Está en la página 1de 5

EXAME FINAL DE MTODOS E TCNICAS DE ESTUDO EN XENTICA

CURSO 2010-2011
16 de febreiro de 2011

Nome e apelidos:

As preguntas 8, 15, 23, 27 y 30 valen 2 puntos cada unha. Cada unha das demis ten un valor de 1,2 puntos. As
respostas incorrectas teen unha penalizacin de 1/5 do valor da resposta correcta.

1. Es mejor usar redes filogenticas en lugar de rboles filogenticos ...
a) cuando se cree que se han producido procesos de hibridacin, pero no de transferencia horizontal de genes.
b) en cualquier caso.
c) si queremos hacer un anlisis concatenado.
d) en ningn caso.
e) cuando se cree que se han producido procesos de hibridacin, entrecruzamiento y transferencia horizontal de genes.
2. S, s y ! son:
a) estimadores de la divergencia entre secuencias de ADN y entre especies.
b) estimadores de la divergencia entre especies, pero no entre secuencias de ADN.
c) medidas del polimorfismo de una regin genmica en estudio.
d) medidas del polimorfismo de genes codificadores de protenas o ARNs, pero no de otro tipo de regiones (como por
ejemplo, regiones espaciadoras).
e) todas son falsas.
3. Mxima parsimonia, Neighbor-joining, anlisis bayesiano y mxima verosimilitud son mtodos de construccin
filogentica:
a) basados en el estado del carcter.
b) basados en distancias.
c) basados en el estado del carcter o en distancias.
d) y todos excepto el anlisis bayesiano estn basados en distancias.
e) y todos excepto la mxima parsimonia estn basados en el estado del carcter.
4. El procedimiento correcto para calcular la diversidad nucleotdica, segn hicimos en clase, sera:
a) alinear las secuencias en el PDA, copiar el alineamiento y llevarlo al Phylemon y all calcular la !.
b) alinear las secuencias en el PDA, copiar el alineamiento y llevarlo al Clustal y all calcular la !.
c) alinear las secuencias en el Clustal, cambiar el formato a fasta (manualmente o a travs de alguna aplicacin web), copiar
el alineamiento y llevarlo al Phylemon, y all calcular la !.
d) alinear las secuencias en el Clustal, cambiar el formato a fasta (manualmente o a travs de alguna aplicacin web), copiar
el alineamiento y llevarlo al PDA, y all calcular la !.
e) alinear las secuencias manualmente, cambiar el formato a PIR (manualmente o a travs de alguna aplicacin web),
copiar el alineamiento y llevarlo al PDA, y all calcular la !.
5. Qu secuencia est en formato PIR?
a) >Homo_neanderthalensis_COX1
individuo procedente de la pennsula Ibrica
ATGTGGATTATATATAGGCTTATGGATTCTATGATC*
b) >DL;Homo_neanderthalensis_COX1
individuo procedente de la pennsula Ibrica
ATGTGGATTATATATAGGCTTATGGATTCTATGATC*
c) >DL;Homo_neanderthalensis_COX1
ATGTGGATTATATATAGGCTTATGGATTCTATGATC*
d) >DL;Homo_neanderthalensis_COX1
individuo procedente de la pennsula Ibrica*
ATGTGGATTATATATAGGCTTATGGATTCTATGATC
e) >DL;Homo_neanderthalensis_COX1*
individuo procedente de la pennsula Ibrica
ATGTGGATTATATATAGGCTTATGGATTCTATGATC

6. Un outgroup debe ser:
a) Una secuencia de la regin genmica que estemos considerando, procedente de una especie no perteneciente al grupo
que queremos estudiar, y que no est demasiado alejada filogenticamente del mismo.
b) Una secuencia de la regin genmica que estemos considerando, procedente de una especie no perteneciente al grupo
que queremos estudiar, y que est muy alejada filogenticamente del mismo.
c) Una secuencia de diferente regin genmica a la del ingroup que estemos considerando, procedente de una especie
perteneciente al grupo que queremos estudiar, y que no est demasiado alejada filogenticamente del mismo.
d) Una secuencia de un gen codificador para protenas.
e) Todas son falsas.
7. Cuando en un artculo encontramos un nmero de acceso y queremos descargar la secuencia correspondiente, podemos
hacerlo en:
a) GenBank solamente.
b) GenBank, EMBL y DDBJ.
c) GenBank y DDBJ solamente.
e) PDA y GenBank.
d) GenBank, EMBL y Clustal.
8. Dado el siguiente rbol filogentico sin enraizar, seale cul de las siguientes afirmaciones es correcta:

a) El grupo formado por D, F, G y H y el grupo formado por B, A, C y E son recprocamente monofilticos.
b) F y G forman un grupo monofiltico respecto del resto de secuencias.
c) D, G y H forman un grupo parafiltico, ya que no incluye F.
d) todas son falsas.
e) todas menos d) son ciertas.
9. Dada la siguiente matriz de distancias genticas calculadas segn el modelo de Kimura-2-parmetros:

a) A y C son las especies menos divergentes para la regin genmica considerada, mientras que C y D son las ms
divergentes.
b) A y B son las especies menos divergentes para la regin genmica considerada, mientras que A y D son las ms
divergentes.
c) B y E son las especies menos divergentes para la regin genmica considerada, mientras que A y C son las ms
divergentes.
d) A y C son las especies menos divergentes para la regin genmica considerada, mientras que C y E son las ms
divergentes.
e) A y B son las especies menos divergentes para la regin genmica considerada, mientras que C y D son las ms
divergentes.

8. Dado el siguiente arbol Iilogenetico sin enraizar:
a) El grupo Iormado por D, F, G y H y el grupo Iormado por B, A, C y E son reciprocamente
monoIileticos.
b) F y G Iorman un grupo monoIiletico respecto del resto de secuencias.
c) D, G y H Iorman un grupo paraIiletico, ya que no incluye F.
d) todas son Ialsas.
!"#$%&'(#)!*%(#&"#(%*#+,!-$'(.
9) Dada la siguiente matriz de distancias geneticas calculadas segun el modelo de Kimura-2-
parametros:
a) A y C son las especies menos divergentes para la region genomica considerada, mientras que C y
D son las mas divergentes.
b) A y B son las especies menos divergentes para la region genomica considerada, mientras que A y
D son las mas divergentes.
c) B y E son las especies menos divergentes para la region genomica considerada, mientras que A y
C son las mas divergentes.
d) A y C son las especies menos divergentes para la region genomica considerada, mientras que C y
E son las mas divergentes.
!"#/#0#1#(%*#2'(#!(3!+,!(#)!*%(#&,4!-5!*$!(#3'-'#2'#-!5,6*#5!*6),+'#+%*(,&!-'&'7#),!*$-'(#
89!#:#0#;#(%*#2'(#)<(#&,4!-5!*$!(.
10. Cuantos genes codiIicadores para ARN ribosomico aparecen en los genomas mitocondriales
estudiados en clase?:
'"#;%(7#!2#/=>-?2#@%#5-'*&!A#/=>-#BCD"#0#!2#/=>-?(#@%#3!89!E%A#/=>-#BFD".
b) Dos, el ARNr 12S y el ARNr 13S.
c) Uno por aminoacido.
d) Uno, el ARNr 18S.
e) Todas son Ialsas.
8. Dado el siguiente arbol Iilogenetico sin enraizar:
a) El grupo Iormado por D, F, G y H y el grupo Iormado por B, A, C y E son reciprocamente
monoIileticos.
b) F y G Iorman un grupo monoIiletico respecto del resto de secuencias.
c) D, G y H Iorman un grupo paraIiletico, ya que no incluye F.
d) todas son Ialsas.
!"#$%&'(#)!*%(#&"#(%*#+,!-$'(.
9) Dada la siguiente matriz de distancias geneticas calculadas segun el modelo de Kimura-2-
parametros:
a) A y C son las especies menos divergentes para la region genomica considerada, mientras que C y
D son las mas divergentes.
b) A y B son las especies menos divergentes para la region genomica considerada, mientras que A y
D son las mas divergentes.
c) B y E son las especies menos divergentes para la region genomica considerada, mientras que A y
C son las mas divergentes.
d) A y C son las especies menos divergentes para la region genomica considerada, mientras que C y
E son las mas divergentes.
!"#/#0#1#(%*#2'(#!(3!+,!(#)!*%(#&,4!-5!*$!(#3'-'#2'#-!5,6*#5!*6),+'#+%*(,&!-'&'7#),!*$-'(#
89!#:#0#;#(%*#2'(#)<(#&,4!-5!*$!(.
10. Cuantos genes codiIicadores para ARN ribosomico aparecen en los genomas mitocondriales
estudiados en clase?:
'"#;%(7#!2#/=>-?2#@%#5-'*&!A#/=>-#BCD"#0#!2#/=>-?(#@%#3!89!E%A#/=>-#BFD".
b) Dos, el ARNr 12S y el ARNr 13S.
c) Uno por aminoacido.
d) Uno, el ARNr 18S.
e) Todas son Ialsas.
10. Cuntos genes codificadores para ARN ribosmico aparecen en los genomas mitocondriales estudiados en clase?:
a) Dos, el ARNr-l (o grande: ARNr 16S) y el ARNr-s (o pequeo: ARNr 12S).
b) Dos, el ARNr 12S y el ARNr 13S.
c) Uno por aminocido.
d) Uno, el ARNr 18S.
e) Todas son falsas
11. Estos resultados se han obtenido del cruzamiento de los machos "jump start" con hembras 2475:
Ojos Alas Quetas Hembras Machos
rojos silvestre Stubble 38 7
rojos Curly silvestre 0 0
rojos Curly Stubble 9 3
rojos silvestre silvestre 51 5
blancos silvestre Stubble 0 19
blancos Curly silvestre 0 0
blancos Curly Stubble 0 21
blancos silvestre silvestre 0 34
Cul de estas mutaciones est ligada a la insercin P[!2-3]? Cul es su fenotipo y su carcter?
a) Stubble; letal, recesivo; quetas cortas y gruesas, dominante.
b) Curly; letal, recesivo; alas curvadas, dominante.
c) Ninguna de ellas; la insercin est ligada al alelo silvestre del gen Stubble.
d) Stubble; letal, quetas cortas y gruesas, dominante.
e) Curly; letal, quetas cortas y gruesas, dominante.
12. Qu fenotipo tienen los individuos que llevan inserciones P[lacW]?
a) Ojos rojos
b) Ojos blancos
c) Quetas cortas y gruesas
d) Alas curvadas
e) LAC-
13. Cuntos individuos del cruzamiento anterior llevan inserciones P[lacW]?
a) 98
b) 113
c) 15
d) 89
e) 0
14. Cuntos individuos llevan nuevas inserciones de P[lacW] en sus autosomas?
a) 34
b) 21
c) 74
d) 12
e) 15
15. Cuntos individuos llevan nuevas inserciones estables de P[lacW] en sus autosomas?
a) 10
b) 51
c) 34
d) 3
e) 5
16. Cambiemos de tema. Para qu se utilizan los geles bidimensionales?
a) Para separar fragmentos de ADN
b) Para separar fragmentos de ARN
c) Para separar diferentes proteinas
d) Para observar una proteina en dos dimensiones
e) Para separar ADN de ARN

17. Cul es la explicacin ms probable para la existencia de pseudogenes?
a) Duplicacin gnica
b) Duplicacin gnica y sucesos mutacionales
c) Mutaciones puntuales
d) Entrecruzamiento desigual
e) Seleccin purificadora
18. Los VNTRs son ...
a) variables en nmero
b) usados para determinar la huella gentica
c) secuencias de ADN
d) repeticiones en tndem
e) todas las respuestas sealan caractersticas autnticas de los VNTRs.
19. Los RFLPs no ...
a) se utilizan para construir mapas de ligamiento
b) son cortados por enzimas de restriccin
c) son secuencias polimrficas de ADN
d) se utilizan para determinar la huella gentica
e) se utilizan como marcadores genticos
20. Qu ventajas tiene utilizar microarrays de ADN para encontrar mutaciones en un nico par nucleotdico respecto a la
hibridacin sobre filtro?
a) Se pueden efectuar cientos de miles de experimentos al mismo tiempo.
b) Se pueden utilizar clulas completas como fuente de ADN molde.
c) No se necesitan sondas.
d) No es necesario hacer una PCR.
e) Los microarrays se pueden leer a simple vista.
21. Los microarrays son ...
a) pequeos chips de cristal que pueden contener cientos de miles de sondas especficas de ADN.
b) chips microscpicos de cientos de ADNs de distintas especies que se utilizan como molde para una hibridacin in-situ.
c) expuestos a ADN digerido, desnaturalizado y marcado con fluorescencia para detectar la hibridacin.
d) Tanto (a) como (c) son respuestas correctas.
e) soportes planos que contienen ordenadamente ADNs digeridos, desnaturalizados y marcados con fluorescencia.
22. Cul de las siguientes caractersticas no est asociada a un microarray?
a) ordenado
b) microscpico
c) desnaturalizable
d) plano
e) especfico
23. Mediante anlisis de ligamiento, usted ha conseguido situar un gen en una regin de 1 Mb de un determinado
cromosoma. Cul de las siguientes aproximaciones sera menos til para llegar a identificar y clonar el gen en cuestin?
a) Anlisis de polimorfismo de conformacin de hebra nica (SSCP).
b) Anlisis comparativo de la secuencia nucleotdica en distintas especies.
c) Secuenciacin de ADN.
d) Aislamiento de islotes CpG.
e) Hibridacin in-situ radiactiva.
24. El Northern blot se utiliza para ..
a) Detectar polimorfismos en anlisis de ligamiento.
b) Analizar variacin proteica.
c) Analizar secuencias de ADN.
d) Analizar la expresin gnica en distintos tejidos.
e) Completar en una segunda dimensin el anlisis de un Southern blot.
25. La enfermedad de Huntington es causada por una mutacin de ganancia de funcin. Qu tipo de terapia gnica sera
entonces potencialmente ms efectiva para tratar esta enfermedad?
a) Reemplazamiento mediante vectores retrovirales.
b) Reemplazamiento mediante vectores adenovirales.
c) Reemplazamiento mediante vectores vricos adeno-asociados
d) Terapia antisentido
e) Todas las anteriores
26. En cul de las siguientes situaciones no tendra sentido aconsejar un diagnstico prenatal mediante amniocentesis?
a) Hijo anterior con una seria anomala cromosmica.
b) Ambos padres son heterocigotos para una mutacin que causa la enfermedad de Tay-Sachs.
c) Ambos padres sufren un desorden afectivo bipolar (son manaco depresivos).
d) La edad de la madre supera los 35 aos.
e) Uno o varios hijos anteriores presentaron defectos en el tubo neural.
27. Cul de los siguientes mtodos no estara implicado en el anlisis de un locus que afecta a un carcter cuantitativo
(QTLs), normalmente asociado al mayor o menor grado con el que se manifiesta una enfermedad?
a) Anlisis de ligamiento.
b) Cruzamientos entre animales de experimentacin.
c) Bsqueda de ortlogos humanos mediante sondas de otras especies.
d) Estima de la heredabilidad.
e) Clonacin posicional del gen causante de la enfermedad.
28. En un mtodo de estudio en gentica, el ADN desnaturalizado de cromosomas metafsicos se hibrida con un sonda
marcada radiactivamente. Este ADN luego se expone a una pelcula para revelar la localizacin cromosmica aproximada
del ADN hbrido. Cul de las tcnicas siguientes corresponde mejor a esta descripcin?
a) Southern blotting.
b) Hibridacin in-situ.
c) Hibridacin de clulas somticas.
d) Hibridacin in-situ fluorescente.
e) Anlisis SSCP.
29. Suponga que est intentando encontrar el gen causante de una enfermedad, y que ha identificado un cierto nmero de
familias en las que se transmite hereditariamente dicha enfermedad. Si no tiene ningn conocimiento del producto de este
gen, ni tampoco ningn locus candidato, cul de las siguientes tcnicas sera la primera que debera utilizar?
a) Anlisis de ligamiento.
b) Secuenciacin de ADN.
c) Anlisis SSCP.
d) Electroforesis en gel de gradiente desnaturalizante (DGGE).
e) Hibridacin in-situ fluorescente (FISH).
30. Suponga ahora que tiene un razonable locus candidato para la enfermedad que est estudiando. Cul de las siguientes
tcnicas sera la que probablemente le dara menos informacin til?
a) Secuenciacin de ADN.
b) Anlisis mediante SSCP.
c) Northern blotting.
d) Anlisis mediante DGGE.
e) Cariotipado cromosmico.