Está en la página 1de 53

Causas y Avances Genticos en los Trastornos del Espectro Autista

Angel Carracedo
Fundacin Pblica Galega de Medicina Xenmica- SERGAS CEGEN-Universidade de Santiago de Compostela

Bata Vilargaca 2013

Qu es la Gentica y el Genoma y como estn organizados nuestros genes? Cules son las bases genticas de los TEA y por qu es importante entenderlas?

El genoma es...
El conjunto completo de genes de un organismo, donde se guarda toda la informacin genetica.

3.200.000.000 de pares de bases (A, T, C, G)

GENOMA HUMANO
3.300.000.000 de pares de bases (A, T, C, G)

Alrededor de 25.000 genes

ATACCTGCGTCGGATGCTGCGATTGCTGACCAACATCGTGACAGTTAGACAAACGATTGAC TGTTAGGATTGACCACCAATTACGATGACGTTGG

Frederik Sanger

ATCGGCTAGCTGATCGACGATGACCGTAG CGTTGATCGGTAGGCTAGCTGAAACTTAAC GGA SNPs ATCTACGGATGGCTGACTGATG ATCTACGGATGGCTGACTGATG ATCTACGGATGGCTGACTGATG

Minisatellites

GATA GATA GATA GATA GATA GATA GATA GATA ATTACTGATCGGTAGCTGAGCCAATGGCA GTGATGGATGGTAGCTGAGTGCTGGACAT
MUTACIONES CON ESE SOL HAY MAS LUZ CON ESA SAL HAY MAS LUZ ONE SES OLH AYM ASL UZ

CNVs- Duplication deletions (15-20%)

CNV: fragmento de ADN de tamao 1 kb y que est presente en nmero de copia variable en relacin a un genoma de referencia.

Delecin homocigota CN: 0

Delecin hemicigota CN: 1

Normal CN: 2

PRDIDAS (deleciones hemicigotas y genotipos nulos o deleciones homocigotas). GANANCIAS (inserciones, duplicaciones y amplificaciones).

Copy neutral LOH UPD CN: 2

Amplificacin CN: 6

Deteccin y caracterizacin de CNVs mediante arrays de SNPs

El trmino CNV no implica datos de frecuencia: CNV polimrfica, polimorfismo de nmero de copia o CNP si > 1%. CNV rara si < 1%.

La mayor parte de los CNVs no tienen implicacin en las patologas y son solo variacin normal pero perdidas o ganancias de copias pueden ser causa de enfermedad
Base de datos de variantes genmicas: Data Base of Genomic Variants http://projects.tcag.ca/variation/

TEA SINDRMICOS

TEA NO SINDRMICOS

Currently a genetic cause can be identified in 20%-25% of children with autism


Chromosomal abnormalities (~5%) Rubella Specific Cytomegalovirus Single gene disorders Alcohol teratogenic (~5-7%) Valproic acid exposures (~2%) Thalidomide Misoprostol CNVs Duplication Deletions 20% Complex (~70%)

Cromosopatas y defectos estructurales

Cariotipo

Arrays de CGH (Hibridacin genmica comparada)

PCR

FISH Hibridacin fluorescente in situ

Microarrays de SNPs y sondas para CNVs

Chromosomal

Disorders (5%)

Trisomy 21. Children with Down syndrome have autism more commonly than expected. The incidence was at least 7% in one study [Kent et al 1999] 45X Turner syndrome. 45X/46XY mosaicism 47XYY del7q del22q11.2 Del22q13.3 del2q37 del18q delXp22.3

Williams Deletion Region

New findings about Williams syndrome may shine light on autism research Journal of Neuroscience , 2010

Maternally derived duplication of the Prader-Willi/Angelman syndrome critical region (15q11-q13) is the most commonly observed chromosome abnormality in autism, detected in 1%-3% of children with autism. Most commonly this duplication is the result of a de novo supernumerary isodicentric 15q chromosome and less commonly the result of segregation of a parental chromosome translocation or a maternally derived interstitial 15q duplication.

Single gene disorders (5%)


Fragile X syndrome. Whereas 1% to 3% of children ascertained on the basis of an autism diagnosis have fragile X syndrome, at least half the children with fragile X syndrome have some autistic behaviors

Single Genetic Disorders (molecular) PTEN germiline mutations Rett syndrome Smith-Lemli-Opitz syndrome Smith-Magenis syndrome Tuberous Sclerosis CHARGE syndrome Sotos syndrome Hypomelanosis of Ito San Filippo syndrome Cornelia de Lange syndrome Williams syndrome Timothy syndrome Joubert syndrome NF1 WAGR Duchenne muscular dystrophy

mtDNA
Disorders of purine metabolism Disorders of pyrimidine metabolism Unknown sulfation defect Disorders of GABA metabolism Disorders of creatine metabolism

CNVs- Duplication deletions (15-20%)

16p11.2 deletion is characterized by developmental delay, intellectual disability, and/or autism spectrum disorder (ASD). Developmental delays are more related to diminished language and cognitive function than motor disability.. Weiss et al [2008] reported 16p11.2 deletions or duplications in approximately 1% of individuals with autism and 1.5% of children with developmental or language delays A large-scale survey of the novel 15q24 microdeletion syndrome in autism spectrum disorders identifies an atypical deletion that narrows the critical region McInnes et al. Molecular Autism 2010 1:5 doi:10.1186/2040-2392-1-5

Mefford HC et al. N Engl J Med 2012;366:733-743.

Affymetrix CytoScan HD Array

Affymetrix CytoScan HD Array: SOFTWARE Y VISUALIZACION

DISCAPACIDAD INTELECTUAL SEVERA. TEA. EJEMPLO DE DI DE HERENCIA LIGADA AL X (MRX60, MIM# 300486) AFECTO 8E011 (varn) MADRE 1H240 NO PORTADORA

AFECTO: delecin en cromosoma X (varn) Madre SANA: no portadora de la delecin DELECIN de novo en Xq12 afectando a gen OPHN1 (gen que codifica la protena activadora de GTPasa Rho cuya LOF est asociada con DI ligada al X (Kasri et al., 2009)).

Deteccin y caracterizacin de CNVs mediante arrays de SNPs

DISCAPACIDAD INTELECTUAL SEVERA. TEA. EJEMPLO DE TEA SINDRMICO: SINDROME DE WOLF-HIRSCHHORN (MIM# 194190)
Nombres alternativos: Sndrome de la delecin 4p16.3 Sndrome de PITT-ROGERS-DANKS; PRDS Sndrome de PITT

FAMILIA 8B710 y 9H424

AFECTO: delecin en hemicigosis Madre SANA: no portadora de la delecin


DELECIN en 4p16.3 afectando a mltiples genes

Risk to Family MembersAutism of Unknown Cause


The empiric aggregate risk to sibs of individuals with autism of unknown cause varies across studies but is generally considered to range from 5% to 10% for autism and 10% to 15% for milder symptoms, including language, social, and psychiatric disorders [Bolton et al 1994, Lauritsen et al 2005, Miles et al 2005, Landa 2008, Selkirk et al 2009]. For families with two or more affected children, the recurrence risk approaches 35% [Ritvo et al 1989].

NGS

Mefford HC et al. N Engl J Med 2012;366:733743.

Clinical Genetic Testing for Patients With Autism Spectrum Disorders excluding single gen disorders
Karyotype yielded abnormal results in 3% Fragile X testing was abnormal 2% CNVs identified deletions or duplications in 20%
Affy Cytoscan 300 (reagents) 20% Fragil X 200 (reagents) (25%)

Exome analysis 700 (reagents) (30-35%)

Mefford HC et al. N Engl J Med 2012;366:733-743.

Currently a genetic cause can be identified in 20%-25% of children with autism


Chromosomal abnormalities (~7%) Specific Single gene disorders teratogenic (~5%) exposures (~2%) CNVs Duplication Deletions 15-20% ComplexUnknown (~70%)

Human Genetic Association Study Design


TEA NO TEA

Allele 1

Allele 2

Marker A: Allele 1 = Allele 2 =

Marker A is associated with Phenotype

SNP: SINGLE NUCLEOTIDE POLYMORPHISM ATCGGCGTACCTGATTCCGAATCCGTATCG ATCGGCGTACCTGAATCCGAATCCGTATCG

3.3 Gigabases Human Genome / >18 M SNP

1 SNP/<200 bp

1M SNPs 1M Tag SNPs identified

CENTRO NACIONAL DE GENOTIPADO CEGEN-ISCIII

Scientific advisory board

Board

Coordination

NODE 1 Santiago de Compostela (USC)

Management unit

NODE 2 Madrid (CNIO)

Illumina 1K Affymetrix 6.0 AXIOM

Assessing the impact of a combined analysis of four common low-risk genetic variants on autism risk. Carayol et al. Molecular autism 2010: 1:4

Results In both samples, odds ratios (ORs) increased significantly as a function of the number of risk alleles, with a genetic score of 8 being associated with an OR of 5.54 (95% confidence interval [CI] 2.45 to 12.49). The sensitivities and specificities for each genetic score were similar in both analyses, and the resultant area under the receiver operating characteristic curves were identical (0.59). Conclusions These results suggest that the accumulation of multiple risk alleles in a genetic score is a useful strategy for assessing the risk of autism in siblings of affected individuals, and may be better than studying single polymorphisms for identifying subgroups of individuals with significantly greater risk.

Next-Generation Sequencing Technologies


Technology 454 Illumina SOLiD HeliScope Ion Torrent PacBio Sequencing method Synthesis (Pyrosequencing) Synthesis Ligation Synthesis Synthesis (H+ detection) Synthesis Ampliifcation method emPCR Bridge PCR emPCR None emPCR None Read lenght (bp) 400 -1000 100+100 75+35 35 100 860-1100 Throughput (Mb/run) 50-500-900 1020-600000 100000-180000 28000 10 -100-1000

Single DNA Molecule Technologies

Recurrent protein-altering mutations were observed in two genes:CHD8 and NTNG1. M

Trends Cogn Sci. 2012 Jan;16(1):81-91. Epub 2011 Dec 10. Neurocognitive endophenotypes of impulsivity and compulsivity: towards dimensional psychiatry. Robbins TW, Gillan CM, Smith DG, de Wit S, Ersche KD