Está en la página 1de 83

Experiencias recientes con levaduras, crianza en madera y destilados autctonos de la EVEGA

Estacin de Viticultura e Enoloxa de Galicia (EVEGA)-INGACAL

Ignacio Orriols Fernndez Pilar Blanco Camba

Experiencias recientes con levaduras, crianza en madera y destilados autctonos de la EVEGA


Aplicacin de levaduras autctonas para la obtencin de vinos de calidad diferenciada

Proceso de elaboracin de un vino blanco Uva Estrujado y despalillado Enzimas Desfangado esttico en fro Espontnea Fermentacin alcohlica
Levaduras Control de temperatura

Prensado SO2 Mosto Bagazo

Mosto

Inoculada LSA (comercial) Levadura autctona seleccionada

Vino

Descube SO2

Estabilizacin Trasiegos

SO2

Filtracin Embotellado

Proceso de elaboracin de un vino tinto uva Estrujado y despalillado SO2 Pasta de vendimia Enzimas Fermentacin alcohlica (Levaduras) Maceracin Prensado Embotellado Descube Vino + Vino prensa Fermentacin malolctica (bacterias lcticas) Vino
Trasiegos Estabilizacin

Crianza en madera

Factores que influyen en la calidad de un vino

Variedad de uva Caractersticas de la variedad Prcticas de viticultura Clima, suelo Fermentacin (Levaduras y bacteria) Prcticas enolgicas Levaduras utilizadas (FA) Bacterias lcticas (FML)

Envejecimiento en madera

Papel de las levaduras en la elaboracin del vino Responsables de la fermentacin alcohlica azcar Alcohol + CO2+ Otros*

Formacin de metabolitos secundarios (>680 ) cidos :No-voltiles (tartrico, mlico, ctrico, lctico, succnico) Voltiles (actico, propinico, hexanoico) Alcoholes:Etanol, glicerol Alcoholes superiores (isoamil alcohol, 2-feniletanol) steres (notas afrutado) Compuestos carbonlicos (Acetaldehido, diacetilo) Fenoles (Brettanomyces)- sudor, establo Compuestos derivados del sulfuro (negativos) Las levaduras que llevan a cabo la fermentacin determinan la composicin del vino y sus caractersticas organolpticas

Sucesin de la poblacin de levaduras durante la fermentacin


A nivel cuantitativo: Uva-mosto: 102-105 UFC/ml Fase inicial: 106 cl/ml Fase tumultuosa:108-109 cl/ml Fase final: se mantiene o desciende
Densidad
9
log (NLV/mL)

1080 1070 1060 1050 1040 1030 1020 1010 1000 990 0 2 4 6 8 10

25 20 15 10 5 0

8 7 6 5 4 0 2 4 6 8 10 BL-esp BL-B BL-A

Tiempo (Das)

Tempo (das)

A nivel cualitativo: Uva-mosto: distintas especies de levaduras (Rhodotorula, Kloeckera/Hanseniaspora sp., Candida sp, Pichia sp.) Fase inicial: (Kloeckera/Hanseniaspora, Candida sp, Metschnikowia sp, Pichia sp) Aumento de la concentracin de etanol Fase tumultuosa: Saccharomyces cerevisiae Fase final: Saccharomyces cerevisiae

Temperatura (C)

Seleccin de levaduras autctonas: por qu? Las levaduras determinan la composicin y caractersticas sensoriales del vino
TIPOS DE FERMENTACIN Espontnea (tradicional) Resultados imprevisibles Riesgos de ralentizacin y/o paradas fermentativa Inoculada o dirigida (industrial) Calidad uniforme, repetitividad Evita problemas de arranque, ralentizacin y/o paradas de fermentacin

Levaduras comerciales frente a Levaduras autctonas


Levaduras comerciales(LSA) Homogeneidad de los vinos Prdida de tipicidad Disponibilidad

Levaduras autctonas
Expresin de las caractersticas propias de cada variedad y zona Obtencin de vinos de calidad diferenciada Buena aclimatacin a las condiciones locales del viedo y de las bodegas La disponibilidad de cepas implica un largo proceso de investigacin

Seleccin de levaduras autctonas: aislamiento de cepas


Toma de muestra para aislamiento de levaduras Uva Mosto Fermentacin espontnea: Fase inicial Fase tumultuosa Fase final Dilucin adecuada de la muestra y siembra en medio slido para recuento de viables y aislamiento

1100 1080
Densidad

Fase inicial

1060 1040 1020 1000 980 0 5

Fase tumultuosa

Fase final

10

15

20

Tiempo (das)

Seleccin de levaduras autctonas: identificacin de las levaduras Tcnicas convencionales Morfologa de las colonias en placa Morfologa de las clulas a microscopio Crecimiento de medio selectivo (agar lisina) Saccharomyces cerevisiae (-) Non-Saccharomyces (+)

Identificacin de las mediante tcnicas de biologa molecular A nivel de especie: Anlisis de los patrones de restriccin de la regin del rRNA 5.8S-ITS. (Esteve-Zarzoso et al., 1999) Confirmacin mediante secuenciacin de la regin D1/D2 del rDNA 26S y comparacin con las bases de datos. A nivel de cepa (S. cerevisiae)- mtDNA-RFLPs (Querol et al., 1992).

Identificacin gentica de las levaduras a nivel de especie Anlisis de los patrones de restriccin de la regin 5.8S-ITS del rRNA Regin del rRNA 5.8S y los espaciadores internos no codificantes ITS1 e ITS2
ITS1

18S

ITS1

5,8S

ITS2

28S

ITS4

Alta variabilidad interespecfica y bajo polimorfismo intraespecfico Amplificacin mediante PCR utilizando los primers: ITS1 (5 TCCGTAGGTGAACCTGCGG 3) ITS4 (5 TCCTCCGCTTATTGATATGC 3) Digestin de los productos de PCR con las endonucleasas: Hinf I, Hae III y Cfo I Confirmacin mediante secuenciacin de la regin D1/D2 del rDNA 26S y comparacin con las bases de datos.

Seleccin de levaduras autctonas: RESULTADOS

Size (bp)

Species I

Species III

Species IV

PCR fragment

150

PCR fragment

PCR fragment

Anlisis de los patrones de restriccin de la regin del rRNA 5.8S-ITS

800 600 500 350 250

Hae III

Hae III

Hinf I

N de levaduras analizadas: 393 Especies identificadas: 20 Especies pendientes de identificacin: 6

Cfo I

Cfo I

Cfo I

50

Hinf I

Hae III

Hinf I

Seleccin de levaduras autctonas: RESULTADOS Resultados: Identificacin de levaduras


Especie 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 20 Tamao producto PCR 850 >800 >800 >800 <800 750 >700 700 650 600 600 <600 500 500 <500 >450 450 450 <400 Nmero de fragmentos Hinf I Hae III Cfo I 2 4 3 4 2 3 2 -4 1 1 2 4 -2 3 -2 4 2 2 2 3 3 2 3 1 2 3 3 1 -2 -2 -2 3 4 2 2 4 -2 3 2 2 3 3 2 3 2 1 3 2 2 3 Especie Saccharomyces cerevisiae S. kudriavzevii (86%) Torulaspora delbrueckii Zygosaccharomyces bailii Hanseniaspora valbyensis Hanseniaspora uvarum Kluyveromyces marxianus Kluyveromyces thermotolerans Debaryomyces hansenii Pichia guilliermondii Pichia anomala Rhodotorula sloofifae Pichia membranifaciens Issatchenkia orientalis Pichia qaleiformis Dekkera bruxellensis Candida sp Issatchenkia terricola Metschnikowia sp

Seleccin de levaduras autctonas: RESULTADOS Identificacin gentica de cepas de Saccharomyces cerevisiae Anlisis de los patrones de restriccin del DNA mitocondrial (mtDNA-RFLPs) Alta variabilidade intraespecfica Extraccin del DNA total y digestin con la endonucleasa Hinf I
Size(bp)

6,000 5,000 4,000 3,000 2,000

Nmero de cepas de S. cerevisiae identificadas: 60

I II III IV V VI M VII VIII IX X XI XII M XIII XIV XV XVI XVII XVIII XIX

Seleccin de levaduras autctonas: RESULTADOS

Aislamiento y caracterizacin gentica de levaduras vnicas aisladas durante fermentaciones espontneas en la bodega experimental de la EVEGA Creacin de una coleccin de levaduras vnicas propias de la EVEGA Ecologa de la poblacin de levaduras durante la fermentacin Fluctuacin de la poblacin de levaduras a lo largo del tiempo en la bodega La variedad de uva y las caractersticas del mosto influyen en la cepa o cepas de S. cerevisiae que llevan a cabo la fermentacin. Caracterizacin enolgica de las levaduras: seleccin Evaluacin de las levaduras seleccionas en bodega

Seleccin de levaduras autctonas: RESULTADOS Ecologa de la poblacin de levaduras durante la fermentacin


14 12 10 8 6 4 2 0 A B C D E F O* Total Fi Ft Ff

Treixadura 2004 Sucesin de las cepas de S. cerevisiae durante la fermentacin El nmero de cepas es mayor al inicio del proceso Una cepa o un n reducido de cepa se implanta sobre las dems La cepa dominante vari a lo largo de proceso

Seleccin de levaduras autctonas: RESULTADOS Ecologa de la poblacin de levaduras durante la fermentacin


25 20 15 10 5 0 A B C D E F G H Otros Total

Fi Ft FF

Albario 2009 (3X) Sucesin de las cepas de S. cerevisiae durante la fermentacin La variabilidad se mantiene a lo largo de la fermentacin Codominancia en la fase inicial, en Ft y Ff domina la cepa E

Seleccin de levaduras autctonas: RESULTADOS Las caractersticas del mosto (acidez total) influyen en la cepa o cepas de S. cerevisiae que llevan a cabo la fermentacin.

Seleccin de levaduras autctonas: RESULTADOS

Caracterizacin enolgica de las levaduras (en laboratorio)


Capacidad fermentativa Tolerancia al alcohol (Ensayada en mosto suplementado con distintas

concentraciones de etanol): A concentraciones de 10% de alcohol en el medio las


levaduras presentaban una capacidad de crecimiento entre 31-52% respecto a un control sin etanol.

Resistencia a sulfuroso (Ensayada en mosto suplementado con distintas

concentraciones de SO2): Todas las cepas eran resistentes a las concentraciones de


sufuroso habituales en bodega

Capacidad killer segn el mtodo descrito en Ramilo et al. (2004). Produccin de sulfhdrico en medio Biggy Agar (Caridi et al. 2002)

K+
Sc 1890

K-

Seleccin de levaduras autctonas: RESULTADOS Caracterizacin enolgica de las levaduras: capacidad fermentativa Cintica fermentativa, consumo de azcares, produccin de alcohol, produccin de acidez voltil. Los ensayos se realizaron a escala de laboratorio utilizando 100 ml de mosto que era inoculado con la cepa a examinar y se ferment a 19C.
Alcohol (%
1B (Treixadura) T8 14 12 T7 T2

Azcares

Acidez

Cepa Sc1

vol) 9,45 12,12 12,89 12,89 12,37 13,00 13,20

reductores (g l-1) voltil (g l-1) 72,11 25,96 12,80 10,98 21,65 10,85 2,46 1,25 1,18 0.95 0.81 1.12 0.72 0.58

CO2 liberado

10 8 6 4 2 0 0 5 10 15 Tiem po (Das)

Sc4 Sc5 Sc7 Sc8 Sc9 Sc10

Seleccin de levaduras autctonas: RESULTADOS

Ensayo en bodega de las cepas seleccionadas


2008
Variedad de uva: Treixadura Cepas: todas (X duplicado) Depsitos 35 L, cmara fra (18C) Inculos: 106 cl/ml Cepa XG1 XG2 XG3 XG4 XG5 Perfil gentico Fenotipo killer XXI XXVIII V XI XXX N N S S K

2009
Variedad de uva: Godello y Albario Cepas: XG1 y XG3 (X triplicado)+ 3X fesp// 3x F inoculada con LSA Depsitos 100 L, T controlada 17C Inculos: 106 cl/ml

Seguimiento de las fermentaciones y anlisis de los vinos Seguimiento diario densidad/temperatura Control microbiolgico de implantacin en fase tumultuosa-final Anlisis del vino: Parmetros bsicos (Mtodos oficiales OIV) Aromas (Cromatografa de gases) Anlisis sensorial mediante cata

Seleccin de levaduras autctonas: RESULTADOS Cintica de fermentacin y control de implantacin Las levaduras evaluadas mostraron una buena capacidad fermentativa
1100 1080 Densidad 1060 1040 1020 1000 980 0 5 10 15

Las cepas inoculadas se implantaron sobre las levaduras presentes en el mosto


XG2 XG3

XG4

XG5

Tiempo (das) TRX-espA TRX-XG3-A TRX-XG1-A TRX-XG4-A TRX-XG2-B TRX-XG5-B

TREIXADURA 2008

Seleccin de levaduras autctonas: RESULTADOS Anlisis bsicos de los vinos

S. cerevisiae strains Must parameter Alcohol (% v/vl) Total acidity (g/L as tartaric acid) Volatile acidity (g/L as acetic acid) Tartaric acid (g/L) Malic acid (g/L) Lactic acid (g/L) Esp 12.45 a 6.55 ab 0.44 ab 2.15 a 2.95 a 0.30a XG1 12.5 a 6.50ab 0.43 ab 2.1 a 2.85 a 0.45ab XG2 12.45 a 6,90b 0.64 b 2.1 a 2.95 a 0.30a XG3 12.4 a 6.45 ab 0.43 ab 2.1 a 2.60 ab 0.45ab XG4 12.45 a 6.25 a 0.51 ab 2a 2.1 b 0,70b XG5 12.25 a 6.25 a 0.39 a 2.15 a 2.7 ab 0,40ab

TREIXADURA 2008

Seleccin de levaduras autctonas: RESULTADOS

4,0 3,5 3,0 2,5 2,0 1,5 1,0 0,5 0,0 TRX- TRX- TRX- TRX- TRX- TRXesp XG1 XG2 XG3 XG4 XG5

Anlisis sensorial TREIXADURA 2008

Nivel hednico

Seleccin de levaduras autctonas: RESULTADOS

GODELLO 2009: Control de implantacin


XG1

Las cepas inoculadas se implantaron sobre las levaduras presentes en el mosto En las fermentaciones espontneas se observ un fenmeno de codominancia de varias especies de S. cerevisiae .

Godello espontnea
40 35 30 25 20 15 10 5 0 A B C E F Otras

Seleccin de levaduras autctonas: RESULTADOS

Ensayo en bodega de las cepas seleccionadas


2009 Variedad de uva: Menca Cepas: Sc5 (S), Sc11(N), Sc21(N) y Sc24 (K)// Fesp// LSA (XR) Fermentaciones por duplicado en depsitos de 35 L Temperatura ambiente Seguimiento diario densidad/temperatura Control microbiolgico de implantacin en fase inicial, tumultuosa y final Fermentacin malolctica Anlisis del vino: Parmetros bsicos (Mtodos oficiales OIV) Aromas (Cromatografa de gases) Anlisis sensorial mediante cata

Seleccin de levaduras autctonas: RESULTADOS Cintica de fermentacin y control de implantacin


1120 1100

Excellence XR

S. cerevisiae Sc5

Densidad

1080 1060 1040 1020 1000 980 0 1 2 3 4 5 6 7 8 Tiempo (Das) M-Sc5 M-Sc24 M-Sc11 M-esp M-Sc21 M-LSA

Todas las cepas mostraron una curva de fermentacin similar

Las cepas autctonas actuaron en codominancia con la comercial XR, bien adaptada a la bodega.

MENCIA 2009

Seleccin de levaduras autctonas: RESULTADOS Composicin qumica del vino


Cepa de Saccharomyces cerevisiae Sc5 Sc11 Sc21 Sc24 14,5b 3,95 0,4ab 2,05a nd 1,75a 48,04ab 1,287a 0,489b 1,100b 46,688ab 20,263ab 57,964b 14,3ab 4,05 0,47ab 1,65c nd 1,50b 55,11c 1,662b 0,494b 1,120b 42,996a 20,940ab 56,707b 14,3a 3,85 0,46ab 1,90ba nd 1,65ab 52,08bc 1,438ab 0,425c 1,096bc 44,806ab 9,759a 49,821b 14,2a 3,95 0,51b 1,75bc nd 1,70a 51,19ab 1,391ab 0,418a 1,013abc 51,895b 26,198b 46,983b

Parmetro Grado alcohlico (% vol) Acidez total (g/l de tartrico) Acidez voltil (g/l actico) cido tartrico (g/l) cido mlico (g/l) cido lctico (g/l) Acetato de etilo (mg/l) Acetato de isoamilo (mg/l) Hexanoato de etilo (mg/l) steres etlicos (C6-C12) Lactato de etilo (mg/l) Acetona (mg/l) 2-feniletanol (mg/l)

Esp 14,3a 3,90 0,39ab 2,00a nd 1,65ab 46,20a 1,309a 0,417a 0,927a 39,247a 20,594ab 78,234a

XR 14,2a 3,90 0,36a 2,05a nd 1,70a 46,71ab 1,179a 0,410a 0,931ac 46,137ab 15,376ab 59,989b

MENCIA 2009

Seleccin de levaduras autctonas: RESULTADOS Influencia de las levaduras sobre el color

56 54 52 50 48 46 44 42

XR

Sc 5 Sc 11 Sc 21 Sc 24

Sc 5 Sc 11 Sc 21 Sc 24

Es p

Sc5 Sc11 Sc21 Sc24 Esp Levaduras

XR

Levaduras

Levaduras

Los vinos Sc21 y Esp mostraron mayores valores en tonalidad, intensidad e IPTs. El contenido de antocianos era mayor en los vinos elaborados con las cepas XR y Sc24. MENCIA 2009

Es p

XR

56 54 52 50 48 46 44 42

640 620 600 580 560 540 520 500 480

Antocianos

Tonalidad

IPTs

Seleccin de levaduras autctonas: RESULTADOS Anlisis sensorial

MENCIA 2009

Seleccin de levaduras autctonas: CONCLUSIONES Las levaduras seleccionadas presentaban: Buena capacidad fermentativa en bodega: Fermentacin rpida y uniforme Consumo de azcares y alta produccin de alcohol Capacidad de implantacin sobre la poblacin de levaduras del mosto de Treixadura, Godello y Albario. Codominancia con la cepa XR en mosto de Menca. Diferencias significativas en el perfil aromtico. A nivel sensorial permitieron la obtencin de vinos diferenciados.

Experiencias recientes con levaduras, crianza en madera y destilados autctonos de la EVEGA


Papel de las levaduras en la fermentacin del bagazo y la calidad de los destilados

Proceso de elaboracin de un aguardiente Bagazo*

Fermentacin
Levaduras Bacterias

Conservacin

Destilacin

Anlisis sensorial Anlisis qumico Aromas primarios Aromas secundarios Aromas terciarios

Aguardiente

Proceso de elaboracin de un aguardiente Factores que influyen en la calidad de un aguardiente Materia prima (variedad de uva, grado de prensado, etc.) Fermentacin Condiciones de la fermentacin (T, tipo y volumen del contenedor) Microorganismos implicados Fermentacin espontnea Conservacin Condiciones de conservacin (T<20C, anaerobiosis) Tiempo de conservacin Alteraciones de origen microbiolgico (acidificacin*) Destilacin Sistema de destilacin

Papel de las levaduras en la elaboracin de aguardiente


Responsables de la fermentacin del bagazo Agua (50-70%) Celulosa (10-20%) Azcares (6-8%) cidos orgnicos (1-2 %) Polifenoles y taninos (1-2%) Sales mineralea (1-2%) Otros: protenas, pectinas, etc

Composicin del bagazo

Originan compuestos voltiles Alcoholes Etanol, Metanol (txico) Alcoholes superiores -propanol, isoamlico, 2-feniletanol Aldehidos- acetaldehido, benzaldehido, acrolena (bacterias) Compuestos cetnicos acetona, diacetilo (bacterias) steres- acetato de etilo, lactato de etilo cidos actico, propanoico, butrico

las levaduras que fermentan el bagazo determinan la composicin del aguardiente y sus caractersticas organolpticas.

Aislamiento y caracterizacin de levaduras de bagazo Toma de muestras Bagazo Lquido Procesado de las muestras Bagazo: 20-50 g en 100 ml de YPD Incubar a 28C, 2 h a 120 rpm Dilucin y siembra en un medio adecuado Lquido: Dilucin y crecimiento en un medio adecuado Incubacin a 28C hasta la aparicin de colonias visibles Recuento de viables y aislamiento de colonias representativas Caracterizacin de las levaduras aisladas

Levaduras presentes en la fermentacin de bagazo: estudios preliminares Bagazo de las variedades Treixadura y Godello Fermentaciones espontneas e inoculadas con una LSA Control microbiolgico de bagazo y antes de destilar

Fermentacin inoculada

Fermentacin espontnea con Treixadura

Fermentacin espontnea con Godello

Levaduras presentes en la fermentacin de bagazo: estudlios preliminares


Muestra Resultados preliminares: N de levaduras aisladas Total S. cerevisiae Non-Saccharomyces (% de implantacin y cepa*; (n especies) caracterizacin gentica cepas) levaduras vnicas aisladas de n de 71 20 (3) 51 (4)

Aislamiento y durante fermentaciones espontneas en la bodega experimental de la EVEGA


Orujo no fermentado

Creacin de una BF-GOD-T(Testigo)


BF-GOD-HA

coleccin de levaduras cepas V y XX; 8) de la EVEGA 50 36 (36 y 28 % vnicas propias 0 (0)


45 32(44, 28 y 16 % cepas V, XX y XV; 6) 50 (100% cepa inoculada) 50 (94% cepa inoculada; 2) 39 (46, 21 y 18 % cepas XX, II y V; 8) 36 (42 y 33 % cepas XX y V; 6) 13

BF-GOD-LV BF-GOD-HALV BF-GOD-HA2

50 50 50

0 (0) 0 (0) 2

BF-GOD-NUT

50

0 (0)

Levaduras presentes en la fermentacin de bagazo: estudios preliminares

Muestra Total

N de levaduras aisladas S. cerevisiae (% de implantacin y cepa; n de cepas) Non-Saccharomyces (n especies)

Orujo no fermentado BF-TRX-T(Testigo) BF-TRX-LV BF-TRX-HA BF-TRX-HALV

48 45 40 50 45

16 (3) 45 (41 % cepa XXII*, 7) 40 (89% cepa inoculada; 4) 43 (38% cepa XXII*; 10) 38 (94% cepa inoculada; 2)

32(4) 0 (0) 0 (0) 7 7

Levaduras presentes en la fermentacin de bagazo: estudios preliminares Especies de levaduras identificadas en bagazo: Saccharomyces cerevisiae Kloeckera apiculata Metschnikowia pulcherrina, otras. CONCLUSIONES En las muestras de bagazo (Godello y Treixadura) inoculadas con LSA se implant la levadura sembrada. En las fermentaciones con Treixadura la cepa dominante fue S. cerevisiae XXII indicando una buena adaptacin de esta cepa a las condiciones de fermentacin y a la variedad de bagazo. En las fermentaciones con Godello las cepas dominantes fueron S. cerevisiae V y XX (fenmeno de codominancia).

Influencia de las levaduras de fermentacin de bagazo Albario en la composicin de los destilados Bagazo de Albario*

6 x XG3

Fermentacin dirigida

6 x BDX

Conservacin Anlisis microbiolgico Destilacin

Alambique charentais

Alambique con columna

Influencia de las levaduras de fermentacin de bagazo Albario en la composicin de los destilados: RESULTADOS Control de implantacin en las fermentaciones con XG3
Fermentacin ALB-XG3 (1) ALB-XG3 (2) ALB-XG3 (3) ALB-XG3 (4) ALB-XG3 (5) ALB-XG3 (6) N de levaduras analizadas 9 18 9 9 16 9 Perfil mtDNARFLP* XG3 XG3 XG3 XG3 IV XG3 N cepas perfil mayoritario 9 18 9 8 9 9 % de implantacin 100 100 100 89 56 100

ALB-XG3 (3)

ALB-XG3 (5)

Influencia de las levaduras de fermentacin de bagazo Albario en la composicin de los destilados: RESULTADOS Control de implantacin en las fermentaciones con BDX
Fermentacin ALB-BDX1 ALB-BDX2 ALB-BDX3 ALB-BDX4 ALB-BDX5 ALB-BDX6 N de levaduras analizadas 9 16 16 18 15 10 Perfil mtDNARFLP* Sc59 BDX BDX/Sc59 XG3 BDX BDX/XG3 N cepas perfil mayoritario 9 7 6/10 18 14 5/4 % de implantacin 100 44 37,5/62,5 100 93 50/40

ALB-BDX (1)

ALB-BDX (3)

Influencia de las levaduras de fermentacin de bagazo Albario en la composicin de los destilados: CONCLUSIONES La cepa autctona S. cerevisiae XG3 mostr una buena adaptacin para la fermentacin de bagazo Albario, implantndose e casi todas las fermentaciones en las que fue inoculada. La cepa comercial BDX solo predomin en cuatro de las seis fermentaciones realizadas; en tres de ellas en codominancia con otras levaduras. Sin embargo, una cepa nueva-Sc59 predominaba en dos fermentaciones. La cepa Sc59 podra ser de inters en la fermentacin de bagazo. Los datos analticos mostraron la existencia de diferencias significativas (p<0.05) para distintos compuestos entre los destilados obtenidos con las dos levaduras. La levadura XG3 produca destilados con un nivel menor de metanol que BDX, mientras que los niveles de alcoholes superiores fueron similares para ambas levaduras.

ESTUDIO DA POTENCIALIDADE DO CARBALLO GALEGO PARA A ELABORACIN DE VIOS TINTOS DE CRIANZA CON PERSONALIDADE PROPIA. CARACTERIZACIN QUMICA E SENSORIAL
(08TAL001505PR)

UVA EN GALICIA

Principales variedades blancas: albario, treixadura, godello, dona branca, loureira, caio blanco y torronts Principales variedades tintas: menca, garnacha, arauxa (tempranillo), brancellao, merenzao, cao y sousn

COSECHA 2010
PRODUCCIN 2010 (aprox 58.000 Tm)

8%

4% 10%

23%

55%

MONTERREI

RIBEIRA SACRA

RIAS BAIXAS

RIBEIRO

VALDEORRAS

PORCENTAJES
100,00 90,00 80,00 70,00 60,00 50,00 40,00 30,00 20,00 10,00 0,00 MONTERREI RIBEIRA SACRA
BLANCA

RIAS BAIXAS
TINTA MENCIA SOUSON

RIBEIRO

VALDEORRAS

PROYECTO
Se aprueba en el ao 2008. Los vinos de la cosecha de 2008 se introducen

en barrica a en julio de 2009 Las tomas de muestra se hacen a los 6, 9 y 12 meses Actualmente estn embotellados todos los vinos del ao 2008. Los vinos de 2009 se metieron en barrica en 2010. Los vinos de 2010 ya estn en barrica

OBJETIVOS
Estudiar el comportamiento de la variedad

Menca en el proceso de crianza con barricas de R.Francs Allier (Quercus petraea), R.Americano (Quercus alba), R.Gallego (Quercus robur), tanto en barrica nueva como en barrica de un ao.

Estudiar el comportamiento de la variedad

Sousn en el proceso de crianza con R.Gallego, tanto en barrica nueva como en barrica de un ao.

BARRICAS
Todas son del mismo volumen (bordelesas-225 L) De grano fino y tostado medio Las de R.Gallego son de tostado medio (PN) y

tostado fuerte (PT) Se hacen 3 repeticiones (barricas) por ensayo, excepto en el R.Gallego (PT) que se hace solamente 1 y PN dos

RESULTADOS
Acidez Voltil
1,00 0,95 0,90 Ac. Voltil (g/l actico) 0,85 0,80 0,75 0,70 0,65 0,60 6 ME 9 ME 12 ME

RF RA PN PT

RESULTADOS
Antocianos totales
270,0

250,0

Antocianos totales (mg/L)

230,0 RF 210,0 RA PN 190,0 PT

170,0

150,0 6 ME 9 ME 12 ME

RESULTADOS
IC
9,5

9,0

8,5 IC

RF RA

8,0

PN PT

7,5

7,0 6 ME 9 ME 12 ME

RESULTADOS
I.IO
40,0 35,0 I.IO (%) 30,0 25,0 20,0 15,0 6 ME 9 ME 12 ME RF RA PN PT

I.Ionizacin: % de antocianos totales que contribuyen al color del vino. (ZAMORA, 2003)

RESULTADOS
I.HCL
29,0 27,0 25,0 23,0 I.HCL 21,0 19,0 17,0 15,0 13,0 11,0 9,0 6 ME 9 ME 12 ME RF RA PN PT

I.HCl: % de taninos de un alto grado de polimerizacin. Valores >35-40% probablemente tendr lugar precipitacin (ZAMORA, 2003)

RESULTADOS
I.GELATINA
50,0 45,0 I.GELATINA (%) 40,0 35,0 30,0 25,0 6 ME 9 ME 12 ME RF RA PN PT

I.Gelatina: % de taninos capaces de reaccionar con las proteinas. Son los taninos astringentes. Suele disminuir con la crianza (valores comprendidos entre 40% al 60% suelen ser normales; <35% indican que el vino carece de cuerpo) (ZAMORA, 2003)

RESULTADOS
I.PVP
100,0 90,0 80,0 I.PVP 70,0 60,0 50,0 40,0 6 ME 9 ME 12 ME RF RA PN PT

I.PVP: % de antocianos que estn combinados con los taninos. Indica el grado de estabilidad del color del vino (ZAMORA, 2003)

RESULTADOS
Aldehdos furnicos: Furfural
7,00 6,00 5,00 Furfural 4,00 3,00 2,00 1,00 0,00 PN RF RA PN PT

Furfural: Termodregadacin de las hemicelulosas (hidrlisis de la hemicelulosa). Tiene aroma a almendra (u.p. 15 mg/L)

RESULTADOS
Aldehdos furnicos: 5Hidroximetilfurfural
3,00 5Hidroximetilfurfural 2,50 2,00 1,50 1,00 0,50 0,00 6 ME 9 ME 12 ME RF RA PN PT

5 Hidroximetilfurfural:Termodregadacin de las hemicelulosas (hidrlisis de la celulosa). Tiene aroma a almendra tostada (u.p. 15 mg/L)

RESULTADOS
Aldehdos fenlicos: Vainillina
0,80 0,70 0,60 Vainillina 0,50 0,40 0,30 0,20 0,10 6 ME 9 ME 12 ME RF RA PN PT

Vainillina: Tiene aroma a vainilla (u.p. 0,065 mg/L)

CATA
En la fase olfativa se han estudiado los siguientes descriptores: fruta, compota, vainilla-coco, especias (clavo), cuero, tostado, cacao, balsmico, vegetal, etanal, resina y brett (fenol). En la fase gustativa: grasa, estructura, astringencia, amargor, persistencia y equilibrio. Se hace repeticin de muestras en cata ciega para ver la eficacia de los ctadores Para el anlisis estadstico de los resultados se ha utilizado el programa BSS

F.OLFATIVA

F.O: Peso descriptores

Notas de fruta

Notas de vainilla-coco

Notas de especias

Notas de tostado

Notas de fenol

F.GUSTATIVA

F.G: Peso descriptores

Persistencia

Equilibrio

Indice hednico

Generadores hednicos

Agradecimientos: Proyectos de investigacin


INIA RTA03-037: Incidencia de las tcnicas de elaboracin sobre la flora levaduriforme y la composicin aromtica del vino en cultivares blancos autctonos de Galicia. IP: Pilar Blanco. INIA VIN03-029: Estudio del potencial enolgico y organolptico de tres cultivares blancos de vid autctonos de Galicia (Lado, Blanco Lextimo y Agudelo). IP: Pilar Blanco. Xunta de Galicia PGIDIT03TAL50501PR: Avaliacin do impacto dos tratamentos antifnxicos en variedades brancas galegas sobre a composicin do mosto, a cintica fermentativa e o vio. IP: Ignacio Orriols. INIA RM2006-00009-00-00: Identificacin y caracterizacin gentica de levaduras de inters enolgico aisladas en Galicia. IP: Pilar Blanco. Xunta de Galicia 08TAL002505PR: Utilizacin de lvedos autctonos illados na EVEGA para a diferenciacin e mellora da calidade dos vios galegos. IP: Pilar Blanco.

Agradecimientos: Proyectos de investigacin


INIA RTA2006-00138-00-00: Composicin qumica y aspectos tecnolgicos que condicionan el perfil sensorial de vinos y aguardientes de Galicia. IP: Sandra Corts Diguez. Xunta de Galicia 08TAL001505PR: Estudio da potencialidade do carballo galego para a elaboracin de vios tintos de crianza con personalidade propia. Caracterizacin qumica e sensorial IP: Ignacio

Orriols.

INIA RTA2009-00123-C02-01: Aplicacin de una columna de relleno en la destilacin de aguardiente de orujo y de frutas (kiwi y pera) para la obtencin de destilados de alto valor aadido. Empleo de una levadura autctona en la fermentacin de orujo y frutas para la obtencin de aguardientes. EVEGA, URV: IP: Ignacio Orriols Fernndez.

Investigacin con empresas


PGIDIT04TAL037E (2004). Elaboracin de vino tinto con variedades autctonas gallegas con diferentes sistemas de vinificacin para su posterior crianza en barrica. (COTO GOMARIZ) PGIDIT04TAL009E (2004). Desarrollo y seleccin de una coleccin autctona de micro-organismos de inters enolgico (levaduras y bacterias) a partir de material biolgico cedido por el I.F.I. (INNAVES) PGIDIT04TAL033E (2004). Estudio de la influencia de prcticas culturales y optimizacin de diferentes tcnicas enolgicas en la identificacin de uva albaria en la subzona Condado de Tea. (FILLABOA) PGIDIT05TAL005E (2005). Optimizacin de diferentes sistemas de destilacin para obtencin de aguardentes de orujo y destilados de frutas autctonas de calidad. (AGUARDIENTES DE GALICIA)

Investigacin con empresas


FEADER2007-11 (2007). Elaboracin y crianza de vino de DO Monterrei sobre roble gallego. Elaboracin de vinos dulces con distintas variedades de DO Monterrei con crianza sobre las durante 24 meses. (CRDO MONTERREI). FEADER2007-15 (2007). Produccin de Levaduras autctonas gallegas de inters enolgico. (INNAVES). FEADER2007-16 (2007). Aprovechamiento y valorizacin del kiwi destro mediante la obtencin de dos productos de alto valor aadido: aguardente a partir de sus fermentados y mermelada mediante altas presiones hidrostticas. (KIWI ESPAA). FEADER2007-18 (2007). Estudio y experimentacin sobre los destilados en alambique tradicional con bagazos y vinos de tintorera. Nuevas formas de destilacin. Valorizacin de los destilados de frutas autctonas de la zona de Chantada. (COOPERATIVA ORETA XIDA).

Investigacin con empresas


FEADER2008-6 (2008). Obtencin de aguardiente de calidad mediante mejora del proceso fermentativo del orujo. Elaboracin de un destilado de uva de Albario. Aprovechamiento de frutas del Val do Ulla (Pexegos) para elaborar aguardientes (AGUARDIENTES DE GALICIA) FEADER2008-10 (2008). Proyecto piloto para la mejora de la calidad del producto final en bodegas de la DO Ras Baixas mediante la innovacin en los procedimientos de gestin. (CRDO RIAS BAIXAS) FEADER2008-20 (2008). Elaboracin de vinos tostados y dulces con diferentes variedades de DO Valdeorras. (CRDO VALDEORRAS). FEADER2009-30 (2008). Elaboracin de un vino espumoso en la D.O Ras Baixas. (AS LAXAS).

Bolseiros de investigacin y otros:

Agradecimientos: recursos humanos

Andrea Ramilo; Patricia Rejas ; Adriana Surez ; Diego Cortias; Vanesa Surez; Olalla Lpez; Andrea Blanco; Iria Dacosta; Raquel Gonzlez ; Rubn Surez Pilar Blanco (Investigadora INGACAL) Esteban Pereira (Contratado INGACAL) Cristina Lpez (Contratada Medio Rural-Beca FPI-INIA) JA Domnguez (Personal laboral de Evega) Andrea Tato (Contratada Tragsa)
Mara Vzquez Aln; Xandra Estvez Melndez

Contratos:

Proxectos fin de carreira: Persoal de EVEGA:

Seccin Enologa EVEGA (Alfonso Losada y personal colaborador) Seccin Viticultura EVEGA (Francisco Rego y personal colaborador) Seccin Laboratorio Anlisis (Juan Luis Casas, Daniel Fornos y personal colaborador) Direccin de EVEGA (Dr.Ignacio Orriols)

Estacin de Viticultura y Enologa de Galicia. Ponte San Clodio s/n. 32427 LEIRO (Ourense) Telfono: 988/488033-488044; Email: evega@cesga.es