is rapidly inactivated at higher temperature (Behnke et al., 1982), which suppresses the amylolytic activity. The pH change of the growth medium not only affected the growth and "-amylase secretion of T. vulgaris but also influence the enzyme stability in the medium. Therefore, the difference of the final pH of

the medium from pH 10.0 to pH 6.0 could explain the complete inhibition of the enzyme activity at pH 10.0 in contrast to the optimum production at pH 6.0 in spite of the same ability of the organism to grow. The results confirms the inducibility nature of the "-amylase when different carbon sources were used and compared. In support, starch is known to induce amylase production in different bacterial strains (Aiyer, 2004; Ryan et al., 2006; Asoodeh et al., 2010). The "-amylase production is also appeared to be subjected to catabolite repression by maltose and glucose, like most other inducible enzymes that are affected by substrate hydrolytic products (Bhella and Altosaar, 1985; Morkeberg et al., 1995). Other carbon sources have been found to be strongly repressive although they supported good growth. Among nitrogen sources, organic nitrogen sources have been preferred for the production of "-amylase, with ammonium acetate as an exception. It was recorded that organic nitrogen sources supported maximum "-amylase production by various bacteria and fungi due to their high nutritional amino acids and vitamins content (Gupta et al., 2003). The role of amino acids and vitamins in enhancing the "-amylase production in different microorganisms have been reported to be highly variable (Gupta et al., 2003). Tryptone was the best nitrogen source that increased the productivity of "-amylase by 26.5 fold comparing to KNO3. Ammonium chloride induced a significant increase in the enzyme yield that is higher than that of the ammonium acetate. Similar effect of ammonium chloride was obtained for B. subtilis DM-03 (Das et al., 2004). Although the different nitrogen sources had a variable effect on "-amylase activity, they did not produce different isozymal profile. This indicate that they have no effect on the isozymal "-amylase over expression. Most raw starch degrading enzymes had optimum pH in the acidic to neutral range (Pandey et al., 2000; Sun et al., 2010). In the present work, "-amylase from T. vulgaris showed a pH activity profile with a flat top which retaining more than 75% of the enzyme activity in the pH range 5.09.0, despite it was completely inhibited at pH 4.0. This pH profile could be attributed to the limitation of the enzyme catalysis by protonation of the nucleophile at low pH and by deprotonation of the hydrogen donor at high pH values (Nielsen et al., 2001). At reaction temperature of 60C, the enzyme expresses maximum activity whereas it showed less than 50% of its activity at 30C. This reduced activity might be attributed to the reduced molecular flexibility of the thermophilic protein under mesophilic conditions. Although the enzyme showed only 4% of its activity at 80C, it showed more than 20% of its activity at 50C after being kept at 80C for 4 hrs indicating inhibition of the enzyme catalysis

70

Abou Dobara M.I. et al.

1
Literature

at 80C rather than inactivation of the enzyme. In general, "-amylase from T. vulgaris, in the present work, is fairly stable at 50C over 6 hrs and with a half-life of about one hour at both 60C and 70C. It is proposed that "-amylases belong to a new class of metallo-enzymes characterized by a prosthetic group, i.e., an alkaline-earth metal rather than a transition element, and which plays primarily a structural role (Prakash and Jaiswal, 2010). At different concentration of CoCl2, a significant inhibition in the enzyme activity was recorded. The Co2+ effect was explained by Leveque et al., (2000) to be a result of competition between the exogenous cations and the protein-associated cation. In spite of the important role of both calcium and sodium ions to retain the structure and function of "-amylases (Prakash and Jaiswal, 2010), "-amylase in the present study was strongly inhibited by both 1 mM CaCl2 and NaCl. Similar inhibitory effect of CaCl2 was reported to amylase of Aspergillus oryzae EI 212 (Kundu et al., 1973). Calcium independent "-amylase is suitable for the manufacture of fructose syrup, where Ca2+ is an inhibitor of glucose isomerase (Tonkova, 2006). Increasing the concentration of CaCl2 and NaCl was found to retain the enzyme activity, assuming that Cl ion has a stabilizing role. Chloride ions have been found mainly in the active site of mammalian "-amylases, which have been shown to enhance the catalytic efficiency of the enzyme (Prakash and Jaiswal, 2010). In accordance with retaining the enzyme activity at high concentration of CaCl2 and NaCl, the enzyme yield when using ammonium chloride was found to be 3.3 fold of that using other sources of ammonium i.e., NH4NO3 and ammonium acetate. Regarding to the effect of EDTA, the enzyme retained almost 100% activity when 0.1 mM EDTA was added to the reaction mixture. But 0.5 mM EDTA inhibited the enzyme activity retaining only 53% of its activity. The inhibitory effect of EDTA was also documented by many studies (Gupta et al., 2003). Although the molecular weights of microbial "-amylases are usually range between 50 to 60 kDa (Vihinen and Mantsala, 1989), the present result revealed a highly molecular weight of two "-amylase isozymes (135145 kDa). In support, Thermoactinomyces vulgaris R-47 was reported to produce two "-amylases, TVAI and TVAII with molecular weights of 71 kDa and 67.5 kDa respectively (Ohtaki et al., 2003). However, molecular weight of some "-amylases was found to rise owing to carbohydrate moieties (Gupta et al., 2003). In conclusion, the present results indicated a new active highly molecular weight, thermostable and calcium independent "-amylase of T. vulgaris which could be of importance for the starch-processing industries. Further work is in progress to purify the "-amylase of T vulgaris and characterize the purified enzyme.

Aiyer P.V.D. 2004. Effect of C: N ratio on alpha amylase production by Bacillus licheniformis SPT 27. African J. Bacteriol. 3: 519522. Asoodeh A., J. Chamanic and M. Lagzian. 2010. A novel thermostable, acidophilic "-amylase from a new thermophilic Bacillus sp. Ferdowsicous isolated from Ferdows hot mineral spring in Iran: Purification and biochemical characterization Int. J. Biol. Macromol. doi:10.1016/j.ijbiomac.2010.01.013 Behnke U., H. Ruttloff and R. Kleine. 1982. Preparation and characterization of proteases from Thermoactinomyces vulgaris. V. Investigations on autolysis and thermostability of the purified protease. Z. Allg. Mikrobiol. 22: 511519. Bhella R.S. and I. Altosaar. 1985. Purification and some properties of the extracellular "-amylase from Aspergillus awamori. Can. J. Microbiol. 31: 149. Bradford M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72: 248254. Das K., R. Doley and A.K. Mukherjee. 2004. Purification and biochemical characterization of thermostable, alkaliphilic, extracellular "-amylase from B. subtilis DM-03, a strain isolated from the traditional food of India. Biotechnol. Appl. Biochem. 40: 291298. Garcia-Gonzalez M.D., J.F. Martin, T. Vigal and P. Liras. 1991. Characterization, expression in Streptomyces lividans, and processing of the amylase of Streptomyces griseus IMRU 3570: Two different amylases are derived from the same gene by an intracellular processing mechanism. J. Bacteriol. 173: 24512458. Gupta R., G. Paresh, H. Mohapatra, V.K. Goswami and B. Chauhan. 2003 Microbial "-amylases: a biotechnological perspective. Process Biochem. 38: 15991616. Herbert R. A. 1992. Molecular biology and biotechnology of extremophiles. Herbert R.A. and T.J. Sharp (eds). Blackie, Glasgow and London, pp. 143. Ito K., S. Ito, k. Ishino, A. Shimizu-Ibuka and H. Sakai. 2007. Val326 of Thermoactinomyces vulgaris R-47 amylase II modulates the preference for alpha-(1,4)- and alpha-(1,6)-glycosidic linkages. Biochimica et Biophysica Acta 1774: 443449. Kundu A.K., S. Das and T.K. Gupta. 1973. Influence of culture and nutritional conditions on the production of amylase by the submerged culture of Aspergillus oryzae. J. Ferment. Technol. 51:142150. Kuo M.J. and P.A. Hartman. 1966. Isolation of amylolytic strains of Thermoactinomyces vulgaris and production of thermophilic actinomycete amylases. J. Bacteriol. 92:723726. Lacey J. 1971. Thermoactinomyces sacchari sp. nov., a thermophilic actinomycete causing bagassosis. J. Gen. Microbiol. 66: 327338. Lacey J. and T. Cross. 1989. Genus Thermoactinomyces Tsiklinsky 1899, 501AL. pp. 25742585. In: Williams S.T., M.E. Sharpe and J.G. Holt (eds). Bergeys Manual of Systematic Bacteriology, vol. 4. Baltimore, Williams & Wilkins. Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685. Leveque E., S. Janecek, B. Haye and A. Belarbi. 2000. Thermophilic archaeal amylolytic enzymes. Enzyme Microbiol. Technol. 26: 314. Lonsane B.K. and M.V. Ramesh (eds). 1990. Production of bacterial thermostable "-amylase by solid state fermentation: a potential tool for achieving economy in enzyme production and starch hydrolysis. pp. 156. In: Advances in applied microbiology, vol. 35. San Diego: California Academic Press. Morkeberg R., M. Carlsen and J. Neilsen. 1995. Induction and repression of "-amylase production in batch and continuous cultures of Aspergillus oryzae. Microbiology. 141: 24492454. Murthy P.S., M.M. Naidu and P. Srinivas. 2009. Production of "-amylase under solid-state fermentation utilizing coffee waste. J. Chem. Technol. Biotechnol. 84: 12461249.

Extracellular "-amylase from Thermoactinomyces vulgaris

71

Nielsen J., T. Borchert and G. Vriend. 2001. The determinants of "-Amylase pH-activity profiles. Protein Engineering 14: 505512. Ohtaki A., A. Iguchi, M. Mizuno, T. Tonozuka, Y. Sakano and S. Kamitori. 2003. Mutual conversion of substrate specificities of Thermoactinomyces vulgaris R-47 "-amylases TVAI and TVAII by site-directed mutagenesis. Carbohydrate Research 338: 15531558. Palanivelu P. 2001. Analytical Biochemistry and separation Techniques. Kalamani Printers, Madurai, India. Pandey A., P. Nigam, C.R. Soccol, V.Y. Soccol, D. Singh and R. Mohan. 2000. Advances in microbial amylases. Biotechnol. Appl. Biochem. 31: 135152. Prakash O. and N. Jaiswal. 2010. "-amylase: An ideal representative of thermostable enzymes. Appl. Biochem. Biotechnol. DOI 10.1007/s12010-009-8735-4 Ryan S.M., G.F. Fitzerald and D. Sinderen. 2006. Screening and identification of starch-, amylopectin-, and pullulan-degrading activities in Bifidobacterial strains. Appl. and Environmen. Microbiol. 72: 52895296.

Shimizu M., M. Kanno, M. Tamura and M. Suckane. 1978. Purification and some properties of a novel "-amylase produced by a strain of Thermoactinomyces vulgaris. Agric. Biol. Chem. 42: 16811688. Sun H., P. Zhao, X. Ge, Y. Xia, Z. Hao, J. Liu and M. Peng. 2010. Recent advances in microbial raw starch degrading enzymes. Appl. Biochem. Biotechnol. 160: 9881003. Tonkova A. 2006. Microbial starch converting enzymes of the "-Amylase family. In: Ray R.C. and wards O.P. (eds.), pp. 421472, Microbial Biotechnology in Horticulture, Science Publishers, Enfield, New Hampshire, USA. Vihinen M. and P. Mantsala. 1989. Microbial amylolytic enzymes. Crit. Rev. Biochem. Mol. Biol. 24: 329418. Waksman S.A. 1959. Strain specificity and production of antibiotic substances. X. characterization and classification of species within the Streptmyces griseus Group. Proc. Natl. Acad. Sci. USA 45: 10431047. Wang J.P., A.W. Zeng, Z. Liu and X.G. Yuan. 2006. Kinetics of glucoamylase hydrolysis of corn starch. J. Chem. Techn. and Biotechn. 81: 727729.

72

Abou Dobara M.I. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 7378

ORIGINAL PAPER

Halomonas sp. nov., an EPA-Producing Mesophilic Marine Isolate from the Indian Ocean
DIPTI SALUNKHE1, NEHA TIWARI1, SANDEEP WALUJKAR2 and RAMA BHADEKAR1*

of Microbial Biotechnology, Rajiv Gandhi Institute of IT and Biotechnology Bharati Vidyapeeth Deemed University, Katraj, Pune 411 046, Maharashtra, India 2 National Center of Cell Sciences, University of Pune, Ganeshkhind, Pune 411 007, Maharashtra, India Received 18 May 2010, revised 19 January 2011, accepted 20 January 2011
Abstract Marine samples from the Indian Ocean were used to isolate and characterize the organisms with respect to their fatty acid profiles. Six mesophilic isolates (MBRI 6, MBRI 8, MBRI 9, MBRI 10, MBRI 12 and MBRI 13) were obtained from three different water samples. They were i) Gram-negative, ii) catalase positive, iii) produced acid from glucose and maltose, iv) tolerated 5 to 15% NaCl v) except MBRI 9, showed pH tolerance in the range of 5.0 to 9.0 with optimum pH 7.0 to 8.0 v) grew well at 30oC and were able to grow in the range of 15 to 45oC. EPA, an essential omega-3 fatty acid, was produced by these isolates in the range of 12 to 60% at 30oC. MBRI 12 was found to be a potential source as it produced 60% EPA. This isolate was further identified by partial 16S rDNA sequencing and phylogenetic analysis revealed that the strain belonged to Gammaproteobacteria and was closely related to Halomonas bolviensis (96% sequence similarity, 570 bp). Thus a new genus of Halomonas may be included in earlier reported EPA- producing prokaryotic genera affiliated to the Gammaproteobacteria. K e y w o r d s: Gammaproteobacteria, Halomonas bolviensis, Alpha-linoleic acid, nutraceuticals, polyunsaturated fatty acid

1 Department

Introduction Long chain polyunsaturated fatty acids (LC-PUFAs) are essential components of membrane lipids of various organisms (Berge and Barnathan, 2005). They are well documented for their beneficial physiological effects in human health including i) lowering of plasma cholesterol and triglycerols ii) prevention of certain cardiovascular diseases (atherosclerosis and thrombosis) and iii) reducing the risk of breast, colon and pancreatic cancer (Robert et al., 2009). Alpha-linoleic acid (ALA), ecosapenthaenoic acid (EPA) and docosahexaenoic acid (DHA) are the major LC-PUFAs of general nutritional importance, suggested by numerous nutritional bodies (Simopoulos et al., 1999). Although the recommended ratio of dietary omega-6 and omega-3 fatty acids is 5:1 (Sargent, 1997), it has shifted heavily towards omega-6 acids in the current western diet and by some estimate, is up to 30-fold too high (Simopoulos, 1999). The main reason being an increase in the consumption of vegetable oils rich in omega-6 fatty acids. Since omega-6 and omega-3 fatty acids are not interconvertible in the human body, the ratio of linoleic acid

(LA)/ALA in our diet influences the ratio of omega-6/ omega-3 fatty acids LC-PUFAs. To correct this imbalance, the needed omega-3 LC-PUFAs, can be obtained in our diet from external sources such as fish oil. The current commercial sources of EPA and DHA are restricted to fish and algal-derived oils. Problems exist with both of these sources. Commercial fish stocks are likely to decline in the future, since the demand for fish oil in the aquaculture industry alone is estimated to exceed the supply by 2010 due to increase in global population (Meyers and Worm, 2003). Besides the concern for the presence of contaminants, such as mercury and polychlorinated biphenyls, in some fish oils, makes it evident that alternative sources of LC-PUFAS must be found (Jacobs et al., 2004). Algal-derived oils require a relatively high investment in technology compared to bacterial fermentation, although bacteria contain a lower proportion of lipid (Nichols et al., 1996). A key advantage of bacterial PUFA production is that only a single PUFA is produced, rather than the complex mixture yielded from fish or algal oils (Russell and Nichols, 1999). Thus bacterial sources of PUFA remove the expense

* Corresponding author: R. Bhadekar, phone: 020-24365713; fax: 91-20-24379013; e-mail: neeta.bhadekar@gmail.com

74

Salunkhe D. et al.

of preparative purification in the production of highpurity PUFA oils. In addition to their potential use as cell factories bacteria in particular offer the biotechnological opportunity to study the structure and regulation of the genes and enzymes responsible for PUFA production. Numerous bacterial species of marine origin producing PUFAs are particularly prevalent in high-pressure, low temperature and deep-sea habitats (Yano et al., 1997). This is an important adaptation for countering the effects of hydrostatic pressure and low temperature on fluidity or phase of membrane lipid (Allen and Bartlett, 2002). Halophilic organisms are also known to be good sources of different bioactive compounds (Margesin and Schinner, 2001). Recently we have reported halotolerant organisms from different food samples (Jadhav et al., 2010a) as well as from wall scrapings of historical building in India (Jadhav et al., 2010b). They were novel owing to their abilities to fix atmospheric nitrogen and produce industrially important enzymes. Considering the significance of PUFA in human health and limitations in using fish oils, microorganisms prove the best suitable alternative. However use of psychrophilic or piezophilic organisms producing EPA, necessitates the need of low temperature and high pressure facilities (Gentile et al., 2003). Hence use of organisms producing these nutraceuticals at room temperature will be efficient and reasonably priced. The present work was aimed at isolation of marine organisms from the Indian Ocean and characterizing them with respect to their fatty acid profiles. Being mesophilic in nature, high PUFA producing isolates could be conveniently used for pilot scale production and for further scale-up. To our knowledge this is the first report of a high EPA- producing marine isolate from the Indian Ocean. Experimental
Material and Methods

Sampling. Water samples were collected during summer 2008 from different locations in the Indian Ocean (Table I). All chemicals were procured from Himedia and Merck, India. All were of A.R. grade.

Isolation and characterization of microorganisms. 10 ml of each individual sample were inoculated in 100 ml Marine Salt Medium (MSM) (Composition per litre: 81.0 g NaCl, 10.0 g yeast extract, 9.6 g MgSO4, 7.0 g MgCl2, 5.0 g protease peptone no 3, 2.0 g KCl, 1.0 g glucose, 0.36 g CaCl2, 0.06 g NaHCO3 and 0.026 g NaBr with pH adjusted to 7.0 0.2) and incubated at 30C, 120 rpm for 48 hrs. After 48 hrs, 0.1 ml of each sample was spread on MSM agar plates and incubated for another 48 hrs. The isolated colonies were maintained on MSM agar slants. The isolates were characterized morphologically, physiologically and biochemically. Acid production was studied by using different sugars (glucose, fructose, sucrose, lactose, mannitol and maltose). They were also studied qualitatively for their ability to secrete extracellular enzymes (amylase, catalase, urease, protease, and gelatinase) (Collee et al., 1989). MSM broth supplemented with various concentrations of NaCl (ranging from 125%) was used to examine salt-tolerance of the isolates. The cultures were incubated at 30C, 120 rpm for 24 hrs and cell growth was determined by measuring the absorbance at 660 nm. Temperature tolerance was examined by incubating the cultures at temperatures 15C, 30C and 45C for 24 hrs. Further these isolates were screened for pH tolerance in MSM broth adjusted to pH 5.011.0. The media at different pH were inoculated with overnight grown inoculum (107 cells/ml). Cell growth was determined by measuring the absorbance at 660 nm. Preparation of fatty acid methyl esters (FAMES). 10% inoculum of all the isolates was used to inoculate MSM and incubated at 30C in an orbital shaker (Remi, India) at 120 rpm. Cells were harvested after 24 hrs by centrifugation (Plastocraft, India) at 10,000 rpm for 12 mins. Following centrifugation, the supernatant was discarded, the cell pellet resuspended in 1.0% NaCl (w/v), and recentrifuged. Each bacterial culture tube was capped and stored at 4C. Cells were reweighed, to which a fresh solution of the transesterification reaction mix (methanolic HCl (0.6 N) 4 ml) was added in the tubes (Carrapiso and Garcia, 2000). The tubes were capped tightly and the solutions were vortexed for 5 s to 10 s and heated in an 80C 2C water bath for 2 hrs. The tubes were then cooled quickly in ice.

Table I Different sampling locations

Location Latitude Longitude Depth (m) 13 9.5 11 pH 8.02 7.62 7.62 TemperaConducti- D.O. Salinity ture (C) vity (ms) (mg/l) 30.4 31.8 31.8 71.61 27.05 27.05 974.7 412.4 412.4 Isolates

6NT/LT/BOT 184852N 724630E 2NT/LT/BOT 1533.016N 7356.58E 2ST/LT/BOT 1533.016N 7356.58E

3.98 MBRI 9, MBRI 10 and MBRI 12 4.72 MBRI 8 4.72 MBRI 6 and MBRI 13

High EPA producing novel Halomonas sp.

75

The resultant FAMES were extracted twice by adding 2 volumes of hexane and then 1 volume of hexane by centrifugation at 5000 rpm for 15 mins. The upper phase of hexane layer was separated and stored for gas chromatography analysis. Gas chromatography analysis of bacterial extracts. Analyses of the FAMES were performed with a Chemito GC 1000 equipped with a 50 m 0.25 mm internal diameter cross-linked methyl silicone fusedsilica CP SIL 88 capillary column and flame ionization detector. Samples were injected at 100C in the split mode. After 5 mins the oven was temperature-programmed from 100C to 198oC at the rate of 1.5C min1 and hold for 9 mins. Nitrogen was used as a carrier gas, and the injector and detector were maintained at 225 and 250C respectively. Peak areas were quantified using chromatography software (IRIS 32, India). 16S rDNA sequencing. The isolate producing high amount of PUFA was used for identification by 16S rDNA sequencing. The genomic DNA was isolated as described by Ausubel et al. (1987). The PCR assay was performed using Applied Biosystems, model 9800 with 1.5 l of DNA extract in a total volume of 25 l. The PCR master mixture contained 2.5 l of 10X PCR reaction buffer (with 1.5 M MgCl2), 2.5 l of 2 mM dNTPs, 1.25 l of 10 pm/l of each oligonucleotide primers 27f (5CCAGAGTTTGATCGT GGCTCAG3), 1488r(5CGGTTACCTTGTTACGA CTTCACC 3), 0.24 l of Taq DNA polymerase and 15.76 l of glass distilled PCR water. Initially denaturation accomplished at 94C for 3 min. Thirty-five cycles of amplification consisted of denaturation at 94C for 1 min, annealing at 55C for 1 min and extension at 72C for 1 min. A final extension phase at 72C for 10 min was performed. The PCR product was purified by PEG-NaCl method. The sample was mixed with 0.6 times volume PEG-NaCl [20% PEG (MW 6000), 2.5 M NaCl] and incubated for 40 min at 37C. The precipitate was collected by centrifugation at 3,800 rpm for 28 min. The pellet was washed with 70% ethanol, air dried and sequenced using 96 well sequencing plate as per manufacturers instructions. The thermocycling for the sequencing reactions was performed with a 9800 PCR model (Applied Biosystems). It began with an initial denaturation at 94C for 2 min, followed by 35 cycles of PCR consisting of denaturation at 94C for 10 sec, annealing at 50C for 10 sec and extension at 68C for 4 min. The samples were purified using standard protocols described by Applied Biosystems, Foster City, USA. To this, 10 l of Hi-Di formamide was added and vortexed briefly. The DNA was denatured by incubating at 95C for 3 min, kept on ice for 510 min and was sequenced in a 3730 DNA analyzer (Applied Biosystems) following manufacturers instructions.

Nucleotide sequence accession number. The partial 16S rDNA sequence generated in this study was deposited in Gen Bank + EMBL+ DDBJ+ PDB under the accession number GU593323. Sequence was compared with the compilation of 16S rDNA genes available in the Gen Bank + EMBL+ DDBJ+ PDB library by BLASTN 2.2.17 searching. Results and Discussion Isolation and characterization. Total six bacterial isolates were isolated from the three samples of Indian Ocean (Table I). The isolates were grown and maintained on MSM. They were named as MBRI 6, MBRI 8, MBRI 9, MBRI 10, MBRI 12 and MBRI 13. All 6 MBRI isolates were characterized morphologically, biochemically and physiologically. They i) were Gramnegative ii) produced catalase, iii) produced acid from glucose and maltose, iv) tolerated 5 to 15% of salt, v) except MBRI 9, showed pH tolerance in the range of 5.09.0 with optimum pH of 7.08.0, vi) grew well at 30C and v) were able to grow in the range of 15 to 45C. MBRI 6, MBRI 8, MBRI 9 and MBRI 10 produced acid from fructose while MBRI 6, MBRI 8 and MBRI 13 used lactose. Only MBRI 11 was able to utilize sucrose as carbon source. MBRI 10 and MBRI 12 could grow on citrate as carbon source. MBRI 9 tolerated a wide pH range of 6.09.0. Fatty acid profile. All six isolates were analysed for their fatty acids profiles (Table II). The results indicated that total saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids were in the range of 21 to 100%, 11 to 30% and 1 to 62% respectively. Interestingly, MBRI 10 did not show presence of unsaturated fatty acids. Linoleic acid was the only omega-6 fatty acid detected in MBRI 8, MBRI 9 and MBRI 12. It was detected in the range of 1 to 6%, while omega-3 fatty acids were ALA and EPA (0.5 to 16% and 12.0 to 60%, respectively). Arachinoidic acid and docosahexanoic acid were not detected in any of the isolates. Trans-fatty acids were also not detected in these isolates. So far, EPA has mainly been reported to occur in eukaryotes and some peizophilic or psychrophilic microorganisms (Freese et al., 2009). Bacteria are known to alter the composition of their phospholipid fatty acids side-chains in order to maintain appropriate membrane organization and function (Suutari and Laakso, 1994). At low temperatures or high pressures, the content of unsaturated fatty acids often increases with a concomitant decline in saturated fatty acids (Allen et al., 1999). Polyunsaturated fatty acids (PUFAs), such as EPA and DHA, are particularly effective in the adjustment of membrane fluidity due to their low melting points (Hazel, 1995). Hence several EPA producing marine organisms isolated

76

Salunkhe D. et al.
Table II Fatty acid profile of MBRI isolates
Fatty acids C 4:0 C 6:0 C 8:0 C 10:0 C 11:0 C 12:0 C 13:0 C 14:0 C 15:0 C 16:0 C 17:0 C 18:0 Total Saturated Fatty acids C 16:1 C 18:1 C 22:1 C 17:1 Total Unsaturated Fatty Acids C 18:2 n6t C 18:2 n6c C 18:3 n6 C 20:5 n3 Total Polyunsaturated Fatty Acids
N.D. Not detected

MBRI 6 0.2 0.4 2.2 0.5 0.7 0.8 N.D. 18.1 N.D. 25.1 N.D. 7.2 55.3 1.6 6.9 0.6 2.3 11.4 N.D. 4.7 15.9 12.8 33.8

MBRI 8 7.7 2.2 4.5 0.7 0.8 1.0 N.D. 34.3 N.D. 19.7 0.9 11.7 83.5 2.7 0.9 N.D. 11.7 15.3 1.1 N.D. N.D. N.D. 1.1

MBRI 9 11.6 2.7 8.3 3.8 1.2 N.D. 1.4 8.7 N.D. 22.0 0.9 0.8 61.4 25.7 2.7 N.D. 1.1 29.5 5.9 0.8 2.5 N.D. 9.2

MBRI 10 MBRI 12 MBRI 13 21.9 8.4 2.5 5 6.1 N.D. N.D. 14.1 N.D. 42.1 N.D. N.D. 100 N.D. N.D. N.D. N.D. N.D. N.D. N.D. N.D. N.D. N.D. 6.8 2.0 N.D. 1.2 1.4 N.D. N.D. 1.7 N.D. 8.5 N.D. N.D. 21.6 12.1 4.7 N.D. N.D. 16.8 1.5 N.D. 0.7 59.5 61.7 19.3 7.3 2.4 N.D. 1.1 0.8 N.D. 4.1 1.9 8.1 4.8 2.5 52.3 10.7 2.5 N.D. N.D. 13.2 N.D. N.D. N.D. 34.4 34.4

were psychophilic and peizophilic from polar regions and deep sea, as mentioned earlier. However the recent isolation of mesophilic EPA-producing Shewanella species from a temperate estuary (Skerratt et al., 2002) and from shallow seawater samples (Frolova et al., 2005; Freese et al., 2008) suggested that EPA may not be restricted to psychrophiles and piezophiles. Figure 1 shows the comparison of % EPA produced by our isolates with that of microalgae and mesophilic bacterial cultures. Vazhappilly andChen (1998) have reported upto 34.2% EPA in various microalgae at 25C. However recovery of EPA from these sources is difficult along with poor yields. Freese et al. (2009) have documented up to 1.2% EPA in various organisms at 30C (Fig. 1). Different sp. of Shewanella were reported to produce EPA up to 6.5% at 28C (Ivanova et al., 2003; Ivanova et al., 2004; Hirota et al., 2005), probably indicating that temperature sensitive enzymes were involved in biosynthesis. Thus our isolates appear novel owing to their ability to produce high EPA at 30C. Also these studies contradict the notion that only barophilic or cold-adapted species are able to produce significant levels of PUFAs such as EPA. Oleaginous fungi are also known to store large amounts of lipid, mainly triglycerols, and Mortierella

spp. are noteworthy for the n-3 and n-6 PUFA contents of their stored lipid. Typically up to 40% of the fungal dry weight may be triacylglycerol in which the acyl chains are up to 15% EPA or 55% AA (Singh and Ward, 1997). Our results are comparable to these observations besides the advantage of rapid cultivation and easy recovery. Branched chain fatty acids (BCFAs) have repeatedly been reported to promote cold adaptations (Chattopadhyay and Jagannadham, 2001). Our results showing comparatively low levels (1 to 34%) of BCFAs in all the isolates except MBRI 10 support these observations. However in some other bacteria no clear changes in BCFAs with varying growth temperature were observed (Nichols et al., 2002). Phylogeny. MBRI 12, the highest EPA producing isolate was identified using partial 16S rDNA sequencing. The sequence was deposited in EMBL+ Genbank under accession number GU593323. BLAST analysis of partial 16S rDNA sequence revealed that the strain belonged to Gammaproteobacteria and was closely related to Halomonas bolviensis (96% sequence similarity, 570 bp). All so far known EPA-producing prokaryotes affiliate with only a few genera within two bacterial phyla: The Gammaproteobacteria (e.g. genera Shewanella, Moritella, Colwellia, Alteromonas,

High EPA producing novel Halomonas sp.

77

Fig. 1. Comparison of % EPA produced by MBRI isolates (this work) with other mesophilic marine bacteria and microalgae.
1. MBRI 12; 2. MBRI 13; 3. Monodus subterraneus UTEX 151, 4. Chlorella minutissima UTEX 2341, 5. Phaeodactylum tricornutum UTEX 642 (Vazhappilly andChen, 1998); 6. MBRI 6; 7. Shewanella pneumatophori (Hirota et al., 2005); 8. Shewanella waksmanii (Ivanova et al., 2003); 9. Shewanella pacifica (Ivanova et al., 2004); 10. Photobacterium sp. SAMA2, 11. Vibrio sp. NB73, 12. Shewanella sp. NB72 (Freese et al., 2009).

and Photobacterium) and the Bacteroidetes (e.g Flexibacter and Psychroserpens). Therefore, EPA may be a potentially useful marker for these genera in environmental microbial communities (Freese et al., 2009). Our results suggest that a new genus of Halomonas may be added to earlier reported EPA producing prokaryotic genera belonging to Gammaproteobacteria. Conclusions. 1. The occurrence of high levels of EPA in MBRI isolates (present work) with MBRI 12 being highest producer of EPA which could be commercially exploited. 2. This is probably the first report of Halomonas sp. producing EPA at 30C in the presence of high salt-concentration.
Acknowledgements This work is financially supported by the Department of Biotechnology, New Delhi, Government of India. We are thankful to Honorable Dr. Shivajirao Kadam, V.C., Bharati Vidyapeeth Deemed University and Dr. R.M. Kothari, Principal, Rajiv Gandhi Institute of IT and Biotechnology, (BVDU) for providing facilities to undertake this work. We are also thankful to Dr. D.P. Nerkar and Ms. V. V. Jadhav for their assistance.

Literature
Allen E.E. and D.H. Bartlett. 2002. Structure and regulation of the omega-3 polyunsaturated fatty acid synthase genes from the deep-sea bacterium Photobacterium profundum strain SS9. Microbiology 148: 19031913.

Allen E.E. and D.H. Bartlett. 1999. Monounsaturated but not polyunsaturated fatty acids are required for growth of the deep-sea bacterium Photobacterium profundum SS9 at high pressure and low temperature. Appl. Environ. Microbiol. 65: 17101720. Ausubel F.M., R. Rrent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl. 1987. Current Protocols in Molecular Biology. Wiley, New York. Berge J.P. and G. Barnathan. 2005. Fatty acids from lipids of marine organisms: molecular biodiversity, role as biomarkers, biologically active compounds and economical aspects. Adv. Biochem. Eng. Biotechnol. 96: 49125. Carrapiso A.I., and C. Garcia. 2000. Development in lipid analysis: some new extraction techniques and in situ transesterification. Lipids 5(11): 116777. Chattopadhyay M.K. and M.V. Jagannadham. 2001. Maintenance of membrane fluidity I Antarctic bacteria. Polar. Biol. 24: 386388. Collee J.G., J.P. Duguid, A.G. Fraser and B.P. Marmion. 1989. Practical Medical Microbiology. Churchill Livingstone, Medical Division of Longman Group UK Ltd., New York. Freese E., J. Koster and J. Rullkoter. 2008. Origin and composition of organic matter in tidal flat sediments from the German Wadden Sea. Org. Geochem. 39: 820829. Freese E., H. Rutters, J. Koster, J. Rullkoter and H. Sass. 2009. Gammaproteobacteria as a possible source of ecosapentanoic acid in anoxic intertidal sediments. Aqu. Microbiol. 57: 444454 Frolova G.M., K.G. Pavel, A.A. Shparteeva, O.I. Nedashkovskaya, N.m. Gorhkova, E.P. Ivanova, and V.V. Mikhail. 2005. Lipid composition of novel Shewanella species isolated from far eastern seas. Microbiology 74: 664669. Gentile G., V. Bonasera, C. Amico, L. Giuliano and M.M. Yakimov. 2003. Shewanella sp. GA-22, a psychrophilic hydrocarbonoclastic antarctic bacterium producing polyunsaturated fatty acids. J. Appl. Microbiol. 95: 11241133 Hazel J.R. 1995. Thermal adaptation in biological membranes: is homeoviscous adaptation the explanation? Annu. Rev. Physiol. 57: 1942 Hirota K.Y. Nodasaka, Y. Orikasa, H. Okuyama and I. Yumoto. 2005. Shewanella pneumatophori sp. nov., an eicosapentaenoic acid producing marine bacterium isolated from the intestines of Pacific mackerel (Pneumatophorus japonicus). Int. J. Syst. Evol. Microbiol. 55: 23552359 Ivanova E.P., N.M. Gorshkova, J.P. Bowman, A.M. Lysenko, N.V. Zhukova, A.F. Sergeev, V.V. Mikhailov and D.V.N. 2004. Shewanella pacifica sp. nov., a polyunsaturated fatty acid-producing bacterium isolated from sea water. Int. J. Syst. Evol. Microbiol. 54: 10831087. Ivanova E.P., O.I. Nedashkovskaya, N.V. Zhukova, D.V. Nicolau, R. Christen and V.V. Mikhailov. 2003. Shewanella waksmanii sp. nov., isolated from a sipuncula (Phascolosoma japonicum) Int. J. Syst. Evol. Microbiol. 53: 14711477. Jacobs M.N., A. Covaci, A. Gheorghe and P. Schepens. 2004. Time trend investigation of PCBs, OCPs, and PBDEs in n-3 polyunsaturated fatty acid-rich dietary fish oil & vegetable oil supplement; Nutritional relevance for human essential n-3 fatty acid requirement. J. Agri. Food. Chem. 52: 17801788. Jadhav G.G., D.S. Salunkhe, D.P. Nerkar and R.K. Bhadekar. 2010a. Isolation and characterization of salt-tolerant nitrogenfixing microorganisms from food. Eur. J. Biosci. 4: 3340 Jadhav G.G., D.S. Salunkhe, D.P. Nerkar and R.K. Bhadekar. 2010b. Novel Staphylococcus sp. isolated from wall scrapings of a historical building in India. Ann. Microbiol. 60: 197201.

78

Salunkhe D. et al.

Margesin R. and F. Schinner. 2001. Potential of halotolerant and halophilic microorganisms for biotechnology. Extremophiles 5(2): 7383 Meyers R.A. and B. Worm. 2003. Rapid worldwide depletion of predatory fish communities. Nature 432: 280283. Nichols D.S., P. Hart, P.D. Nichols and T.A. McMeekin. 1996. Enrichment of the rotifer Brachinous plicatilis fed an Antarctic bacterium containing polyunsaturated fatty acid. Aquaculture 147: 115125. Nichols D.S., K.A. Presser, J. Olley, T. Ross and T.A. McMeeekin. 2002. Variation of branched-chain fatty acids marks the normal physiological range for growth in Listeria monocytogenes. Appl. Environ. Microbiol. 68: 28092813 Robert S.S., J. R. Petrie, X. Zhou, M. P. Mansour, S.I. Blackburn, A.G. Green, S.P. Singh and P.D. Nichols. 2009. Isolation and characterization of a )5-fatty acids elongase from the marine microalgae Pavlova salina. Mar. Biotechnol. 11: 410418. Russell N.J., and D.S. Nichols. 1999. Polyunsaturated fatty acids in marine bacteria a dogma rewritten. Microbiology 145: 767779. Sargent J.R. 1997. Fish oils and human diet. Br. J. Nutr. 78: Suppl. 1, 513.

Simopoulos A.P., A. Leaf and N., Jr Salem. 1999. Workshop on the essentiality of and recommended dietary intakes for omega-6 and omega-3 fatty acids. Food. Aust. 51: 332333. Simopoulos A.P. 1999. Essential fatty acids in health and chronic disease. Am. J. Clin. Nutr. 70(3): 560S569S. Singh A. and O.P. Ward. 1997. Microbial production of docosahexaenoic acid (DHA, 22:6) Adv. Appl. Microbiol. 45: 271312. Skerratt J.H., J.P. Bowman and P.D. Nicholas. 2002. Shewanella olleyana sp. nov., a marine species isolated from a temperate estuary which produces high levels of polyunsaturated fatty acids. Int. J. Syst. Evol. Microbiol. 52: 21012106. Suutari M. and S. Laakso. 1994. Microbial fatty-acids and thermal adaptation. Crit. Rev. Microbiol. 20: 285328 Vazhappilly R andF. Chen. 1998. Eicosapentaenoic acid and docosahexaenoic acid production potential of microalgae and their heterotrophic growth. J. Am. Oil Chem. Soc. 75(3): 393397 Yano Y., A. Nakayama and K. Yoshida. 1997. Distribution of polyunsaturated fatty acids in bacteria present in intestines of deepsea fish and shallow-sea poikilothermic animals. Appl. Environ. Microbiol. 63: 25722577.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 7983

SHORT COMMUNICATION

Yersinia Species in the Dunnock (Prunella modularis) in Sub-alpine Habitats of the Western Carpathians
JANA KISKOV* , ZUZANA HREHOV, MARIN JANIGA, MARTIN LUK, MARTINA HAAS and MARTINA JUROVIOV

Institute of High Mountain Biology, University of ilina, Tatransk Javorina, Slovakia Received 29 August 2010, revised 5 December 2010, accepted 15 December 2010
Abstract The study presents the prevalence of Yersinia species in dunnok Prunella modularis from the sub-alpine zone of the Western Carpathians. Bacteria were detected from cloacal and pharyngeal swabs from 97 specimens using PCR assay. Yersinia enterocolitica showed the highest prevalence (47.4%) from among the determined Yersinia species. Yersinia species (except Y. frederiksenii) were detected more frequently in pharyngeal than cloacal samples. The highest prevalence of yersiniosis was detected in April (Yersinia spp. 80%, Y. enterocolitica 70%). No statistically differences were observed in the prevalence of Yersinia spp. between males and females and between juveniles and adult birds. Bacterial contamination did not affect body weight or tarsus length. K e y w o r d s: Yersinia spp. Yersinia enterocolitica, Dunnock Prunella modularis

The genus Yersinia is a highly heterogeneous group of the family Enterobacteriaceae comprising acknowledged pathogens and a variety of strains that are widely distributed in nature in both aquatic and terrestrial ecosystems (Cover and Aber, 1989). Many species such as Yersinia enterocolitica are psychrophilic bacteria capable of persisting and growing in cold environments (Kato et al., 1985; Gill and Reichel, 1989). The wild-living birds, due to their great mobility, may play a significant role as effective spreaders of Yersinia through faecal contamination of pastures and surface waters (Kaneuchi et al., 1989; Niskanen et al., 2003). There are only a few studies on bacteria living in wild birds in the extreme environments of the subalpine and alpine vegetation levels. Janiga et al. (2007) identified the composition of microflora in the digestive tract of the alpine accentor (Prunella collaris) as a typical species of alpine environments. Novotn et al. (2007) specifically discussed the ecology of Yersinia spp. in relation to alpine accentors considering that the genus Yersinia may play an important role in the ecology of this bird species. The objective of this study was to continue research of yersiniosis in lower sub-alpine habitats in the West

Carpathians. The dunnock (Prunella modularis) is a dominate bird species of the dwarf-pine ecosystem (9501 700 m a.s.l) and as the alpine accentor is the member of the family Prunellidae, therefore it was chosen as experimental host species for this microbiological study. From April 2007 to July 2009, 97 free-living dunnocks were captured with mist nets in the local mountains of the Slovakian part of the Western Carpathians The West, High, Low and Belianske Tatras, Great and Small Fatra, Babia hora, and Cho (from 1 000 to 1 750 m a.s.l). Captured birds were identified as adults or juveniles (age 2 months). Adult birds were sexed by the presence of a cloacal protuberance in males (Nakamura, 1990). They were weighed with 0.2 g accuracy using a Pesola spring scale and standard morphometric measurements were taken. Two types of samples were collected from each bird pharyngeal and cloacal swabs. Samples were taken using sterile transport swabs suitable for both aerobes and anaerobes (DispoLab, Copan Italia, Brescia, Italy). Isolated bacterial cultures from cloacal and pharyngeal swabs were enriched in Tryptone-soya broth at 2628C for 48 hours (Nikolova et al., 2001). Enriched

* Corresponding author: J. Kiskov, Institute of High Mountain Biology, Tatransk Javorina 7, 059 56, Slovakia; phone: (+421) 51-449-91-08; e-mail: jakiskova@gmail.com

80

Kiskov J. et al.

cultures were plated on CIN agar presented as highly selective medium for Yersinia spp. (Schiemann, 1979) and cultivated at 2628C for 48 hours (Neubauer et al., 2000; Hussein et al., 2001). Bacterial DNA was extracted and then Yersinia species were identified among isolated bacterial cultures using the PCR method developed by Neubauer et al. (2000). The authors designed primers Y1 and Y2 for amplification of the specific region of the 16S rRNA gene of the genus Yersinia. Primers A1 and A2 were used to amplify a 430 bp fragment of the ail gene, found exclusively in pathogenic Yersinia spp. strains (Wannet et al., 2001). For the identification of Yersinia spp. a reference strain (CCM 5671) of Y. enterocolitica subsp. enterocolitica, serovar 0:3, biovar 4 was obtained from the Czech collection of microorganisms, Masaryk University, Brno. The PCR products were independently sequenced in both directions on the Genome Lab GeXP Single genetic analyzer (Beckman Coulter Inc.) The obtained sequences were subjected to BLAST searches in sequence database GenBank for species identification. Y. pseudotuberculosis was also independently examined in all samples. The AmpliSens Yersinia pseudotuberculosis kit (Russia) was used for the identification. A P2 statistics (STATISTICA 8.0) was used to test the hypothesis of independence of frequencies of selected factors (prevalence, sex, age and season) which may influence the occurrence of bacteria. Morphometric data were compared by one-way ANOVA.

From 97 examined birds, a total of 47.4% individuals were Yersinia positive (28.9% of pharyngeal and 27.8% of cloacal samples). Seven Yersinia species were detected by comparison of PCR-products to the nucleotide sequences in BLAST (GenBank, Table I). Y. enterocolitica showed the highest total incidence (34.0%) of the genus Yersinia, therefore it is considered in this study as separate species. The higher prevalence of Y. enterocolitica tended to be in cloacal (20.6%) than in pharyngeal (16.5%) samples. Also other Yersinia species (except Y. fredericksenii) were detected more frequently in pharyngeal than cloacal swabs. The differences were not statistically significant. A seasonal variation in the distribution of Yersinia spp. was observed. The highest prevalence of Yersinia species was detected in April (80%). Even, the contamination of Y. enterocolitica reached a statistically significant value compared to other months (P 0.05), in which the prevalence of bacteria decreased significantly (Table II). Comparison of the total prevalence of Yersinia spp. between males and females did not show significant differences but in females was nearly 10% higher than in males. A much lower frequency of infection in juveniles than in adult individuals was found but the difference didnt reach the statistical significance value (P 0.05, Table II). Table III shows the potential relation between the occurrence of Yersinia spp., resp. Y. enterocolitica and morphological features of the adult birds. Measurements of body weight and tarsus length were

Table I Species and prevalence of pharyngeal and cloacal bacteria in Dunnocks in the Western Carpathians, Slovakia
Strain according GenBank Prevalence (n = 97) Total N (%) 46 (47.4) 33 (34.0) Pharynx N (%) 28 (28.9) 20 (20.6) Cloaca N (%) 27 (27.8) 16 (16.5)

Bacteria species Yersinia spp. Y. enterocolitica

Y. kristensenii Y. molareti Y. intermedia Y. aleksici Y. bercovieri Y. frederiksenii

8081 FE 80735 KM 1 PO/Y/1-3 ARCTIC-P11 ATCC 33638 N1SF35 Y 160 H279-36/86 H9-36/83 253 991 Y 388 H632-36/85 WS 52/02

10 (10.3) 2 (2.1) 2 (2.1) 2 (2.1) 2 (2.1) 2 (2.1)

10 (10.3) 2 (2.1) 2 (2.1) 2 (2.1) 2 (2.1) 0 (0)

6 (6.2) 1 (1) 0 (0) 0 (0) 1 (1.0) 2 (2.1)

n number of examined birds N number of Yersinia positive samples with relative value in the brackets

Short communication
Table II The prevalence of bacterial genera (species) in dunnocks according to the season years, the host sex and age
Variable (n) Y. enterocolitica April (10) May (32) June (25) July (30) April (10) May (32) June (25) July (30) Females (45) Males (35) Females (45) Males (35) Adults (80) Juveniles (17) Adults (80) Juveniles (17) Yersinia positive Yersinia negative N (%) N (%) 7 (70) 13 (40.6) 6 (24) 7 (23.3) 8 (80) 15 (46.9) 10 (40) 13 (43.3) 17 (37.8) 13 (37.1) 25 (55.6) 16 (45.7) 30 (37.5) 3 (17.7) 41 (51.3) 39 (48.8) 3 (30) 19 (59.4) 19 (76) 23 (76.7) 2 (20) 17 (53.1) 15 (60) 17 (56.7) 28 (62.2) 22 (62.9) 20 (44.4) 19 (54.3) 50 (62.5) 14 (82.4) 5 (29.4) 12 (70.6) P

81

0.03

Yersinia spp.

NS

Y. enterocolitica Yersinia spp. Y. enterocolitica Yersinia spp.

NS NS NS NS

n number of examined birds N number of Yersinia positive (+) or negative () samples with relative value in the brackets NS not significant P > 0.05 (Chi-square test)

Table III Morphological characters of adult dunnocks examined for yersiniosis

Bacteria Y. enterocolitica Morphological variables Body weight (g) Tarsus length (mm) Yersinia spp. Body weight (g) Tarsus length (mm) Yersinia Number of adult individuals +/ + + + + 25 46 29 48 34 37 39 38 Mean SE 19.7 0.8 19.1 0.6 24.9 0.2 24.8 0.1 19.6 0.7 19.1 0.6 24.8 0.2 24.9 0.2 P NS NS NS NS

NS not significant, P > 0.05 (one way ANOVA test)

considered. No significant relationships were found between the Yersinia spp., resp. Y. enterocolitica infection and tarsus length or body weight of hosts. When the dunnock sex and infestation by yersiniosis were considered as independent variables, no statistically significant difference was found in prevalence of Yersinia between males and females (Table II). Therefore, both sexes were pooled together and tested against Yersinia as one group. Y. pseudotuberculosis was not detected in any of pharyngeal and cloacal swabs. The presence of the ail gene associated with the pathogenic strains of Yersinia was not confirmed in any of the examined samples. Recently, PCR method is widely used to identify specimens and studying the relationship of bacteria.

However, the target sequences of both primers Y1 and Y2 using in this study are presented in more members of the genus Yersinia; it was possible to determinate more Yersinia species by using only one PCR array (Neubauer et al., 2000). In this study, a lower occurrence of yersiniosis was found in subalpine habitats compared to the alpine zone in previous study (Novotn et al., 2007). The authors showed that in alpine accentors there is an unusually high prevalence of yersiniosis in comparison to many other bird species. The authors attribute this to high adaptability of Yersinia species to cold environment. For example, Gill and Reichel (1989) referred to the ability of Y. enterocolitica to grow at 2C. This might be the reason for its successful

82

Kiskov J. et al.

expansion in high mountain environments and for its higher prevalence in alpine accentors than in dunnocks. In this study we have confirmed that Y. enterocolitica is the most common yersinia in dunnocks in comparison with other Yersinia species. Similar findings were reported in other species of birds (Niskanen et al., 2003; Novotn et al., 2007). Also other species of Yersinia (no pathogenic environmental species e.g. Y. intermedia, Y. frederiksenii or Y. kristenseni ect.) were frequently found in other species of birds (Niskanen et al., 2003; Janiga et al., 2007). As our results show that distribution of yersiniosis in dunnock is seasonally dependent. Prevalence of avian bacterial infections is known to have seasonal dynamics where social and other behaviours have been hypothesized to be a factor shaping these dynamics (Faustino et al., 2004). The high occurrence of Y. enterocolitica in cold months was confirmed in many studies. For example, Kato et al. (1985) reported significantly higher incidence of Y. enterocolitica in birds in the spring than in the summer or autumn months. The highest prevalence of all Yersinia species in the dunnock was detected in April. In this month, the dunnock breeding season begins and birds begin to mate. Avian copulation involves cloacal contact, which has been documented to host rich bacterial communities (Lombardo, 1998; Lucas and Heeb, 2005). So, the risks of bacterial transmission during copulations in birds are expected to be high. Dunnocks have a variable mating system from monogamy through polyandry to polygynandry (Davies, 1985) and copulation with multiple partners further increases the risk of avian infection. It seems bird diet may also influence the occurrence of bacterial infection. The dunnock is an insectivorous species and in April, when the occurrence of insects increases in the mountains, the risk of infection is higher. In the next months (outside the mating period) the prevalence of bacterial infection declines gradually. In July, when the juveniles have left the nests, the bacterial infection may be slightly increased again. This phenomenon is probably associated with reduced body condition of birds. The birds are exhausted after breeding and subsequent moulting may also have a significant impact on the physiological status of the individuals. Colonisation of nestlings by environmental microbes begins soon after hatching. Mills et al. (1999) detected cloacal microorganisms in nestlings of the tree swallow (Tachycineta bicolour) two days after hatching. The inoculation of nestlings by microbes may occur from the environment via ingestion of adult saliva, from food provided by the parents or from nest materials (Mills et al., 1999; Berger et al., 2003). In our study, we detected about 20% fewer contamination of Yersinia in juveniles than in adult birds. The low infection of juveniles during whole research period

indicates that infection of juveniles by Yersinia occurs later. We therefore suggest that young birds are infected by bacteria mainly during the breeding season in the following year. To conclude, we confirmed that the prevalence of bacterial infections in dunnocks shows seasonal dynamics. In early spring, the high occurrence of Yersinia contamination may be associated with changes in diet, but is most likely a consequence of the increased risk of contamination during mating. We observed that the sex of birds did not influence the distribution of Yersinia spp. in the dunnock and that bacterial occurrence in birds increases with nestling age and stabilizes in adults. We didnt found relationship between morphological parameters (tarsus length and body weight) and Yersinia infestation, therefore we assume that bacteria do not affect health and body condition of individuals. Our findings support the idea that the Yersinia species are surely a common member of bacterial microflora in dunnocks. Literature
Berger S., R. Disko and H. Gwinner. 2003. Bacteria in starling nests. J. Ornithol. 144: 317322. Cover T.L. and R.C. Aber. 1989. Yersinia enterocolitica. New Engl. J. Med. 321: 1624. Davies N.B. 1985. Cooperation and conflict among dunnocks, Prunella modularis, in variable mating system. Anim. Behav. 33: 628648 Faustino C.R., C.S. Jennelle, V. Connolly, A.K. Davis, E.C. Swarthout, A.A. Dhondt and E.G. Cooch. 2004. Mycoplasma gallisepticum infection dynamics in a house finch population: seasonal variation in survival, encounter and transmission rate. J. Anim. Ecol. 73: 651669. Gill C.O. and M.P. Reichel. 1989. Growth of the cold-tolerant pathogens Yersinia enterocolitica, Aeromonas hydrophila and Listeria monocytogenes on high-pH beef packaged under vacuum or carbon dioxide. Food Microbiol. 6: 223230. Hussein H.M., S.G. Fenwick and J.S. Lumsden. 2001. A rapid and sensitive method for the detection of Yersinia enterocolitica strains from clinical samples. Lett. Appl. Microbiol. 33: 445449. Janiga M., A. Sedlrov, R. Rigg and M. Novotn. 2007. Patterns of prevalence among bacterial communities of Alpine Accentors (Prunella collaris) in the Tatra Mountains. J. Ornithol. 148: 135143. Kaneuchi Ch., M. Shibata, T. Kawasaki, T. Kariu, M. Kanzaki and T. Maruyama. 1989. Occurrence of Yersinia spp. in migratory birds, ducks, seagulls and swallows in Japan. Jpn. J. Vet. Res. 51: 805808. Kato Y., K. Ito, Y. Kubokura, T. Maruyama, K. I. Kaneko and M. Ogawa. 1985. Occurrence of Yersinia enterocolitica in wild-living birds and Japanese Serows. Appl. Env. Microbiol. 49: 198200. Lombardo M.P. 1998. On the evolution of sexually transmitted diseases in birds. J. Avian Biol. 29: 314321. Lucas F.S. and P. Heeb. 2005. Environmental factors shape cloacal bacterial communities in great and blue tit nestlings. J. Avian Biol. 36: 510516. Mills T.K., M.P. Lombardo and P.A. Thorpe. 1999. Microbial colonization of the cloacae of nestling tree swallows. Auk 116: 947956.

Short communication

83

Nakamura M. 1990. Cloacal protuberance and copulation behavior of the Alpine Accentor (Prunella collaris). Auk 107: 284295. Neubauer H., A. Hensel, S. Aleksic and H. Meyer. 2000. Identification of Yersinia enterocolitica within the genus Yersinia. Sys. Appl. Microbiol. 23: 15 Nikolova S., Y. Tzvetkov, H. Najdenski and A. Vesselinova. 2001. Isolation of pathogenic Yersiniae from wild animals in Bulgaria. J. Vet. Med. 48: 203209. Niskanen T., J. Waldenstrm, A.M. Fredriksson, B. Olsen and H. Korkeala. 2003. virF-Positive Yersinia pseudotuberculosis

and Yersinia enterocolitica found in migratory birds in Sweden. Appl. Env. Microbiol. 69: 46704675. Novotn M., M. Fekov, M. Janiga, M. Luk, M. Novotn and Z. Kovalkov. 2007. High incidence of Yersinia enterocolitica (Enterobacteriaceae) in Alpine Accentors Prunella collaris of the Tatra Mountains. Acta Ornithol. 42: 137143 Schiemann D.A. 1979. Synthesis of a selective agar medium for Yersinia enterocolitica. J. Microbiol. 25:1298. Wannet W.J.B., M. Reessink, H.A. Brunings and H.M.E. Maas. 2001. Detection of pathogenic Yersinia enterocolitica by rapid and sensitive duplex PCR Assay. J. Clin. Microbiol. 39: 44834486.

84

Kiskov J. et al.

Polish Journal of Microbiology 2011, Vol. 60, No 1, 8587

SHORT COMMUNICATION

First Report of Serratia plymuthica Causing Onion Bulb Rot in Poland

BEATA KOWALSKA*, URSZULA SMOLISKA and MICHA OSKIERA

Institute of Horticulture, Skierniewice, Poland Received 6 January 2010, revised 18 December 2010, accepted 20 December 2010
Abstract Specific bacterial disease symptoms were observed on onion bulbs in almost all regions in Poland. For the purpose of identification of agents causing disease, bacteria were isolated from the symptomatic plants. Their pathogenicity was confirmed by using pathogenicity test on onion scales. These bacteria were identified biochemically and molecularly as Serratia plymuthica. K e y w o r d s: Serratia plymuthica, bacterial disease, onion

Onion (Allium cepa L.) is one of the major vegetable crops grown in Poland. Since the onion harvesting period often coincides with rainy weather and during cultivation it may hail, complex bacterial and fungal diseases often occur. In the last years especially bacterial diseases of onion cause very serious problems in Poland. These diseases may cause significant economic losses because they are difficult to control. Bacterial soft of onion bulbs is the most frequent and it can appear during cultivation, storage or transportation. It is common knowledge that in Poland, bacterial diseases of onion are caused by Burkholderia gladioli, Burkholderia cepacia, Pectobacterium carotovorum subsp. carotovorum (Sobiczewski and Schollenberger, 2002). Foreign reports conclude that bacteriosis of onion can also be caused by Pseudomonas marginalis (Kim et al., 2002; El-Hendawy, 2004), Pseudomonas syringae, Pseudomonas viridiflava (Gitaitis et al., 1998), Pantoea ananatis (Gitaitis et al., 2002), Enterobacter cloacae (Schroeder et al., 2009; Schwartz and Mohan, 2008), Burkholderia ambifaria and Burkholderia pyrrocinia (Jacobs et al., 2008). Also bacterium Serratia spp. was noted as an onion pathogen in Brasil (Beriam, 2007). The liberalization of policies concerning border protection and intense trade favor transmission of pathogens from foreign countries. During the summer and autumn of 2003, 2006 and 2007, disease symptoms of unknown origin were

observed on onion (Allium cepa L.) bulbs in the field and storage houses in different places in Poland. These symptoms were typical for bacterial disease water soaked and pale brown lesions appeared on the internal scales, they enlarged and extended to external scales with an associated sour smell. Bacteria from the infected bulb tissues were isolated and purified on nutrient agar. About forty isolates were obtained and these isolates were examined for the ability to macerate onion tissue. The pathogenicity test was conducted on healthy onion bulbs cv. Grabowska. The bulbs were peeled, washed with running water and sterilized in 70% ethanol for 30 sec and in 0.5% NaOCl for 5 min. The bulbs were washed in sterile water and cut lengthwise into two parts. Three onion pieces were placed, cut side down, into a Petri dish (180 mm in diameter). The outer scale of each piece was wounded with the microbiological needle and inoculated by 20-l aliquot of bacterial suspension of density 1.02.5 108 cfu/ml. For each isolate three Petri dishes were included. Control treatment remained uninoculated. The Petri dishes were incubated 4 days at 28C. Nine of forty isolates expressed rot symptoms on the scales. These isolates were studied by using biochemical and molecular methods. Biochemical identification of the isolates were performed by using the API 20E system (bioMerieux) which gave a bacterial code of 1207763 (Table I)

* Corresponding author: B. Kowalska, Institute of Horticulture, Konstytucji 3 Maja 1/3; 96-100 Skierniewice, Poland; e-mail: beatakow@iwarz.pl

86

Kowalska B. et al.
Table I Biochemical profile of tested isolates conducted using identification system API 20E
ONPG MAN AMY ADH ODC RHA ARA MEL TDA GLU URE LDC SOR SAC GEL IND INO CIT H2S OX

VP

+ +

test ONPG ADH LDC ODC CIT H2S URE TDA IND VP GEL GLU MAN INO SOR RHA SAC MEL AMY ARA OX

reactions / enzymes $-galactosidase arginine dihydrolase lysine decarboxylase ornithine decarboxylase citrate utilization H2S production urease tryptophane deaminase indole production acetoin production gelatinase fermentation / oxidation (glucose) fermentation / oxidation (mannitol) fermentation / oxidation (inositol) fermentation / oxidation (sorbitol) fermentation / oxidation (rhamnose) fermentation / oxidation (saccharose) fermentation / oxidation (melibiose) fermentation / oxidation (amygdalin) fermentation / oxidation (arabinose) cytochrome oxidase

(% identity = 59.6; T = 1.0). The numerical profile showed a correct identification of all examined strains as Serratia plymuthica. Additionally, some biochemiAJ233433.1

cal tests were conducted. The microorganisms were Gram-negative, catalase positive, oxidase negative and grew in anaerobic condition.

CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGG--CAGTG ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 420

HM596429.1 361 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTTCAGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| AY394724.1 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTAGTGTG

AJ233433.1

TTAATAGCACAT-TGCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG |||||||||| | | | ||||||||||||||||||||||||||||||||||||||||||| 479

HM596429.1 421 TTAATAGCAC-TGTRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| AY394724.1 TTAATAGCACAT-TRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG

AJ233433.1

AGAA-TT-CGCTAGAGATAGCTTAGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC |||| || | | |||||| | || |||||||||||||||||||||||||||||||||||| 1017

HM596429.1 960 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AY394724.1 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC

Fig. 1. Homology sequence alignment of the 16S rRNA region of type strain S. plymuthica DSM 4540 acc. no. AJ233433.1, tested isolate 466 acc. no HM596429.1, strain of the nearest BLAST match S. plymuthica RVH1 acc. no AY394724.1. Sequences were retrieved from the GenBank (National Center for Biotechnology Information) database under the accession numbers indicated.

Short communication
Table II BLAST search results for 16S rRNA gene sequence of representative isolate 466
S. plymuthica isolate DSM 4540 type strain 466 tested isolate RVH1 Accession no AJ233433.1 HM596429.1 AY394724.1 Country Germany Poland Belgium Identity 98.9% 100% 99.7% Match 1449/1465 1460/1460 1456/1461

87

The identity of the isolates was confirmed by molecular techniques 16S rRNA sequence analysis. DNA was isolated by Genomic mini kit according to producents clues (A & A Biotechnology). The 16S rDNAs were amplified by using universal primers fD1 (5AGAGTTTGATCMTGGCTC3) and rP2 (5ACGGCTACCTTGTTACGACTT3) (Weisburg et al., 1991). Additional sequensing primers were used: 800f (5ATTAGATACCCTGGTAG3) and 800r (5CTACCAGGGTATCTAAT3) (Fouad et al., 2002). The amplified PCR products, lenght 1500 bp, were separated by 1.5% agarose gel electrophoresis, then extracted and purified from gel with the DNA Fragment Purification Kit (A & A Biotechnology). DNA sequences were compared to NCBI database (www. ncbi.nlm.nih.gov) using BLAST program (Basic Local Alignment Search Tool), demonstrated that 16S rRNA gene of the studied isolates of bacteria shared high identities (99.7%) with Serratia plymuthica RVH1, NCBI GenBank database accession no. AY394724.1 (Fig. 1, Table II). The 16S rRNA sequence of the one representative isolate (466) has been deposited in the GenBank database under the accession number HM596429.1. The biochemical test data along with sequence analysis of a portion of the 16S rRNA gene confirmed all the isolates to be Serratia plymuthica. According to our knowledge, this is the first report of S. plymuthica causing a bulb rot of onion in Poland.
Acknowledgments This work was supported by grant NN 310299734

Literature
Beriam L.O. S. 2007. Palestra doencas bacterianas em hortalicas. Biologico 69: 8184. El-Hendawy H.H. 2004. Association of pectolytic fluorescent pseudomonads with postharvest rots of onion. Phytopathol. Mediterr. 43: 369376. Fouad A.F., J. Barry, M. Caimano, M. Clawson, Q. Zhu, Carver R., K. Hazlett and J.D. Radolf. 2002. PCR-based identification of bacteria associated with endodontic infections. J. Clin. Microbiol. 40: 32233231. Gitaitis R., G. MacDonald, R. Torrance, R. Hartley, D.R. Sumner, J.D. Gay and W.C. Jahnson. 1998. Bacterial streak and bulb rot of sweet onion: II. Epiphytic survival of Pseudomonas viridiflava in association with multiple weed hosts. Plant Dis. 82: 935938. Gitaitis R., R. Walcott, S. Culpepper, H. Sanders, L. Zolobowska and D. Langston. 2002. Recovery of Pantoea ananatis, casual agent of center rot of onion, from weeds and crops in Georgia, USA. Crop Protect. 21: 983989. Jacobs J.L., A.C. Fasi, A. Ramette., J.J. Smith, R. Hammerschmidt and G.W. Sundin. 2008. Identification and onion pathogenicity of Burkholderia cepacia complex isolates from the onion rhizosphere and onion field soil. Appl. Environ. Microbiol. 74: 31213129. Kim Y.K., S.D. Lee, C.S. Choi, S.B. Lee and S.Y. Lee. 2002. Soft rot of onion bulbs caused by Pseudomonas marginalis under low temperature storage. Plant Pathol. J. 18: 199203. Schroeder B.K., L.J. du Toit and H.F. Schwartz. 2009. First report of Enterobacter cloacae causing onion bulb rot in the Columbia Basin of Washington State. Plant Dis. 93: 323. Sobiczewski P. and M. Schollenberger. 2002. Bacterial deseases of horticulture plants (in Polish). pp. 6467; 5457. Pastwowe Wydawnictwo Rolnicze i Lene. Warszawa. Schwartz H.F. and S.K. Mohan. 2008. Compendium of onion and garlic diseases and pests. APS PRESS, St. Paul, Minnesota, USA. Weisburg W.G., S.M. Barns, D.A. Pelletier and D.J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173: 697703.

88

Kowalska B. et al.

Polish Journal of Microbiology 2011, Vol. 60

Instruction to Authors
(modified, effective Vol. 60, 2011) Scope Polish Journal of Microbiology publishes descriptions of all aspects of basic and applied research that focuses on topics of basic research and practical value in microbiology. Topics that are considered include microbiology in the area of basic biological properties of bacteria and archaea, viruses, and simple eukaryotic microorganisms, genetics and molecular biology, microbial ecology, medical bacteriology, public health as well as food microbiology, industrial microbiology and bacterial biotechnology. A manuscript of the original paper (full length paper and short communication) submitted to Pol. J. Microbiol must present reports of original research that have not been previously published and is not being considered for publication elsewhere. All authors of manuscripts areresponsible for their content and it is assumed that they all have contributed substantially to the presented research, read and approved the manuscript. Minireviews in areas of particular interests and importance in microbiology are also published. They are usually invited, but authors wishing to submit a mini-review should contact the Editor in Chief directly for further information How to Submit Manuscripts Submit via e-mail the electronic version (text and tables as a Word 7 attachment, with figures in jpg/pdf format saved individually) to the address: pjm@pzh. gov.pl, The manuscript should be accompanied by a cover letter stating the postal address, phone and fax numbers and e-mail of the corresponding author who is responsible for the all correspondence regarding the submitted paper. Receipt of each manuscript will be confirmed by e-mail to the corresponding author within five business days. It will be given a PJM number which the corresponding author is asked to refer to in correspondence with the editors. Correspondence is by e-mail. Beside the main title of the paper include in the cover letter the proposed running title of the manuscript (about 50 characters in length, including spaces). Before writing a manuscript authors are advised to consult a current issue of Polish Journal of Microbiology and carefully read the Instructions to Authors (available at www.microbiology.pl/pjm and printed in the first issue of the volume) in order to be familiar with the general form of papers published. The manuscript should be written in English. Grammar, syntax and spelling must be carefully checked before submission of the paper. Authors who are unsure of proper English usage should have their manuscript checked by someone proficient in both the English language and biological terminology. Manuscripts may be rejected on the basis of poor English or lack of conformity to accepted standards of style before the review process. Junior scientists submitting his/her paper must have the submitted manuscript accepted by the head of the scientific unit where the research was carried out. Illustrations may be supplied as PDF/jpg files for reviewing purposes only on initial submission. After receiving the Letter of Acceptance, please submit illustration at their intended publication size in tiff format (with LZW compression) at the correct resolution: 300 dpi for grayscale and color, 600 dpi for combination art (lettering and images) and 1,200 dpi for line art. Halftone images (those with various densities or shades) must be prepared in tiff, not bitmap or jpg. For instructions on creating acceptable tiff files, refer to the Cadmus digital art website. There is no page charge for publication in PJM, except to color illustrations. The Review Process All manuscripts are subjected to pre-screening by the Editor in Chief and can be rejected at this stage or returned for corrections before evaluation (if they do not meet the criteria given in the Instruction to Authors, including language quality or are out of scope of PJM). After passing the pre-screening stage the manuscripts are processed by one of the editors and sent to at least one qualified outside referee, but the editors may also act as reviewers. Authors may suggest, in the cover letter, the names (together with contact details) up to 5 potential referees which may be used at the discretion of the editor. When a manuscript is returned to the authors for modification, it should be returned to the editorial office within 3 months; otherwise it may be considered withdrawn.

90

Instruction to Authors

While the paper is accepted for publication the transfer of copyright to the Publisher becomes effective. The papers are generally printed in no more than three months after returning the corrected version and obtaining its final acceptance. Preparation of Manuscripts
Regular paper

words, and be followed by the latter in alphabetical order. All key words should be relevantly connected with the subject matter (avoid common terms like: bacteria, medium, soil, temperature etc.) as they will be used for indexing purposes.
Introduction

The manuscript of the full length original paper in general should not exceed 20 typed pages (up to 1800 letters per page) including tables and figures. Type every portion of the manuscript double-spaced using 12 points Times New Roman. Do not use bolded fonts except for subtitles or italics except for microorganism names (Escherichia coli), genetic loci (repA) or Latin words like: in vivo, et al., etc., journal title abbreviations (J. Bacteriol.) and book titles (not titles of the chapters). No part of the manuscript should be underlined and written using CAPITAL letters). Number all pages in sequence, including abstract, tables, figures and figure legends. The full length paper should be divided into the following sections written in sequence: Title, Abstract, Introduction, Experimental: Materials and Methods, Results, Discussion, Acknowledgments, Literature.
Title

The introduction should provide background information to allow the reader to understand and evaluate the results of the present study and describe the purpose of the undertaken research. However, broad academic lectures on the subject and extensive literature reviews should be avoided. Experimental
Materials and Method

The title should describe the contents of the paper in a concise but attractive for readers way. Below the title of the manuscript include: full name (including first name and middle initial) of each author, name of the institution(s) at which the work was performed, or each co-authors affiliation if different. Street address, telephone/fax number and e-mail address should be given only for the corresponding author and placed in the footnote at the bottom of the first page.
Abstract

Limit the abstract to 250 words or fewer. Because the abstract will be published separately by abstracting services, it must be complete and understandable without reference to the text. It should be written in an impersonal form. Abbreviations, diagrams and references are not allowed.
Key words

This section should contain description of materials (biological and others) used and sufficient technical information so that the experiments can be repeated. For commonly used materials and methods (e.g. commonly used media, protein determination) a simple reference is sufficient. Novel or modified procedures should be described in detail. When a large number of microbial strains or mutants were used in a study, include strain tables identifying the sources and properties of the strains, mutants, bacteriophages, plasmids, etc. For names of microorganisms, follow the guidelines of the International Nomenclature Committee (up to date names available as validation list of International of the Systematic and Evolutionary Microbiology). Species names are written in full the first time the name appears in text; subsequently, only use the first letter of the genus name followed by the species epithet (e.g. Escherichia coli, then E. coli). Genetic loci are italicized (repA), protein products of the loci are not italicized (RepA). The source of materials (media or chemicals) should be indicated if critical for the validity of experimental results. For centrifugation conditions preferably give the centrifuge forces in g (10 000g) rather than rpm. Units of measurement should be used in SI system, but for practical reasons, some exceptions to SI units are allowed; e.g. for liter use l not L (1 l not 1 L, 20 mg/ml not 20 mg/ml). Always include the space between the number and the unit (2 mM not 2 mM).
Results

Up to five key words or short phrases should be given and placed below the abstract. If names of microorganisms are used, they should precede the key

In the Results section, include only the results of the experiments; reserve extensive interpretation of the results for the Discussion section. While justified

Instruction to Authors

91

by the nature of the paper the ,,Results and ,,Discussion sections may be combined (e.g. Results and Discussion). Present the results as concisely as possible and illustrate them with tables or figures if applicable (presentation of the same results in both tables and figures is not acceptable). Avoid the use of graphs to present data that might be more concisely presented in the text. Limit illustrative materials to those that are absolutely necessary to demonstrate the original experimental findings. Number figures (Arabic numerals) and tables (Roman numerals) in the order in which they are cited in the text, and be sure to cite all figures and tables. Tables. Each table must be typed on separate pages and numbered with Roman numerals (Table I., etc.) in the order they are cited in the text. The headings should be sufficiently clear so that the data will be understandable without reference to the text. Explanatory footnotes are acceptable. Prepare your tables as simple as possible in Word not in Excel, no decorative frames should be made. Figures (graphs, diagrams etc.) should be submitted ready for reproduction, each on a separate sheet (or as a separate document on a floppy disc or CD). The preferred graphic application is Photoshop or CorelDraw saved in tiff format (with LZW compression). Figures should be numbered as in the text (Arabic numerals, Fig. 1., etc.) and marked with the name of the first author. Figures should be understandable without referring to the text. Original recorder tracing (outprints) of NMR, IR, ESR spectra etc. are not acceptable for reproduction; they should be redrawn. Figure titles and legends must be listed on a separate page. Photographs need to be in good quality with proper resolution used (minimal resolution are 300 for halftones and 600 dpi for combination of photos with lettering). Color illustration can be made only at the authors expenses (further details are available at the Editorial Office). New nucleotide sequences must be accompanied by the accession number obtained from proper databases and should be included in the text.
Discussion

named) are given in two separate paragraphs below the main text.
Literature

It is the responsibility of authors to verify each reference against the original article as well as make sure that each paper cited in the text is included in the list. Keep the number of citations reasonable, avoid exhaustive citations of historical papers except if absolutely necessary. In the text references should be cited by the names of the authors and the year of publication, e.g. Nowak and Kowalski (1999) stated that...; as previously described (Nowak and Kowalski, 2000; Nowak, 2005). When a paper has more than two authors, the first authors name should be followed with et al. and the year of publication, e.g. Nowak et al., 2002. While references occur that are not identified by the authors names and year, use a, b etc. after the year (Nowak et al., 2002a; 2002b). The list of the papers cited (Literature) must be arranged alphabetically according to the last name of the first author and not numbered. Papers with one only author are listed in chronological order (the earliest first); papers with two authors are listed alphabetically according to the last name of the first author and by the last name of the second author; paper with three or more authors appear as those with two authors and are listed chronologically. When the paper has more than ten authors state the names of the first ten, followed by .. ..and others. For citations of books, books chapters, thesis, printed conference proceedings etc. see examples given below. Please follow the punctuations, brackets, capital letters etc. exactly as shown. Put and not & before the last authors name. Use the proper journal titles abbreviations (ISO) as indicated in the PubMed Journal Database. Examples of literature citations
Books and book chapters:

The Discussion should provide an interpretation of the obtained results in relation to previously published work and to the experimental system at hand and should not contain extensive repetition of the ,,Results section or reiteration of the introduction. In some papers the Results and Discussion can be combined into one section as mentioned above.
Acknowledgements

Acknowledgements for financial support and for a personal assistance (with the permission of person

Sambrook J., E.F. Fritsch and T. Maniatis. 1989. Molecular Cloning; a Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Snyder L. and W. Champness. 2003. Molecular Genetics of Bacteria. 2nd ed. ASM Press, Washington, D.C. Funnel B.E. and G.J. Phillips (eds). 2004. Plasmid Biology. ASM Press, Washington, D.C. Belfort M., V. Derbyshire, M.M. Parker, B. Cousineau and A.M. Lambowitz. 2004. Mobile introns: pathways and proteins, pp. 761783. In: Funnel B.E. and G.J. Philips (eds). Plasmid Biology. ASM Press, Washington, D.C.

92
Journal articles:

Instruction to Authors

1 author: Eckhardt T. 1978. A rapid method for identification of plasmid desoxyribonucleic acid in bacteria. Plasmid 1: 584588. 2 authors: Soyga A. and D. Bartosik. 2004. Entrapment vectors how to capture a functional transposable element. Pol. J. Microbiol. 53: 139144. 3 to 10 authors: Bartosik D., M. Szymanik and J. Baj. 2004. Identification and distribution of insertion sequences of Paracoccus solventivorans. Appl. Environ. Microbiol. 69: 70027008. More than 10 authors Roberts R.J., M. Belford, T. Bestor, A.S. Bgagwat, T.A. Bickle, J. Bitinaite, R.M. Blumenthal, S.K. Degtyarey, D.T. Dry den, K. Dybyig and others. 2003. A nomenclature for restriction enzymes. DNA methyl-transferases, homing endonucleases and their genes. Nucleic Acids Res. 31: 18051812. Papers in a language different than English the title should be translated into English and the original language should be stated in parenthesis. Bartosik D. 2001. Bacterial plasmids stability (in Polish). Post. Biochem. 47: 138145. Ph.D. Thesis Szymanik M. 2006. Ph.D. Thesis, (title optional). Warsaw University. Warsaw. Poland Conference materials (exceptionally) Dziewit L., M. Jazurek, L. Drewniak, J. Baj and D. Bartosik. 2006. Identification of a novel family of addiction systems. Abstracts of International Plasmid Biology Conference. Plasmid Biology 2006. Fallen Leaf Lake, South Lake Tahoe California. USA. p. 163. Papers in press or personal communication and unpublished results should not be included in the Literature citation list. Short communications A short communication is intended for the presentation of brief observations that do not warrant a fulllength paper. Submit it in the same way as a full-length paper. Each Short communication must have an abstract of no more than 100 words. Do not use sections heading in the body of the text. All the required formation (introduction, methods, results and discussion)

except for the Literature must be given in single section. Total length cannot exceed 8 double printed pages including illustrative material (in total no more than 3 figures and tables). They undergo the same review process as full length papers and are not printed more quickly. Minireviews Minireviews are published in areas of particular interest and importance. They are usually invited, but authors wishing to submit a minireview should contact the Editor in Chief directly for further information. Authors need to be experts on the topic reviewed documented with published achievements in the field. Proofs The text for proof will be e-mailed (as .pdf file) to the corresponding author. It should be printed out and after introducing necessary corrections, returned by priority mail to the postal address of editorial office as soon as possible. If the required corrections are minor, the author (especially foreign) may list them and e-mail directly to the address pjm@pzh.gov.pl (do not forget to state the paper title and given editorial number of the manuscript). Reprints Beginning 2007 the Journal has not provided free reprints. The corresponding author will be provided with a pdf of his article by the Editorial Office. If printed copies of the article are required they can be ordered (in multiples of 20) together with return of the corrected proof. The reprints will be mailed after receiving payment (conditions of payment may be obtained at secret@cls.edu.pl, Ms Beata Mazinska). Free of charge copies are available at www.microbiology.pl/pjm Copyrights Submission of the manuscript implies that the research presented has not been published before (except in the form of a conference abstract or a part of PhD thesis). Transfer of copyrights to the publisher becomes effective if and when the article is accepted for publication. All articles published in Polish Journal of Microbiology are protected by copyrights which cover the exclusive rights to reproduce and distribute the article as well as the translation. No part of the published material can be reproduced without obtaining written permission from the publisher.

POLISH JOURNAL OF MICROBIOLOGY

(founded in 1952 as Acta Microbiologica Polonica)

www.microbiology.pl/pjm EDITOR-in-CHIEF: EDITORS: Stanisawa TYLEWSKA-WIERZBANOWSKA Izabela SITKIEWICZ Waldemar SIUDA Anna SKORUPSKA Ilona MCZKA

EDITORIAR OFFICE:

EDITORIAL SECRETARY: Anna KRACZKIEWICZ-DOWJAT POSTAL ADDRESS: Polish Journal of Microbiology Chocimska 24 00-791 Warsaw, POLAND Phone / Fax: (48 22)5421250 E-mail: Editorial Office (pjm@pzh.gov.pl) Editor-in-Chief (stylewska@pzh.gov.pl)

CONTACT:

EDITORIAL BOARD President: Andrzej PIEKAROWICZ (Warsaw, Poland) Agata Budkowska (Paris, France) Hanna Dam (Olsztyn, Poland Estera Dey (Lund, Sweden) Jarosaw Dziadek (d, Poland) Waleria Hryniewicz (Warsaw, Poland) Katarzyna Jagusztyn-Krynicka (Warsaw, Poland) Donovan P. Kelly (Coventry, UK) Jzef Kur (Gdask, Poland) Teresa Lagergrd (Gteborg, Sweden) Wanda Maek (Lublin, Poland) Zdzisaw Markiewicz (Seattle, USA) Barbara Ralska (d, Poland) Geoffrey Schild (Potters, Bar, UK) Wacaw Szybalski (Madison, USA) Torkel Wadstrm (Lund, Sweden) Krystyna I. Wolska (Warsaw, Poland)

PUBLISHER: POLISH SOCIETY OF MICROBIOLOGISTS Published quarterly with the financial support of the Ministry of Science and Higher Education SUBSCRIPTION: For information for Polish subscribers contact Secretary of Polish Society of Microbiologists, Chemska 30/34, 00-725 Warsaw, Poland; phone: (48) 228413367, fax: (48) 228412949, e-mail: sekret@cls.edu.pl For information for foreign subscribes contact Ars Polona e-mail: arspolona@arspolona.com.pl; phone: + 48 (22) 5098661-5 also www.arspolona.com.pl Cover illustration:
Setose of C. dematium in SEM (Photo M. Wrbel).

ZOFIA MACHOWICZ-STEFANIAK: Occurrence and characterization of Colletotrichum dematium (Fr.) Grove, in: Polish J. Microbiology 59, 3, 191200

Typesetting and print: Publishing House Letter Quality, 01-216 Warsaw, Brylowska 35/38 Circulation: 300

Polish Journal of Microbiology, founded in 1952 as Acta Microbiologica Polonica, is a broad-based international microbiological journal covering: general microbiology, bacterial physiology, molecular biology and genetics, virology, clinical bacteriology, environmental microbiology and biotechnology. Polish Journal of Microbiology publishes mainly original research articles including short communications, but also minireviews, book reviews and press releases. All the papers should be prepared according to Instruction to Authors which is included in the first issue of every volume and also available at www.microbiology.pl/pjm. The papers appear usually within 3 months after final acceptance. Abstracts and full texts of the papers (as pdf-s) are available under www.microbiology.pl/pjm directly after the printed version appears. Polish Journal of Microbiology is currently covered by Science Citation Index Expanded (ISI) and Journal Citation Reports (JCR)/Science Edition, Thomson Master Journals List, Biological Abstracts, BIOSIS Previews, EMBASE/Excerpta Medica, Index Medicus/MEDLINE, Cambridge Scientific Abstracts, SCOPUS, Index Copernicus. Submissions of manuscripts in various areas of microbiology are very welcome. After acceptance of the paper the copyrights are reserved to the Publisher. No part of the publication may be reproduced in any form without prior written permission of the Publisher, Polish Society of Microbiologists.

Subscription information for Polish subscribers under sekret@cls.edu.pl, for foreign subscribers under www.arspolona.com.pl or arspolona@arspolona.com.pl

Advertising offer The Editorial Office of the Polish Journal of Microbiology encourages our Readers to place advertisements in our quarterly. Our journal reaches scientists working in various research and educational institutions and involved in different fields of microbiology. We ensure rapid appearance of the ad. Price of black and white ad on inside cover: half of page = 150 PLN, full page = 300 PLN Price of ad inside an issue: half page = 75 PLN, full page 150 PLN. Please send file with graphical layout directly to the editorial office of the journal or contact us at pjm@pzh.gov.pl. The Editorial Office and Publisher do not take any responsibility for the contents of advertisement and announcements. ISSN 1733-1331 Index 35119