Está en la página 1de 422

BIOFIZIKA

..., kai materija organizuota ir gyva, turi j veikti kakokia ypatinga jga, kuri j, ali, beform ir nejaudri, sudlioja organin form ir suria. ... Neatsivelgdami jos prigimt, toliau j vadinsime organizuojanija, arba organine, jga.

ORGANINI BTYBI TEORIJA,

Vilnius-Varuva 18041811m.

Andrius Sniadeckis (17681837)


GYVYBS ORGANIZUOTOS VEIKLOS TEORIJOS PRADININKAS

Vadovlis skiriamas prof. Andriaus Sniadeckio molekulins ir bioinformacins biologijos idj kilms Vilniaus universitete 200-osioms metinms

DOBILAS KIRVELIS

BIOFIZIKA
Vadovlis

VILNIAUS

UNIVERSITETO LEIDYKLA ,

2007

L IETUVOS R ESPUBLIKOS
IR MOKSLO MINISTERIJOS

VIETIMO

AUKTJ MOKYKL BENDRJ VADOVLI LEIDYBOS KOMISIJOS REKOMENDUOTA

2004-12-10; N R. A-255 A PSVARST IR REKOMENDAVO SPAUSDINTI VILNIAUS UNIVERSITETO G AMTOS MOKSL FAKULTETO TARYBA (2002-05-22; NR. 16)

R ECENZENTAI :

prof. R. Rakauskas doc. dr. K. Konstantinaviius

RM

LEIDINIO RENGIM L IETUVOS M OKSLO

IR STUDIJ FONDAS

I LEISTA L IETUVOS R ESPUBLIKOS


VIETIMO IR MOKSLO MINISTERIJOS LOMIS

UDK 577.3(075.8) Ki-186 ISBN 978-9955-33-055-4 Dobilas Kirvelis, 2007 Vilniaus universitetas, 2007

4
BIOFIZIKA

TURINYS
1 SKYRIUS. v a d a s

11

1.1. Kas yra biofizika? 12 1.2. Metodinis poiris 19 1.3. Informacinis udarasis kodavimas ir dekodavimas gyvybs esms paradigma 24 1.4. Udarai valdomas kodavimas ir dekodavimas informacins procedros 28 1.5. Gyvyb organizuota sistema 30 1.6. Gyvyb tikslingai funkcionuojanti sistema 32 1.7. Istoriniai biofizikos tarpsniai 33 1.8. Sistem biofizikos raida iekant organizuotumo ir organizuojani veiksni informacijos 44 1.9. ingsniai neuroinformatik ir psichofizik 49 1.10. Gyvybs savaimins organizacijos, kilms, esms ir evoliucijos biofizikos pradmenys 53

2 S K Y R I U S . Biologin sistema termodinamikos poiriu

57

2.1. Pagrindins svokos 58 2.2. Sistemos vidin energija ir pirmasis termodinamikos dsnis 61 2.3. Gyvojo pasaulio energjos vyksmai 64 2.4. Biochemini reakcij darbas 67 2.5. Energijos apykaita su aplinka 69 2.6. Heso dsnis pirmojo termodinamikos dsnio atmaina 71 2.7. Energijos tverms dsnis mogui 75 2.8. Gyvybs energijos virsm naudingumo koeficientas 77 2.9. Laisvoji ir nelaisvoji (suritoji) energijos 78 2.10. Entropija 79 2.11. Antrasis termodinamikos dsnis (izoliuotajai sistemai) 82 2.12. Antrasis termodinamikos dsnis. Prigoino lygtis 84 2.13. Negrtam vyksm termodinamika 86 2.14. Fenomenologins termodinamikos lygtys 87 2.15. Prigoino principas 89 2.16. Gyvyb disipatyvioji sistema 92

3 S K Y R I U S . Biologini vyksm kinetins organizacijos pagrindai

93

3.1. 3.2. 3.3. 3.4. 3.5. 3.6. 3.7. 3.8. 3.9. 3.10.

3.11. 3.12. 3.13. 3.14. 3.15. 3.16.

Chemini reakcij kinetika. Veikianij masi dsnis 95 Paprasiausios chemins reakcijos kinetika 97 Paprasiausios grtamosios chemins reakcijos kinetika 98 akotosios chemins reakcijos kinetika 100 Grandinins chemins reakcijos kinetika 102 Atvirosios chemins sistemos kinetika 103 Ciklins chemins reakcijos kinetika (ciklai) 106 Chemini ir biochemini reakcij greiio priklausomyb nuo temperatros 108 Fermentins reakcijos kinetika 110 3.9.1. Michaelio ir Menten lygtis 110 3.9.2. Fermentins reakcijos, turinios slopinomj kinetik 113 Dviej sveikaujani vyksm kinetika. Puankar modelis 117 3.10.1. Dviej nesusijusi vyksm modeliai 119 3.10.2. Dviej susijusi vyksm paprasiausi modeliai 121 3.10.3. Dviej sveikaujani vyksm kinetikos bendrasis modelis 123 3.10.4. Sveikaujani vyksm sistemos kokybin kinetika 126 Daugelio vyksm dinamin sistema 133 3.11.1. Kokybin dinamins sistemos matrica 134 3.11.2. Hierarchin ir visika plra 137 Netiesins kinetikos modeliai 139 Disipacin struktra 145 Kiti grtamieji ryiai 146 Katastrofos 147 Chaoso sistemos ir fraktalai 148
4 S K Y R I U S . Teoriniai organizuot sistem pagrindai

(vadas kibernetik)

153

4.1. 4.2. 4.3. 4.4.

Udarojo kodavimo ir dekodavimo samprata 156 Kodo samprata 161 Organizuota valdoma sistema 163 Reguliatorius paprasiausia kodavimo ir dekodavimas sistema 4.4.1. Dinamin sistema plrnas ir auka reguliuoja 166 4.4.2. Kibernetinis reguliatorius kaip informacijos grandin kanalas 168 4.4.3. Reguliatorius disipatyvioji sistema 171 4.4.4. Reguliatorius paprasiausia organizuota sistema 172 4.5. Informacija reikalinga valdymui 172 4.5.1. Informacijos istorija 173 4.5.2. Informacija ir jos kiekio samprata 174
6
BIOFIZIKA

165

4.6. 4.7. 4.8.

4.9. 4.10.

Informacijos talpis ir dekodavimo medis 175 Priimtas ir perduotas informacijos kiekis 177 Informacijos perteklius 180 Klasikin kodavimo ir dekodavimo struktra (anono ryio linija) 180 Dekodavimas kaip valdymas 187 Signalai kaip atspindiai 190 4.7.1. Signalai ir grandys 191 Integralins transformacijos kaip kodavimo ir dekodavimo procedros 194 4.8.1. Sska kaip kodavimo ir dekodavimo procedra 195 4.8.2. Diskretusis kodavimas ir dekodavimas 196 4.8.3. Laplaso ir Furj integralins transformacijos kodavimas ir dekodavimas 198 4.8.4. Kitos ortogonaliojo transformavimo, arba kodavimo ir dekodavimo, sistemos 200 4.8.5. Kodavimas diskretizavimas (anono ir Kotelnikovo teorema) 202 4.8.6. Kitokios kodavimo ir dekodavimo sampratos 203 Organizuot sistem valdymo principai 205 4.9.1. Valdymo bdai 205 Kibernetins valdymo sistemos, atsivelgiant paskirt 207 4.10.1. Komandiniai (loginiai) automatai 208 4.10.2. Reguliavimo sistemos (reguliatoriai ir stabilizatoriai) 209 4.10.3. Sekimo sistemos (servosistemos) 209 4.10.4. Programinio valdymo sistemos 210 4.10.5. Optimalaus reguliavimo sistemos 211 4.10.6. Anticipacins prognozuojaniosios sistemos 214 4.10.7. Adaptyviosios sistemos 215 4.10.8. Savitvarks (save organizuojanios) ir kitos organizuotos sistemos 217
5 S K Y R I U S . Lstel organizuota sistema

4.5.3. 4.5.4. 4.5.5. 4.5.6.

219

5.1. Noimano automatas lstels modelis 222 5.2. Bendroji biologins lstels struktra 223 5.3. Lstels gyvavimo ciklai valdymo biologine informacija procedros 225 5.4. Lstel informacinio valdymo organizuota sistema 5.5. Lstel kodavimo ir dekodavimo sistema 230 5.6. Genetinis kodas 232 5.7. Fosfolipidins erdvskyros lstels sienos 237 5.8. Lstels organizuotos sistemos schema 239
7

227

5.9. Operonas molekulin lstels biotechnologin dekodavimo sistema 242 5.10. Matematinis operono veiklos modelis 245 5.11. Lac operono schema 249 5.12. Operon sveika 250 5.13. Eukariotins lstels gen raikos tinklas 251 5.14. Lstels ciklo valdymas 252 5.15. Fizikocheminis lstels modelis (Gibso ir Donano pusiausvyra) 254 5.16. Mediag pernaa lstelje 258 5.17. Bioelektriniai lstels potencialai 260 5.18. Veikimo potencialo sklidimas (Kabelio teorijos taikymas) 263 5.19. Elektrini membranos savybi netiesikumas 266 5.20. Elektrokinetinis potencialas 267 5.21. Lasteli augimo dsniai 268 5.22. Apoptoze programuota lastels mirtis 271
6 S K Y R I U S . Organizmas organizuota sistema

275

6.1. Daugialstis organizmas 278 6.2. Lasteli diferenciacijos modelis (Trigerin akobo ir Mono schema) 280 6.3. Organizm valdymas hormonais 284 6.3.1. Lastels taikinio, arba agento, funkcin organizacija 6.4. Organizmo valdymas nerviniais tinklais 288 6.4.1. Bendroji nerv sistemos funkcin struktra 289 6.5. Jutimo organ biofizika 292 6.5.1. Jutimo organ informacijos perdavimo greiiai 293 6.5.2. Psichofizikos dsniai 296 6.6. Funkcin neurono charakteristika 301 6.7. Neuron tinklas 307 6.8. Neuron sluoksniai 313 6.9. Mokslusis, arba adaptyvusis, neuron tinklas 319 6.10. Raumen posistemio veiklos principai 321
7 S K Y R I U S . Populiacij biofizika

287

327

7.1. Populiacija ir jos didjimo dsniai 329 7.1.1. Eksponentinis, arba Maltuso populiacijos didjimo dsnis 330 7.1.2. Logistinis populiacijos dauginimosi dsnis 332 7.1.3. Logistinis populiacijos dauginimosi dsnis vlinimo atvejui. Hatinsono modelis 336 7.1.4. Populiacijos amiaus svarba 336 7.1.5. Diskretusis logistinis populiacijos dauginimasis 337
8
BIOFIZIKA

7.2. 7.3. 7.4. 7.5. 7.6. 7.7. 7.8.

Difuziniai populiacij plitimo modeliai 341 Populiacij saveik dsningumai 345 Populiacij konkurencija 347 Populiacij simbioz mutualizmas ir protokooperacija 352 Populiacij plra ir parazitizmas 354 Bendrieji daugiakomponeni populiacij modeliai 356 Informacinis populiacij valdymas 358
8 S K Y R I U S . Gyvyb adaptyvi, informacij kaupianti

kodavimo ir dekodavimo sistema

363

8.1. Bendroji gyvybs sudtingjimo schema 365 8.2. Gyvyb chemins evoliucijos tsa 369 8.3. Biologins raidos veiksniai 373 8.4. Sveik raidos tendencijos (kompiuterinio modeliavimo ivados) 8.5. Konkurencija tik stabilizuoja ir tobulina 380 8.6. Kooperacija lemia naujas kokybes 381 8.7. Informacija ir valdymas, pagrsta plrno ir aukos sveika 383 8.8. Biomolekulin simbiogenez 384 8.9. Hiperciklai 387 8.10. Genetinio kodo susiformavimas 390 8.11. Nukleorgi ilgjimas genetins atminties didjimas 392 8.12. Pagrindiniai organizmo lstels informacijos srautai 393 8.13. Baltymai fermentai dekoderiai 395 8.14. Noimano automatas, kuris dauginasi 397 8.15. Kinetinis gen atrankos modelis 399 8.16. Universalios save gaminanios sistemos (saizeriai) ir organizm simbiogenez 400 8.17. Adaptyvioji gyvn elgesio evoliucija 404 altiniai ir rekomenduojama literatra Dalykin rodykl 411 409

376

10
BIOFIZIKA

VADAS

11

Reikalinga mokslo aka, kuri neorganini, arba fizikos, reikini dsningumus pritaikyt organini form raidai aikinti. Mokslas, bandantis parodyti, kad biologijos (morfologijos, embriologijos ir fiziologijos) duomenys sudaro tik pavienius bendr fizikos dsni atvejus, pavadintas etiologija. Geriau bt moksl vadinti BIOFIZIKA. iuo metu biofizika nepasiek ryki laimjim. Tikimasi, kad jos laukia ypatinga ateitis. KARLAS PIRSONAS, The Grammar of Science London, 1892

1.1. KAS YRA BIOFIZIKA ?

BIOFIZIKA [lot. bios gyvyb, lot. physis, gr. fusix gamta] mokslas apie gyvj gamt, gyvsias sistemas. Biofizika kitaip nei beveik t pat reikianti biologija, apraanti ir aikinanti gyvj gamt biologij modernizuoja, t. y. kuria j ant tikslij moksl pamato. iuo metu biofizika visus gyvosios gamtos vyksmus bando aikinti fizikos, chemijos, kibernetikos ir informatikos moksl svokomis ir dsniais, vartodama matematikos kalb. i biofizikos formuluot gana gerai atitinka prie imt met ymaus matematiko, biometrijos krjo, biofizikos vardo autoriaus Karlo Pirsono (Karl Pearson) pateikt samprat. Aristotelio fizika aikino ir gyvj, ir negyvj gamt. Negyvoji gamta buvo aikinama remiantis energija (dynamis/potentia, energeya), o gyvoji dar ir entelechija (entelecheia) tiksling, krypting veikl lemiania jga. Galiljaus (Galilei Galileo, 15641642) laikais fizika bandomaisiais tyrimais ir kiekybiniais matematikos metodais daugiau tyr tik negyvosios gamtos vyksmus. Todl tuo paiu metu gyvajai gam12
BIOFIZIKA

tai nagrinti atsirado fiziologija (lot. physis, gr. fusix gamta; lot. logos, gr. l^goz odis, svoka, protas, mokslas) gyvosios gamtos fizika. Fiziologija neaprp visos gyvosios gamtos, todl Lamarko (Lamarck Jan Batista, 17441829) laikais pradjo formuotis mokslas apie organin materij, organines btybes biologija. Pastebta, kad gyvybs esm tarsi slypi specialioje cheminje mediagoje, organiniuose dariniuose atsirado organin chemija ir biochemija. Bet ir ia vyravo apraomasis aikinimas. Galtonui (Galton Francis, 18221911) nepakako apraomosios biologijos ir organins chemijos jis pradjo kurti kiekybin biologij biometrij, o jo mokinys Pirsonas (Pearson Karl, 18571936) Galtono biometrijos turin pervardino biofizika. Vyneriui (Wiener Norbert, 18941964) ir anonui (Shannon Claude Elwood, 19162001 ) gyvosios gamtos, visuomens ir tam tikr main veiklai aikininti nepakako fizini mediag ir energijos virsm dsni. Jie alia fizikos ir chemijos sukr lygiavert pamatin moksl kibernetik ir informatik mokslus apie valdym ir valdanias sistemas, organizuotum kurianias informacines procedras, kurios energijos, mediag ir informacijos srautus nukreipia funkcikai tikslinga kryptimi, ved nauj pamatin svok informacij reikaling valdymui. inynuose, enciklopedijose, daugelyje vadovli biofizika apibriama siauriau. Juose biofizika pateikiama kaip mokslas, gyvybs vyksmus aikinantis tik fizikos ir fizikins chemijos metodais bei dsningumais. i biofizikos samprata sumenkina ar net atmeta kibernetikos ir informatikos (plaija prasme) svarb. Neatskleidiami reguliavimo, valdymo, homeostazs bei informacini kodavimo ir dekodavimo vyksmai kaip savitos savybs, lemianios biosistemos organizuotum ir funkcin darn aikinant gyvybs vyksmus. Tokia biofizika pirmum teikia tik energijos ir mediag virsmams. Tai siauroji biofizikos mokslo samprata, kuriai stinga biofizikos mokslo savitumo. Biofizika, kaip biologijos ir fizikos hibridas, dar kitaip vadinama fizikochemine biologija. J sunku atskirti nuo biochemijos, molekulins biologijos ar fiziologijos mokslo ak, kurios turi didesn reikm aikinant gyvybs vyksmus. Skirtumas siauroji biofizika gyvybs vyksmus daugiau aikina energijos virsm kalba, o biochemija ir molekulin biologija mediag virsmais. Tai atspindi fizikos ir chemijos moksl savitum: fizika gamtos reikinius aikina energijos virsmais, chemija mediag virsmais. Gyvyb gamtoje sukuriama cheminiais ir biocheminiais virsmais, kurie vykdo ir energijos virsmus, taip pat atlieka informacines signalines valdymo ir reguliavimo (bioinformacines) procedras. Biologijos bandymais neginijamai nustatyta, kad gyvosios sistemos tai mediag ir molekulini virsm sistemos, kuri metu vyksta ir energijos virsmai. Vis daugiau pastant gyvyb, aikinantis jos savybes, pastebima, kad daugiausia gyvybs esm lemia informaciniai kodavimo ir dekodavimo, reguliavimo ir valdymo vyksmai bei procedros. Tai yra kibernetikos moksl aikinimo sritis. Tenka naujai sistem teorijos, informacinio valdymo bei kodavimo ir dekodavimo poiriais pervertinti ias teorines
13
vadas

biologijos mokslo sampratas, susieti jas su naujausiais bandym duomenimis. Tai ir yra iuolaikins biofizikos paskirtis. Fizikai, biologai, matematikai, kibernetikai, ininieriai ir medikai, save vadinantys BIOFIZIKAIS, gana skirtingai supranta biofizikos esm: FIZIKAI BIOFIZIKAI teigia, kad biofizika yra fizikos mokslo dalis, fizikos ir fizikins chemijos metodus taikanti biologini objekt, sistem tyrimams ir biologijos vyksmus aikinanti fizikos dsniais. Toks poiris labai danai atmeta ypa svarbius gyvosios gamtos informacinius valdymo ir fiziologinius funkcinio tikslingumo reikinius. BIOLOGAI BIOFIZIKAI tvirtina, kad biofizika yra biologijos mokslas, kurio paskirtis biologijos vyksmus aikinti ir tirti fizikos mokslo metodais. Fizik biologai biofizikai supranta kaip biologijos mokslo tarnait. MATEMATIKAI BIOFIZIKAI, apvelkantys biologinius reikinius matematikos modeliais, biofizik sutapatina su biometrija ir matematiniu kompiuteriniu modeliavimu. Pastaraisiais metais jie iuos vyksmus traukia nauj mokslo ak bioinformatik. KIBERNETIKAI BIOFIZIKAI gyvj gamt ir jos objektus laiko kibernetinetinmis sistemomis ir kibernetinmis mainomis. J manymu, gyvybs esm lemia informacins kodavimo ir dekodavimo bei valdymo funkcins organizacijos procedros, maiau svarbiais laiko fizikini ir chemini mechanizm aikinim. ININIERIAI BIOFIZIKAI gyvj gamt vertina technikos poiriu kaip vairiausias sudtingas energines, chemines, informacines mainas, i kuri semiasi krybos idj. Danai ininieriai biofizik sutapatina su bionika. MEDIKAI BIOFIZIKAI biofizik supranta kaip fizikos ir ininerijos metod taikym diagnostikai, gydymui ir kaip atitinkam biomedicinos prietais krim.
ios biofizikos sampratos gana gerai atsispindi naujausioje Europos (1991) ir Lietuvos (1998) priimtoje penki mokslo srii (karalysi) klasifikacijos sistemoje. ia BIOFIZIKA, paenklinta kodiniu numeriu B002, pripainta kaip viena svarbiausi BIOMEDICINOS (B000) moksl srities krypi. j eina visos biologijos moksl akos, taikanios moderniausius io laikotarpio tikslij mokslini tyrim metodus. Ji dalijama akas: MOLEKULIN BIOFIZIKA (B120), SISTEM (FIZIOLOGIN) BIOFIZIKA (B130), KLINIKIN FIZIKA, RADIOLOGIJA, TOMOGRAFIJA, MEDICINOS PRIETAISAI (B140), BRANDUOLIN MEDICINA, RADIOBIOLOGIJA (B145), KLINIKIN CHEMIJA (B190), AUGAL BIOCHEMIJA (B191), CITOLOGIJA, ONKOLOGIJA, KANCEROLOGIJA (B200), GENETIKA, CITOGENETIKA (B220), AUGAL GENETIKA (B), MIKROBIOLOGIJA, BAKTERIOLOGIJA, VIRUSOLOGIJA, MIKOLOGIJA (B230), PIRMUONI ZOOLOGIJA (235), MOGAUS ir GYVN PARAZITOLOGIJA (B240), ENTOMOLOGIJA ir AUGAL PARAZITOLOGIJA (B250), HIDROBIOLOGIJA, JR BIOLOGIJA, VANDEN EKOLOGIJA, LIMNOLOGIJA (B260). (r.: Valstybs inios, 1998-01-16, Nr. 6, Lietuvos Respublikos statymas Nr. 30). 14
BIOFIZIKA

BIOMEDICINOS MOKSLAI B 000 Bendrieji biomedicinos mokslai B 001 B 100 Biomedicinos moksl istorija ir filosofija, teorin biologija, bendrieji evoliucijos aspektai. B 110 Bioinformatika, medicinos informatika, biomatematika, biometrika. B 115 Biomechanika, kibernetika. Biofizika B 002 B 120 Molekulin biofizika B 130 Sistem (fiziologin) biofizika B 140 Klinikin fizika, radiologija, tomografija, medicinos prietaisai B 145 Branduolin medicina, radiobiologija *** Radiofarmacin technologija: r. T 411 *** Genetiniai efektai: r. B 220 *** Biochemija, metabolizmas: r. P 004 *** Baltymai, enzimologija: r. P 310 *** Nukleorgtys, baltym sintez: r. P 320 *** Bioenergetika: r. P 330 *** Lipidai, steroidai, membranos: r. P 340 *** Biopolimerai: r. T 390 B 190 Klinikin chemija *** Hormonai: r. B 370 ir B 480 *** Endokrinologija: dr. B 480 *** Serologija: r. B 500 B 191 Augal biochemija *** Biotechnologija: r. T 490 *** Azoto fiksacija: r. B 433 B 200 Citologija, onkologija, kancerologija *** Patologin anatomija: r. B 520 B 210 Histologija, lsteli chemija, histologin chemija, audini kultra B 220 Genetika, citogenetika *** Klinikin genetika: r. B 790 *** Gyvn veisimas: r. B 400 *** Augal selekcija: r. B 390 B 225 Augal genetika B 230 Mikrobiologija, bakteriologija, virusologija, mikologija *** Azoto fiksacija: r. B 433 *** Augal parazitologija: r. B 250 *** mogaus ir gyvn parazitologija: r. B 240 B 235 Pirmuoni zoologija B 240 mogaus ir gyvn parazitologija B 250 Entomologija, augal parazitologija *** Fitopatologija: r. B 390 B 260 Hidrobiologija, jr biologija, vanden ekologija, limnologija. 15
vadas

Nagrinjant naujj mokslo klasifikacij, atkreiptinas dmesys daug i pirmo vilgsnio atrodani nelogikum. BIOMECHANIKA ir KIBERNETIKA (B115) yra priskirta prie BENDRJ BIOMEDICINOS (B001) moksl, o ne FIZINI (P000) ar TECHNOLOGINI (T000), kaip yra prasta manyti. BIOCHEMIJA (P004) priskirta ne prie BIOMEDICINOS, bet prie FIZINI MOKSL (P000). Suteikiant mokslo vardus ir laipsnius KIBERNETIKA (B115) priskiriama ne tik prie BIOLOGIJOS (01 B), bet ir prie BIOFIZIKOS (02 B) mokslo krypi. Daug bendrj biomedicinos mokslo ak, ypa nagrinjani teorinius biologijos dalykus, pavyzdiui, BIOINFORMATIKA, BIOMATEMATIKA, BIOMETRIKA (B110), TEORIN BIOLOGIJA (B110), neabejotinai priskirtin prie biofizikos mokslo interes srities, laikoma tik bendruoju biomedicinos mokslu. sigilinus nesunku suvokti, kad ias mokslo klasifikacijos keistenybes lemia biologijos moksl raidos neapibrtumas. Tai akivaizdiai rodo, kad biofizika, kaip ir visa iuolaikin biologija, gyvena virsm laikotarp. Biofizikos mokslo kryptis pakeliama vien svarbiausi biomedicinos ir apskritai io laikotarpio gamtos moksl lygmen. Biofizika vertinama kaip pagrindinis gyvosios gamtos mokslas, grindiamas tiksliaisiais mokslais. Visos biomedicinos mokslo akos, priskirtos prie biofizikos, i tikrj priklauso biofizikai, jei tradicins t biologijos ak tyrimai ir aikinimai yra pagrsti tikslij fizikos, fizikochemijos bei kibernetikos metodais. Tiesa, EKOLOGIJA (B 003), iskiriama kaip savarankika biomedicinos mokslo aka, taip pat kaip ir BIOFIZIKA (B 002), o paliekamos tradicins biologijos mokslo akos BOTANIKA (B 004), ZOOLOGIJA (B 005), MEDICINA (B 007). Biologini sistem mediag ir energijos virsmai skiriasi nuo prast negyvosios gamtos moksl objektuose vykstani fizik idealij duj inde ar chemik homogenikoje terpje. Gyvosioms sistemoms bdinga savita mediag ir energijos virsm darna, tikslinga vyksm organizacija. Ji ir lemia gyvybs savybes, kuri neturi tradicin fizika ir chemija negyvosios gamtos moksl tiriami objektai. Ikyla poreikis mstyti darni organizuot sistem apibrtimis. Ne atsitiktinai nuo seniausi laik biologai vartoja termin o r g a n i z m a s , pabrdami biologini sistem organizuotumo svarb. Ikyla poreikis, aikinant gyvsias sistemas, pasitelkti moksl apie organizuotas sistemas k i b e r n e t i k . Kibernetika organizuotum aikina savomis informacinmis kodavimo ir dekodavimo bei reguliavimo ir valdymo svokomis. Jos visikai skiriasi nuo fizikos ir chemijos mediag bei energijos virsm. Btent, informaciniai valdymo vyksmai ir procedros suteikia organizuotoms sistemos tvarkingos ir kryptingos veiklos savitumo, o biologinms reguliacijos, homeostazs, koordinacijos, funkcinio tikslingumo savybi. Biologijos vyksmai, organizmai, j populiacijos bei biosfera ir evoliucija aikinami tik fizikos ir chemijos dsniais, o tyrimai pagrsti tik fizikos ir chemijos metodais akivaizdus ribotumas. Gyvajam pasauliui bdinga tvarkinga veikla organizuotumas.
16
BIOFIZIKA

GYVYB GYVA SISTEMA FIZIKA


(ENERGIJOS VIRSMAI)

CHEMIJA

(MEDIAG
VIRSMAI)

1.1 pav. Biofizikos samprata siaurja prasme kaip fizikochemin biologija

Kad organizuota veikla yra savita gyvj sistem savyb, taip pat rodo biologijos mokslo auroje, t. y. prie du imtus met, plaiai vartotas terminas organinis, arba gyvas, kurio iandienin prasm organizuotas. Atitinkamai svoka neorganinis, neorganizuotas suprantama negyvas. I t laik sampratos apie gyvyb iliko organins chemijos pavadinimas, kuris ms laikais evoliucionavo biochemij. Kaip rayta, daugelyje biofizikos vadovli biofizika suprantama labai siaurai, tik kaip fizikochemin biologija. Tai biofizika siaurja prasme, kurios esm vaizdiai pateikta 1.1 paveiksle. Siaurj biofizik tenka apvilkti specialiu funkcinio tikslingumo, sisteminiu organizuotos veiklos informacinio kodavimo ir dekodavimo bei reguliavimo ir valdymo moksliniu aikinimu kibernetikos mokslu (1.2 pav.). Siaurosios sampratos biofizika, papildyta kibernetikos ir informatikos moksliniais poiriais, tampa mokslu apie organizuotas sistemas. Ji gauna savitumo ir virsta gana savarankiku mokslu
KIBERNETIKA, INFORMATIKA

(VALDYMAS, VALDYMO PROCEDROS, INFORMACIJA ir SIGNALAI)

GYVYB ? GYVA SISTEMA FIZIKA


(ENERGIJOS VIRSMAI)

CHEMIJA
(MEDIAG VIRSMAI)

1.2 pav. Biofizika plaija prasme mokslas apie biologines organizuotas sistemas

17
vadas

visaverte biofizika, biofizika plaija prasme. Tokia biofizika aikina gyvyb, gyvsias sistemas, funkcin j organizacij, savybes ir virsmus. Ji darniu kibernetikos poiriu sujungia cheminius mediag ir fizikinius energijos virsmus organizuot sistemin veikl. ia didel tak turi informacins procedros: informacija suprantama kaip organizuotum lemiantis veiksnys, kaip koordinavim, reguliavim bei valdym vykdanti jga. Informacini procedr bei mechanizm aikinimas informatikos ir signal, o konkreiau bioinformacini procedr ir biosignalini mechanizm teorija tampa ypa svarbia suprantant ir aikinant biologini sistem funkcionavim bei savybes. Informacija ir jos neikliai biologini sistem signalai yra ne maiau svarbs, o gal net ir svarbesni u mediag ir energijos virsm metabolinius vyksmus. iuo poiriu galima formuluoti biofizikos mokslo plaija prasme apibrt:
BIOFIZIKA tai tikslusis gyvosios gamtos mokslas, gyvojo pasaulio vyksmus aikinantis fizikos, chemijos ir kibernetikos bei informatikos moksl dsniais ir juos tyrinjantis i moksl metodais. Biofizika tai mokslas, kuris organizuot sistem teorijos (kibernetikos) poiriu aikina funkcikai tikslingai, kryptingai vykstanius energijos ir mediag virsmus, informacines gyvj sistem valdymo procedras, bei kibernetikos, fizikos ir chemijos moksl metodais vykdo biologini vyksm tyrimus.

Tokios sampratos biofizika labai keiia biologini moksl raidos krypt sampratos pagrindas perkeldamas i materialij virsm informacini procedr srit. Kibernetika ir informatika tampa jungiamuoju besiskaidanios biologijos mokslu. Paviens siauros biologijos mokslo akos gyvuoja trumpai, nes pltojantis biologijai, jos negyja savitumo ir itirpsta bendresni moksl terpje: biofizika siaurja prasme kiekybinje biochemijoje, biochemija molekulinje biologijoje, biokibernetika ir fiziologija plaiosios sampratos biofizikoje. Biofizika, organizuotas sistemas pagrindianti kibernetika bei fizika ir chemija, gali visikai pakeisti biologijos moksl. Pirmum teikiant ne tiek mediag ir energijos virsmams, bet informaciniams kodavimo ir dekodavimo bei reguliavimo (valdymo) procedroms kuriamas kiekybinis gyvosios gamtos mokslas, kurio pagrindas biofizika. Mediag ir energijos virsmai gyvosiose sistemose suprastini tik kaip priemons ir mechanizmai, vykdant informacines valdymo programas, esanias biologini valdymo posistemi struktrose (genetinse, hormon, nervinje, feromon ir pan.). Toks biofizikos poskis visikai keiia biofizikos mokslo esm. Jam sitvirtinus biologijoje isipildyt K. Pirsono pranayst, kad biofizikos laukia ypatinga ateitis. Tokia biofizikos samprata j sutapatina su teorine ir bendrja biologija, teorine fiziologija, biokibernetika, bioinformatika (plaija prasme). iuo metu biofizikos vardas daugiau paplits nei teorins ir bendrosios biologijos, yra trumpesnis, be to, ap18
BIOFIZIKA

ima ir bandomuosius tyrimus. Tikkime, kad jis ir liks B I O F I Z I K A , kaip t i k s l u s i s gyvosios gamtos esm aikinantis mokslas.

1.2. METODINIS POIRIS

Gyvosios gamtos vairov daugyb gyvybs ri, kuriose vis atrandama dar didesn vyksm ir naudojam mechanizm vairov. Geometrine progresija daugja bandymais nustatom duomen kiekis. Taip pat tam tikr element sveik derini gausa veria iekoti bendresni mokslini tyrim ir aikinimo metodini poiri nei tradicinis, gyvavs kelis imtus met. Ypa skmingas negyvosios gamtos fizikos ir chemijos taikomas indukcinis gamtos painimo kelias yra neisamus. is biofizikos vadovlis yra bandymas iekoti nauj bd engiant gyvojo pasaulio esms painimo, gyvosios gamtos dsningum labirintus. Per apibendrint teorin samprat ir funkcin kibernetikos sistemin poir galima nenagrinjant, neatsivelgus daugel bandymo duomen dedukciniu bdu gauti mokslui naudingas ivadas. Tai metodas, kuriuo gyvyb vertinama BIOSISTEM teorijos poiriu kaip SISTEM (FIZIOLOGIN) BIOFIZIKA (B130), sistem biologija. Tradicin pozityvystin metodin poir tenka keisti neopozityvystiniu. Tradiciniai gamtamoksliniai, fizikos, chemijos ir biologijos vadovliai prigrsti gausybs fakt apraym. Fakt nagrinjimas veria skaitytoj apibendrinti ir daryti ivadas. Tai analitinis indukcinis tyrinjimo, painimo ir danai mokymo metodas. Juo siekiama mokslins tiesos einant keliu: bandym duomenys => faktai => apibendrinimas => hipotezs => teorijos => dsniai, t. y. mokslins tiesos iekojimo metodas, apibendrinantis konkreius duomenis. io metodo pagrindas FAKTAS, jo didenyb BANDYMAS EKSPERIMENTINIS F A K T A S . Toks mokslinio painimo metodas, pradtas Galiljaus, tinkamas negyvosios gamtos fizikos ir chemijos dsningumams aikinti. inoma, jis taikomas ir tradicinei bei molekulinei biologijai, taiau ikyla metodologini sunkum. Ypa bandant isiaikinti gyvj organizm, dar gerai nepaint j informacini valdymo struktr bei posistemi gen, hormon, nerv veikl. Tokie biologijos vadovliai yra labai didels apimties, prikimti gausybs fakt, ilgainiui apaugani papildomais. Vadovliai storja ir storja. Pavyzdys gali bti bendrosios biologijos ar biochemijos knygos. Ypa pastarojo deimtmeio lstels molekulins biologijos knygos. Vienam tyrintojui ar studentui net vis lstels vyksm aprpt nebemanoma. O dar organizm ir populiacij vairov, pilna skirtybi, biosfera ir evoliuciniai procesai. Visi ie faktai vienas su kitu dar ir susij. Tenka iekoti kitoki mokslini gamtos aikinimosi ir aikinimo metod. Vienas j, pradtas pltoti po Antrojo pasaulinio karo, yra neopozityvistin mokslinio painimo metodologija. Pozityvistinis poiris.
19
vadas

Greitas bdas engti sudting sistem mokslin painim gali bti dedukcinis metodas, reikinius aikinant hipotezmis teorijomis, o bandym duomenis vartoti tik kaip iliustracijas. Pozityvistin metodika yra mokslinis painimas bandym duomenis apibdinant bendraisiais dsniais ir sampratomis, einant nuo paprasto ir konkretaus prie bendro. Neopozityvistinio metodo esm prieingos nuostatos. Pradedama nuo problemos nuo sudtingo sugalvoto sisteminio poirio, i viraus, pagal sumanyt iankstin teorin hipotetin nuostat. Kitas ingsnis konkretaus hipotez atmetanio bandymo planavimas. Laikoma, kad vertinga tik ta hipotez, kuri galima bandymu atmesti (falsifikuoti). Bandymais nustatyti duomenys ir faktai nagrinjami taikant logikos dsnius. Remiantis jais, koreguojama duomen analiz ir apibendinimai, keiiamos hipotezs. Taip studentas susipasta su teorine painimo ir mokslins krybos samprata. Tokiu bdu formuojama sava teorinio mstymo sistema. Tai kuriamasis (konstruktyvusis) mokymasis, o mokymo metodas vadinamas konstruktyvija edukologija. Tiesa, is metodas yra subjektyvus dl pasirenkamos teorins nuostatos. Taiau turint laki krybin fantazij, greiiau galima atrasti faktus jungiani logini ryi sistem, pastebti prieastingumus ir prietaravimus. Be to, tenka pripainti, kad tyrj bandym duomenys danai pateikiami remiantis subjektyviomis nuostatomis, Matoma tai, kas norima matyti. Dedukcin painimo sistema patikrina faktus savu logins sistemos poiriu ir danai fakt reikm vertina kitaip. Gana danai kitoks vertinimas ir paskatina keisti samprat, kuri ir bna naujo mokslinio painimo impulsas, prasidedantis virsmu moksline revoliucija. Tai XX imtmeio antrosios puss filosof, 1.3 pav. Karlas Raimundas mokslo metodolog Karlo R. Poperio (Karl Raimund Pop- Poperis (19021994) per) (1.3 pav.) neopozityvistins bei Tomo Kno (Tomas Neopozityvistinio gamtos mokKuhn) mokslo revoliucij sukurtos sampratos, vis daugiau slinio painimo metodologijos taikomos gyvosios gamtos ir visuomens mokslams. Prad- pradininkas ta plaiai kalbti apie nauj mokslo idj atsiradimo prieastis ir kelius paradigmas (1.4 pav.). Paradigma (gr. paradeigma pavyzdys) tai tam tikras poiris, mstymo modelis, subjektyvi aikinimo schema, padedanti suprasti ir aikinti vyksmus. Paradigmins nuostatos lemia mokslo urnale spausdinam straipsni atitikim urnalo paradigm. Galima teigti, kad visi urnalai atspindi tam tikr mokslo paradigm. T. Knas taip aikina bdingus paradigmos keitimosi elementus: kitaip mstoma aikinant naujus klausimus; gali bti atrandamas tam tikras naujas principas (nauja hipotez, aksioma), kuris visada gyvavo, taiau nebuvo inomas (nebuvo suformuluotas); Nepozityvistinis poiris.
20
BIOFIZIKA

BANDYMO PLANAVIMAS POVEIKIAI

GYVYB
GYVA SISTEMA

LYGINIMAS

HIPOTEZ
MODELIS

DSNIS TEORIJA

BANDYMAS I N D U K C I J A

FANTAZIJA

DUOMENYS A N A L I Z

KOREGAVIMAS

S I N T E Z

D E D U K C I J A

FAKTAS

1.4 pav. Neopozityvistin mokslini tyrim metodologijos schema. (Sudaryta remiantis K. Poperiu ir G. Ivanickiu)

naujos paradigmos nemanoma priimti, jeigu neatsisakoma senosios; naujos paradigmos visada susilaukia prieikumo. Pavyzdiui, Dono D. Votsono (James Dewey Watson) ir Fransio H. Kriko (Francis Harry Crick) mokslo straipsnis Nukleorgi molekulin struktra (Nature, 1953) visikai pakeit biologijos mokslo raid. Gyvosios gamtos vyksm mokslinis aikinimas pradjo skaidytis biologai ir kiti gamtamokslininkai (fizikai, chemikai, matematikai, kibernetikai), tyrinjantys gyvyb, remdamiesi mstymo samprata, pradjo skirstytis tris mokslines nuostatas paradigmas: tyrim metu vadovaujamasi tradicinmis nuostatomis apie gyvyb (tradicins biologijos samprata, animalistin paradigma). Teigiama, kad biologija yra savarankikas mokslas. Jis yra daug savarankikesnis u fizik ir chemij. Todl gyvybs vyksmus pakanka aikinti savais, biologijos, dsningumais. Nei chemija, nei fizika, nei kibernetika, nei informatika gyvybs vyksmams aikinti nereikalingos; gyvybs esm paaikintina molekuliniais biocheminiais mechanizmais ir j virsmais (molekulin, carbonovinistin paradigma). Tikima, kad gyvyb molekulini virsm sistema, ir visus gyvybs vyksmus galima paaikinti molekuliniais (papildius ir energijos) virsmais;
21
vadas

gyvybs esm savitos informacinio valdymo procedros (kibernetin biofizika, kibervitalistin paradigma). iuo poiriu gyvyb, biosfera yra informacij kaupianti sistema, o mediag ir energijos virsmai tik technologins priemons, mechanizmai bioinformacinms organizuotai valdomos veiklos procedroms gyvendinti. Neopozityvistin gamtos mokslinio painimo schema pateikta 1.4 pav. Atsivelgiant j, mokslo painimo esm ne duomen nustatymas, bet teorij, grindiam hipotezmis, aikinaniomis gamt, krimas. Mokslo krybos vyksmas suprantamas kaip hipotezi iklimas ir j atmetimas (falsifikavimas) bandymais nustatytais duomenimis, vliau nauj hipotezi klimas ir atmetimas. Vertingomis laikomos tos hipotezs, kurios numato bsimus naujus faktus ir gali bti bandymais falsifikuotos, t. y. atmestos. Tik tokios hipotezs veria teorijas tobulti ir kartu iekoti nauj, tikslesni paaikinim, nauj idj. Ir taip artjama prie vis geresnio ir tikslesnio teorinio paaikinimo geresns teorijos. Bandym duomenys, atitinkantys (verifikuojantys) hipotez teorij, moksliniu nepozityvistiniu poiriu yra laikomi menkaveriais, nes nekelia poreikio iekoti naujovi, nauj hipotezi, o kartu ir nauj fakt. Tvirtai teigiama, kad hipotez gali bti tik atmetama (falsifikuojama) ar verifikuojama, bet niekada negali bti rodyta! Teigiama, kad bandym duomenys neturi didels takos hipotezi krimui. Pripastama, kad idj ir hipotezi kryba yra subjektyvi tam tikr asmenybi krybin savyb. Todl mokslinei krybai ypa svarbi vaizduot. Vertingiausia sumanyta hipotez laikoma ta, kuri bandym keliu atmetama, nes reikalaujama i esms keisti teorij. Tai ir yra mokslini revoliucij perversm esm. Toks mokslinio tyrimo vyksmas yra nuolatinis objektyvios tikrovs lyginimas su teoriniais (virtualiais) modeliais. Neopozityvistinis mokslinis tyrimas suprantamas kaip nepabaigiamas ciklikas vyksmas per nauj hipotezi krim vis tobulinant modelius hipotezes, teorijas juos atmetant bandymais. Modelio neatitikimas tikrovs, prietaravimai veria keisti analiz ir sintez arba parengti ir atlikti kontrolinius bandymus. Kontroliniai bandymai, kaip ir visi bandymai, yra vertinami kaip gamtai uduodami klausimai. Neopozityvistiniu poiriu bandymai atliekami tik labai pagrstais atvejais, aiku, naudojant bandymo planavimo procedras. Bandym rezultatai duomenys pagrindia faktus, kurie vartojami hipotetini modeli krybos laisvei riboti. is udaras ir ciklikas mokslins tiesos iekojimo vyksmas iuo metu laikomas gamtos, ypa labai sudtingos gyvosios gamtos, mogaus ir visuomens paiu veiksmingiausiu mokslinio painimo nuosekliu keliu. Mokslins tiesos iekojimo metodologinei slinkiai nuo pozityvistini bandym neopozityvistin teorin modeliavim, reikia ir speciali modeliavimo priemoni. Tradiciniai teorinio tyrimo metodai, labai skmingai taikomi fizikai ir fizikochemijai,
22
BIOFIZIKA

buvo matematika. Daugiausia tai tiesiniai matematikos modeliai. Gyvajai gamtai aikinti tiesiniai matematiniai modeliai veiksmingi tik iimties atvejais. Bendrieji gyvosios gamtos matematiniai modeliai labai sudtingos netiesins daugiakomponents dinamini lygi sistemos, susijusios daugeliu netiesini grtamj ryi. Tai sudtingos sistemos, kurioms tirti btina pritaikyti chaoso, katastrof ir kitoki sudting sistem tyrimo matematika bei kompiuterijos metodus. Klasikins matematikos metodai yra maai veiksmingi. Taiau kompiuterija yra nepamainomas biosistem tyrimo metodas parodant (verifikuojant), atmetant (falsifikuojant) ir tikslinant hipotezes (teorijas). Modernus mokslinis tyrimas nemanomas be naujj informacini technologij, kompiuterijos priemoni. Neopozityvistiniu poiriu, kompiuteris mokslinio tyrimo metu turi ir vykdo bandymo sumanym; jutikliais (receptoriais), prijungtais prie tiriamojo, nustato reakcijos duomenis ir juos nagrinja; atlieka visus kiekybinius vertinimus, dokumentuoja bandym; pagal program stebi bandymo eig ir siunia duomenis tyrjui stebtojui apie bandymo eig ir jo nukrypimus nuo programos. Nukrypimo atvejais teikia tyrjui rekomendacijas dl bandymo eigos keitimo. Tyrintojui paliekama tik eigos kontrol ir sikiimas neprastomis aplinkybmis. Visa veikla gali bti visikai programuota ir gyvendinta kompiuteriniu valdymu. Taip atrodo dabartinis visikai automatizuotas bandymas. Tyrinjui, biofizikui lieka pagrindinis krybinis jokiam kompiuteriui ar kompiuterio programai nemanomas ingsnis nauj hipotezi krimas ir bandymo sumanymo sudarymas. Be to, iuo metu, be interneto ir kompiuterijos metod, be BIOINFORMATIKOS (siaurja prasme) ar kitoki informacini technologini priemoni, jau nemanomi atlikti bandym, daugelio biologini tyrim duomen nagrinti ir derinti. Neopozityvistikai vertinant mokslinio painimo vyksm apskritai, taip pat reikia neopozityvistikai vertinti ir biologijos, ir juo labiau biofizikos mokslo raid. iuo atveju pirmasis ir svarbiausias ingsnis, kur tenka atlikti tyrintojui pasirinkti poir hipotetin nuostat, pasirinkti paradigm. Atsivelgiant tris pateiktas biologines paradigmas, kiekvienos nuostatos atstovai pasirenka atitinkam tyrim metodologij. Pirmoji tradicin biologija pasyvius gamtos stebjimus ir j apibendrinimus. Antroji molekulin biologija daug sudting ir aktyvi bandym bei aukto lygio statistins analizs metodus. Treioji kibernetin-informacin grindiama savitais, informaciniais metodais, tam tikro naujo mstymo poiriu. Jis kyla i sampratos, kad gyvoji gamta per vis evoliucijos proces yra gijusi visikai nauj savybi, kuri nra ir negali bti natralioje negyvojoje gamtoje. Tai tam tikras dualistinis poiris. Jis, aikinant gyvj pasaul, suderina materialij ir nematerialij vyksm sambv, kaip udarojo kodavimo ir dekodavimo principais funkcionuojant organizm organizuot sistem.
23
vadas

1.3. INFORMACINIS UDARASIS KODAVIMAS IR DEKODAVIMAS GYVYBS ESMS PARADIGMA

Biologijai ir tradicinei biofizikai taikant kibernetik ir informatik nesunkiai galima pastebti iuos mokslus jungiani bendryb informacines udarojo kodavimo ir dekodavimo procedras. Jos irykintos remiantis biofiziko Roberto Roseno (Robert Rosen) (1985) ir sistem teoretiko Johano Kastio (John L. Casti, 1988) modeliavimo samprata Modeling Relations koncepcija (1.5 pav.). i koncepcija teigia, kad gamtos painimo ir mogaus smegen funkcionavimo vyksmai pastant aplink, tikrj gamt, tikrsias N sistemas, yra modeliavimas informacins udarojo kodavimo ir dekodavimo procedros, t. y. tikrojo mediaginio objekto, materialios N sistemos atspindjimas (kodavimas) formalioje atminties loginje struktroje tokia abstrakia simboli forma F, i kurios bt galimas visavertis atvirktinis grimas dekodavimas. Kitaip tariant, tikrosios N sistemos analiz (kodavimas) ir uraymas atmintyje modelio F forma, ir grtamoji tikrosios materialios sistemos N sintez (dekodavimas) pagal formal jos F model. Atsivelgiant i samprat, kodavimas gali bti suprastas kaip tikrosios sistemos analiz, o dekodavimas tikros sistemos sintez remiantis modeliu (projektu, planu, programa). Tai sukuria hipotetin nuostat paradigm, kad gyvyb, organizmai, gyvosios biologins sistemos yra udarojo kodavimo ir dekodavimo sistemos. Pasirenkama aikinimo hipotez, kad prie 3,8 milijard met emje chemins raidos metu susiformavo tikrosios molekulins udarojo kodavimo ir dekodavimo technologij gyvendinusios sistemos. Jos biologins evoliucijos metu vis tobuljo ir sukr gyvyb, naujas biologines ris, biosfer, mog ir noosfer. Naudodamas tokias paias udarojo kodavimo ir dekodavimo informacines procedras, mogus, moni visuomen sukr mokslin gamtos, paties savs mogaus bei visuomens painim. Udarojo kodavimo ir dekodavimo esms schema parodyta 1.5 pav. Tai tikrojo pasaulio atspindjimas abstrakija formali simboli erdvje ar j atitinkanioje atminties struktroje taip, kad bt manomas grtamasis atspindjimas atkrimas i abstrakios formos vl tikroje erdvje, materialiame pasaulyje. is abstraktusis pasaulis, atspindjimai ir vykstanios procedros danai vadinamos virtualiu, simboli, informaciniu pasauliu ar teoriniais (virtualiais) informaciniais reikiniais. Tokia sistemin samprata panai Aristotelio ir Dekarto (Ren Descartes) bei kit, vlesnio laikotarpio biologijos teoretik dualistines mokslines koncepcijas. Jomis remiantis nustatomi ne tik materialieji mediag ir energijos gyvybs virsmai, bet ir nematerialieji Aristotelio ir Hanso A. E. Dryo (Hans Adolf Eduard Driesch) entelechijos, Dekarto atspindiai sieloje (refleksijos), A. Sniadeckio (Jedrzei Sniadecki) organins, organizuojanios jgos ir pan. Dabar is dualistinis poiris suprantamas kaip fenotipas ir
24
BIOFIZIKA

1.5 pav. Informacin udarojo kodavimo ir dekodavimo procedr schema, sudaryta pagal R. Roseno ir J. Castio Modeling Relations koncepcij. Plonomis rodyklmis (deinje) rodomos nematerialiosios informacins vertybs

genotipas (genetika), smegenys ir smon (neuropsichologija), knas ir siela (mogaus psichobiologija), aparatra (hardware) ir programin ranga (software) (kompiuterija), biosfera ir noosfera (ekologija, antropologija). Vadinasi, gyvajame pasaulyje, neatsiejamai vienas nuo kito gyvuoja ne tik materialieji mediag ir energijos virsmai, bet ir nematerials informaciniai veiksniai. Darnus j sambvis suteikia tikslingo funkcionavimo savybi. Taiau informacines procedras gyvendinanios struktros taip pat yra sudarytos dvejopai (dualistikai) i materialiosios ir nematerialiosios dali: signal ir informacijos. Signalai suprantami kaip nematerialios vertybs (informacijos) materialioji informacijos iraika. Dl kodavimo procedr tikrov, materials vyksmai atspindimi ir veriami signaliniais, taip pat materialiaisiais vyksmais, bet skirtais jau nematerialioms informacinms valdymo procedroms gyvendinti. Dekodavimo
25
vadas

procedros prieingai nematerialius informacinius veiksnius, taip pat materialiaisiais neikliais signalais paveria valdomaisiais veiksniais ir reikiama kryptimi kreipia materialiuosius veiksmus mediag ir energijos virsmus, t. y. valdo materialiosios sintezs vyksmus. Tai bdinga visoms kibernetinms organizuotoms sistemoms. J daugiausia suformuota biosistemose. Jau nuo etojo XX amiaus deimtmeio kalbama apie kodavimo ir dekodavimo svarb biologinms sistemoms. Jos plaiai taikomos informacinms visuomens ryi ir kitoms informacinms technologijoms. Taiau nra aikios bendros formuluots, rodanios i procedr svarb ne tik gamtai, bet ir kasdieniam mogaus gyvenimui. Juk be kodavimo ir dekodavimo procedr nevyksta joks gyvybs ir mogaus gyvenimo ingsnis. Mokslo painimo vyksmas (1.4 pav.) gali bti tapatinamas su pateikta udarojo kodavimo ir dekodavimo schema (1.5 pav.). Mokslas gamtos ar technologinius jos vyksmus bei procedras (mediag ir energijos virsmus) atspindi abstraguota (virtualia, tarsi tikra) odi, enkl, simboli, matematine ar kompiuterio program forma taip, kad t simbolik suprantaniam mogui abstraki form bt manomas paversti realia. Kaip anksiau rayta, perjimas i tikrosios erdvs teorin (virtuali) vadinamas kodavimu, o i teorins (virtualios) tikrov (reali) dekodavimu. Akivaizdiausia kodavimo procedra raytinio, matematinio, kompiuterinio modeli sukrimas. Aiku, visi gamtos ar technologinio jos proceso modeliai yra io tikrojo mediag ir energijos virsm proceso atspindys atminties struktroje arba kodinis jo uraas bei to vyksmo projektas. Jeigu is projektas (sumanymas) atitinka tam tikrus reikalavimus ir gana tiksliai atspindi tikrovs savybes, tai jis gali sukurti gana tiksl atvirktin atspind dekodavim arba tikrovs sintez. Tokiu bdu kodavimas susijs su tikrovs rekini analize ir modeliavimu, o dekodavimas su sinteze arba informaciniu technologinio proceso valdymu. Koduotas tikrovs atspindys modelis i tikrj yra projektas (sumanymas). Juo remiantis, kaip pagal architektros ar ininerijos projekt, yra statomi ir kuriami tikri objektai. iuo poiriu moksliniai tyrimai, bandym duomen gavimas ir mokslini teorij krimas gali bti vertinamas kaip kodavimas. Teorij teisingumo rodymai bandymais ir mokslo duomenimis sukurt technologini projekt gyvendinimas gali bti vertinamas kaip dekodavimas. Per udarsias kodavimo ir dekodavimo procedras gali bti valdomi visi technologiniai tikrovs veiksmai, tarp j ir natrals biotechnologiniai vyksmai bei gyvybs raida. Gamtos painimo vyksmas per kodavimo ir dekodavimo procedras.

26
BIOFIZIKA

Gyvyb udaroUdarojo kodavimo ir dekodavimo schema gali bti vertinama sios organizacijos ir gyvyb, vienalstis ar daugialstis organizmas, populiacija ar kodavimo ir deko- net biosferos raida (1.6 pav.). davimo biotechnoPaprasiausias gyvasis organizmas prokariotin (bebranloginis vyksmas. duol) lstel, kodavimo ir dekodavimo poiriu, yra specializuotas biotechnologinis vyksmas, kur vykdo organizuotos fermentins reakcijos. ferment biotechnologini gamybos priemoni (stakli) buvim lemia j projektai (sumanymai) urayti patvariose molekuli struktrose nukleorgtyse (NR), biolog vadinamuose genuose. Gyvybs gyvavimas tai nuolatin dekodavimo procedra, speciali fermentini reakcij kompleks gamyba remiantis genetinmis programomis (genetiniais sumanymais), o ie ferment kompleksai, esant itekliams ir vykdydami biochemines reakcijas, atlieka reikalingus veiksmus. Kaip susidaro biotechnologinio vyksmo genetinis projektas (sumanymas, genomas) atspindys nukleorgtyse, iandien dar neaiku. Neabejojama, kad jis egzistuoja ir susidaro per biologins evoliucijos vyksm. Manoma, kad tai biologins molekuli evoliucijos padarinys. Nukleorgtys biologinse lstelse ne tik saugo ir skleidia biotechnologinio proceso koduot atspind projekt, taip pat j daugina bei keiia. Visa tai atlieka deoksiribonukleorgtys (DNR). Daugialsiuose organizmuose kodavimo ir dekodavimo procedros pildomos hierarchikai funkcionuojaniomis hormon ir nerv struktromis. Populiacijose veikia dar auktesnio hierarchinio lygio feromon, vabzdi ar pauk-

STABILIJ BSEN INFORMACINIS POSISTEMIS (NR)

DEKODAVIMAS

KODAVIMAS

ITEKLIAI

DINAMINI METABOLINI VYKSM POSISTEMIS (E)

VEIKSMAI

1.6 pav. Udarojo kodavimo ir dekodavimo procedr schema (NR nukleorgtys, E fermentins reakcijos)

27
vadas

i oki, gars bei kitos kodavimo ir dekodavimo informacins procedros. Jomis vykdoma organizuota veikla populiacij valdymas. Tiktina, kad gyvyb gamtos raidos (evoliucijos) metu prasidjo atsiradus kokybikai naujos udarojo kodavimo ir dekodavimo sveikoms. Tolesn biologin evoliucija buvo udarj kodavimo dekodavimo procedr dauginimasis, pltra ir tobulinimas, t. y. natrali bioinformacini technologij raidos vyksmas. i udarojo kodavimo ir dekodavimo raida vyko organizuotai, funkcikai tikslingai, arba kibernetikos poiriu valdomai. Todl prasminga biofizikos, kaip biosistem teorijos, pagrindine dedukcine paradigma hipoteze pasirinkti valdom udarojo kodavimo ir dekodavimo organizacin princip.

1.4. UDARAI VALDOMAS KODAVIMAS IR DEKODAVIMAS INFORMACINS PROCEDROS

Atsiradus kibernetikai mokslas pasipild nauja pamatine vertybe informacija. Ji yra tiesiogiai susijusi su sistem organizuotumu ir valdymu. Informacija, kaip sumaintas ar panaikintas sistemos bsenos neapibrtumas, rodo tiksling jos veik, sistemos tikslingos funkcins veiklos tendencijas. Akivaizdu, kad biosistemos yra organizuotos, funkcikai tikslingos sistemos. Todl informacija ir valdymas yra neatsiejama gyvybs savyb. Yra trys pagrindins sistem teorijos vertybs mediaga, energija ir informacija. Jomis remiantis aikinamos sistem savybs, formuluojami dsniai. Aikinant negyvosios gamtos, neorganizuot sistem vyksmus pakanka dviej pirmj mediag ir energijos virsm. Chemija aikina mediag virsmus, konkreiai apibria mediagos svok, moka kiekybikai vertinti ir matuoti jos kiekius, formuluoti j virsm dsnius ir j pagrindu kurti chemines technologijas. Analogikai fizika sistem veikl aikina energijos virsmais. O kibernetika, kurios objektas yra organizuotos sistemos sistem veikl aikina naudodamasi treija vertybe informacinmis valdymo procedromis. Pateikta udarojo kodavimo ir dekodavimo procedr schema (1.5 pav.) padeda suprasti informacijos esm kaip kodin tikrovs atspind tam tikr sistem specialiose atminties struktrose. Kodavimas ir dekodavimas yra informacins procedros. Kodavimas, kaip informacijos suformavimas, yra vienos sistemos atspindjimas kitoje tam tikr simboli kalba, o dekodavimas informacijos, ireiktos tam tikrais abstrakiais simboliais, enklais uraytos (atspindtos) sistemos atmintyje grtamasis atspindjimas pirmojoje sistemoje. Tokiu bdu informacija suprantama kaip glaustas pirmosios, kitaip sakant emesnio lygio, sistemos (ar posistemio) atspindys aukte28
BIOFIZIKA

sniojo lygio sistemoje (posistemyje). Informacijos samprata, kuri neatsiejama nuo atminties, kodavimo ir dekodavimo procedr, yra vertinama dvejopai. Fizikos poiriu struktrin informacija susiejama su sistemos entropija jos energins bsenos neapibrtumo matu. Tam tikrais atvejais tokia informacija vertinamos atminties struktr savybs. Kibernetikos poiriu santykin informacija susijusi su galimybe ir tikslumu atkurti pirmin sistem pagal informacin ura atmintyje, t. y. dekodavimu arba valdaniuoju poveikiu valdymu. Tikslingai funkcionuojanti udarojo kodavimo ir dekodavimo tikrovs sistema turi bti sudaryta bent i dviej posistemi. Vienas j informacinis, arba valdantysis, turi turti pastovi, diskreij bsen savybi. Kitas valdomasis, mediag ir energijos virsm posistemis nepastovi, tolydiai kintam bsen. Abi tarpusavy susijungusios tam tikrais kodavimo ir dekodavimo ryiais jau gali virsti kibernetine, tikslingai funkcionuojania organizuota sistema. Tokiai sistemai taikytina santykins informacijos, informacijos kaip valdaniojo veiksnio (faktoriaus) samprata. Jei viena sistema (arba posistemis) lemia kitos sistemos (ar posistemio) elgsen, laikoma, kad pirmasis valdo antrj, arba pirmasis perduoda antrajam informacij. Taip informacijos ir valdymo santyk aikina kibernetika. Tokia santykin arba kibernetin informacijos samprata yra labai svarbi aikinant gyvybs vyksmus (1.6 pav.). Manoma, kad paioje gyvybs raidos pradioje, susidarius fermentini (E) reakcij posistemiui ir informacinei nukleorgi (NR) simbiozei, kaip tik ir susiformavo tikroji udarojo kodavimo ir dekodavimo sistema. Fermentini reakcij posistemis tai dinaminis mediag bei energijos virsm (technologinis) posistemis, o nukleorgi stabilij bsen arba atminties posistemis. Suprantama, tokia tarpusavio grtamosios sveikos kodavimo ir dekodavimo sistema, esant DNR sugebaniai komplamentariai redublikuotis, ir sudar gyvosios organizacijos itakas. Daugialsi organizm valdymo hormon ir nerv posistemi susiformavimas taip pat vertintinas kaip hierarchins udarojo kodavimo ir dekodavimo sistemos tolesne raida. Informacins kodavimo ir dekodavimo procedros yra gyvendinamos konkreiomis mediag ir energijos virsm priemonmis, vadinamomis signal virsm vyksmais (signal transformacijomis). Signalais vadinami materials (mediag ir energijos) virsmai, atliekantys informacijos neikli funkcijas. Biologinse sistemose tai nukleorgtys, hormonai, nervini impuls siuntos, feromonai, kvapai, garso bei vaizdo ir kiti panas reikiniai. Signalams ir j virsmams taikytini fizikos ir chemijos dsningumai. Jiems galioja ir pagrindiniai termodinamikos, tarp j materijos tverms dsnis. Taiau j perneamai informacijai, turiniai sistemos bsenos tikimybin prasm, kuri yra visikai kitokia kokyb, materijos tverms dsnis netaikytinas. Informaciniams procesams taikomi visikai kitokie informaciniai dsningumai, kurie i esms skiriasi nuo materialij signalini virsm. iuo poiriu informacija yra nemateriali.
29
vadas

Sistemoms, kuriose vyksta mediag ir energijos, taip pat informacins kodavimo ir dekodavimo procedros, bdingos savitos organizuot sistem savybs. Toki organizuot sistem klasei priklauso ir gyvyb.

1.5. GYVYB ORGANIZUOTA SISTEMA

Neabejotina, kad gyvasis pasaulis, organizmai ir populiacijos, sistem teorijos poiriu, priklauso sudting (complex) sistem klasei. Tai netiesins dinamins, tikslingai funkcionuojanios sistemos. Jos dar vadinamos antrosios eiles kibernetinmis ar biosemiotinmis sistemomis, kuriose cirkuliuoja vairiausi valdomi mediag, energijos ir informacijos srautai. Tradicin fizikos, chemijos, biochemijos ir biologijos mokslini tyrim metodologija yra pagrsta prieasties ir padarinio aikinimu (1.7 pav.). Sudtinga sistema skaldoma maiausias sudedamsias grandis (elementus), kurios yra paprastoms klasikins jimas/ijimas sudtins dalys, o j funkcionavimui aikinti pritaikomi mediag ir energijos virsm dsningumai. Toki neorganizuot fizikini ar chemini sistem tyrim metu nustatomi ir aikinami prieastiniai ryiai tarp reakcijos (R) ir poveikio sistemai (P). Visa tai yra mediag ir/ar energijos virsmai, todl tyrimo duomenys formuluojami materialij virsm dsniais. Gyvsias sistemas nagrinjant udarojo kodavimo ir dekodavimo principais, atskirai tirti mediag ir energijos apykaitos virsmus ir informacinius valdymo signalinius srautus nemanoma. Tenka taikyti organizuot sistem, teorinius valdymo metodus, kurie abu posistemius sujungia darnaus veikimo schema. Toki sistem savybes lemia ne paprastas fizini posistemi prieastingumas, bet informaciniai valdymo veiksniai informacija. Biologijos duomenys, net ir pai paprasiausi gyvybs apraikos form, yra akivaizdiai susij su informacinmis procedromis. Gyvybei bdinga veiksmai, elgseDSNIAI Prieastis
MEDIAGOS ENERGIJA

Padarinys

SISTEMA
VIRSMAI

MEDIAGOS ENERGIJA

Poveikiai P(t)

Reakcijos R(t)

1.7 pav. Neorganizuotos jimas / ijimas sistemos sampratos schema

30
BIOFIZIKA

A P L I N K A

GAUNAMA INFORMACIJA VALDANTYSIS POSISTEMIS TIKSLAI PROGRAMOS ATMINTIS VALDANIOJI INFORMACIJA VALDOMASIS POSISTEMIS A P L I N K A

ITEKLIAI

MEDIAG ir ENERGIJOS VIRSMAI

VEIKSMAI TARA

1.8 pav. Bendroji organizuotos sistemos schema

na, kaip tikslingos funkcijos. Biosistemose yra informacins valdymo struktros, kuriose yra signalai, valdantys mediag ir energijos virsmus (1.8 pav.). Tai specialios struktros valdymo posistemiai. Jiems bdinga atmintis, funkcinis tikslingumas, programos, t. y. tokios struktrins ir funkcins dedamosios, kurios i esms keiia tradicins neorganizuotos fizikins ir chemins sistemos samprat. ie posistemiai lemia organizuotus mediag ir energijos virsmus. Jie dl valdaniojo dekodavimo vyksmo lemia funkcikai tikslingus veiksmus. Tai kitokio tipo sistema organizuota sistema, kurioje vyksta darns, sujungti abipus visum, materialieji mediag ir energijos virsmai, valdomi nematerialij informacini procesr funkcikai tikslingai veiklai. Organizuota sistema visada yra sudaryta i dviej, skirting funkcini paskiri posistemi: valdaniojo ir valdomojo. Antrasis valdomasis tai prastin mediag ir/arba energijos virsm sistema (posistemis), turinti informaciniam j valdymui reikalingus signalinius mechanizmus (dekoderius, efektorius). Informacinius signalinius poveikius teikia valdantysis posistemis. Jis, sisdamas signalus valdomojo posistemio grandims perduoda informacij, kada ir kurios grandys turi atlikti savo funkcijas, lemia tam tikr konkrei sistemos bsen. Tai ir yra valdymo informacija procedros esm. Bendruoju atveju organizuotose sistemose paprastais koderiais (sensoriais, receptoriais) valdaniajam posistemiui siunia informacij apie tikrj valdomojo posistemio bsen. Tai ypa ryku grtamojo ryio principais funkcionuojaniuose reguliatoriuose.
31
vadas

Tokiu bdu organizuot, tarp j ir biologini sistem veikla yra nulemta cirkuliuojani informacijos sraut. Biologins sistemos yra kibernetins informacins sistemos, taip pat jos yra ir tikslingai funkcionuojanios sistemos.

1.6. GYVYB TIKSLINGAI FUNKCIONUOJANTI SISTEMA

Fiziniai mokslai, aikinantys negyvj gamt, atmeta tikslingum kaip nemokslin samprat. Neorganizuotoms sistemoms, kuriose nra valdymo veiksm ir kuri savybes lemia termodinamikos dsniai, informacija nereikalinga. Todl jose nra ir negali bti funkcinio tikslingumo. Siauroji biofizika ir molekulin biofizika tikslingum atmeta taip pat. J poiriu gyvieji organizmai yra sudaryti i materialij mediag ir energijos virsmus vykdani dedamj. iuo poiriu joms bdingi prasti fiziniai temodinamikos dsniai, kuri pakanka gyvybs reikiniams aikinti, ir todl tikslingumo svoka yra nereikalinga. Nors informacija, aikinant gyvybs vyksmus, neatmetama, bet suprantama tik kaip fizikin sistemos energins bsenos entropija. Gyvybei, kaip organizuotai sistemai, informacija yra valdantysis veiksnys, o valdymas nesuprantamas be funkcinio tikslo ar visos tiksl sistemos. Tokia metodin nuostata padeda atmesti biologini vyksm aikinimo nesusipratimus skeptik fizikin poir tikslingum. Gyvosioms organizuotoms sistemoms funkcinio tikslingumo svokos taikymas, aikinant biologines sistemas ir jose vykstanius reikinius, tampa norma ir padeda panaikinti daug nesusipratim. Tikslij moksl srities tikslingumo svok ved N. Vyneris (N. Wiener) nagrindamas kibernetines, tarp j biologines, psichologines ir socialines sistemas. Toks poiris suteikia teis keisti metodines biofizikos dstymo nuostatas. Sisteminiu poiriu galima formuluoti bendr hipotetin biofizikinio poirio nuostat, kad:
GYVYB yra hierarchikai susidaranti informacin udarojo kodavimo ir dekodavimo principais funkcionuojanti tikslingos veiklos organizuota sistema.

is poiris neprastas fizikinio ir cheminio mstymo metodologijos specialistams, nors fizikos mokslas, aikindamas gyvybs esm, nuo Aristotelio laik rmsi dualistiniu materijos ir dvasios-sielos poiriu. Dualistin nuostata tai ikildavo, tai inykdavo, ir buvo vadinama vitalizmu. Organizuotos sistemos, udarojo kodavimo ir dekodavimo poiriu i nuostat galima vadinti kibernetiniu vitalizmu. Aristotelio entelechijos, vitalins, organizuojanios, valdanios jgos, be kuri negaljo gyvybs aikinti daugyb autoriteting gyvosios gamtos tyrintoj, vienokia ar kitokia forma
32
BIOFIZIKA

matomos visose organizuotose, tarp j ir biologinse sistemose. Tai informacins kodavimo ir dekodavimo procedros, tikslingai veikiantys valdantieji veiksniai. Jie yra tikri, nes yra gyvendinami konkrei struktr (ferment E, nukleorgi NR, hormon, feromon, nerv) vykdomais vyksmais fizikinmis chemini virsm priemonmis. Jose nemateriali informacij, reikaling valdyti, priima, saugo, perdirba ir siunia materials neikliai signalai. Signalams galioja fizikos ir chemijos dsningumai, o informacija yra nauja kokyb, turinti visikai kitokius dsningumus nei fizikiniai ar cheminiai energijos bei mediag virsm dsniai. Tuo ir pasireikia informacijos nematerialumas. Informaci1.9 pav. Platonas pripasta tik dvasin jos esm yra element, vadinam simboliais, idj pasaul, o Aristotelis dedukcinio kombinacijos, deriniai ir funkcin j reikm. gamtos painimo metodo ir gyvosios gamToks poiris jau buvo Aristotelio laikais. tos dualistins sampratos pradininkas rodo dar ir emikj material pasaul Aristotelio mokytojas Platonas pripaino tik dva(427322 pr. m. e.). (Rafaelio freska) sin ir idj, iandien vadinam virtualiu ar informaciniu, pasaul (1.9 pav.). Aristotelio fizika deduktyviai aikindama gyvj gamt teig, kad pasaulis yra dualistinis susideda i materialij ir nematerialij, organizuojani veiksni entelechij, kurias galima vadinti informacinmis valdymo procedromis. ie poiriai ryks tyrinjant biofizikos raidos istorij.

1.7. ISTORINIAI BIOFIZIKOS TARPSNIAI

Biofizikos, kaip fizikos ir organizuot biologini sistem teorijos, pradininku, taikiusiu dedukcijos metod, galima laikyti Aristotel (Gr. Aristot#lhV, 384 322 pr. m. e.). Fizikos mokslo apie gamt pradininkas neskyr gyvosios gamtos nuo negyvosios. Aikindamas gyvybs vyksmus, reikalavo remtis funkciniu tikslingumu ir savitomis gyvybs savybmis entelechijomis. Aristotelis teig, kad mokslas, tyrinjantis gamt (gyvj ir negyvj) fizika, turi atsakyti 3 klausimus, pavyzdiui: 1. I ko padarytas lapas (augalo)? 2. Kaip auga lapas? 3. Kokiam funkciniam tikslui (paskiriai) skiriamas lapas?
33
vadas

Biologijos vyksmus vertinti matematikai pradjo Leonardas Pizietis, pravardiuotas Fibonaiu Gerojo snaus pravarde (Leonardo Pisano, 11801240). Jis 1202 m. paskelb pirmj idealizuotos triui populiacijos augimo dsn (iuo metu vadinam Fibonaio skaii eil, tada pradjs kompiuteri naudojam rekursyvinio skaiiavimo metod). Organizuot biosistem teoriniu poiriu ypatingo dmesio vertos plaiai inomo vidurami gydytojo stebukladario Paracelso (Paracelsus; tikr. Filip Teofrastus Bombastus von Hohenheim, 14931541) teiginiai, kad kiekviename organizme slypi gyvybs pradmuo archaeus. is archaeus reguliuoja (valdo) plaui, irdies ir kit organ veikl. XVII a. fiziologas Helmontas (Johan Baptista van Helmont, 15791644), pltodamas Paracelso idjas, rodinjo, kad yra visa hierarchin archaeus sistema visi organai turi savus archaeus, kurie valdo.

1.10 pav. Pirmojo mechanicistins biofizikos veikalo, Emilio Borelio knygos De motu animalium (1680) viena iliustracija

34
BIOFIZIKA

Mechanistins biofizikos mokslo pradia yra 1680-ieji metai. Tuo metu Italijoje pasirod Diovanio Borelio (G. Borelli, 16081679) dviej tom knyga Apie gyvn judjim (De motu animalium). Galiljaus mokinys Borelis, kartu su mokytoju pagrind fizikos bandymais pradi ir eng ingsn biofizikos kryptimi. Pirmajame tome apra mogaus ir gyvuli raumen, griaui struktras bei form. Antrajame tome fizikini mechanizm, mechanikos, hidraulikos kalba aikino raumen susitraukim, griaui mechanizm, irdies judjim, kraujo cirkuliacij ir virkinimo mechanik (1.10 pav.). Tai pamatinis biomechanikos veikalas. Tiesa, biofizikos vardo iame veikale nerasime. Jis pasirodys tik po 200 met, bet biofizikin dvasia vieia beveik visuose io veikalo skyriuose. Vliau, kelis imtus met buvo publikuoti tik keli pavieniai mechanicistins biofizikos darbai. Matematin hidrodinamin kraujotakos teorij yra krs matematikas Leonardas Oileris (Leonhard Euler, 17071783). 1768 m. prancz hipologas Burdelis (Bourdelle) ileido taikomosios biomechanikos veikal Arklio eksterjeras, kuriame buvo pateikti tam tikr arklio parametr vertinimo matematikos metodai taikytini vairioms arkli panaudojimo reikmms. (Tai tuo metu buvo taip pat aktualu, kaip iandien automobili duomenys). Biofizikines teorines koncepcijas skelb pranczas Ren Dekartas (Rene Descartes, 15961650), lotynikai vardijamas kaip Renualdas Kartezijus. Dar pirmojoje XVII amiaus pusje jis publikavo Traktat apie mog. Jame pateik hipotetinius teorinius

1.11 pav. Ren Dekartas (15961650). Dedukcinio gamtos painimo metodologijos ir dualistins gyvybs sampratos krjas, atspindjimo (reflection) gyvojoje gamtoje teorijos pradininkas

35
vadas

aikinimus apie raumens susitraukim, reflekso lank, regjim, nerv sistemos ir smegen veikimo mechanizmus. Jis sukr ir pritaik mechanicistin poir biologijos vyksmams. Jam priklauso plaiai inomas filosofinis posakis, apibdinantis dualistin mstymo ir materijos (smegen) poir: Mintis tai ne materija. Materija tai ne mintis. Tai jis yra atspindjimo teorijos pradininkas, pradjs aikinti atspindjimo sielas bei dvasias ir j reakcijas, iki iol vadinamas refleksais. Dekarto pateikta smegen veiklos schema vaizduoja to laikotarpio aplinkos atspindio smegenyse samprat, grtamj valdantj poveik ir smegen hidraulins skilveli veiklos bei kankorins liaukos svarb (1.11 pav.). Dekarto biofizikins sampratos buvo daugiau sumanytos ir silpnai pagrstos bandymais. J galima laikyti ne tik tikruoju sistemins ir dedukcins biofizikos pradininku, bet ir organizuot biologini sistem, kurioms labai didel tak turi dvasiniai atspindiai (reflections), informacinio kodavimo ir dekodavimo metmen idjiniu autoriumi. Jo teorijos gana ilgai buvo dstomos visuose Europos universitetuose, tarp j ir Vilniaus. XVIII a. dl fiziko Galiljaus ir filosofo Fransio Bekono (Francis Bacon) darb takos gamtos moksluose suklestjo bandym metodas, tvirtins indukcinio analizinio gamtos painimo metodologij. Galiljus kviet gamtos tyrjus Matuoti tai, kas matuojasi, o tai, kas nesimatuoja padaryti matuojamu. Mokslins tiesos pagrindu tapo jo didenyb bandym faktas. J duomenimis remiantis, buvo formuluojami dsniai. Apsiribojus tik negyvosios gamtos painimu i fizikos mokslo buvo imestas Aristotelio treiasis, funkcinio tikslingumo, reikalavimas. i metodologija labai sitvirtino negyvosios gamtos moksluose, suformavo iandienins fizikos ir chemijos moksl, moksl apie negyvj gamt bandymais painimo paradigm ir atitinkamus mokslinio tyrimo metodinius pagrindus. Tiesa, tai suteik galimyb sukurti gana adekvaius materijos ir mediag virsm kiekybinius, matematiniais modeliais apraytus dsnius. Tai sudar pramonins (industrins) visuomens nauj technologij idjin pamat. Klestinti negyvosios gamtos fizika antrj viet nustm gyvosios gamtos fizik. Todl ne atsitiktinai jau XVII imtmet anatomin gyvn struktr siejant su funkcijomis atsirado fiziologija. Ji, reikianti t pat kaip ir fizika mokslas apie gamt tiria ir aikina tik gyvj organizm vyksmus. Pirmuoju fiziologu laikytinas Viljamas Harvjus (Willam Harvey, 15781657), nustats udaruosius kraujotakos ratus ir funkcin irdies paskirt. Pagrindinis to laikotarpio publikuotas fiziologijos darbas buvo veicaro Albrechto fon Halerio (Albrecht von Haller, 17081777) atuoni tom sugyvintos anatomijos veikalas mogaus kno fiziologijos elementai. Atsirado naujas, kaip ir fizika, artimas biofizikai mokslas fiziologija. Fiziologija biofizikai buvo artima savo interesais, o to meto fizika savo kiekybine metodologija. Kartu su fiziologija buvo pltojamos ir teorins gyvybs sampratos. 17941796 m. Erazmas Darvinas (Erasmus Darwin, 17311802), arlzo Darvino senelis, publikavo
36
BIOFIZIKA

veikal Zoonomija arba organins gyvybs dsniai. Jame ikl palaipsninio gyvn evoliucijos ir tobuljimo teorij. Tuo metu biologijos vardas dar nebuvo inomas. Vietoje biologijos termino buvo vartojama organins gamtos, organins materijos, organini btybi svokos. Rykiausias XVIII amiaus pabaigos biofizikos mokslo pradios reikinys ital anatomo ir fiziologo Luidio Galvanio (Luigi Galvani, 17371798) (1.12 pav.) ir jauno fiziko Aleksandro Voltos (Alessandro Giuseppe Antonio 1.12 pav. Luidis Galvanis Anastasio Volta, 17451827) (1.13 pav.) mokslinis gin- (17371798), fiziologas as dl gyvn elektros. 1791 m. Galvanis paskelb knyg Traktatas apie elektrines jgas judant raumenims ir 1795 m. idst hipotez, kad raumenyse kaupiasi elektros krvis. Jis aikino, kad usidarius grandinei, nervais atsklidusi elektros srov ir sukelia raumens susitraukim. Bandymai buvo atlikti Bolons universitete su varls nervo ir raumens preparatais. Taiau Volta, nesutikdamas su Galvanio aikinimu ir negaldamas pripainti gyvnins elektros, atkakliai kr vairiausias visa tai paneigianias alternatyvias teorijas. 1794 met gegus 5 d., po daug kartoti1.13 pav. Aleksandras Volta ni bandym, jis pripaino Galvanio ties. Taiau po 9 (17451827), fizikas par vl pradjo nauj puolim, aikindamas, kad elektra atsiranda dl skirting metal slyio savybi. Abu mokslininkai nirtingai gyn savas tiesas, pagrsdami jas vis naujais savais bandym duomenimis. Tuo metu atrod, kad gin laimtojo Volta. Mums jau inoma, kad jie abu teiss. i dviej mokslo vyr gino padarinys elektrofiziologija, elektrochemija, termoelektros mokslas. Volta, kurdamas bioelektros elemento model, sukr Voltos stulp, taip atsirado ir elektrocheminis g a l v a n i n i s e l e m e n t a s . is mokslinis ginas nebuvo svetimas Vilniaus universitetui. Vilniaus universiteto fizikos profesorius Steponas Stubuleviius (17621814) dstydamas elektr ir magnetizm, visada atkreipdavo dmes elektros ir gyvj organizm ry. Jis 18021804 m. laikotarpiu staavosi Austrijos, Vokietijos, Pranczijos ir Italijos universitetuose, ir ne atsitiktinai yra paras veikal, Elektros taka gyvn bsenai. Jame, idsts elektrofizikos teorinius pagrindus, aprao elektrostatini priemoni naudojim tam tikroms ligoms gydyti. Beveik tuo paiu metu, keleriais metais anksiau, iaurs Italijos Paduvos universitete studijavo ir kitas Vilniaus universiteto profesorius Andrius Sniadeckis. Po kele37
vadas

ri met, dar staavsis Edinburgo universitete pas augal fiziolog Braun, grs Vilni jis naujausius mokslo laimjimus dst Vilniaus universiteto medikams ir gamtininkams. 18041861 m. A. Sniadeckis ileido trij tom teorins biologijos veikal, kuris buvo to meto teorins biologijos, chemijos, biochemijos ir biofizikos vadovlis Organini btybi teorija (1.14 pav.). i knyga atspindjo naujausias to meto Europos mokslo inias, ir net pralenk laikmet. Vadovlis buvo iverstas prancz ir vokiei kalbas. Tuo metu buvo pradti formuoti populiacij au1.14 pav. Andrius Sniadeckis gimo dsniai, vartojant net Izaoko Niutono (Isaac New(17681837). Organizm orga- ton, 16431727) diferencialini lygi matematin nizuotos veiklos teorijos ir biofizi- kalb. 17981803 m. anglikon banyios pastorius kos bei biochemijos moksl pra- Tomas Robertas Maltus (Thomas Robert Malthus, dininkas Vilniaus universitete 17661834) paskelb pamatin darb Patirtis apie gyventoj augimo dsn. Jame matematine diferencialini lygi kalba rodinjo, kad mons ir kiti gyvieji dauginasi geometrine progresija, o maisto kiekis didja aritmetine progresija. Taip jis pagrind kovos u bv neivengiamum, kuris turjo reikms Darvino evoliucijos teorijai. is darbas yra bene pirmasis, kuriame Niutono klasikins mechanikos mstymo diferencialini lygi kalba buvo pritaikyta biologiniams dsningumams aikinti. Tiesa, matematikos metod taikymas biologini populiacij kiekybiniam vertinimui (matematinis kodavimas) buvo pradtas daug anksiau, dar 1202 m. Leonardo Pizieio. 1835 m. Briuselyje belg matematikas, Laplaso mokinys Adolfas Ketl (Adolphe Quetelet, 17961874) publikavo knyg Apie mog ir jo sugebjim vystymsi, arba socialins fizikos patirtis. iame veikale populiacij kitimas pateikiamas tikimybi teorijos, matematins statistikos kalba, sujungiant antropometrijos ir socialins statistikos metodus. 1848 m. ileistame veikale Apie socialin sistem ir j valdanius dsnius A. Ketl nagrinja moni bendruomen ne kaip paprast individ sum, o kaip sistem, paklstani tam tikriems gamtos dsniams, nepriklausomiems nuo moni valios. 1871 m. darbe Antropologija A. Ketl parod statistini dsningum reikm ne tik moni visuomenei, bet ir visoms biologinms populiacijoms. 1869 metais papildytas pirmasis veikalas Socialin fizika, arba tyrim apie moni sugebjim, vystymsi patirtis, A. Ketl, pagrsdamas didiuliais statistini tyrim duomenimis parod, kad moni savybms ir elgsenai aprayti taikytini tikimybi teorijos metodai, dsniai, ypa tokie kaip K. F. Gauso (Carl Friedrich Gauss) ir Laplaso (Pierre-Simon, Marquis de Laplace). A. Ketls darbai padjo pagrind iuolaikinei biometrijai ir biostatistikai.
38
BIOFIZIKA

Kai kuriuose vadovliuose biofizikos gimimo data enklinama 1841 metais, mediko Juliaus Roberto Majerio (Julius Robert Mayer, 18141878) paskelbtu darbu, apie mogui galiojant energijos tverms dsn (1.15 pav.). Laivo gydytojas, keliaudamas Karib jra, atkreip dmes, kad arterinio kraujavimo metu sunku i kraujo spalvos atskirti arterin krauj nuo veninio. Nagrindamas fakt, jis suprato, kad iltuosiuose kratuose organizmui reikia maiau deguonies negu altuosiuose, ir suvartotas deguonies kiekis rodo sudeginto biologinio kuro kiek. J. R. Majeris suprato mogui galioja energijos pu- 1.15 pav. Julius Robertas Majeris (18141878), energijos siausvyra energijos tverms dsnis. tverms dsnio mogui ir visiems Tiesa, energijos tverms dsnio formuotei lemiamos gyviesiems organizmams idjos reikms turjo angl fiziko Deimso Preskoto Daulio autorius (James Prescott Joule, 18181889) ir mokslininko universalo, vieno didiausi biofizikos autoritet Hermano Liudviko fon Ferdinando Helmholco (Hermann Ludwig Ferdinand von Helmholtz, 18211894) darbai (1.16 pav.). Pastarajam priklauso ne vien energijos tverms dsnis. H. L. F. Helmholcas 1850 metais irado oftalmoskop ir sukr originali fiziologins optikos studij. Tais paiais metais pamatavo nervinio suadinimo sklidimo varls nervu greit, o 1867 metais mogaus nervu. Sukr rezonansin klausos teorij ir ausies model. Ne atsitiktinai kai kurie biofizikos autoritetai Helmholc laiko pagrindiniu tikru biofizikos pradininku. Nors biofizi1.16 pav. Hermanas L. F. Helmkos vardu jis nra paskelbs n vieno darbo. Energijos tverms dsn mogui bandymais, kalori- holcas (1821 1894), daugelio biofizikos idj ir eksperiment metrijos metodu, patikrino Maksas Rubneris (Max Rubpradininkas ner) 1894 m. ir U. Atwateris (W. Atwater) 1904 m. Biometrijos moksl, kaip kiekybin biologij, taip pat biometrijos bei biofizikos svokas ved anglai Frencis Galtonas ir Karlas Pirsonas. J darbai turjo didels reikms bandym (eksperimentinei) biologijai. Papildydami Darvino evoliucijos teorij jie kr biologin kiekybin mstym. Tuo metu vyravo kokybin K. Linjaus (Karl Linn-Linnaeus) ir . Kiuvj (Baron Georges Lopold Chrtien Frdric Dagobert Cuvier) gyvojo pasaulio klasifikavimo dvasia fenotipikoji sistematika ir lyginamoji anatomija. Kaip rayta, K. Pirsonas yra ir biofizikos vardo autorius. 1892 m. ileistame filosofijos veikale Mokslo gramatika jis itaiso mokytojo Fr. Galtono nevisikai tiksli
39
vadas

1.17 pav. Viljamas S. Gosetas (18761937), jo darbai paskelbti Stjudento slapyvarde

1.18 pav. Ronaldas E. Fieris (18901962), daugelio biometrijos ir sistem modeliavimo metod autorius

biometrijos mokslo apibrt. Nurod, kad biologij, sukurt ant tikslij moksl pamato, prasminga vadinti ne biometrija, o BIOFIZIKA. Vliau kiekybinius biologini tyrim biometrijos metodus plt dan biologas genetikas Vilheimas Johansenas (Willheim Johannsen, 18571927). Jis reikalavo atsargiai vertinti statistik, pirmum tiekti biologinei esmei. Aikindamas gyvybs esm, jis 1909 m. sugalvojo genotipo ir fenotipo svokas. Jas biologai pripaino tik 1953 m., nustaius molekulin DNR struktr. K. Pirsono mokinys V. S. Gosetas (William Sealy Gosset, 18761937) (1.17 pav.), tyrinjs mieli populiacij augimo vyksmus rgstant alui, sukr matavimo ir statistinio vertinimo metodus. Juos iuo metu taiko visi tyrjai. Dauguma tyrj, vartojantys Stjudento koeficient, Stjudento t kriterij, net ir neino, kad naudojasi V. S. Goseto sukurta matematinio mstymo metodika. Angl matematikas Ronaldas Fieris (Ronald Aylmer Fisher, 18901962) (1.18 pav.), vis gyvenim nagrinjs biologijos klausimus, sukr biologins atrankos (selekcijos) metodus, bandym (eksperiment) planavim, dispersin analiz ir daug kit biometrijos metod. Jie iuo metu plaiai taikomi vairiausioms technologijoms, tarp j ir biotechnologijai. Taip pat jis sukr daug veiksming sisteminio mstymo naujovi, ypa biosistem modeliavimo metod, pateik original R. Fierio kiekybin informacijos vertinim.

1.19 pav. L. Michaelis (18751949) ir M. Menten (18791960). Fermentini reakcij kinetikos matematinio modelio autoriai

40
BIOFIZIKA

Matematinius biologijos metodus nuo XX a. pradios kr daug vairiausi krypi tyrintoj. Vienas svarbesni to metu sukurt matematini modeli buvo Leonoro Michaelio (Leonor Michaelis, 18751949) ir Maudos Menten (Maud Leonora Menten, 18791960) (1.19 pav.) ivesta fermentins reakcijos kinetin lygtis. 1917 m. anglas dArci W. Thompsonas (DArcy Wentworth Thompson, 18601948) ileido didiul veikal Apie augim ir form. Jame pateik gyvj organizm transformacij teorij, taikytin gyvybs formos kaitai vertinti gyviesiems organizmams augant, bei original optimalumo princip. Pamatiniai raumens susitraukimo biofizikiniai tyrimai ir matematiniai modeliai 1922 m. Nobelio premija buvo vertinti A. V. Hilio (Archibald Viviano Hill, 18861977) darbai (1.20 pav.). 1924 m. amerikietis Alfredas J. Lotka (Alfred James Lotka, 18801949) publikavo pirmj siaurosios biofizikos sampratos veikal Fizikins biologijos elementai. i knyga buvo to meto originali matematiniais aikinimo metodais pagrsta fizikin gyvybs chemija. 1931 m. Paryiuje ymus ital matematikas Vitas Voltera (Vito Volterra, 18601940) paskelb darb Kovos u bv matematin teorija. Jame tokiomis paiomis matematinmis lygtimis kaip ir A. J. Lotka aikino biologini populiacij kitimo dsningumus. Beveik tuo paiu metu Paryiuje buvo pa1.20 pav. A.V. Hilis (1887 skelbtas ir rus mokslininko G. F. Gauzs ( 1977). Raumens susitraukimo , 19101986) ekologins konkurencijos s- biofizikos pagrindjas. Nobelio premija 1922 m. veik monopolizacijos dsnis. Rykiausi pirmieji pokario biofizikos laimjimai, suformav samprat apie lstels biofizik, buvo elekrofiziologiniai ir joniniai tyrimai, sukurti fiziniai ir matematiniai nervinio impulso modeliai. Juos garsiojoje Kembrido universiteto fiziologijos laboratorijoje atliko A. L. Hodkinas (Alan Lloyd Hodgkin, 19141998) ir A. F. Hakslis (Andrew Fielding Huxley, 1917) (1.21 pav.). U iuos tyrimus 1963 m. jiems buvo suteikta Nobelio premija. Matematins biofizikos pionieriumi, skleidju ir tyrju laikytinas rus mokslininkas, vis laik dirbs Ilinojaus universitete Nikolas Raevskis (Nicholas Rashev- 1.21 pav. A. F. Hakslis (1917) ir A. C. Hodkinas (1914 sky, 18991972). Emigravs JAV po rus revoliucijos, 1998). Nobelio premija u jis ten sukr matematins biofizikos mokykl, para ma- nervinio impulso tyrimus bei tematins biofizikos ir biologijos vadovlius ir 1938 m. modelius 1963 m.
41
vadas

pradjo leisti mokslo urnal The Bulletin of Mathematical Biophysics. Vliau N. Raevskio matematin biofizikos mokykla, vadovaujama R. Rozeno (Robert Rosen, 19341998) persikl Bufalo universitet (JAV), kur toliau vyt matematin biofizik ir biologij. ia 1985 m. buvo suformuluota Modeling Relation samprata, publikuota knygose Anticipatorins sistemos, o vliau Life as Itself. Kitas rus emigrantas biofizikas Ilja Prigoinas (Ilya Prigogine, , 1917 2003) (1.22 pav.) Briuselyje sukr ir pltojo nepu1.22 pav. Ilja Prigoinas (1917 siausvirij disipatyvij sistem teorijos krypt, kuri 2003). Nobelio premija 1977 m. u nepusiausvirij sistem ir gy- termodinamikos poiriu aikino gyvybs esm, sukr plaiai inom Briuselio mokykl. U iuos nuopelnus vybs termodinamik buvo apdovanotas Nobelio premija (1977). Dar kitas rus emigrantas JAV buvo plaiai inomas daugelio originali vairi mokslo srii idj autorius, matematikas Georgas (Jurijus) Gamovas (Georgy Antonovich Gamov, 19041968), kuris su Martynu Yu (Martynas Yas, 1917) ir Aleksandru Riu (Alexander Rich, 1925) 1954 m. sugalvojo genetinio tripleto hipotez. Aptariant biofizikos istorijos bruous btina atkreipti dmes Rusijos mokslo na. XX a. pirmojoje pusje Rusijoje susiformavo stipri biologijos teorini samprat mokykla, kurios dvasia buvo prof. Nikolajus Kolcovas ( , 1.23 pav. Ervinas S. Baueris 18721940). Jo mokiniai ir mokini mokiniai, paskli(18901938). Biofizikos, kaip d po pasaul ir lik Rusijoje, kr teorines biologijos teorins biologijos, pradininkas mokyklas. Todl natralu, kad jau 1919 m. Maskvoje buvo kurtas pirmasis pasaulyje mokslinis biofizikos institutas. Tuo metu tarp Rusijos biolog tvyrojusi teorinio mstymo aplinka suviliojo vengr kilms biologijos teoretik Ervin S. Bauer ( , 18901938) (1.23 pav.), studijavus gamtos mokslus pagrindiniuose Vokietijos universitetuose ir dirbus Berlyno moksl institutuose, atvykti Rusij. ia jis 1930 m. atspausdino teorin biofizikos veikal Fiziniai biologijos pagrindai, o po keleri met paskelb pagrindin original darb Teorin biologija. ioje knygoje jis gyvybs esm aikina fizikins termodinamikos poiriu, kaip stabilios nepusiausviriosios bsenos princip sistem. (ia, Rusijoje, u politines, beje komunistines pairas, jis su mona buvo suaudyti 1938 m.).
42
BIOFIZIKA

Rus biolog nuopelnai biofizikai buvo vertinami pasauliniu mastu. 1939 metais Niujorke (JAV) organizuojant Pirmj pasaulin biofizikos ir kosmologijos kongres, pagerbiant rus biofizikos pionierikum, kongreso garbs prezidentu buvo kvieiamas biofizikas Aleksandras L. ievskis ( , 1897 1964). Taiau to meto TSRS valdia jo neileido vykti JAV. Nebus per daug pasakyta ryks biofizikos ir teorins biologijos pradininkai buvo XX a. pirmosios puss rus biologai. Biofizika, kaip ir visa biologija, Rusijoje buvo sulugdyta dl nemokslini, politini nuostat po Rusijos Spalio revoliucijos, ypa TSRS stalinizmo metais. Ji atsigavo po Antrojo pasaulinio karo, kartu su didjania biofizikos svarba Vakar pasaulio mokslui ir ypa reikalinga mokslo kryptis, atsiradus branduoliniams ginklams bei pltojant biotechnologijas. Radikaliausias mokslo darbas pokaryje, sukls nauj biologijos ir biofizikos paradigm atsiradim, buvo biologo D. Votsono ir fiziko Fransio Kriko, 1953 m. balandio mn. urnale NATURE paskelbtas teorinis straipsnis apie dvigub DNR spiral (1.24 pav.). Buvo paaikinta, kaip gyvendinta viena svarbiausi gyvybs savybi genetin 1.24 pav. Deimsas Votsonas (1928) ir Fransis Krikas (19162004). Nobelio premija u dvivij DNR atmintis, genas. Prasidjo molekulins spiral 1962 biologijos, biokibernetikos ir bioinformatikos (plaija prasme) era. Kibernetinio vitalizmo, kaip genetins informacijos, gyvendinimo mechanizmas lstels struktrose, buvo parodytas daugybs kolektyv 19531962 met tyrimais. Kaip rayta, 1954 m. G. Gamovas, M. Yas ir A. Rias sugalvojo ir paskelb genetinio kodo tripleto hipotez, o 19651968 m. buvo iifruotas genetinis kodas. Biofizikos poiriu ypa reikminga Fransua akobo (Franois Jacob, 1.25 pav. akas Mono (19101976), Fransua ako1920) ir ako L. Mono (Jacques Lucien bas (1920). Nobelio premija u operon 1965. Monod, 19101976) (1.25 pav.) nu- Prokariotins lstels molekulinio-genetinio valdstatyta prokariotins lstels molekuli- ymo reguliavimo schemos operono autoriai
43
vadas

nio-genetinio valdymo ir reguliavimo, arba kitaip vadinama operonu, schema. Ji rodo dekodavimo arba informacinio valdymo bei mediag apykaitos vyksmus lstelje, darni reguliuojamj struktr veikl. ioje schemoje akivaizdiai parodyta kibernetin funkcin lstels organizacija. U darb 1965 m. jiems buvo suteikta Nobelio premija. Be to, i schema pravr galimyb suprasti kit, labai svarbi ir neaiki lsteli biologin savyb lsteli diferenciacijos fenomeno mechanizm. akobas ir Mono pateik trigerin gen tarpusavio sveikos idj. Ji paskatino daug teoretik kurti lsteli morfogenezs ir diferenciacijos matematinius modelius, tirti modeliuojant kompiuterijos metodais. Pokario molekuliniai ir genetiniai gyvojo pasaulio tyrimai kartu su atsiradusiomis naujomis informacinmis technologijomis pasaulio moksl atved dabartin biologij, gen ininerij, biochemij ir sistem biofizik. Lietuvoje biofizika atsirado tik baigiantis XX a. etajam deimtmeiui, 1957 m. Kauno medicinos institute ir 1962 m. Vilniaus universitete rus biofizikos takoje (r. D. Kirvelis, B. Sadeckien, 2004). Rykiausias lietuvis biofizikas yra Martynas Yas (1917), JAV pilietis, Vilniaus universiteto Garbs daktaras, pasaulyje inomas kaip 1969 m. paskelbto veikalo Genetinis kodas ir vienas i trij genetinio tripleto idjos autori. Daugumoje ali, iskyrus Vokietij ir Rusij, biofizika suprantama siaurja prasme, kaip fizikochemin biologija. Biofizika plaija prasme, sistem biofizika, ypa buvo pltojama pokaryje sprendiant ekologijos problemas ir atsiradus kibernetikai. Sisteminis poiris gyvyb vis svarbja, ypa pleiantis molekulinei lstels biologijai, sisteminant gausjanius biologini bandym duomenims.

1.8. SISTEM BIOFIZIKOS RAIDA IEKANT ORGANIZUOTUMO IR ORGANIZUOJANI VEIKSNI INFORMACIJOS

Pokaryje paaikjo, kad tik per sistemin teorin poir gyvyb biofizika gali gyti mokslinio savitumo. Todl suprantama, kodl klasifikuojant moksl, biofizikos mokslo krypt buvo traukta SISTEM (FIZIOLOGIN) BIOFIZIKA (B 130). Nes gyvybei, gyvosioms sistemoms bdinga tvarkinga, organizuota, funkcikai tikslinga veikla, kuri lemia specialios, tam tikrais principais organizuotos ir gerai matomos paios sistemos ar organizmo struktros. Sisteminio poirio teorijos pradininku yra laikomas austr biologas Karlas Liudvigas von Bertalanfis (Karl Ludwig von Bertalanffy, 19011972) (1.26 pav.), kuris dar prie Antrj pasaulin kar pradjo kurti bendrj sistem teorij (General System
44
BIOFIZIKA

Theory). Jo nuomone, tam tikriems organizmams ir j populiacijoms aikinti turi galioti bendri dsniai, kuriuos privalo atrasti ir suformuluoti mokslas bendroji sistem teorija. Tokio biofizikinio poirio pradininku kai kas laiko Leonard da Vin (14521519), kuris mokslikai nagrinjo spiralin augal filotaksij. Kiti io poirio krimo pradia laiko DArcy Thomsono (1.27 pav.) 1917 m. atspausdint veikal On Growth and Form ir 1925 m. Alfredo Lotkos (1.28 pav.) knyg Elements 1.26 pav. Liudvigas von Bertalanfis (19011972), of Physical Biology. bendrosios sistem teoriNeabejotinu organizuot biosistem pradininku laikyti- jos pradininkas nas senojo Vilniaus universiteto profesorius Andrius Sniadeckis. Jis dar 1804 m. ileisto mokslinio veikalo Teorya jestestw organicznych pirmojo tomo vade pabria, kad ...jeigu materija organizuota ir gyva, tai turi j veikti speciali jga, kuri j ali, beform ir nejaudri, sudlioja organin form ir suria...Neatsivelgdami jos prigimt, toliau j vadinsime organizuojanija, arba organine, jga... Tokius knus vadiname gyvybingais, gyvais, arba atsivelgdami j sandar organiniais. Pirmajame tome aptars bendruosius mokslinio painimo metodinius principus ir organini btybi savybes, antrajame tome aikina to meto cheminiubiocheminiu ir biofizikiniu poiriu mogaus anatomij ir fiziologij, o treiajame nerv sistem, psichikos ir net socialinius vyksmus. Bendrosios organizuot sistem teorijos pradininku laikytinas rus medikas teoretikas, pirmojo pasaulyje mokslinio kraujo instituto krjas Aleksandras A. BogdanovasMalinovskis ( -, 18731928) (1.29 pav.). Jo 1912 m. pasirods veikalo TEKTOLOGIJA bendrasis organizacijos mokslas pirmasis leidimas, taip pat kartotiniai leidimai ir vertimai vokiei

1.27 pav. DArcy Thompsonas (18601948)

1.28 pav. Alfredas Lotka (18801949)

1.29 pav. Aleksandras BogdanovasMalinovskis (18731928)

45
vadas

kalb buvo vertinti kaip originalaus organizacinio ar kibernetikos mokslo pradiamokslis. Ypatingo dmesio vertos tarpukaryje Estijoje dirbusio biologo teoretiko Jakobo von Ukskulio (Jakob von Uexkll, 18841944) Umwelt samprata apie gyvybs organizacijos principus. i samprata akivaizdiai rodo organizm ir aplinkos udarojo kodavimo ir dekodavimo procedr svarb, kuri teorin biologija pateikia kaip biosemiotikos pradmenis. Antrojo pasaulinio karo metu fizikas teoretikas, vandenilio atomo matematinio modelio autorius Ervinas rdingeris (Erwin Rudolf Josef Alexander Schrdinger, 18871961) apibendrino fizikos poir biofizik. 1943 m. istudijavs biologinius faktus, knygoje Kas yra gyvyb? Fiziko poiris padar ivad, kad inom fizikos dsni gyvybei suprasti nepakanka. Jo manymu, gyvybei paaikinti bus atrasti papildomi dsniai, kurie atskleis gyvybs paslaptis, ir ie dsniai taip pat bus fizikos dsniai. 1948 metais pasirod du mokslo darbai pateik alternatyv ne tik E. redingerio nuomonei, bet ir fizikai bei chemijai. Jais buvo parodyta, kad ne visus gamtos vyksmus, ypa gyvosios gamtos ir visuomens, paaikinti fizikos ir chemijos dsniais bei svokomis nemanoma. Tai buvo Norberto Vynerio (Norbert Wiener, 18941964) (1.30 pav.) Kibernetika ir Klodo Elvudo enono (Claude Elwood Shannon, 1916 2001) (1.31 pav.) Matematin informacijos perdavimo teorija. Buvo parodyta, kad gyvajai gamtai, technikai ir visuomenei, be mediag ir energijos virsm, bdingi saviti informaciniai valdymo vyksmai, lemiantys organizuotum ir funkcin tikslingum. Buvo pabrta, kad informaciniai valdymo vyksmai bdingi tik gyvajai gamtai ir tam tikrai technini rengini grupei; kad informacijos i esms negalima apibrti energijos ar/ir mediag virsmais. enonas apibr informacij kaip sumaint ar panaikint neapibrtum ir pateik informacijos kiekio nustatymo me-

1.30 pav. Norbertas Vyneris (18941964)

1.31 pav. Klodas E. enonas (19162001) su elektronine pelyte labirinte

46
BIOFIZIKA

tod. Jis nurod algoritm, kaip kiekybikai vertinti kodavimo ir dekodavimo veiksmingum perduodant informacij kanalu triukmo slygomis. alia fizikins energijos, chemins mediagos atsirado nauja, visikai kitas savybes turinti mokslin kibernetikos vertyb informacija, reikalinga tikslingam valdymui ir organizuotumui gyvendinti. Daugjani ir tobuljani biologini sistem funkcinei sampratai svarbus matematiko, pirmojo elektroninio kompiuterio krjo Johano von Noimano (John von Neumann, 19031957) (1.32 pav.) ir mainos-automato, kuris gamina ir tobulina savo kopijas, teoriniai darbai. Jo teorins sampratos yra pirmasis lstels, kaip organizuotos sistemos, dauginimosi, kodavimo ir dekodavimo, arba genotipo ir fenotipo principais funkcionuojanios sistemos modelis. Kitas kompiuteri teorijos krjas Alanas M. Turingas (Alan Mathison Turing, 19121954) (1.33 pav.) pokaryje matematikos metodais pateik teorinius biologins morfogenezs modelius Tiuringo disipatyvij struktr model. Kibernetins idjos buvo priimtos biolog ir medik. Angl psichiatras Viljamas Rosas Ebis (William Ross Ashby, 19031972) (1.34 pav.) yra vienas pirmj biokibernetikos pradinink. Jis paskelb vad kibernetik (1953), pateik original homeostato model ir suformulavo savaimins organizacijos principus. Kibernetikos, informacijos teorijos, kompiuteri ir interneto atsiradimas labai paveik poir biologij. Atsirado atitinkamos mokslini tyrim kryptys: biokibernetika, neurokibernetika, bionika, tam tikr biologini vyksm modeliavimai (matematiniai, elektriniai, kompiuteriniai), bioinformatika, neuroinformatika ir pan. Kibernetika ir informacijos vertyb privert i naujo perirti XIX a. chemijos ir fizikos atmestas gyvybini jg vitalizmo tikslingo funkcionavimo sampratas.

1.32 pav. Johanas von Noimanas (19031957). Pirmojo elektroninio kompiuterio ir automat, kurie gamina ir tobulina savo kopijas teorini idj autorius

1.33 pav. Alanas M. Turingas (19121954). Kompiuterio idjos ir biomorfogenezs matematinio modelio autorius

1.34 pav. Viljamas R. Ebis (19031972). Kibernetinio homeostato ir organizavimosi idj autorius

47
vadas

Kibernetikos ir informacijos teorijos atsiradimas vl sukl susidomjim vitalistine biologijos. Tik prie kelerius metus buvo mirs ymus embriologas, neovitalizmo ideologas Hansas A. E. Dryas (Hans Adolf Eduard Driesch, 18671941) (1.35 pav.). Jis teig, kad gyvosiose sistemose yra ypatingi, ne fizikiniai ir ne cheminiai gyvybs veiksniai. Jo manymu, ie veiksniai lemia gyvj organizm nuosekli vyksm tvark, gebjim siekti konkrei tiksl. H. A. E. Dryas pripaino, kad gyvosioms sistemoms bdingas prieastingumas, tverms dsnis ir visi pagrindiniai mediag ir energijos, 1.35 pav. Hansas A. E. Dryas t. y. chemijos ir fizikos virsm, dsningumai. Be j, jo (18671941). Embriologas, XX am- nuomone, gyvajame pasaulyje yra savitieji veiksniai eniaus neovitalizmo ideologas telechijos reguliuojantys, valdantys gyvybs vyksmus taip, kad jie vykt planingai, sukurt ir palaikyt organizuotum. Entelechijos svok jis pasiskolino i Aristotelio. Pagrindines idjas H. Dryas publikavo veikaluose: Organin reguliacija, pasiruoimas gyvenimo teorijai (1899), Siela kaip natralus gamtos veiksnys (1903), Organinio pasaulio filosofija (1908). Kaip namo statyba yra tam tikro plano, minties realizavimas, taip ir organizmo susiformavimas yra tam tikros idjos, kurias Aristotelis vadino entelechija, gyvendinimas ra Dryas. Jis tvirtino, kad entelechija ne energija, ne jga, ne pastovioji, ne mediaga, ji nesusijusi su materialia vertybe, ji neerdvin ir egzistuoja kaip svoka. Dabar is jo teiginys mums primena kibernetin automat, main, robot valdanias programas. J analog galima rasti ir gyvuosiuose organizmuose (DNR ir nerv sistemoje). H. A. E. Dryas mir nusiteiks gana pesimistikai, abejodamas mogaus galimybe entelechijas painti. Galimyb painti informacines entelecijas i esms parod N. Vyneris ir K. E. enonas prajus keleriems metams po H. A. E. Dryo mirties 1948 m. Dar po keleri met paaikjo molekuliniai tam tikr vitalini entelechij gyvojoje gamtoje mechanizmai: 19511968 m. nustatyti genetins informacijos neikliai DNR ir RNR, iifruotas genetinis kodas. Pradta aikinantis nerv sistemos informacini vyksm ir valdymo procedr veikla. Kibernetinio valdymo pirmini idjini uuomazg yra ir fiziologijos istorijoje. XVIIXVIII a. pleiantis bandomajai fizikai ir pagrindiniam jos dmesiui nukrypus negyvj gamt, gyvosios gamtos mokslas susitelk po t pai prasm kaip ir fizika turiniu fiziologijos mokslo pavadinimu. nirtingai buvo iekoma savit biologini sistem savybi, kurios lemia gyvj organizm esm. Dmesingai buvo nagrinjamas reguliavimas gyvj organizm vidins aplinkos stabilizavimas. i savyb pirmasis, dar 1857 m., atkreip dmes pranczas fiziologas Klodas Bernaras (Claude
48
BIOFIZIKA

Bernard, 18131887) (1.36 pav.). Jis tyrinjo temperatros ir vandens kiekio organizmuose pastovum ir teig, kad vidins aplinkos pastovumas yra btina laisvos gyvybs slyga. Vliau, 1932 m., amerikiei fiziologas Valteris B. Kenonas (Walter Bradford Cannon, 18711945) ioms savybms apibendrinti sukr termin homeostaz [gr. homois tas pats, gr. stasis stovjimas]. Dar vliau iuos biologijos reguliavimo principus pltojo vokieiai E. Holstas (E. Holst) ir H. Mitteltadtas (H. Mittelstaedt, 1950 m.). Pagrindinis dmesys krypo nerv sistemos, psichikos proces teorinio painimo link.

1.36 pav. Klodas Bernaras (1813 1887). Biologijos reguliavimo, biokibernetikos pradininkas

1.9. INGSNIAI NEUROINFORMATIK IR PSICHOFIZIK

Biofizikos poirio nerv sistemos, kaip informacinio kodavimo ir dekodavimo bei valdymo struktr, pradininku laikytinas XVII a. dualistinio mokslinio poirio pagrindjas Ren Dekartas (1.11 pav.). Neurokibernetinmis schemomis funkcin nerv sistemos organizacij aikino Ramonas Kajalas (Santiago Ramn y Cajal, 18521934, Nobelio premija 1906) ir Lorente de Noas (Lorente de No, 19021990). Minties svarb gyvybs, mogaus ir visuomens raidai dar prie Antrj pasaulin kar aikino antropologas ir filosofas Pieras Teijaras de ardenas (Pierre Teilhard de Chardin, 18811955). Savo originaliame veikale mogaus fenomenas (ileistame tik 1955 m.), nagrindamas materijos raid ir numatydamas biosferos, ypa mstanios noosferos raid, iri minties (tada informacijos svoka dar nebuvo vartojama) lemiam reikm noosferai ir biologins evoliucijos vyksmui. XX a. antrosios puss gyvybins jgos (Vis Vitalis) samprat psichovitalizm daugiausia nagrinjo teoretikai etologai ir neuropsichologai, tyrinjantys nerv sistem, smegenis. ia gyvybins jgos savoka buvo apibriama kaip prieastis, jungianti daugyb organizmo vyksm darni visum. Toki jg samprata sukl daug klausim apie siel. Buvo teigiama, kad tik igyvendami sismonint veiksm sukuriame vaizdin, jog visas galimas ir norimas vyksm grandines valdo sprendimai, priklausantys nuo savojo a, kaip valdaniosios psichins jgos. Ypatingas dmesys organizm reguliacijai ir valdymui buvo aikinamas per nerv sistemos funkcins veiklos neurokibernetinius modelius. Neurokibernetikos ir neuroinformatikos poirio pradininku laikytinas austr kilms kibernetikas, antrojo lygio
49
vadas

1.37 pav. Hainsas von Fiorsteris (19112002). Antrojo lygio kibernetikos ir neurokibernetikos idj autorius

1.38 pav. W. Mccullochas (1899 1996). Nerv sistemos veiklos aikinimo neuron tinklais teorijos pradininkas

1.39 pav. Valteris Pitsas (19231996). Pritaik matematins dvireikms logikos aparat neuron tinkl veiklai aikinti

kibernetikos autorius Hainsas von Fiorsteris (Heinz von Foerster, 19112002) (1.37 pav.). Jis sukr organizm tikrins veikms (elgsenos) funkcijos (eigenbehavior) teorin samprat, kuria parodoma organizm valdymas udarojo kodavimo ir dekodavimo procedromis ir j svarba, ypa ryki nerv sistemos funkcinje veikloje. Didiausi biofizikins neurokibernetikos mokslo nuopelnai tenka Masaseto technologijos instituto grupei, kuriai vadovavo neurofiziologas Uorenas McKallochas (Warren McCulloch, 18991969) (1.38 pav.) ir matematikas Valteris Pitsas (Walter Pitts, 19231969) (1.39 pav.) Jie pateik formalij logini neuron tinkl teorij kaip nerv sistemos funkcionavimo model. Nerv sistemos veikla buvo pagrsta matematine dvireikme logika. i teorija turjo didel tak baigtini diskreij automat teorijai lm elektronini skaiiavimo main atsiradim. Pamatins neurofizikins savybs oninio (lateraliojo) slopinimo principo, lemianio kontrast irykinim aikinim ir matematin model pateik H. K. Hartlainas (Haldan Keffer Hartline, 19031983) (1.40 pav.). Savo atradimus jis pagrind nariuotakojo kardauodegs (Limulus) ciklopins akies omadidij tyrimais. Jam u tai 1967 m. skirta Nobelio premija. is oninio slopinimo principas bdingas ne tik nerv sistemos veiklai, bet biologinms, ekologinms ir socialinms sistemoms. Isamiausiai, tirdamas funkcin klausos analizatoriaus organizacij neurofiziologiniais metodais bei fizikiniais ir matematinias modeliais, onin slopinim ityr Honolulu universitete Georgas von Bekeis (Georg von Bksy, 18991972) (1.41 pav.). U iuos tyrimus 1961 m. jam suteikta Nobelio premija. ie ir kiti panas neurobiologiniai tyrimai buvo pradia daugeliui teorini matematini neuron tinkl modeli. Buvo atkreiptas dmesys tai, kad nerv sistema
50
BIOFIZIKA

1.40 pav. Haldainas K. Hartlainas (19031983). oninio (lateraliojo) slopinimo nerv sistemoje iaikinimo ir matematinio modelio autorius. Nobelio premija 1967 m.

1.41 pav. Georgas von Bekeis (18991972). Nobelio premija 1961 u klausos sistemos biofizikinius tyrimus ir modelius

1.42 pav. Ernstas Heinrichas Vberis (17951878)

funkcionuoja kitokiais principais nei tradiciniai kompiuteriai. Ikilo nauj mokslini tyrim ir poiri poreikis. Pradta nauj princip, kuriais reikt aikinti nerv sistemos funkcin organizacij, paieka. Taip pat ikilo praktinis technologinis neurokompiuteri, veikiani kitokiais principais krimo poreikis. Buvo akivaizdu, kad McKallocho ir Pitso neuron tinkl teorija netinka aikinti nerv sistemos veikl viskas arba nieko principu. Reikalingi nauji poiriai kuriant mokslo ir technologij metodus bei teorijas. Dauguma neurobiofizikini tyrim yra susij su organizm jutimo organais ir psichofizikinmis j savybmis. Todl tokio pobdio moksliniai tyrimai taip pat patenka psichologins biofizikos ar psichofizikos mokslo tyrim srit. Pirmieji, pradj matuoti ir matematikai aikinti bei kiekybikai vertinti fizinio poveikio jutimo organams ir taip pat sukeliamus psichikos pojius, savybes, j dsningumus, buvo Leipcigo universiteto profesoriai Ernstas Heinrichas Vberis (Ernst Heinrich Weber, 17951878) (1.42 pav) ir Gustavas Teodoras Fechneris (Gustav Theodor Fechner, 18011887) (1.43 pav.). E. H. Vberis pradjo kiekybinius poji sunkiui matavimus, o G. T. Fechneris 1860 m. suformulavo pagrindin psichofizikos dsn. Vliau dsn ireik diferencialine lygtimi ir nustat logaritmin priklausomyb tarp fizinio poveikio ir pojio Vberio ir Fechnerio dsn. jutimo organ psichofizikos dsn tik po Antrojo pasaulinio karo iplt Stanlis S. Stivensas (Stanley S. Stevens, 1906 1973) (1.44 pav.), pritaikydamas tinkamesn rodiklins funkcijos dsningum. Fizinio poveikio jutimo organams ir jo atspind nerv posistemyje bei kontrasto parykinimo psichofizikin reikin, kur sukelia oninis slopinimas, dar baigiantis devynioliktojam amiui nagrinjo austr fizikas ir mokslo filosofas Ernstas Machas (Ernst
51
vadas

1.43 pav. Gustavas Teodoras Fechneris (18011887)

1.44 pav. Stanlis S. Stivensas (19061973)

1.45 pav. Ernstas Machas (18381916)

Mach, 18381916) (1.45 pav.). Jis yra pateiks ir io reikinio matematin diferencialin model, ireikt diferencialine lygtimi. is modelis aikino, kad fizinis pasaulis atsispindi psichiniuose ir jutiminiuose (sensoriniuos) pojiuose neproporcingai, o i proporcingo jutiminio atspindio atimama poveikio antrosios eils ivestin. E. Machas fizikos poiriu tyrinjo optines regos savybes, aptar mogaus jutimo organ galimybes objektyviai atspindti tikrov ir mokslinio gamtos painimo ribas. Psichofizikos raida neatskiriama nuo sistem biofizikos neuropsichologijos, psichokibernetikos, neuroinformatikos tyrim. Atsiradus kompiuterinms technologijoms, pleiantis informacijos kiekio matavimams, prasidjo kiekybinis jutimo organ priimamos ir perduodamos informacijos apimties, kiekybiniai greii vertinamai, nerv sistemos atminties struktr informacijos talpos, natralaus mogaus ir gyvn intelekto, krybingumo matavimai, net dirbtinio intelekto krimas. Aktyvja mstanios fizikos kiekybiniai tyrimai. XXI amius vadinamas informacijos, ini/inojimo ar net krybos amiumi. Mstanios biosferos dalies noosferos raidos savitum apvelgdamas P. T. de ardenas, jau mintame veikale mogaus fenomenas teigia, kad: Be jokios abejons, materialioji ir dvasin energija kakuo susijusios viena su kita ir papildo viena kit. Jo nuomone, moni visuomens organizuotum lemia intensyvus keitimasis mintimis. P. T. de ardeno vartojama dvasins energijos svoka mintis, iandien suprantama kaip informacija, inios bei inojimas, pagrindiniai veiksniai, nulm gyvojo pasaulio elgsen (etologij) , ekologij ir biologin evoliucij bei socialin monijos raid. Atrodo, kad informacijos fenomeno atsiradimas yra neatsiejamas nuo gyvybs atsiradimo ir yra lemiamas gyvybs kilms ir evoliucijos veiksnys.

52
BIOFIZIKA

1.10. GYVYBS SAVAIMINS ORGANIZACIJOS, KILMS, ESMS IR EVOLIUCIJOS BIOFIZIKOS PRADMENYS

Gyvybs atsiradimo ir evoliucijos teorij pateikia ir biologai, ir biochemikai, tai aktualu ir biofizikai. Manoma, kad gyvoji organizacija chemins evoliucijos padarinys ir kad gyvybs kilm slypinti chemijos mechanizmuose. Taiau informacinio kodavimo ir dekodavimo bei kibernetin valdymo samprata gyvybs esms ir kilms svarbos tvark bando keisti. Atkreiptinas dmesys ymaus rus biologo teoretiko, evoliucionisto Ivano Ivanoviiaus malgauzeno ( , 18841963) metodologin poir gyvybs painim. Paskutiniaisiais savo gyvenimo metais, susipains su tik k atsiradusio naujo mokslo kibernetikos esme, jis rao knyg Kibernetika mokymas apie gyvj btybi savaimin vystym. Kibernetika, visikai kitoks mokslas nei fizika bei chemija, daugiausia dmesio skiria naujoms funkcinms vertybms informacijai, reguliavimui ir valdymui. Btent ios vertybs, I. I. malgauzeno nuomone, sudaro biologijos teorijos pamat. Atsiradus kibernetikai ir informacijos teorijoms, nustaius genetins informacijos DNR, RNR mechanizmus, fizikas Henris Kastleris (Henry Quastler, 19081963) pateik pirmuosius informacinius gyvybs kilms ir raidos modelius. Jis informacijos teorija aikino genetins informacijos perdavimo vyksmus ir tikimybmis vertino atsitiktinio (stochastinio) gyvybs atsiradimo galimybes bei evoliucijos greiius. Be to, H. Kastleris informacijos teorijos kalba pradjo aikinti biologini sistem veikl ir i sistem veiklos nagrinjimo metodus. Isamiausiai molekulins biofizikos kinetiniais modeliais gyvybs kilm ir raid aikina Manfredo Eigeno (Manfred Eigen, 1927) (1.46 pav.) teorins makromolekuli savaimins organizacijos teorija. ios teorins sampratos buvo paskelbtos atuntj deimtmet originaliomis monografijomis. Jose, remdamasis autokataliziniais matricins polimerini molekuli sintezs per hiperciklus, matematins kinetikos modeliais parod biochemins darvinins evoliucijos galimybes. M. Eigeno gyvybs ir gyvybs raidos biofizikiniai modeliai sujungia nukleorgi ir baltym sveikas atsirandant, dauginantis ir vystantis gyvybs organizuotai struktrai. Dabar, XXI amiaus pradioje, kai mokslo metodais, 1.46 pav. Manfredas Eigenas bioininerija, gen ininerija pradedama kurti organizmus, (1927). Molekulins gyvybs kilms per hiperciklus turinius naujus gen derinius, galima sakyti mogus autorius. Nobelio premija pradjo kurti naujas gyvybs ris. Akivaizdu, kad bioche- 1967 m.
53
vadas

UDARASIS KODAVIMAS IR DEKODAVIMAS 1948 m. N. Vyneris, K. E. enonas.................. VALDYMAS, INFORMACIJA 19381955 m. P. Tejaras de ardenas ......................... MINTIS NOOSFEROJE 19001940 m. H. Dryas .................. VITALINS JGOS, ENTELECHIJOS 18041830 m. A. Sniadeckis .... ORGANIZUOJANIOS (ORGANINS) JGOS VIS VITALIS ......... G. Treviranus (17791837) VALDANTI SIELA ..... G. A. talis (16601734) REFLEKSIJA SIELOJE ... Ren Dekartas (15961650) ARCHAEUS .................. T. Paracelsas (14531541) ENTELECHIJOS .................. Aristotelis (384322 p. m. e.) PSICHE ............................................................. Platonas (427347 p. m. e.)
1.47 pav. Idj apie savitus gyvyb organizuojanius veiksnius, nematerialisias jgas gyvojoje gamtoje chronologin raidos schema

mija, molekulin biologija ir sistem biofizika gana tiksliai vertina gyvojo pasaulio esm. ie laimjimai rodo didiules ateities galimybes. Sisteminis biofizikos poiris gyvj gamt, jungiantis biochemij, teorin biologij, kibernetik ir informatik, yra raktas gilesn nauj organizuoto pasaulio painim. Biofizikins minties bei biofizikos mokslo istorin raid, iekant organizuotos sistemins veiklos ir lemiani gyvybs esm veikni, galima pateikti schema (1.47 pav.). Kaip minta, organizuojani vitalini entelechij autorius ir pagrindjas yra Aristotelis. Jis sukr pirmj dedukcin mokslini samprat sis tem apie gyvyb, biologin tikslingum entelechijas. Aristotelis pertvark Platono dvasios ir sielos svokas, jas pritaik aikinti gyvuosius organizmus. Vliau vitalizmo samprat gyn daug labai autoriteting, originalaus mstymo biolog, palikusi ne vien reikming pdsak gamtos moksluose. Plaiai inomas vidurami gydytojas T. Paracelsas teig, kad kiekviename organizme slypi gyvybs pradmuo archaeus. is archaeus reguliuoja plaui, irdies ir kit organ veikl. J. B. Helmontas, vystydamas Paracelso idjas, rodinjo, kad yra visa hierarchin archaeus sistema, kad kiekvienas organas turi sav archaeus. Septynioliktojo imtmeio pradios mokslo autoritetas Ren Dekartas sukr dualistin organizmo veiklos teorij pritaik reflekso sieloje samprat. Reflekso samprata plaiai naudoja ir i dien fiziologijos mokslai, tik kur kas konkreiau ir primityviau. Garsus chemikas ir fiziologas Georgas Ernestas talis (Stahl) teig, kad siela kuria kn savo tikslams knas gyvena tik gaivinamas sielos. Jo manymu nei anatomija, nei fizika, nei chemija neiaikins mums joki gyvybini reikmi, nes pastarieji yra tik rezultatas to, kad siela gaivina kn.
54
BIOFIZIKA

Gotfridas Reincholdas Treviranus (17761837), pirmasis bendrosios biologijos autorius, knygoje BIOLOGIJA arba gyvosios gamtos filosofija (18021822) pritaik gyvybins jgos (Vis Vitalis) svok ir pradjo vitalistin teorij. J pltojo garsus to meto Didysis Biologas Karlas Ernestas von Beras (17921876). 1828 m. K. E. Bras suformulavo biogenetikos dsn, j paskelb veikale Gyvn vystymosi tyrimai. Vitalini veiksni, aikinant gyvyb, reikjo ymiam anatomui ir fiziologui Jochanui Peteriui Miuleriui (18011858). Be valdanij, organizuojani, organini jg veikimo, gyvj organizm veiklos taip pat negaljo suprasti ir Vilniaus universiteto prof. Andrius Sniadeckis. Daug rykiau neovitalizm pltojo jau mintas gyvn embriologas H. Dryas. Jis neleido savo gyvybs veiksniui entelechijai prietarauti prieastingumui. Aikino, kad reikinius, bdingus organizmui, reikia aikinti neerdvinio formavimosi determinanto saviveikos prieastimi, sukuriania visum. Remiantis biochemijos poiriu, bandoma rodinti, kad vitalin/dualistin samprata buvo atmesta chemikui F. Violeriui (Friedrich Whler) 1828 m. i neorganini mediag sintezavus lapal. Dl io atradimo buvo atmesta hipotez, kad organinius cheminius junginius gali sintetinti tik gyvieji organizmai. is teiginys nra vitalistins gyvybs sampratos esm. Vitalizmo esm slypi sampratoje, kad gyvj organizm gyvavim lemia saviti, nematerials veiksniai, kuri negalima paaikinami vien tik energijos ir mediag virsmais. Nematerialaus veiksnio minties ypating svarb ems ir Visatos visuotinei evoliucijai filosofin poir pateik P. Tejardas de ardenas, sukurdamas minties pasaulio noosferos samprat biosferoje. Didiausi tak naujai atgaivinant vitalistin poir turjo kibernetin informacinio valdymo paradigma, dar vadinama kibervitalizmu. J paskelb ir pltojo matematikos metodais N. Vyneris ir K. E. anonas. Apibendrinant galima tvirtinti, kad iuo metu biofizika, aikindama gyvyb, ieko savitumo. Tiktina, kad remiantis bioinformacini technologij kodavimo ir dekodavimo sampratomis, nustatant iuos mechanizmus ir bus surastas tas stuburas, sujungsiantis vis biologijos srii inias. Atsiras naujas poiris biologijos moksl, sujungsiantis fizikos, chemijos ir kibernetikos mokslus. Bus sukurtas bendras, vienas kit papildantis mokslas apie gyvj gamt biofizik. Lauktina, kad informacinio kodavimo ir dekodavimo bei valdymo nuostatomis grindiamas gyvybs aikinimas pateisins prie imtmet K. Pirsono lkesius, kad biofizikos laukia ypatinga ateitis. Kuriant XXI amiaus monijos strategins raidos planus neabejojama, kad biotechnologija ir informacins technologijos yra jgos, kurios mus veda kokybikai nauj informacijos ir ini/inojimo krybos epoch. O mokslui biofizikai, kaip fizikai ir chemijai, industrins visuomens epochoje, kartu su biochemija bei bioinformatika privalu bti naujosios bioinfotechnologins visuomens idjiniu pamatu.
55
vadas

56
BIOFIZIKA

BIOLOGIN SISTEMA TERMODINAMIKOS POIRIU

57
2. Biologin sistema termodinamikos poiriu

Gyvyb minta negentropija E. RDINGERIS, What is Life?, 1944

Gyvybs, arba gyvosios sistemos, esmei suprasti pirmiausia reikia gyvyb, gyvj gamt palyginti su negyvja gamta, negyvja sistema. Svarbiausiems skirtumams irykinti tinkamiausia fizikochemin termodinamika. Termodinamika fizikos mokslo kryptis, tyrinjanti ir aikinanti paius bendriausius gamtos dsningumus, taiau nesigilinanti objekto ar sistemos vidaus struktr. Tai mokslas apie bendriausius energijos virsm dsningumus vairiausiose sistemose, tarp j ir gyvojoje gamtoje. Fizikin chemija rod, kad ir mediag virsmai gali bti ireikti ir vertinti kiekybikai energijos virsmais. Termodinamika virto bendriausiu mokslu apie fizinius, t. y materialiuosius, fizikinius ir cheminius virsmus, mokslu, tiksliausiai aikinaniu materialij vyksm dsningumus. Todl tik termodinamikos poiriu apibrus gyvyb galima irykinti gyvybs esm. Aiku, lyginant gyvsias sistemas su negyvosiomis fizinmis sistemomis, btina pabrti gyvybs savitumus.

2.1. PAGRINDINS SVOKOS

Pagrindins svokos, be kuri termodinamika negali nieko aikinti, yra sistema ir energija.
58
BIOFIZIKA

APLINKA

MEDIAGOS ENERGIJA

Galaktika, Sauls sistema, em, biosfera, noosfera, jra, eeras, mikas, populiacija, mikroorganizm kolonija, lstel, organizmas, mogus

S I S T E M A

MEDIAGOS ENERGIJA APLINKA

2.1 pav. Sistema ir jos santykis su aplinka

Sistema element visuma, tam tikru tyrintojo poiriu sudaranti bendr vienet ir atskiriama nuo kitos dalies aplinkos (2.1 pav.). Pavyzdiui, Galaktika, Sauls sistema, em, biosfera, lstel, organizmas, mogus, mikroorganizm kolonija, populiacija, ekologin sistema, biosfera, noosfera ir pan. Energija abstrakti fizin svoka. J vartoja fizikai ir chemikai. Jie energija vairiausius gamtos virsmus matuoja vienu ir tuo paiu matu, pateikia kiekybinius i reikini dydius ir formuluoja bendrus dsningumus (R. Feinman). Dsniai yra pati svarbiausia fizini moksl vertyb. Energija tai gebjimas veikti, atlikti darb (M. Planck). Energija tai sistemos bsenos apibdinimas. Pavyzdiui, knas, kurio svoris P, pakeltas H aukt, turi potencins energijos:
Ep = P H.

Knas, turintis mas m ir judantis vienodu tiesiaeigiu greiiu v, turi kinetins energijos:

m v2 . 2

Kn mass m papildomai paildius, padidinus jo temperatr t 0, suteikiama ilumin energija: E = Q = c m t 0, (ia c ilumins talpos koeficientas). Knu t laiko tekanti elektros srov I, kuri sukuria elektrini potencial skirtumas U (tampa), kitaip sakant, elektros lauke U perneamas elektros krvis q, vadinama elektros energija: Eel = U I t = U q, (ia I =
q , pernetas elektros krvis q per laik t ). t
59
2. Biologin sistema termodinamikos poiriu

kaitintas knas spinduliuoja vies elektromagnetin viesos energij: Eem = h , (ia h Planko konstanta, elektromagnetini bang danis). Inde arba kne esant kelioms homogenikai pasiskirsiusioms mediagoms (pvz., tirpale), i-tosios mediagos, kurios cheminis potencialas i , ir kurios koncentracija, arba tiksliau aktyvumas ai , o kiekis ni , apibdinamas chemine energija: Echi = ni i = ni (0i + R T lnai ). (ia 0i standartinis potencialas, t. y. potencialas, kai mediagos koncentracija l mol/1, T0 = 25C = 298 K, o slgis 1,013 baro = l atm). Viso kno ar inde esanio tirpalo chemin energija yra vis k esani mediag energij suma:

E ch = E chi .
i =1

Bendriausiu atveju, jeigu yra mediagos, kurios mas m, vadinasi, yra energijos: Emas = c 2 m, (ia c viesos greitis vakuume). Sistemos atliktas darbas W taip pat apibdinamas kaip sunaudota energija ir ireikiamas dviej dydi intensyviojo (danai vadinamo potencialu) ir ekstensyviojo (susijusio su triu ir kiekiu) sandauga. Pavyzdiui: pltimosi W = p V, (knas isipleia dydiu V, kai slgis p); paviriaus tempties W = o, (pavirius sumaja dydiu o, jei paviriaus temptis ); susitraukimo W = F l, (knas sutrumpjo dydiu l, veikiant jgai F); elektrinis W = q, (perneamas krvis q, kai elektrinis potencialas ); cheminis W = i ni , (i-tojo mediagos sando pernet moli kiekis ni , kai cheminis potencialas i ). Visi ie dydiai W, gauti matematikos lygtimis, aikina (galima sakyti koduoja) bendr energijos svok. Arba kitaip sakant, vairius fizinius tikrovs reikinius atspindi energijos svoka, matematinio kodavimo formulmis, t. y. kiekybikai vertina iuos gana skirtingus reikinius vienu ir tuo paiu matu energija. Visoms sistemoms bdinga energijos ir mediag apykaita su aplinka. Atsivelgiant tai, termodinamikos poiriu sistemos skirstomos : izoliuotsias nevyksta jokie energijos ir mediagos mainai; udarsias nra mediag apykaitos, bet vyksta tik energijos mainai;
60
BIOFIZIKA

adiabatines nevyksta mediag apykaita, bet vyksta energijos mainai, iskyrus ilum; atvirsias vyksta energijos ir mediag mainai. Akivaizdu, kad gyvosios sistemos yra atvirosios sistemos. Jos negali ilgesn laik gyvuoti be energijos ir mediag main. Taiau pagrindiniai klasikins termodinamikos dsniai formuluojami izoliuotosioms ir udarosioms sistemoms. Aiku, klasikin izoliuotj sistem termodinamika yra gera pradin atskaitos sistema, lyginant negyvsias sistemas su gyvosiomis. Vienos pagrindini termodinamikos svok, padedani suprasti sistem savybes, yra : SISTEMOS VIDIN ENERGIJA E ir sistemos energins bsenos kokybs matas ENTROPIJA S.

2.2. SISTEMOS VIDIN ENERGIJA IR PIRMASIS TERMODINAMIKOS DSNIS

Sistemos vidin energija E tai vis sistemoje esani energijos ri suma. Fizika ia energija apibdina sistemos bsen. Apibendrintai vertinant tam tikras energijos ris G laisvj (Gibso energij), ilum Q ir atlikt darb W galima urayti, kad: E = Q + G W. Bandymo bdu pamatuoti absoliuiuosius E, Q, G, W, S dydius sunku arba net nemanoma. Praktikai, vykstant tam tikriems procesams, galima matuoti j pokyius E, Q, G, W, ir tada: E = Q + G + W = Q p V + o + F l + q + (ni i )+ ilumos pokyiai ireikiami intensyviojo (temperatros T ) ir ekstensyviojo (entropijos S) dydi sandauga Q = T S. i iraik staius ankstesn formul gaunama Gibso lygtis:

Tokie vertinimai galina ivesti vien svarbiausi materijos tverms dsni, kuris vadinamas Pirmuoju termodinamikos, arba izoliuotosios sistemos energijos bei mediag tverms, dsniu. is dsnis teigia, kad izoliuotosios sistemos energija E i niekur neatsiranda ir
61
2. Biologin sistema termodinamikos poiriu

E = Q + G + W = T S p V + o + F l + q + (ni i )+

niekur nedingsta, tik vienos energij rys virsta kitomis rimis, o jos kiekis pastovus dydis. Chemija ino mediag tverms dsn ir j veiksmingai taiko praktikai. Tokia formuluot mediagai, kaip mediagos tverms dsnis, fizikos poiriu ne visikai tinka. Branduolini reakcij metu elementariosios dalels imediagja. Mediaga, kurios kiekis vertinamas mase, gali virsti tik energija. Tai yra pranyksta mas ir ispinduliuojama elektromagnetin energija. Pvyzdiui, Saulje vyksta termobranduolins reakcijos. Vandenilio branduoliai protonai H+ virsta He branduoliais. Dl io vyksmo susidarant 4,003 gram helio, inyksta 0,029 gram mass, kuri virsta viesos energija Eem (E = m c 2, c 300 000 km/s). Taip atsiranda ta elektromagnetin energija, kuri i Sauls viesos pavidalu atkeliavusi pas mus sukuria energijos pagrind gyvybei egzistuoti emje. Fizika, chemija ir biologija daugyb vyksm aikina termodinamikos svokomis, kuri daniausi yra keturi termodinaminiai potencialai: sistemos vidin energija E; laisvoji Helmholco energija A; entalpija, arba ilumin talpa H; laisvoji Gibso energija G. Biologiniams procesams aikinti daniausiai naudojama laisvoji Gibso energija G, chemijos vyksmams entalpija H, o fizikos ir energetikos laisvoji Helmholco energija A. Daniausiai termodinamikos aikinimai pradedami nuo ilumins mainos bendrj energijos dsningum, nors ie dsningumai taikytini ir biologiniams vyksmams. Formuojantis klasikinei termodinamikai, didiausias dmesys buvo skiriamas iluminms mainoms ir j darbo veiksmingumui. Pirmasis termodinamikos dsnis iluminms mainoms ireikiamas sistemos energijos pusiausvyros lygtimi: E = Q W . Pateikta lygtis rodo, kad iluminei mainai suteikus ilumos kiek Q (paildius), ji atlieka darb W, veikia aplink. Taip pat padidja paios mainos vidin energija dydiu E. Tokiu bdu pirmasis termodinamikos dsnis sistemai ireikiamas kaip energijos pusiausvyros lygtis: sistemos i aplinkos gautos energijos, pvz. ilumins Q kiekis turi atsispindti pakitusiame vidins energijos kiekyje E ir naudojamas darbui W, kur sistema veikia aplink (2.2 pav.): Q = E + W arba E = Q W .

ios iraikos bdingos iluminms mainoms, ir sakoma, kad:


62
BIOFIZIKA

S I S T E M A

Q ILUMA

E
ILUMIN MAINA

W DARBAS
APLINKA

2.2 pav. Termodinamin sistema ilumin maina

Sistemai suteiktas ilumos kiekis Q didina sistemos vidin energij E ir naudojamas darbui W, kur sistema atlieka aplinkoje.

Pirmasis termodinamikos dsnis iluminms mainoms daugiausia dmesio skiria ilumai. Taiau iluma nra taip svarbi gyvj gamt tirianiam biologui, kaip negyvosios gamtos tyrintojui fizikui ar main konstruktoriui ininieriui. Biologini vyksm metu labai danai iluma yra atliekos, o ne energijos altinis. Pavyzdiui, fotosintezs vyksmo (2.3 pav.) energijos apykaita termodinamikai ireikiama lygtimi: E = W ' G Q.

Eem = h Saul s viesa W'

GYVA S I S T E M A E + G VIDAUS ENERGIJOS POKYTIS

Q APLINKA

2.3 pav. Fotosintez kaip termodinaminis procesas

Biologins sistemos, kurios energij gauna i aplinkos elektromagnetins energijos (augalai), arba chemins energijos (gyvnai, grybai) formomis, termodinamikai apibdinamos laisvja Gibso energija G arba jos pokyiu G. Ji geriausiai atspindi sukaupt chemin energij tokiose sistemose, kuriose vykstant energijos virsmams nekinta (arba kinta gana maai) sistemos temperatra T 0 = const. ir slgis P = const. iuo atveju sistemos vidins energijos pokyt E eina ir ilumins energijos dalis QV, isisklaidiusi sistemos viduje. ilumin sklaida ir sistemos viduje, ir aplink pasireikia vykstant visiems energijos virsmams. Kai sistem veikianios iorins jgos, neanios jai energij, atlieka darb sistemos viduje, pvz., fotosintezs procesas, tada energijos pusiausyros lygtis bt ireikiama:
63
2. Biologin sistema termodinamikos poiriu

2.1 lentel. Termodinaminiai potencialai


-TS
E Vidin energija A=ETS Laisvoji Helmholco energija

+PV
H=E+PV Entalpija G=E+PVTS Laisvoji Gibso energija

W' = E + G + Q,

arba

E = W' G Q,

ia: Q aplinkoje isisklaids ilumos kiekis; G chemins energijos prieaugis; W' absorbuotas viesos energijos kiekis. Analogika energijos pusiausvyros lygtis tinka ir gyvnams, kurie i aplinkos ima ne viesos energij, bet naudoja chemin aplinkos energij (maist), kuri sistemos viduje keiia kitomis energijos rimis. I i pavyzdi aiku, kad gyvosios sistemos yra ne ilumins, bet chemins mainos. Termodinaminis bendrasis biologijos poiris rodo, kad organizmas yra atvira chemin maina, kurioje vis laik vyksta cheminiai virsmai. iuos cheminius virsmus galima pamatuoti ir ireikti energijos dydiais, termodinaminiais potencialais, kuri vienas svarbiausi laisvoji Gibso energija G. Fizikos, chemijos ir biologijos vyksmams aikinti naudojami termodinaminiai potencialai tarpusavyje susij matematinmis priklausomybmis, pateiktomis 2.1 lentelje.

2.3. GYVOJO PASAULIO ENERGIJOS VYKSMAI

Gyvoji ems gamta beveik vis biai reikaling energij gauna i Sauls elektromagnetins energijos viesos forma. Augalinis pasaulis geba viesos energij paimti ir j paveria chemine chemini jungi energija. Gyvnai ir kitos gyvybs formos, neskaitant iimi, geba naudotis tik chemine energija. Gyvybs btis termodinamikos poiriu tai vairiausi energijos virsm, daugiausia chemini, vyksmai. Visi gyvojo pasaulio energijos virsmai sukelia ilumos, ilumins energijos sklaid. Tai galutinis energijos virsm produktas, apibdinamas per entropij Q = S T. em atjusios Sauls elektromagnetins bangos nra monochromatins vienodo bangos ilgio elektromagnetiniai kvantai. Jos apibdinamos energijos spektru, kur nu64
BIOFIZIKA

Sauls spinduliavimo energinis aktyvumas

10-5x 10 8 6 4 2 0

Ultravioletin spinduliuot

Regimoji spinduliuot

Infraraudonoji spinduliuot

30000

25000

20000
Danis,

15000
cm1

10000

5000

2.4 pav. Sauls viesos spektrai tam tikrame ems lygyje: I atmosferoje; II jros lygio; III prajus debesis; IV prajus medi lapij; V po stikliniu stogu

lemia tie ems sluoksniai ir struktros, pro kurias ios bangos prajo ar nuo kuri atsispindjo (2.4 pav.). Pateikti spektrai gana aikiai parodo, kaip kinta elektromagnetins savybs viesai praeinant debesis, lapij, stikl. Matoma, kad lapija daugiausia sugeria paima regimosios spinduliuots spektrin dal, o atspindi aplink infraraudonosios spinduliuots spektrin dal. Taip pat gerai inoma, kaip blogai praleidia elektromagnetines bangas stiklas ir ypa tas elektromagnetines bangas, kurios reikalingos fotosintezei. Aikiai matomas sauls spektro, o kartu ir energijos pokyiai dl debes, lyginant spektrus ties jros lygiu ir prajus debesis. Atlikti emje vykstani energijos vyksm vertinimai rodo, kad fotosinteze paimama tik labai maa dalis atjusios Sauls energijos (2.5 pav.). Didiul ~30% ultravioletins spektro dalies energijos atsispindi nuo debes ir grta kosmin erdv. Kita nemaa ~20% dalis per ilum, vandens igarinim lieka debesyse. Ji pasireikia vj ir audr forma. Apie 50% krintanios ant paviri energijos virsta iluma ir infraraudonosios spinduliuots forma atsispindjusi taip pat grta kosmos. Fotosinteze biosfera paima tik ~0,02% visos mums Sauls atsistos energijos! Aikiai matoma, kok ma Sauls atsistos energijos kiek paima ms em. Taip pat ma paimtos energijos dal mogus naudoja naudingai. inoma, debesys ir kitos atmosferos struktros, atspindiniosos ultravioletin energij, atlieka taip pat labai svarbi gyvybei apsaugos funkcij. Juose sukaupta energija eina teigiamj energijos pusiausvyros dal. Taiau visos kitos atspindimos energijos dalys tai potencials energijos itekliai, kuriuos manoma panaudoti veiksmingai, inoma, mokslo pagrindu, kiekybikai iaikinus gyvosios gamtos dsnius.
65
2. Biologin sistema termodinamikos poiriu

Saul s spinduliavimas em 175 000 1012 W Debes atspindima energija 52 000 1012 W

~30 %

em s ir aplinkos iluma 81 000 1012 W

~50 %

Debes energija 40 000 1012 W

~20 %

em s fotosintez 40 1012 W

~0,02 %

2.5 pav. Sauls viesos energijos pusiausvyros emje schema

SAUL

FOTOSINTEZ

CUKR S

H2O DRUSKOS (KSILEMA)

MINERALIN S MEDIAGOS

2.6 pav. Mediag ir energijos apykaita

66
BIOFIZIKA

Gyvieji organizmai, atsivelgiant imamos energijos bdus, skirstomi autotrofus ir heterotrofus. Autotrofai augalai ir dumbliai sugeba pasiimti i aplinkos elektromagnetin energij, vanden H2O, anglies dvidegin CO2, mineralines druskas ir i j sintetinti daugyb vairiausi organini jungini (2.6 pav.). Visi kiti gyvieji organizmai heterotrofai energij i aplinkos ima chemins energijos forma. Specialiomis struktromis jie skaldo sudtingas chemines mediagas ir chemini jungi energij naudoja funkcikai tikslingai veiklai. Vadinasi, gyvieji organizmai yra chemins mainos. Tiek autotrofams, tiek heterotrofams bdinga mediag sintez (asimiliacija) ir mediag chemini ryi skaldymas (desimiliacija). Augaluose vyrauja sintezs vyksmai, o gyvnuose ir sintezs, ir skaidymo. Akivaizdu, kad visoje gyvojoje gamtoje vyrauja cheminiai virsmai. Be jokios abejons, gyvieji organizmai yra chemins mainos. Bet toki main nra klasikins fizikos ir chemijos moksl srityse. Tai ne indas ar maias, pripildytas idealij duj ar homogeninio tirpalo. Tai sudtingos heterogenins struktros, sudarytos i funkcikai tikslingos paskirties dali, kurios privalo tam tikromis aplinkybmis ir reikiam akimirk atlikti tam tikrus, atitinkamose programinse struktrose numatytus cheminius mediag ir energijos virsmus bei operacijas. Ir tol, kol ios, programikai numatytos funkcikai tikslingos operacijos vykdomos reikiamai tiksliai, sakoma, kad organizmas gyvas. Kai tik i funkcikai tiksling veiksm darna sutrinka ir nebeatliekamos svarbiausios funkcijos, prasideda tai, kas bdinga negyvajai gamtai, kas gerai suprantama visiems ir inoma klasikinei fizikai bei chemijai entropija pradeda nesuvaldomai didti. Tada organizmas nyksta, irsta ir va. Sunku atskirti gyvj organizm struktrines mediagas nuo kuro. Gyvieji organizmai panas degias, nuolatos dirbanias mainas. ios sistemos i esms skiriasi nuo ininerini main. Gyvosios mainos paios atsinaujina, palaiko darbing bsen, remontuojasi, reguliuojasi ir dauginasi, kritikais atvejais gali paios save deginti ir valgyti. J esm biochemins reakcijos, biocheminiai virsmai, kuriais atliekamas darbas.

2.4. BIOCHEMINI REAKCIJ DARBAS

Organizmuose skylant organinms mediagoms isiskyrusi laisvoji energija nepaveriama vien iluma (kaip vyksta iluminse mainose), o naudojama tikslingam darbui tiesiogiai. Organizm energijos esm yra ne iskiriama arba sugeriama biochemini reakcij iluma, bet su jomis susijusi laisvoji entalpija G, daniau vadinama laisvo67
2. Biologin sistema termodinamikos poiriu

sios Gibso energijos pokyiu dG. Tai yra toji vidins energijos E dalis, kuri egzistuoja sistemoje grtamai, todl gali bti paversta darbu: G = E T S + p V (arba E = G + T S p V ), ia T temperatra, S entropija, p slgis, V tris. (ilumini main atvejais vartojama Helmholco laisvoji energija A, kur A = E T S. Tada G = A + p V ). Vertinant pokyius diferencialine matematine forma: dG = dE T dS S dT + p dV + V dp. Kai slygos izotermins (dT = 0) ir izobarins (dp = 0): dG = dE T dS + p dV. Atsivelgiant Gibso lygt (dE = T dS p dV + (i dni ) + ...), gaunama: dG = (i dni ) + ... Taigi dG yra sistemoje vykstani biochemini reakcij gebjimo dirbti matas (laikant, kad darbas yra tik cheminis) i reakcij varomoji jga, esant izoterminms ir izobarinms slygoms. Yra taisykl: dG < 0, jei tam tikro biocheminio vyksmo metu sistemos laisvoji entalpija maja sakoma, kad tai egzergonin (iskirianti energij) reakcija; dG > 0, jei sistemos laisvoji entalpija didja sakoma, kad tai endergonin (absorbuojanti energij) reakcija. ilumins talpos prieaugis dH chemins reakcijos metu, kur sudaro dE + p dV, H ir G priklausomyb, ireikiama: dH = dG + T dS. iuo poiriu: jei H < 0 iluma iskiriama (egzergonin reakcija), o jei H > 0 iluma sugeriama (endergonin reakcija). Egzergonins reakcijos yra savaimins, jos vyksta ir iorje, ir organizmo viduje (tais atvejais, kai molekulms bdinga tam tikra aktyvioji energija), o endergonins atvirkiai, ir tik tiekiant laisvj energij G (laisvj entalpij H). Jei sistema yra chemins pusiausvyros bsenos, dG = 0. Laisvosios entalpijos majimas, reakcijos darbas Amax, atitinka didiausi darb, vykstant grtamajai reakcijai izobarinmis slygomis: G = Amax .
68
BIOFIZIKA

Termodinaminiai biochemini reakcij vertinimai daniausiai taikomi stacionariosioms reakcij bsenoms. Turint chemins ar biochemins reakcijos pusiausvyros konstant KP (r. 3 skyriuje) ir jos pradini slyg konstant a, galima nustatyti laisvj entalpij G: G = R T ln KP /= R T lnKP + R T ln . Juo maesnis , lyginant su KP , juo atliekamas didesnis cheminis darbas G. Jei = KP , G = 0. Praktikai vertinant atskaitos pradia bna pasirinktos prastos (standarins) slygos. Priimta pasirinkti tokias slygas: reakcijoje dalyvaujani mediag pradins koncentracijos lygios 1 mol/l, = 1, temperatra T ' = 250 C = 2980 K, slgis 1,013 baro = 1 atmosfera. Tokiomis standartinmis slygomis laisvosios entalpijos dydis: G 0 = R T ' lnKP (J/mol). Esant toms paioms slygoms, tik kitokioms pradinms mediag koncentracijoms, reakcijos energija susideda i standartins energijos ir rimties bvio energijos: G = G 0 + R T ' ln = G 0 + 1,365 lg. Padidjus ar pamajus 10 kart vienos i pagrindini mediag koncentracijai ar tiek pat pakitus galutinio produkto koncentracijai, sumas 0,1, o G ' 1,365. Biologins praktikos metu, atsivelgiant standartin rgtingumo dyd pH = 7, vartojama normalioji reikm G 0'.

2.5. ENERGIJOS APYKAITA SU APLINKA

Augal pasaulis yra pagrindinis chemins energijos gamintojas, t. y. auktos kokybs elektromagnetin Sauls energij veria emesns kokybs chemine energija ir j kaupia cheminiuose ryiuose. Gyvnijai bdingas prieingas vyksmas chemins energijos vertimas kitomis, dar emesns kokybs energija ilumine. Apskritai gyvoji gamta sugeba i chemins energijos gaminti tam tikras energijos ris: pavyzdiui, elektromagnetin jonvabali ir kit gyvn vytjimas; mechanin iueli bei raumen darbas; elektrin elektrini uv rankiai, bet daniausiai galutinis energijos virsmas sukuria ilum. Gyvno energijos apykaitos su aplinka schema parodyta 2.7 pav. Gyvn veikia daugyb poveiki. Vieni j teikia vairiausias energijos ris: tiesioginis ir netiesioginis sauls spinduliavimas, ilumin infraraudonoji spinduliuot i
69
2. Biologin sistema termodinamikos poiriu

Atmosferos infraraudonoji spinduliuot Infraraudonoji spinduliuot


Dulk s s Igarinimas

Augalijos infraraudonasis atspindys

V jai

Dirvos infraraudonasis atspindys

Saul s viesos atspindys

2.7 pav. Sisteminis poiris gyvno energijos apykait su aplinka

SAUL

ELEKTROMAGNETIN ENERGIJA

E = h

AUGALIJA
O2

Mineralin s mediagos CO ir H O
Paprasti cheminiai

junginiai
Organiniai junginiai

MIKROORGANIZMAI

GYV NIJA

H2O CO

ILUMA Q

2.8 pav. Energijos ir mediag kaitos gyvojoje gamtoje bendroji schema

70
BIOFIZIKA

dirvos, augalijos, dulki, atmosferos. J veikia aplinkos vjai ir temperatros pokyiai. Taiau pagrindinis jo energijos altinis yra maistas suvalgytos organins mediagos chemin energija. Dl vairiausi virsm chemin energija virsta emiausios kokybs energijos rimi iluma, kuri isisklaido ne tik paiame organizme, bet yra imetama ir aplink. Sistemikai vertinant augalij ir gyvnij nesunkiai pastebima darni energijos ir mediag makrovirsm sistema (2.8 pav.). Mediag apykaitai bdingi grtamieji mainai, t. y. augalijos susintetintos organins mediagoa suskaldytos gyvnijos pasaulio vl gali bti augal vartojamos regeneracijai. Vadinasi, energijos apykaita yra negrtamasis procesas. Elektromagnetin, i Sauls atjusi energija, per chemins energijos virsmus vairiausi procedr bdu galutinai virsta iluma ir isisklaido nebesugrinamai. Gyvyb emje maitinasi isisklaidania (disipuojania) Sauls elektromagnetine energija viesa. inoma, tai ne vieninteliai gyvojo pasaulio laisvosios energijos altiniai. Yra ir iimi, pavyzdiui, azotobakters bei sierabakters sugeba pasiimti energij skaldydamos neorganinius junginius. Taiau tai nesudaro gyvojo pasaulio pagrindins dalies ir gyvybs energijos. Kiekybikai vertinant bioenergetinius gyvn mediag virsmus labai svarbus Heso dsnis.

2.6. HESO DSNIS PIRMOJO TERMODINAMIKOS DSNIO ATMAINA

Heso dsnis teigia:


Chemins reakcijos metu sugertas ar isiskyrs ilumos kiekis Q nepriklauso nuo reakcijos kelio, bet priklauso tik nuo galini produkt.

is dsnis galino vertinti cheminius virsmus kiekybikai chemines mediagas matuoti fizikiniais energijos vienetais. Jis ypa svarbus nagrinjant bioenerginius vyksmus. Vadinasi, maistas, pvz., cukrus, degdamas ugnyje, iskiria tok pat energijos kiek ilumos forma, kok energijos kiek gauna gyvnas ar mogus, suvalgs ir suvirkins t pat cukraus kiek j suskaldius iki t pai galini produkt CO2 ir H2O. Heso dsnio energijos pusiausvyros samprata galina vertinti vairiausi chemini mediag kaloringum. Ypa tai svarbu vertinant maisto produktus. Specialiais bandymais, deginant organines mediagas kalorimetrinse bombose, nustatyta vis pagrindini maisto dali kaloringumas (2.2 lentel).
71
2. Biologin sistema termodinamikos poiriu

2.2 lentel. Pagrindini maisto mediag kaloringumas


Chemin maisto ris Angliavandeniai Baltymai Riebalai Vieneto kiekis, g 1g 1g 1g Energijos ekvivalentas kJ/g 17 17 39 kcal/g 4,1 4,1 9,3

Perskaiiuojant energijos vienetus 1J = 0,239 cal = 6,25 1018 eV. 1 kcal = 4,19 kJ. Angliavandenius ir riebalus organizmai suskaldo (sudegina) iki anglies dvideginio ir vandens, o baltymus iki karbamido (lapalo), anglies dvideginio ir vandens. Heso dsnio matematins formuls, kuriomis ireikiami cheminiams vyksmams bdingi energij ryiai, vartojami entalpijos pokyiai H. Graik kalboje entalpija reikia ilumin talp, o termodinamikos poiriu sistemos energijos bsenos funkcij:

Bandym metu H = E + p V Apskritai p V yra mechaninis darbas, kur atlieka sistema vykstant reakcijai dl trio V ir slgio p pokyi. Organizmuose biochemins reakcijos vyksta beveik nekintant slgiui p ir triui V. Todl daniausiai galima stebti chemins energijos virsmus. Juos patogiau vertinti Gibso laisvja energija G, arba jos pokyiais G. Remiantis inynuose esaniais chemini mediag entalpij vertinimais, galima numatyti chemini reakcij eig ir pagal galutinius produktus apskaiiuojama net ir sudting chemini bei biochemini virsm ilumins kaitos Q kiekis ir pobdis:

H=E+pV

Q = H = Hik H jm ,
i j

kur

H H
i j

ik jm

galutini produkt entalpij suma, pradini mediag entalpij suma.

Kaip jau rayta, jei H (+), iluma sugeriama reakcija endotermin. Jei H (), iluma iskiriama reakcija egzotermin. Organizm mediag apykaitos biochemins reakcijos yra ir egzotermins, ir endotermins.
72
BIOFIZIKA

t'

t''

A E

O2

2.9 pav. mogaus ir kit gyvn kalorimetravimo sistema. 1 ir 2 vidiniai kalorimetro cilindrai; 3 elektrinio ildymo elementai; 4 termoizoliacija; 5 termometras; 6 vandens ilumolaidis; 7 svarstykls; 8 deguonies tiekimo ranga; 9 gar rinktuvas; 10 CO2 rinktuvas

Specialiomis kalorimetravimo sistemomis matuojama gyvn ir mogaus energijos apykaita (2.9 pav.). Vis par gyvn ar mog laikant tam tikroje kaloritmetravimo kameroje, vertinant jo suvartoto maisto kiek, matuojant jo iskirt ilum bei kitus atliek produktus, ir visa tai perskaiiavus energijos vienetus (pavyzdiui kilokalorijas), galima apskaiiuoti gyvno paros energijos pusiausvyr. Taip galima vertinti naudojam energijos kiek ir mediag apykaitos (metabolizmo) greit. Gyvno energijos apykaitos greitis vertinamas naudojama galia, t. y. energijos kiekiu, sunaudojama per laiko vienet (sekund). Ji matuojama vatais W, o bandomasis jo dydis iskiriamas ilumos kiekis Q per sekund. Apykaitos greitis priklauso nuo gyvno mass P. Logaritminse koordinai skalse tarp mediag apykaitos greiio W ir gyvno mass P stebimas tiesins regresijos dsningumas (2.10 pav.). Jis rodo, kad daugiau sveriantis gyvnas iskiria didesn ilumos kiek. Vadinasi, atitinkamai didesnis gyvnas naudoja daugiau itekli, bet kartu sklaido ilumin energij aplink neproporcingai masei.
73
2. Biologin sistema termodinamikos poiriu

Mediag apykaitos greitis W

Dramblys

Jautis Arklys

impanz uo

mogus

Gaidys

Makaka Kat

Pauk iukas

iurk Balandis

Pel

,
Gyv no mas kg

2.10 pav. Gyvno energijos apykaitos priklausomumas nuo jo mass

Natraliose matuojam dydi skalse grafikas bt ne ties, bet laipsnin, biologijoje vadinama alometrine funkcija, nes: lgW = k lgP, tada W = P k. Tiesin priklausomyb matuojam dydi skalje bt tik tuo atveju, jei k = 1. Kitais atvejais i priklausomyb bt arba usirieianti vir, jei k > 1, arba usilenkianti abscisi aies link, jei k < 1. Gyvnijos ilumins sklaidos, ispinduliuojamos ilumos W priklausomybs nuo gyvno mass P alometrijos koeficientas k = 0,75. Tokio dydio koeficientai k bdingi ir kitoms gyvosios gamtos alometrinms priklausomybms. i ryio tendencija rodo, kad natraliose konkrei matavim skalse ilumins sklaidos priklausomyb nuo gyvno mass bus rodiklin:

Q = a P 0, 75,
kurios laipsnio rodiklis artimas trij ketvirtj alometriniam dsningumui. i priklausomyb rodo gerai biologams inom gyvn energijos naudojimo savyb, kad maj gyvn apykaita daug greitesn nei didij. Koeficientas a priklauso nuo matuojam dydi dimencij (vienet).
74
BIOFIZIKA

2.7. ENERGIJOS TVERMS DSNIS MOGUI

XIXXX ami sandroje kalorimetrijos bdu, M. Rubneris (M. Rubner) 1894 m. Vokietijoje ir W. Atwateris (W. Atwater) 1904 m. D. Britanijoje atskirai ir nepriklausydami vienas nuo kito pamatavo mogaus paros energijos apykait. Vis par kalorimetrijos kameroje buvo laikomas apie 70 kg sveriantis mogus. Buvo matuojami jam teikti itekliai oras, maistas, skysiai, ir taip pat iskirti produktai ikvptos dujos, lapalas, imatos ir j temperatros (2.9 pav.). Apskaiiavus energijos pusiausvyr, gauta (2.3 lentel):
2.3 lentel. Naudojamos mogaus per par energijos pusiausvyra

Pateikta maisto produkt Mediaga Baltymai Angliavandeniai Riebalai Kiekis, [g] 56,8 79,9 140,0 [kJ] 965,8 1358,3 6460,0 [kcal] 237 335 1307

Paalinta energija Q [kcal] Pobdis Iskirta ilumos Ikvptos dujos Iprakaituota Iskirtos dujos lapalas ir imatos Pataisos [kJ] 5743 757 949 180 96 46 7771 [kcal] 1374 181 227 43 23 11 1859

I viso:

7784,1

1879

I viso:

Pusiausvyros sutapimo tikslumas ~1% lygio. Panai bandym vertinimai parod, kad vidutinikai sveriantis mogus, dirbdamas vidutinio sunkumo darb, naudoja ~5 kilolorijas energijos per minut. Biofizikas E. Ballis (E. Ball) mogaus naudojam bioenergij vertino, atsivelgdamas suvartojam deguonies kiek. Po 100 met praktiniais kiekybiniais metodais buvo gyvendinta biofizikos pradininko Juliaus R. Majerio (J. R. Mayer) idja, suvartotu deguonies kiekiu vertinti mogaus energijos apykait (metabolizm). E. Ballis pamatavo, kad suaugusio vidutinikai sverianio mogaus organizmas ramybs metu vartoja 264 cm3 per minut deguonies. Deguonis organizmui reikalingas organiniams junginiams deginti energikai isismusiems elektronams laidoti H2O jungtyse po oksidacinio fosforilinimo mitochondrijose. Tuo remdamasis Ballis apskaiiavo, kad is O2 kiekis atitinka 2,861022 elektron per minut sraut, arba 76 amper srov. Vadinasi, moguje ramybs metu teka 76 A elektros srov. Tarkim, elektron perjimo elektrini potencial skirtumas yra 1,13 V (0,32 V iki +0,81 V ). Vadinasi, mogaus organizmas nuolatos naudoja ne maesn kaip ~85,9 W gali. Lygindami mog
75
2. Biologin sistema termodinamikos poiriu

2.4 lentel. mogaus, sverianio apie 70 kg, naudojama energija atliekant tam tikrus darbus
Eil. Nr. 1 2 3 4 5 6 7 8 9 10 Darbo pobdis Miegant 8 val. Valgant prie stalo 30 min. Skaitant prie stalo 1 val. Vairuojant automobil 1 val. Einant lygiu keliu 10 min. luojant grindis 2 val. Lyginant drabuius 1 val. Valant langus 1 val. Einant laiptais emyn 5 min. Einant laiptais auktyn 5 min. Sunaudojamos energijos kiekis kcal 580 40 110 350 30 560 280 250 70 180 kJ 2430 168 461 1466 126 2346 1131 1047 293 754 kWh 0,673 0,046 0,129 0,406 0,035 0,650 0,313 0,290 0,081 0,209 Eikvojama galia cal/s 20 22 31 49 50 78 75 69 47 300 W 84 92 130 205 209 327 314 289 197 1257

1 W = 0,239 cal /s; 1 cal /s = 4,19 W; 1 J = 0,239 cal = 6,25 1018 eV; 1 cal = 4,19 J = 1,16 106 kWh = = 26,2 1018 eV

pagal naudojam energijos kiek su elektros prietaisais, galime sakyti, kad ramybs metu mogus pagal energijos virsm snaudos ir energijos gali yra tarsi elektros lemput (remiantis senosiomis elektrotechnikos technologijomis). Remiantis panaiais kiekybiniais vertinimais, matuojant suvatojam deguonies kiek atliekant vairiausi darb, galima vertinti gyvn ir mogaus naudojam energij ir j gali. Apytikriai vertinimai mogaus, sverianio apie ~70 kg, pateikti 2.11 pav. ir 2.4 lentelje. Vidutinikai sudtas mogus btinai turi gauti per par ne maiau kaip 1800 kcal energijos, o dirbdamas net ir sdimj darb daugiau. Dirbant fizin darb reikia daug daugiau energijos itekli. Tai rodo formals kiekybiniai termodinaminiai vertinimai. inoma, visko vertinti tik formaliais energijos vienetais negalima. mogui ir visiems kitiems organizmams gyvybei palaikyti reikia ne tik energijos, bet ir vairiausi mediag. Visi organizmai, be visiems organizmams reikaling mediag, turi gauti papildomai savit, jo ries individams btin mediag.Vadinasi, gyvybei palaikyti reikalinga ne tik energija, bet ir tam tikros mediagos.
76
BIOFIZIKA

92 W

205 W

209 W

84 W

130 W

327 W

197 W

314 W

289 W 1 257 W
2.11 pav. mogaus, sverianio ~70 kg, naudojama galia dirbant tamtikr darb

ie mogaus veiksm energijos vertinimai akivaizdiai rodo, kad visk, k augalas, organizmas, gyvnas ar mogus daro, visk galima ireikti vienu ir tuo paiu matu energija. mogaus veiksm galios gali bti ireiktos galios vienetais, t. y. naudojamos energijos kiekiu per laiko vienet. Fizikos poiriu visi organizmai ir mogus paveriamas energine maina. Energijos vyksmai mogaus organizme yra organini molekuli deginimas. Pagridin molekul, kuri yra svarbiausia greitiems energijos vyksmams, yra gliukoz, o vyksmas ireikiamas formule: Gliukoz + Deguonis DARBAS + + CO2 + H2O + iluma.

Organizmo vyksmai yra daug sudtingesni. Jie susideda i daugybs biochemini etap, kuriuos vykdo imtai ir tkstaniai speciali fermentini reakcij. Termodinaminiams energijos dydiams vertinti ir apibdinti pakanka pradini slyg ir galini duomen.

2.8. GYVYBS ENERGIJOS VIRSM NAUDINGUMO KOEFICIENTAS

Organizm lstelse mediagos atlieka vairiausias funkcijas, tarp j ir darbus: elektrin, mechanin, osmosin, chemin ir pan. Galutinis vyksm produktas iluma. Vyksmo padarinys sudtingos organins mediagos virsta paprastomis molekulmis. Jos vl grta aplink ir gali bti naudojamos autotrofams kaip energija ir mediagos. Tokiu bdu chemins molekuls udaruoju ciklu naudojamos kaip energijos neikliai, o pati energija veriama tam tikromis energijos rimis, kol isklaidoma ilumos forma po vis sistem ir aplink. ie virsm vyksmai yra tikri, todl jiems bdingi ir naudingumo koeficientai (r. 2.5 lentel).
77
2. Biologin sistema termodinamikos poiriu

2.5 lentel. Tam tikr biologini vyksm naudingumo koeficientas


Biologinis vyksmas Glikoliz Oksidacinis fosforilinimas Bakterij vytjimas Raumens susitraukimas (Be ildymo naudingojo efekto) Fotosintez Naudingumo koeficientas , [%] 36 55 90 30 75

ie ir anksiau pateikti pavyzdiai neabejotinai rodo, kad gyvieji organizmai ir gyvoji gamta paklsta pirmajam termodinamikos arba energijos tverms dsniui. Gyvybs virsmams galioja ir mediag tverms dsnis, nes manoma, kad biologini virsm metu branduolins reakcijos nevyksta, todl ir mas nekinta. Mediag kiekio kitimai gyvajame pasaulyje paklsta fizikocheminiams tverms dsningumams.

2.9. LAISVOJI IR NELAISVOJI (SURITOJI) ENERGIJOS

Termodinamika sistemos vidin energij E dalija dvi visikai skirtingas energijos ris: laisvj El ir nelaisvj (suritj) Es : E = El + Es. Laisvoji energija El tai sistemos energijos dalis, kuri galima panaudoti naudingam darbui veriant vienos ries energij kitomis energijos rimis. Nelaisvoji (suritoji) energija Es tai sistemos vidins energijos dalis, kurios paprastai panaudoti naudingam darbui nebemanoma. Praktikai tai yra iluma Es ~ Qs , vienodai pasiskirsiusi, isisklaidiusi po vis sistem. Todl sistemos Es potencialj lyg galima apibdinti absoliuija temperatra T. Laisvoji energija labai vairios energijos rys, kurias kai kurie autoriai skirsto auktesns ir emesns eils energijos ris. Laikomasi tokio energijos ri hierarchijos rikiavimo: gravitacin, branduolin, elektromagnetin, elektrin, mechanin, chemin ir emiausio rango ilumin energija. ilumin energija gali bti laisvja energija tuo atveju, jei ji sistemoje pasiskirsiusi nevienodai bus temperatr gradientai T. Klasikin termodinamika vartoja dvi laisvosios energijos svokas: Laisvoji Helmholco energija A; Laisvoji Gibso energija G.
78
BIOFIZIKA

Laisvoji Helmholco energija A patogi naudoti tais atvejais, kai naudingas darbas atliekamas kintant slgiui, ypa ilumini technini main atvejais (T = const.). Ji uraoma: A = E Q s , arba A = E Q s . Biologinse sistemose energijos virsmai daniausiai vyksta nekintant slgiui (P const.) ir temperatrai (T = const.). Tada patogu naudotis laisvja Gibso energija G: G = E + p V Qs . ia p V sistemos slgio ir trio sandauga, apibdinanti mechanin energij. Biologiniai vyksmai, kuri metu vyrauja mediaginiai virsmai, susij su chemins energijos virsm samprata. Jie apraomi vartojant entalpijos H ir isisklaidiusios ilumos nelaisvosios (suritosios) energijos, Q s svokas. Todl: G = H Qs Tokiu bdu biologini sistem termodinamins analizs atvejais vartojama entalpija H, yra laisvosios Gibso energijos ir isisklaidiusios ilumos Qs suma: H = G + Qs , arba H = G + QS Nelaisvajai (suritajai) energijai Qs suprasti fizikai vartoja entropijos svok S.

2.10. ENTROPIJA Sistem energins bsenos kokybei vertinti vartojamas abstraktus dydis entropija S. Sakoma, jeigu entropija didel, vadinasi, sistemoje naudojamas didelis laisvosios energijos kiekis. Entropija tiesiogiai susijusi su isisklaidiusia iluma Qs : Qs = T S. Apraant virsmus, ypa juos vertinant bandym bdu, manoma praktikai pamatuoti tik pokyius, bet ne absoliuisias vertes. Pavyzdiui, energijos pokyius vieno periodinio ciklo metu. Todl energijos virsmai vertinami ir apraomi pokyiais:

Q = T S , arba

S =

Q T

cal . K
79
2. Biologin sistema termodinamikos poiriu

i lygtis rodo entropijos S vertinimo metod. Vienodai sistemoje isisklaidiusi iluma, tenkanti vienam sistemos vidutins temperatros kelvino laipsniui K 0, ir yra entropijos dydis. Tai Klauzijaus entropijos samprata. Entropija labai populiari ir nesuprantamiausia, vairiausiai aikinama termodinamikos svoka. Teigiama, kad tai netvarkos matas, gerai neapibrus, kas gi yra tvarka. Dar kitur bandoma entropij sieti su sistemos neapibrtumu ir informacijos kiekiu, gerai nesuformulavus informacijos svokos esms. Termodinamikos poiriu entropija yra energin sistemos kokybs bsen apibdinantis dydis. Tai galima pavaizduoti 2.12 paveiksle pateiktais paprastais schem pavyzdiais. Tarkime, sistem galima suskirsti vienodas (homogenines) dalis vienalytes erdvskyras (kompartmentus) ir pamatuoti kiekvienai j tenkant energijos kiek ei . Sistema, turinti toki pai vidin energij E, gali turti skirtingas energines bsenas, kai i energija yra skirtingai pasiskirsiusi erdvskyrose. Didiausi potencin galimyb atlikti darb turi sistema, kurios visa energija E sukoncentruota vienoje vietoje, vienoje erdvskyroje, o kitose erdvskyrose energijos nra (beveik nra, ar yra maiau). Tai maiausios entropijos sistema Smin , vadinasi, sistema turi daugiausia laisvosios energijos G max . Jeigu visa energija E visoje sistemoje pasiskirsiusi vienodai po e = E /n, ir i energija yra iluma, sistema energijos poiriu yra sunykusi. Ji negali atlikti darbo, jos entropija didiausia Smax , visa ios sistemos energija yra nelaisvoji (suritoji), o laisvoji energija G lygi nuliui G = 0. Natralios sistemos energija erdvskyrose pasiskirsiusi skirtingai. Todl dalis sistemos vidaus energijos E yra laisvoji, o kita dalis nelaisvoji (suritoji).

2.12 pav. Termodinamins sistemos entropijos samprat vaizduojanti schema, skirtingai pasiskirsius energijai erdvskyrose

80
BIOFIZIKA

Akivaizdiausias maiausios entropijos sistemos energins bsenos pavyzdys yra Sauls sistema. Galima teikti, kad visa sistemos energija sutelkta Saulje. Todl ji energij spindulioja aplink. Vyksta energijos sklaida disipacija atsiunianti energij ir ms em. Nesant sistemoje energijos pasiskirstymo skirtybi arba energijai vienodai pasiskirsius sistemoje, disipacija nevyksta. Toks sistemos makroenergins bsenos modelis gali bti perkeltas ir mikromolekulin lyg, kuris leidia sukurti entropijos S statistin kiekybinio vertinimo algoritm. Daniausiai vartojamas L. Bolcmano (Ludwig Eduard Boltzmann) statistinis entropijos aikinimas ireikiamas lygtimi: S = k ln ia k Bolcmano konstanta k = 1,381023 [JK1], sistemos bsenos termodinamin tikimyb, kuri yra sveikasis skaiius, rodantis ios bsenos galimybs kiek. Termodinamin tikimyb galima ireikti ir matematins tikimybs vienetais, t. y. trupmeniniais dydiais, gyjaniais vertes tarp 01, padalijus Bolcmano termodinamin tikimyb i vis galim bsen skaiiaus, kuris tai sistemai yra pastovus dydis. Tik tada entropija, bdama to paties dydio, turt neigiamj enkl. Pavyzdiui, jeigu sistema, sudaryta i N erdvskyr, kuri kiekvienoje bt po ni daleli (molekuli) (2.13 pav.), sistemos termodinamin tikimyb apskaiiuojama formule:

N! = n1! n2 ! nl !
l

N!

n !
i i =1

ia N =

ni sistemoje esani daleli kiekis.


i =1

n1

n2

n3

...

ni

...

nl

2.13 pav. Termodinamin sistema i l erdvskyr, kuriose yra po ni daleli

Entropija yra didiausia Smax , kai visos dalels vienodai tolygiai pasiskirsiusios visose erdvskyrose. Entropija Smin maiausia, kai visos dalels susitelkusios vienoje erdvskyroje. is vertinimas lm populiarj entropijos netvarkos mato aikinim. inoma, toks aikinimas priimtinas pradinei entropijos supratai, bet ne visai tinkamas isamesnei ana81
2. Biologin sistema termodinamikos poiriu

2.6 lentel. Vandens entropija tam tikromis energinmis bsenomis

H2O bsena Ledas Skystas Garai (1 atmosfera)

S kJ /K (atsivelgiant hlauzij) 41 70 189 entropijos vnt. (atsivelgiant Bolcman) 9,8 16,7 45,1

lizei. Ypa jei entropija susijusi su informacine entropija vertinant organizuotas sistemas, kuriose vyksta informaciniai reguliavimo ir valdymo vyksmai (r. 4 sk.). Bolcmano entropija yra grynai fizikin apibrtis, kuri padeda vertinti fizikochemins sistemos energijos kokyb. Pavyzdiui, sistema 1 grammolekul vandens, jai esant skirting fazini bsen ledas, skystis, garai entropijos dydiai skirtingi (2.6 lentel). Nesunkiai pastebima, kad garai, dujos turi didesn netvark (entropij) nei skysiai ir kietieji knai. Akivaizdus entropijos ryys su iluma ir temperatra. Entropija suprantama kaip sistemos suvienodjimo, isilyginimo, vairiausi gradient nykimo svoka. i svoka turi prieing prasm nei neigiamoji entropija (negentropija) ar organizuotumas. Juo sistemoje daugiau yra heterogenikumo ir maiau homogenikumo, juo sistema laikoma sudtingesne, juo joje yra daugiau vairi ir didesni gradient. iais atvejais sistema virsta maina, o mainoms bdingos savitos galimybs. Taiau tai ne taisykl. Mainoms bdinga speciali nehomogenika organizacija, nulemianti tam tikr virsm bei veiksm kryptingum, nieko bendra neturint su energins entropijos svoka. Maa entropija rodo didesn laisvosios energijos kiek, o didel entropija ma laisvj sistemos energij. Laisvoji energija, kakada vadinta gyvybs energija, rodo energijos galias, bet ne funkcin organizuotum.

2.11. ANTRASIS TERMODINAMIKOS DSNIS (IZOLIUOTAJAI SISTEMAI)

Pirmaisiais fizikins termodinamikos ingsniais buvo pastebta, kad laikui bgant laisvoji sistemos energija savaime virsta nelaisvja (suritja). Buvo suformuluotas fundamentalus negyvosios materijos dsnis:
IZOLIUOTJ SISTEM ENTROPIJA DIDJA:

dS > 0. dt
82
BIOFIZIKA

Tai reikia labai paprast, visiems monms suprantam negyvosios gamtos savyb laikui bgant viskas virsta, viskas nyksta, viskas genda ir pan. Visos fizikins ir chemins prigimties skirtybs gradientai laikui bgant isilygina artja prie nulio. Sakoma, kad izoliuotosios sistemos juda (vystosi) termodinamins pusiausvyros kryptimi. Termodinamin pusiausvyra tai tokia izoliuotosios sistemos energin bsena, kai visa laisvoji energija pavirsta nelaisvja (suritja) (El = 0, Es = E = Q). Tai bsena, kai visose sistemos erdvskyrose energija bna tik iluma, pasiskirsiusi vienodai (kiekvienoje sistemos vietoje temperatra T yra ta pati). Tai bsena, kai S = Smax . Praktinis pavyzdys populiari fizikos sistema indas pripildytas idealij duj. Tokioje sistemoje nra joki gradijent viskas visur vienoda, viskas visur lygu. Tokios bsenos kryptimi natraliai keiiasi (vystosi, juda) visos negyvosios fizikins ir chemins sistemos. Tai ir yra antrojo termodinamikos dsnio izoliuotosioms sistemoms esm. Laisvosios energijos poiriu dsn galimi formuluoti ir kitaip:
IZOLIUOTJ SISTEM LAISVOJI ENERGIJA TIK MAJA

dG dA < 0. < 0 , arba dt dt

Visi samprotavimai, taikyti aikinant antrj termodinamikos dsn entropijos ir nelaisvosios (suritosios) energijos svokomis, tinka ir laisvajai energijai, tik su prieingu nelygybs enklu. is pamatinis antrasis termodinamikos materijos dsnis buvo suformuluotas anksiau u pirmj termodinamikos taip pat pamatin energijos tverms dsn teigiant, kad izoliuotosioms sistemoms galioja energijos balansas. Gyvosiose sistemose vyksta sudtingesni vyksmai. Kol sistema gyva, ji visada yra labai nutolusi nuo termodinamins pusiausvyros bsenos, joje daug vairiausi gradient. Gyvosios sistemos, ypa kurios dauginasi ir auga, pvz., paukiukas, kuris vystosi kiauinyje akivaizds vyksmai, i pirmo vilgsnio tarsi prietaraujantys klasikiniam fizikins chemijos antrojo termodinamikos dsnio supratimui. Gyvosios sistemos nra izoliuotosios sistemos. Jos yra atvirosios termodinamins sistemos. Ir todl antrasis termodinamikos dsnis, aikinantis atvirsias, tarp j ir gyvsias sistemas, formuluojamas kitaip.

83
2. Biologin sistema termodinamikos poiriu

2.12. ANTRASIS TERMODINAMIKOS DSNIS. PRIGOINO LYGTIS

Atvirojoje termodinaminje sistemoje svarbi viet uima mediag ir energijos apykaita su aplinka. Atsiranda du skirtingi virsm srautai: virsmai sistemos viduje, jeigu sistema bt izoliuota, ir virsmai, susij su sistemos ir aplinkos ryiais: APLINKA Mediagos, energija,
dS di S d e S = + dt dt dt

mediagos, energija.

Prigoinas pateik atvirojoje termodinaminje sistemoje vykstani entropijos vyksm lygt:


dS di S d e S = + , dt dt dt

vadinam Prigoino lygtimi, arba atvirj termodinamini sistem antrj termodinamikos dsn. i formul panaikina daug nesusipratim, ypa aikinant gyvybs reikinius. ia diS /dt vidins entropijos kaita, esant izoliuotajai sistemai (suprantama, diS /dt > 0), deS /dt entropijos kaita dl apykaitos su aplinka (izoliuotj sistem deS /dt = 0), dS /dt visos atvirosios sistemos entropijos kaita. Dl apykaitos atvirosios sistemos entropija S gali ir mati, ir didti. Entropija gali bti pastovi (S = const Smax ), bet nebti termodinamins pusiausvyros (Smax ). Pastaroji yra ypatinga atvirosios termodinamins sistemos atskaitos bsena stacionarioji sistemos bsena, ir ireikiama:
dS dS dS = 0, arba i = e . dt dt dt

Stacionariosios bsenos entropijos apykaita su aplinka dydiu susilygina su sistemos vidaus entropijos dydiu, natraliu sistemos nykimu (irimu), bet prieingo enklo. i entropijos kaitos lygtis rodo, kad stacionariosios bsenos apykaitos entropijos kaita visada turi bti tik neigiama, t. y. sistema i aplinkos turi imti neigiamj entropij:

de S < 0. dt Majant sistemos entropijai, t. y. didjant sistemos gradientikumui ir organizuotumui, btinai sistem turi veikti tam tikri neigiamieji entropijos apykaitos pokyiai.
84
BIOFIZIKA

Aikiau ir suprantamiau atvirj sistem antrasis termodinamikos dsnis aikintinas laisvja energija, Prigoino lygt perraius laisvajai energijai. Taikant gyvosioms sistemoms Prigoino lygt tinkamiausia perrayti laisvja Gibso energija:
dG di G d e G . = + dt dt dt

iuo atveju entropija S keiiama laisvja energija G. Remiantis ia lygtimi reikia neumirti, kad izoliuotj sistem laisvoji energija tik maja, t. y.
di G < 0 . Vadinasi, dt sistemai esant stacionariosios bsenos, kai G = const 0, apykaitos vyksmas yra teigiamas, deG > 0. Teigiamasis enklas bna ir tada, kai vidin laisvoji sistemos energija G dt didja. Vadinasi, kad sistema bt stacionariosios bsenos, ji i aplinkos turi imti arba gauti laisvj energij.

t. y.

Fizikas rdingeris, bandydamas suprasti gyvybs esm termodinamikos poiriu, suformulavo gana abstrakt teigin: gyvyb yra sistema, mintanti negentropija. Ivertus aikesn laisvosios energijos kalb Prigoino lygtimi, visa tai galima apibrti gana banaliai gyvyb valgo laisvj energij. Populiariai kalbant gyvoji sistema turi valgyti vertingas ir kaloringas mediagas. Antrasis termodinamikos dsnis atvirosioms sistemoms padeda suformuluoti fizikin gyvybs apibrt:
Gyvosios sistemos yra tokios atvirosios termodinamins sistemos, kurios geba laisvj energij imti i aplinkos ir palaikyti nekintam arba net mainti sistemos entropij.

Negyvosios paprastos fizins (fizikins ir chemins) sistemos, net ir gana sudtingos, taip pat ir iuo metu esanios technins mainos toki ypatybi neturi. Yra keletas fizikini ar chemini reikini, rodani, kad toki ypatybi negyvosios sistemos gali turti. Kibernetika apie save taisanius, savo kopijas gaminanius, auganius automatus kol kas tik svajoja. Jie kuriami kaip virtuals matematiniais ir kompiuterijos modeliai. Todl pateikta termodinamin gyvybs formuluot gana gerai atspindi gyvojo ir negyvojo pasauli esminius skirtumus. Sugebjimas i aplinkos pasiimti laisvj energij ir panaudoti j irimo ir nykimo vyksmams kompensuoti ir naujiems gradientams sudaryti, seniesiems palaikyti, yra ypatinga savyb. Norint visa tai suprasti, vargu ar pakanka vien tik energijos ir mediag virsm aikinimo. rdingeris teig, kad esam fizikos dsni gyvybs esmei suprasti per maa: organizmai, atsivelgiant funkcionavim, panaesni mainas, nei klasikines fizikos nagrinjamas sistemas.
85
2. Biologin sistema termodinamikos poiriu

Gyvyb yra rykiai nepusiausvirioji termodinamin sistema, kuriai bdingi negrtamieji termodinaminiai vyksmai. Jai bdingi prieingi entropijos ar netvarkos didjimui organizuotos veiklos negrtamieji antientropiniai reikiniai. Akivaizdu, kad gyvybs organizuotos veiklos funkcionavimo esms reikia iekoti kitokiu poiriu. Vienas j negrtamj vyksm termodinamika.

2.13. NEGRTAMJ VYKSM TERMODINAMIKA

Nagrinjant atvirsias sistemas tiriami negrtamieji termodinaminiai vyksmai, kurie maiau svarbs izoliuotosioms ir udarosioms sistemoms. Negrtamasis vyksmas sako, kad sistema nesugrta pradin bsen, o entropijos kitimo tendencija lemia laiko strl pirmyn (A. Edingtonas Arthur Stanley Eddington). Anksiau pateikta Prigoino lygtis jau atspindi negrtamum, nes lygtyse yra laiko koordinat. i lygtis atspindi bendr atvirosios sistemos entropijos gamybos greit (dS /dt), vertinama ir apykaitinis entropijos naas (dSe /dt), ir entropijos gamyba sistemos viduje (diS /dt). Remiantis negrtamj vyksm termodinamika, nepusiausviriosios sistemos (sistemai nesant termodinamins pusiausvyros bsenos) laikoma, kad kiekviena atskirai iskirta erdvskyra yra pusiausvirosios bsenos (vietins pusiausvyros principas). Tam vartojama svoka vietins entropijos gaminimo greitis trio elemente dV. Tada entropijos gamyba ireikiama:

di S = dV , dt V
ia V visos sistemos tris. Integravimas suprantamas kaip vis visos sistemos erdvskyr entropij gaminimo greii sumavimas. Laikoma, kad sistemos entropijos didjimas trio vienete tiesiogiai susijs su isisklaidanios ilumos kiekiu ir i sklaida ireikiama energine disipacijos funkcija T

di S . dt Tai universalus termodinaminis apibdinimas, plaiai vartojamas aikinant nepusiausviruosius vyksmus. Disipacijos funkcija susijusi su fizikos ir chemijos potencialij jg X ir j sukelt sraut I svokomis. Jgos suprantamos kaip atitinkam potencial skirtumai. Pati disipacijos funkcija atspindi energin galios prasm, nes atitinka jgos ir vietos srauto sandaug. Pavyzdiui, esant sistemoje elektrini potencial skirtumui arba tampai U = 1 2 (jgai), ji sukels elektros srov I. Jgos ir srauto
86
BIOFIZIKA

arba tampos ir srovs sandauga U I fizikoje inoma kaip elektros galia N. Difuzijos atvejais jg atitinka koncentracij gradientas c / r, o sraut perbgani molekuli ar daleli kiek per laiko vienet n / t ir pan. Remiantis termodinamikos dsniais, sistemoje veikia daug vairiausi bendrj jg X (potencial skirtum arba gradient), kurie sukelia atitinkamus ilyginamuosius srautus arba sroves I (2.14 pav.). Bendruoju atveju srautai yra sudtingos netiesins jgos funkcijos I(X), bet remiantis tam tikromis prielaidomis jos labai suprastinamos.

X1 ==> I1 X2 ==> I2 . . Xi ==> Ii . . Xn ==> In

2.14 pav. Termodinamins sistemos bendrosios jgos X ir j sukelti gradijentus ilyginantieji srautai I

2.14. FENOMENOLOGINS TERMODINAMIKOS LYGTYS

Fizika ir chemija plaiai taiko reikini, pateikt netiesinmis matematinmis lygtimis (matematiniais modeliais), skleidim Teiloro ir Makloreno, arba laipsnine, eilute. Toks sudtingo reikinio iskaidymas suprastina jo analiz paliekami tik du arba trys pirmieji nariai. Taip atitinkamoje vietinje erdvje netiesin bendrojo srauto I priklausomyb nuo bendrosios jgos X pakeiiama paprasiausiais matematiniais modeliais tiese ir/arba parabole:
I ( X ) = I (0) + I ' (0) X X2 + I ' ' (0) + ... 2! 1!

Jei X = 0 ir I(0) = 0, vadinasi, sistema yra termodinamins pusiausvyros bsenos. Danai vartojama tik tiesinis vertinimas, t. y. priklausomyb vertinama tik pirmaisiais dviem nariais. Kasdienikai kalbant, iam suprastinimui taikytina svoka proporcinga. vertinama tik proporcinga srovi arba sraut Ii tiesin priklausomybes nuo jg Xj : Ij Xj . iuos dydius jungiantys proporcingumo koeficientai Lij vadinami fenomenologiniais arba remiantis juos sugalvojusio autoriaus pavarde Onzagerio koeficientais. Tada paprasiausiu tam tikru atveju kiekvienas bendrasis termodinaminis srautas Ii ireikiamas tiess lygtimi:
87
2. Biologin sistema termodinamikos poiriu

Iij = Lij Xj . Remiantis fizika ir chemija bendruoju atveju kiekvieno srauto Ii pokyt gali sukelti visos kitos sistemoje veikianios bendrosios jgos Xj. Pavyzdiui, temperatr skirtumas sistemoje gali sukelti ne tik ilumos srautus, bet ir elektros sroves (termoelektra), chemines reakcijas (mediag virsmus) ir panaiai. Tarkim, bendruoju atveju kiekviena jga Xj veikia kiekvien srov Ii , o sveik ryiai yra patys paprasiausi (tiesiniai). Taip gaunama fenomenologini termodinamini lygi sistema:

I1 = L11 X 1 + L12 X 2 + K + L1 j X j + K + L1n X n I = L X + L X + K + L X + K + L X 21 1 22 2 2j j 2n n 2 LLLLLLLLLLLLLLLLLL I i = Li1 X 1 + Li 2 X 2 + K + Lij X j + K + Lin X n LLLLLLLLLLLLLLLLLL I n = Ln1 X 1 + Ln 2 X 2 + K + Lnj X j + K + Lnn X n
i tiesini algebrini lygi sistema ireikiama ir tiesine vektorine lygtimi:

r r I = L X.
ia srovs I ir jgos X vektoriai, yra matricos-stulpeliai:

I I 21 [I ] = , In

X1 X 2 [X ] = , X n

L11 ; L12 ; L L1n ; L ; L ; L L ; 22 2n L = 21 L L Lii ; L Ln1 ; Ln 2 ; L Lnn ;

o L fenomenologini Onzagerio koeficient matrica. Diagonaliniai fenomenologiniai koeficientai Lii yra gerai inomi fizikos ir chemijos dydiai: laidumas elektrai elektros srovs ir tampos atveju; difuzijos koeficientas difuzini sraut atveju; ilumos laidumo koeficientas perduodant ilumin energij ir pan. Tai atitinka Omo, difuzijos, Furj ir kit klasikini dsni proporcingumo koeficientus. Kiti fenomenologiniai koeficientai Lij taip pat turi fizikin prasm, inoma, sudtingesn. Jie vadinami tarpusavio ryi koeficientais.
88
BIOFIZIKA

Fenomenologins termodinamikos lygtys gali btiu uraomos ir kitaip:


Ii =
n

Lij XX j .
j =1

Tiesinei nepusiausvirajai termodinamikai yra svarbus Onzagerio principas, kuris teigia, kad: Lij = Lji , t. y. rodo, kad fenomenologini koeficient matrica yra simetrika. Remiantis fizika ir chemija, tai yra atitinkam sveik simetrija: jei Ij -tj sraut veikia Xi jga koeficientu Lji , tai tokio paties dydio koeficientu Lij Xj -toji jga veikia Ii -j sraut.

2.15. PRIGOINO PRINCIPAS

Prigoino principas, dar vadinamas teorema, teigia, kad sistemai esant stacionariosios, arti termodinamins pusiausvyros bsenos, ir nekintant ioriniams parametrams, vietika atvirosios sistemos entropija artja prie minimaliausio dydio:

min,
arba, esant sistemos triui V
diS min . dt

io principo konkretus chemini reakcij vyksmo atvejis fizikinei chemijai inomas ir vadinamas La atelj principo vardu. Prigoinas dsningum teorikai iplt ir apibendrino visoms termodinamins sistemoms. Prigoino principo veikimo login galimyb galima pajusti i paprasiausio dviej sraut sveikos modelio. Pavyzdiui, atviroji termodinamin sistema, kurioje vyksta negrtamieji ilumos I1 ir mediag I2 virsmai. Vietika erdvskyros entropijos gamyba bus ireikiama:

= I1 X1 + I2 X2 > 0.
iems susijusiems srautams taikytina algebrini lygi sistema: I1 = L11 X1 + L12 X2 I2 = L21 X2 + L22 X2, i kur:
89
2. Biologin sistema termodinamikos poiriu

= (L11 X1 + L12 X2) X1 + (L21 X X1 + L22 X X2) X2 =


= L11 X12 + L12 X2 X1 + L21 X1 X2 + L22 X22. Pasinaudojus Onzagerio principu, kad L12 = L21, gaunama:

= L11 X12 + L12 X2 X1 + L21 X1 X2 + L22 X22 > 0.


ia visi koeficientai Lij > 0. Fenomenologins lygtys padeda ireikti sistemoje veikiani energijos vyksmus disipacijos funkcija. Jos savybes ireikia diferencialin lygtis:
T di S =N dt
n i =1

jimo

N i

jimo

= X I .

Vietikos entropijos gaminimas matematikai uraomas lygtimi:

T =

I i X i , arba
n

T =

Lij I i X i .

i =1, j =1

Tokia priklausomyb padeda suprasti tam tikras bendras sudting termodinamini sistem stabilizavimosi savybes, formuluojamas Prigoino ir Le atelj principais. Pavyzdiui, iekant ekstremali bsen anksiau nagrintos dviej susijusi virsm sistemai pagal bendrj jg X1, laikant, kad X2 = const, gaunama:

= 2 L12 X 1 + 2 L22 X 2 = 2( L12 X 1 + L22 X 2 ) = 2 I 2 = 0 . X 2


Galima matyti, kad sistema turi ekstremumo tak, nes antrosios eils dalin ivestin:

2 = 2 L22 > 0 , rodo, kad reikm yra minimali. X 2


Prigoino principas rodo, kad atvirosios nepusiausviriosios sistemos susiranda ekstremalisias disipacines duobes, kuri dugn jos ir rieda. Grafikai tai pavaizduota 2.15 pav. Prigoino principas papildo La atelj princip ir nusako termodinamins atvirosios fizikins ir chemins sistemos, esanios stacionariosios bsenos, stabilum. Sistemos, esanios chemins pusiausvyros bsenos ir nukrypusios nuo jos paveikus iorinei jgai, stengiasi savaime grti buvusi pusiausvirj bsen, keisdamos parametrus taip, kad atsirast vyksmai, kompensuojantys iorinio poveikio padarinius.
90
BIOFIZIKA

is Le atelj principas gerai suprantamas i Prigoino principo grafiko. Jeigu sistemos bsena yra tam tikra kreivs tako padtis, tai nukrypus nuo termodinamins pusiausvyros X0 bsenos, atsiras jgos, stumianios atgal X0 tako link. Remiantis potencialiosiomis termodinamikos funkcijomis ir jas vertinant daugiamatmis vektorinmis erdvmis, galima suprasti, kad sudtingos netiesins sistemos vaizduotinos sudtingais potencialiaisiais paviriais, panaiais kaln reljef, turint daugyb keter, griov, duobi ir perj (baln). Tokiu bdu stacionariosios bsenos sistema suprantama kaip esanti atitinkamos potencialiosios duobs dugne, arba besivystanti, t. y. riedanti tam tikra griova emesn potencialij disipacin duob (2.16 pav.).

di S dt

di S dt

min
X
0

X0

2.15 pav. Termodinamins sistemos disipacijos funkcija

di S dt
max02

min03

di S dt

min min
X
0 X01 Stabilioji b sena X0 2 Nestabilioji b sena X03 Metastabilioji b sena

2.16 pav. Termodinamins sistemos disipacijos funkcija

91
2. Biologin sistema termodinamikos poiriu

2.16. GYVYB DISIPATYVIOJI SISTEMA

Prigoino principas padeda suprasti, kad gyvyb sudtinga netiesini sveik sistema gali bti vertinama disipacine funkcija. Tai daugiamat disipacijos funkcija, kurios geometrinis vaizdinys sudtingas daugiamatis reljefas. Jis turi daug ekstremalij tak duobi, kaln virni, kuriuos jungia griovos, kalnagbriai ir perjos (balnai). Tai visada tikrovika kintama sistema, kuri kiekvien akimirk savo termodinamine bsena bna kakuriame viename io reljefo take. Ji savaime, pagal antrojo termodinamikos dsnio reikalavimus, rieda bent vien ariausiai esani duobi. Jeigu iorins jgos bando i tos dsningos raidos, judjimo krypties istumti sistema prieinasi, stengiasi duob grti. Esant didesniems poveikiams, sistema gali pereiti naujas bsenas kitas griovas, persiveria per kalnus ir rieda kitas duobes. Sistema visada bna ne termodinamins pusiausvyros bsenos, bet tam tikros duobs traukos srityje. Vislaik ji juda slenka tam tikra, vietins duobs emiausio lygio kryptimi. Jeigu ta duob nra absoliuioji termodinamins pusiausvyros bsena, tai net ir bdama prie duobs dugno, sistema pasiymi nepusiausvirija bsena, tam tikra organizacija. Esanios galimo reljefo klitys neleidia sistemai kristi emyn, nors joms inykus, sistema smukteli emesn duob. Tai sistemos nykimo vyksmas. Gyvyb emje rodo prieingas tendencijas. Gyvybs ri vairovs gausa, gyvybs raida akivaizdiausias pavyzdys. Tam tikros gyvybs rys termodinamikos poiriu atitinkamos disipacijos reljefo duobs. ias duobes bei sudtingus daugiamaius disipacijos reljefus formuoja ne tik visuotinai veikiantis antrasis termodinamikos dsnis. Taip pat ir pati gyvoji gamta, jos viduje esanios specialios struktros, lemianios galimyb tam tikrose erdvskyrose pasukti proces eig entropijos majimo kryptimi. Tai, kas suprantama kaip gyvj organizm sugebjimas pasiimti laisvj energij i aplinkos, yra savita gyvybs savyb. Ji bdinga specialioms gyvybs struktr priemonms. Tiesa, visuotins evoliucijos vyksmas gali ridentis sistemos bsenos riedjimu griova visuotins entropijos didjimo kryptimi. ios disipacijos funkcijos reljefas gali keistis ir nuo iors poveiki, tam tikr atsitiktinum bei paios sistemos veiksm. Tikimasi, kad tokios savybs bdingos biologinms ir ekologinms sistemoms kaitos metu. Isamiai i vyksm analizei reikalingi dinamini sveik kinetikos metodai. Termodinamika domisi tik galimomis bsenomis. Termodinamika i esms yra termostatika. Kokios prieastys ir kaip sukuria tuos netiesinius disipacijos reljefus, kas lemia ir biologini sistem vyksmus, dar visikai neaiku. kai kuriuos klausimus atsako biologini vyksm kinetika.

92
BIOFIZIKA

BIOLOGINI VYKSM KINETINS ORGANIZACIJOS PAGRINDAI

93
3. Biologini vyksm kinetins organizacijos pagrindai

Nieko nra praktikesnio u ger teorij. LIDVIGAS BOLCMANAS, 1877

Molekuliniai lstels tyrimai rodo, kad organizmas yra biochemini reakcij sistema. Tai kintamai sveikaujani organizuot vyksm visuma, didiulis funkcikai tikslingai sudarytas fermentini reakcij tinklas, gyvendinantis biotechnologines programas. Organizmas yra gyvas, kai vyksta biochemins reakcijos pagal tam tikras, funkcikai tikslingas, programikai suderintas schemas. Dar ne viskas nustatyta, nors ir didiules mediag apykaitos vyksm schemas pateikia biochemija ir molekulin biologija. Dalis i schem aikina mediag ir energijos virsm mechanizmus. Kita dalis informacini procedr, signalini vyksm gyvendinim. Reakcijas sustabdius, pavyzdiui, organizm ataldius, gyvybs vyksmai nutrksta. Taigi biochemins reakcijos sudaro gyvj sistem gyvendinimo pagrind. Fermentin reakcija yra vienas pagrindini organizmo funkcij gyvendinimo element. Biocheminiu poiriu organizmas tai elektrolitin erdvskyra. Ji yra speciali membran atskirta nuo panaios, danai taip pat elektrolitins, aplinkos. i erdvskyr teka mediagos i aplinkos, viduje vyksta biotechnologins reakcijos, o tam tikra dalis produkt imetama aplink (3.1 pav.). Organizmas tai vis laik vykstanios reakcijos, kuri greit ir krypt lemia daugyb veiksni. Didiul tak ioms reakcijoms turi anksiau vykusios ir aplinkins reakcijos, ankstesni reakcij produktai ir pan. Visas reakcij derinys, sveikaujani tarpusavyje, lemiani ne tik j pai, bet ir kit reakcij vyksmus, lemia tiksling funkcionavim. Tiesa, kaip organizuota darni organizmo
94
BIOFIZIKA

veikla, kol kas yra neaiku. Manoma, kad nustaius sveik dsningumus ir atradus biochemini reakcij tinklo dydi kaitos kiekybinio vertinimo metodus, bus rastas raktas iuos neaikumus. Todl fermentini reakcij greiiai tampa pagrindiniais vyksm kinetikos poymiais. Bendru poiriu, norint suprasti biochemini reakcij tinkl kinetik, pirmiausia btina suprasti paprast chemini proces kinetines savybes.

M E D I A G O S

A D P

B G R

C H Z

M E D I A G O S

3.1 pav. Organizmas funkcikai tikslingai organizuot fermentini reakcij tinklas

3.1. CHEMINI REAKCIJ KINETIKA. VEIKIANIJ MASI DSNIS

Chemini virsm kinetik aikina veikianij masi dsnis. Jis sako, kad chemins reakcijos greitis v, esant izoterminms (T = const.) ir izobarinms (P = const.) slygoms, priklauso nuo reakcijoje dalyvaujani mediag koncentracij. Apibendrinta chemin stechiometrin reakcija yra:
m A + n B + ... <=> l C + r D + ... ,
k k+

todl jos reakcijos greitis:


d [C ] = k + [ A]m [ B ]n ... k [C ]l [ D ]r ... , dt ia: A, B, C, D mediagos, dalyvaujanios reakcijose, o lautiniuose skliaustuose paymtos j koncentracijos, m, n, l, r molekuli kiekiai, laikantis mediag tverms dsnio, k+ tiesiogins, o k grtamosios reakcij greii pastoviosios. v=

Matematikos poiriu tai netiesin diferencialin lygtis, bendruoju atveju neisprendiama. Daniausiai veikianij masi dsnis taikomas vertinant pusiausvirsias reakcij bsenas, t. y. reakcijai nusistojus (jai esant stacionariosios bsenos), kai reakcijos greitis nulinis. Stacionariosios bsenos mediag koncentracijos bna pastovieji dydiai Ast , Bst , Cst , Dst .
95
3. Biologini vyksm kinetins organizacijos pagrindai

Vienas i pagrindini pusiausvirosios reakcijos bsen apibdinantis dydis yra pusiausvyros pastovioji (konstanta) K, kuri yra lygi:
K= k + [C St ]l [ DSt ]r ... . = k [ ASt ]m [ BSt ]n ...

Tarp reakcijos pusiausvyros konstantos K ir laisvosios entalpijos ar laisvosios Gibso energijos G egzistuoja priklausomyb: G = R T ln(K/) = R T ln(K) + R T ln(), nes
G 0 A = n = A + RT ln a A , A P ,T G 0 B = n = B + RT ln a B , B P ,T ....................................................... G C = n C 0 = C + RT ln aC , P ,T

G 0 D = n = D + RT ln a D , D P ,T ..........................................................

tada:
G = C + D + ... A B ... = RT ln
0 0 0 0 + (C + D + ... A B ...),

[C St ]l [ DSt ]r ... + [ ASt ]m [ BSt ]n ...

G = RT ln

k+ + const = RT ln K + const , k

o esant pusiausvyrai, kai G = 0, const. = RT lnK . Pateikti teiginiai tinka izoliuotosioms sistemoms. Atvirosiose sistemose, kai reakcijos aplink pradins mediagos nuolat teka, o produktai iteka, proces kinetika bna sudtingesn. Nagrinjant biologines sistemas svarbi dinamin pusiausvyra, t. y. toks vyksmas, kai nenutrkstant reakcijoje dalyvaujani mediag srautams, nusistoja j stacionariosios bsenos.
96
BIOFIZIKA

Nagrinjant sudting biologini vyksm kinetinius reikinius tenka remtis paprastesni chemini reakcij kinetika. Paprasti chemini reakcij kinetikos pavyzdiai danai bna geri modeliai vertinant biologinius vyksmus.

3.2. PAPRASIAUSIOS CHEMINS REAKCIJOS KINETIKA

Paprasiausios chemins reakcijos schema yra:

A B.

Esant T = const. ir P = const., bei pradiniu laiko t = 0 momentu [A(t)]0 = A0 ir [B(t)]0 = B0, pritaikius veikianij masi dsn sudaromas matematinis kinetikos modelis. iuo atveju jis pats paprasiausias, nes utenka vienos diferencialins lygties:

d [ A] = k [ A] , arba dt d [ B] = + k [ A] , dt
kuriai sprsti reikalinga papildoma lygtis, gaunama i mediag tverms dsnio: [A(t)] + [B(t)] = A0. Isprendus pirmj diferencialin lygt gaunamas A(t) mediagos koncentracijos kitimo per laik pobdis, o i mediag tverms lygties B(t):
[ A(t )] = A0 e kt , ir [ B(t )] = A0 (1 e kt ) .

Eksponentins sprendinio lygtys, rodanios mediag koncentracij kait, grafikai pavaizduotos 3.2 pav. Pagrindinis io modelio kinetika apibdinantis dydis yra greiio konstanta k, kurios dimensija atvirktin sekund [S1]. Fizikoje ir kibernetikoje, vertinant eksponentinio vyksmo kinetik, vartojama atvirktin greiio konstanta laiko pastovioji , kuri matuojama sekundmis:
= 1 [S], k
97
3. Biologini vyksm kinetins organizacijos pagrindai

, ,

S C

3.2 pav. Paprasiausios chemins reakcijos kinetikos grafinis vaizdas

o biologijoje dar ir skilimo arba atsinaujinimo pusperiodis (puslaikis) t1/2, t. y. laiko trukm, per kuri suskyla (arba priauga) pus visos mediagos didiausiojo (maksimalaus) dydio (3.2 pav.). ios trys kinetins konstantos yra susijusos tarpusavyje paprastais matematiniais ryiais: t1/2 = [ln 2] = 0,693 / k. Jos tinka biologinio atsinaujinimo ir biologinio nykimo kinetikai apskaiiuoti. Pavyzdiui: cukraus atsinaujinimo pusperiodis iurks kraujyje yra 19 min.; glikogeno kepenyse 2024 val., o glikogeno raumenyse 34 dienos; baltym kepenyse 24 dienos (o mogaus 810 dien); rezervini riebal 1620 dien. Vis mediag atsinaujinimo greitis gali bti vertinamas visomis iomis greii konstantomis. Vyksmo baigmei vertinti patogiausia vartoti laiko pastovij . Po 3 laiko proceso baigm vertinama 5%, o po 5 1% tikslumu.

3.3. PAPRASIAUSIOS GRTAMOSIOS CHEMINS REAKCIJOS KINETIKA

Paprasiausia grtamoji chemin reakcija vaizduojama schema:

A B
k

k+

98
BIOFIZIKA

Jos diferencialinis matematinis modelis, esant toms paioms kaip ir negrtamosios reakcijos slygoms, bus:
d [ A] = k + [ A] + k [ B ] , arba dt d [ B] = + k + [ A] k [ B ] ir dt

[ A( t )] + [ B ( t )] = A0 .

Isprendus gaunamos mediag A(t) ir B(t) koncentracij kitimo algebros lygtys, kuri grafinis vaizdas parodytas 3.3 pav.:

[ A(t )] = A0 [ B(t )] = A0

k k+ + A0 e(k+ + k ) t k+ + k k + + k k+ [1 e ( k + + k ) t ] k+ + k

kinetin vyksm apibdina dvi svarbios konstantos: laiko pastovioji ir pusiausvyros konstanta K. Vyksmo greit apibdinanti laiko pastovioji , kuri iuo atveju yra:

1 . k+ + k

[A(t)] [B(t)]
A0 BSt

[B(t)]

K=
[A(t)]
ASt 0

BSt ASt

= (k+ + k)1

3.3 pav. Grtamosios chemins reakcijos kinetikos grafikai

99
3. Biologini vyksm kinetins organizacijos pagrindai

Pusiausvyros konstanta K yra santykinis dydis:


K= [ Bs ] k + , = [ As ] k

rodantis reakcijoje dalyvaujani mediag stacionarij koncentracij produkto ir substrato santyk. Akivaizdu, kad esant K > 1, t. y. k+ > k , procesas vyksta pagal pavaizduotas kreives, kai K = 1, abi eksponents artja prie A0/2 dydio, o kai K < 1 eksponents nesusikerta.

3.4. AKOTOSIOS CHEMINS REAKCIJOS KINETIKA

Biologini vyksm metu i vienos ir tos paios mediagos gaminama daugyb vairiausi mediag. Paprasiausios akotosios chemins reakcijos schema,
k1

B C

A
k2

kuria remiantis ir taikant veikianij masi dsn sudaromas diferencialinis modelis. J sudaro trys lygtys, atspindinios reakcijoje dalyvaujani mediag koncentracij kait. Matematinis modelis taikomas izoterminms ir izobarinms slygoms. Taip pat laikantis pradini slyg, kaip ir ankstesniais atvejais [A(0) = A0], [B(0) = 0], papildius [C(0)= 0], bus:
d [ A] = (k1 + k 2 ) [ A] , dt d [ B] = k1 [ A] , dt d [C ] = k 2 [ A] , dt [ A( t )] + [ B ( t )] + [ C ( t )] = A0 .

Isprendus gaunama mediag koncentracij kitimo pobdi algebrins lygtys:

[ A(t )] = A0 e ( k1 + k2 ) t
100
BIOFIZIKA

[A(t)], [B(t)], [C(t)]


A0

[A(t)]
BSt

[B(t)]
CSt

[C(t)]

= (k+ + k-)-1

3.4 pav. akotosios chemins reakcijos kinetikos grafinis vaizdas

[ B(t )] = A0 [C (t )] = A0

k1 [1 e ( k1 + k 2 ) t ] k1 + k 2 k1 2 [1 e ( k1 + k2 ) t ] k1 + k 2

Chemini reakcij vyksm pobdis parodytas 3.4 pav. Vis mediag eksponentini kitim kinetin konstanta vienoda:

=1/(k1 + k2), t. y. laiko pastovij nulemia abiej greiio konstant suma.


Nesunkiai galima aprayti analogikos, daug ak isiakojanios chemins reakcijos vyksm, t. y. i vienos ries mediagos A gaminant daug vairi mediag. Paprasiausios isiakojanios chemins reakcijos mediag koncentracij kitimo pobdis, pasinaudojus chemins reakcijos matematine analogija, bt ireiktas gana nesudtingomis matematinmis lygtimis:

A(t)

!
A(t)

k1

B(t )
k2

ki t
i =1

[ A (t )] = A0 e

,
n

C (t )
ki

A(t)

H (t )
kn

[ H (t )] = A0

ki
n

ki t
i =1

[1 e ki

],

i =1

Z (t )
101
3. Biologini vyksm kinetins organizacijos pagrindai

ia =

k
i =1

.
i

Reakcij greit lemia vis greiio konstant suma. Daugiausia takos turi greiiausia reakcija, kurios greiio konstanta didiausia kmax . Eksponentinis kinetinis vyksmo pobdis atitinka 3.4 pav. pavaizduot. Jis skirsis tik tuo, kad vis mediag koncentracij kitimo suma turi atitikti mediag tverms dsnio slyg: [A(t)] + [B(t)] + [C(t)] + +[H(t)] + + [Z(t)] = A0

3.5. GRANDININS CHEMINS REAKCIJOS KINETIKA

Paprasiausia chemini reakcij grandin yra:

A B C.

k1

k2

Matematinis diferencialinis jos modelis, sudarytas taip pat kaip ir anksiau nagrint reakcij atvejais, bus sudarytas i trij lygi. Pirmoji lygtis tai paios paprasiausios chemins reakcijos kinetika, nepriklausanti nuo kit reakcij. Dar viena lygtis gaunama i mediag tverms dsnio. Bdingiausia grandininms reakcijoms kinetika yra gaunama i antrosios lygties sprendimo, j staius pirmosios mediagos kinetikos sprendin:
d [ A] dt = k1 [ A], d [ B ] = k [ A] k [ B ], 1 2 dt d [C ] = k 2 [ B ], dt [ A(t )] + [ B (t )] + [C (t )] = A0 .

Diferencialines lygtis isprendus gaunama:


[ A( t )] = A0 e k1t t k1 t [ B ( t )] = A0 [ e k1t t e k2t] k 2 k1
102
BIOFIZIKA

[A(t)], [B(t)], [C(t)]

A0 [A(t)] [C(t)]

[B(t)]

3.5 pav. Grandinins chemins reakcijos kinetikos grafinis vaizdas


2 1

[ C ( t )] = A0 [1

k2 k1 e k1t t + e k2tt] . k 2 k1 k 2 k1

Grandinins chemins reakcijos kinetikos grafinis vaizdas pateiktas 3.5 pav. Ilgosios grandins schema bt:

Jos kinetikai bdinga bganioji banga, pradinei mediagai A eksponentikai majant, ji nuosekliai virs i pradi B, vliau C, dar vliau D, ir pan., ir paskiausiai galiniu produktu P. Nesunku suprasti, kad visos grandins chemini virsm greit, t. y. [P(t)] susidarym, lems grandinje esanti maiausia greiio konstanta kmin arba max .

A B C P.

k1

k2

kn

3.6. ATVIROSIOS CHEMINS SISTEMOS KINETIKA

Artinant chemins kinetikos model prie biologini virsm organizacijos, btina nagrinti atvirj sistem. Tai sistema, turinti sienas, pro kurias vid teka mediagos substratai S greiiu vi ir iteka mediagos produktai P greiiu v0.

S0

ki

S P
k

k+

P0

k0

103
3. Biologini vyksm kinetins organizacijos pagrindai

Laikoma, kad tekjimas ir itekjimas vyksta difuzikai, kai iors mediag koncentracijos [S]0 ir [P]0 yra pastovios:
vi = ki ([ S ]0 [ S ]) , vo = k o ([ P ] [ P ]0 ) .

Tad atvirosios sistemos matematinis modelis bus:


d[S ] dt = ki ([ S ]0 [ S ]) k+ [ S ] + k [ P] d [ P] = k+ [ S ] k [ P] ko ([ P] [ P]0 ) dt

Iraikas pertvarkius gaunama


d[S ] dt = ki [ S ]0 (ki + k+ )[ S ] + k [ P] d [ P] = ko [ P]0 + k+ [ S ] (k + ko )[ P] dt

pirmosios eils tiesini nehomogenini diferencialini lygi sistema. J isprendus gaunamas mediagos koncentracij kaitos algebrinis modelis, pereinant sistemai i vienos stacionariosios bsenos kit, staigiai pakitus pavyzdiui, aplinkoje esaniai substrato koncentracijai [S]0. Naujj stacionarij bsen S(t) = const. = Sst ir P(t) = const. = Pst galima nustatyti sprendiant stacionariosios bsenos algebrini lygi sistem Kramerio metodu:
(k i + k + )[ S ] + k [ P ] = k i [ S ]0 + k + [ S ] (k + k o )[ P ] = + k 0 [ P ]0

+k k i [ S ]0 + k [ P ] (k + k ) 0 , S st = 0 0 + k (k i + k + ) +k (k + k 0 ) +

( k i + k + ) k i [ S ]0 +k + k 0 [ P ]0 . + Pst = + k (k i + k + ) +k (k + k 0 ) +

Pereinamojo vyksmo pobd atskleidia homogenins lygi sistemos sprendiniai. Atvirosios chemins grtamosios reakcijos bendroji lygtis bus:
( ki + k + ) k+ k = 0, ( k + ko )

arba

2 ( ki + k + + k + k o ) + ( ki k o + ki k + k o k + ) = 0 .
104
BIOFIZIKA

I ios lygties gaunamos aknys 1 ir 2 bei stacionarieji Sst ir Pst dydiai nusako perjim kinetik:
[ S ( t )] = Sst + A1 e 1t + B1 e 2 t , [ P ( t )] = Pst + A2 e 1t + B2 e 2 t .

A ir B koeficientai priklauso nuo pradini slyg. Matome, kad reakcij pobd nusako bendrosios lygties aknys 1 ir 2, kurios gali bti vairios. Patogiausia iuos procesus nagrinti bendrj lygt suprastinus ir paymjus:
( ki + k + + k + k o ) = 2 ,
2 ki ko + ki k + k o k + = 0 ,

nes joje slypi kinetinio proceso prasm. Tada bendroji lygtis bus:
2 2 2 + 0 = 0 , kurios aknys: 2 1, 2 = 2 0

Bendruoju atveju matyti, kad bendrosios lygties aknys gali bti visokios ir lemti kinetik : 1. Realios neigiamosios ir skirtingos (3.6 pav., a). 2. Realios teigiamosios ir skirtingos (3.6 pav., b). 3. Realios, viena teigiamoji, kita neigiamoji (3.6 pav., b). 4. Kompleksins, kai 0 > ir turi neigiamj (3.6 pav., c). 5. Kompleksins, turinios teigiamj (3.6 pav., d). 6. Tik menamosios ( = 0) (3.6 pav., e). 7. Abi aknys lygios 1 = 2 = 0. Esant abiem aknims lygioms, sprendiniai ireikiami kitaip:
[ S ( t )] = Sst + A1 e 0t + B1 t e 0t , [ P ( t )] = Pst + A2 e 0t + B2 t e 0t .

Jei abi aknys lygios ir menamosios 1 = + j0, 2 = j0 (kai = 0), turime mediag koncentracij svyravimo generatorius:
[ S ( t )] = S st + A1 e j 0t + B1 e j 0t = Sst + C1 cos 0t , [ P ( t )] = Pst + A2 e j 0t + B2 e j 0t = Pst + C2 cos( 0t ) .

Fazin kamp nusakys nuo pradini slyg priklausani konstant A ir B santykis:


105
3. Biologini vyksm kinetins organizacijos pagrindai

B = arctg , A

o C=

A2 + B 2 .

Taip pat vertas dmesio atvejis 0 = 0. Tada bendroji lygtis bus:

2 2 = 0 ,
o aknys 1= 0, 2 = 2. Ne visi ie, formaliai matematikai galimi atvejai, gyvendinami praktikai pagal atvirosios paprastos grtamosios reakcijos schem. Taiau laikant, kad sistema turi papildom grandi, galimi net sudtingesni atvejai. Teorikai galim pereinamj vyksm bdingi grafiniai vaizdai pateikti 3.6 pav.
STABILIEJI VYKSMAI NESTABILIEJI VYKSMAI

e kt

e +kt

e te jt

e +te jt

e j t te kt

3.6 pav. Atvirosios grtamosios chemins reakcijos kinetikos teorikai galim pereinamj vyksm grafiniai vaizdai

3.7. CIKLINS CHEMINS REAKCIJOS KINETIKA (CIKLAI)

Tikrosios chemins reakcijos daug sudtingesns, nes jos vyksta jungiantis bent dviem ar net daugiau molekulms. Danai j reakcijose dalyvauja jau gauti reakcijos produktai. Paprasiausios tokios reakcijos schema bt:
106
BIOFIZIKA

ki

vi

k 2 >
> k
y

k3

vo .

Laikant, kad sistema yra stacionariosios bsenos, kur [S] = const, [P] = const. didiausi dmes reikia skirti grtamj ryi takai dinaminiams vyksmams. chemini virsm mazg galima pavaizduoti kitokia schema:
S + X + Y k2 n Y ,

kurios matematinis kinetikos modelis bt:


d [Y ] = k 2 [ S ] [Y ]n [ X ] . dt

Tai jau netiesins lygtys, atspindinios netiesinius vyksmus. Jiems nagrinti reikalingi sudtingesni sprendimai ir analizs metodai. Netiesikumai pasireikia kintamj sandaugomis ir kintamj laipsni rodikliais, kurie nelygs vienetui. Klasikiniais matematikos metodais j nagrinti beveik nemanoma. Tokios sistemos nagrinjamos kompiuterijos metodais, specialiomis programavimo priemonmis. iems vyksmams bdingas slaptasis (latentinis) periodas, vliau labai greitas didjimas, o pasieks tam tikr lyg, po tam tikro laiko ltjant artjama prie didiausiojo dydio (3.7 pav.). Grtamieji vyksmai gali greitinti, ltinti arba net lemti visikai nauj kokybini savybi atsiradim. Daugeliu atvej jiems bdinga sigmoidin dinamika, t. y. galutinio produkto sigmoidinis augimas, S tipo kinetikos dsningumas. Sudtingose biologinse sistemose vyrauja grtamojo pobdio vyksmai, kurie danai net nulemia svarbiausias gyvybs savybes.

Y
Ymax

Ymax 2

Ymin
0

t
P5 P50 t50% Laikas

3.7 pav. Sigmoidinis didjimas

107
3. Biologini vyksm kinetins organizacijos pagrindai

3.8. CHEMINI IR BIOCHEMINI REAKCIJ GREIIO PRIKLAUSOMYB NUO TEMPERATROS

Organizmai yra iltakraujai ir altakraujai. iltakrauj organizm temperatra reguliuojama, t. y. palaikoma tam tikru tikslumu pastovaus dydio. Nagrinjant cheminius kinetinius iltakrauj vyksmus visikai priimtina izotermikumo slyga. Be to, biochemini virsm metu daniausiai beveik nekinta ir slgis. Taigi nagrinjant chemin iltakrauj organizm kinetik priimtinos anksiau nagrint reakcij prielaidos. Visikai kitokios temperatros savybs nustatomos altakraujams. Pavyzdiui, kokios greitos skruzds mike vasar ir kokios jos flegmatiks anksti pavasar ir vl ruden. Laikant, kad skruzdi judjimo greit lemia biochemini reakcij greiiai, vadinasi, aplinkos temperatros reikm svarbi. Biochemin fermentin reakcija labai jautri temperatrai. Chemins reakcijos greiio v priklausomyb nusakoma Arenijaus lygtimi:

v = vmax e RT ia vmax didiausias greitis, vmax = n0 p; n0 molekulini susidrim skaiius per laiko vienet; p sterinis faktorius (skmingo susidrimo tikimyb); Ea aktyvacijos energija; R idealij duj konstanta; T temperatra Kelvino laipsniais.
Priklausomyb grafikai parodyta 3.8 pav. Temperatros chemins reakcijos veiksmingumui vertinti vartojamas temperatrinis vant Hofo koeficientas Q10:

Ea

Q10 =

VT +10 . VT

Jis rodo, kiek kart pakito chemins reakcijos greitis padidjus temperatrai 10 laipsni. Daniausiai Q10 = 2 4. inant koeficient, apskaiiuojama chemins reakcijos aktyvacijos energija Ea: Ea = 0,46 T (T + 10) lgQ10 . i aktyvacijos energijos nustatymo lygtis, gauta i Arenijaus lygties, plaiai vartojama ne tik cheminiams bet ir biologiniam vyksmams vertinti. Taiau ja vertinti biologinius vyksmus reikia atsargiai.
108
BIOFIZIKA

v
vmax

Fermentin s reakcijos greitis

Chemin s reakcijos greitis

T
0 273 K
0

Topt

373 K

K0

3.8 pav. Chemins ir biochemins reakcij greiio priklausomyb nuo temperatros

inoma, kad dauguma biochemini reakcij vyksta vandens aplinkoje ir vandeniui esant skystos bsenos. Todl j vyksm temperatros diapazonas yra 273373 K. Be to, biochemines reakcijas vykdo didiuls baltym molekuls fermentai. Fermentai savo funkcijas atlieka turdamos tretin, ketvirtin struktras. ias struktras palaiko van der Valso jgos. Jos, didjant temperatrai, keiia struktr ir praranda savo tam tikras katalizines savybes. Fermentins reakcijos greiio priklausomyb nuo temperatros pasiymi optimalia temperatra Topt , kuriai esant greitis didiausias (3.8 pav.). Aiku, kodl vant Hofo metodas taikytinas tik iki Topt , nes esant didesnei temperatrai, reakcijos greitis maja ir vant Hofo koeficientas nebetenka prasms. Panaios, turinios optimum priklausomybs fermentinms reakcijoms bdingos ir kitiems aplinkos parametrams. Pavyzdiui, fermento lizocimo aktyvumo, ireikto procentais, priklausomyb nuo aplinkos, terps pH, parodyta 3.9 pav. Optimumas yra take pH = 5,2. Viena svarbiausi savybi, bding fermentinms reakcijoms, yra j savyb vykdyti tik tam tikrus mediag virsmus savitumas. iems vyksmams bdinga tam tikra kinetika, daugiausia nagrinjama izoter- 3.9 pav. Fermento aktyvumo prikausomyb nuo pH minmis ir izobarinmis salygomis.
109
3. Biologini vyksm kinetins organizacijos pagrindai

3.9. FERMENTINS REAKCIJOS KINETIKA

Fermentin reakcija yra pagrindinis funkcinis lsteli veiklos elementas, kuriuo gyvendinami tikrieji mediag ir energijos virsmai bei informacijos signal pertvark (transformacijas). Todl fermentin reakcij galima vertinti vairiausiais poiriais: klasikiniu, chemins ar biochemins reakcijos kinetikos, molekulini mechanizm veiklos. Fermentin reakcij galima laikyti kryptingai valdomu gyvybs organizuotos sistemos veiklos elementu. Tam btina gerai suprasti jos kinetikos dsningumus, ypa klasikin Michaelio ir Menten kinetik. 3.9.1. Michaelio ir Menten lygtis Izoterminmis (T = const.) ir izobarinmis (P = const.) slygomis fermentin reakcij, kurioje fermento molekul E, aktyviojo centro silpnais ryiais laikinai prisijungia maesn substrato molekul S ir j paveria produkto molekule P :
Ei S E P

galima ireikti chemine lygtimi:


S + E ES
k 1 k +1

k2

E+P

Pritaikius veikianij masi dsn, fermentins reakcijos greit galima ireikti:


d [ P] = k 2 [ ES ] . dt ia [ES] laikinai egzistuojantis fermento substrato kompleksas, kuris suskyla arba produkt P ir laisv ferment E, arba, nevykus virsmams, atvirsta S ir E. Greiio lygtyje neinoma komplekso [ES] koncentracija, todl jo kitimo greitis ireikiamas: v=

d [ ES ] = k +1 [ E ] [ S ] ( k 1 + k +1 ) [ ES ] . dt Jeigu fermento kiekis vis reakcijos laik nekinta ir yra E0, galima pasinaudoti mediag tverms lygtimi, kuri ireikia laisvojo fermento [E ] ir komplekso [ES ] kiekio pusiausvyr:
110
BIOFIZIKA

E0 = [E ] + [ES ]. ia lygtimi pasinaudojus, toliau vertinant galima ivengti sunkiai nustatomo laisvojo fermento kiekio reakcijos metu [E ]: [E ] = E0 [ES ], ir tada:
d [ ES ] = k +1 E0 [ S ] [k +1 [ S ] + (k 1 + k +1 )] [ ES ] . dt

Tai pirmosios eils netiesin diferencialin lygtis, kuri bendruoju atveju neisprendiama. Todl daroma dar viena prielaida, kad i atvira fermentin reakcija yra stacionariosios bsenos, t. y. [ES] = const 0, tada:
d [ ES ] = 0, dt [ ES ]st . = k +1 E0 [ S ] E0 [ S ] . = k 1 + k 2 + k +1 [ S ] k 1 + k 2 + [ S ] k +1

Darant daug prielaid, ivedama pagrindin Michaelio ir Menten lygtis, padedanti suprasti pagrindins gyvojo organizmo funkcins plytos fermentins reakcijos kinetik (jos greiio priklausomyb nuo S ir E ):
v= k E [S ] v [S ] . d [ P] = 2 0 = max k 1 + k 2 dt K M + [S ] + [S ] k +1

Nesunku suprasti, kad k2 E0 = vmax . i lygtis rodo, kad visos fermento molekuls yra komplekse, ir tada produkto atsiradimo greit lemia k2 greiio konstanta. Vis trij greiio konstant algebrin iraika yra kiekvienam fermentui savita konstanta Michaelio ir Menten konstanta:

KM =

k1 + k2 . k+1

Michaelio ir Menten fermentins kinetikos hiperbolins savybs pavaizduotos 3.10 ir 3.11 paveiksluose. Konstant KM galima suvokti kaip tok substrato koncentracijos dyd, kuris lemia pus maksimalaus reakcijos greiio. Taip pat labai aikiai matoma vmax priklausomyb nuo substrato ir fermento koncentracij. Akivaizdu, kad fermentas valdo reakcijos greit, vadinasi, jis ne tik vykdo reakcij, bet ir valdo mediagos S virsm. Kai S << E0, t. y. S < KM , reakcijos greitis priklauso nuo substrato koncentracijos:

v max [ S ] . KM
111
3. Biologini vyksm kinetins organizacijos pagrindai

V = d[P]/dt Vmax = k2 E0

Vmax/2

[S] 0 KM

3.10 pav. Fermentins reakcijos kinetikos grafikas

1/V

[S]/V

1/Vmax

Vmax/KM

1/[S] -1/KM 0 -Kmax 0

[S]

3.11 pav. Fermentins reakcijos kinetikos Lainuiverio ir Berko grafikai

Kai S >> E0, t. y. S > KM , reakcijos greit lemia fermento kiekis:

v k2 E0
Praktikai matuojant konstantas KM ir Vmax, vartojamos Michaelio ir Menten hiperbolins lygties tiesinta regresija pagal Lainuiverio ir Berko lygtis:
1 KM 1 1 , = + v vmax [ S ] vmax

arba

s 1 K = [ S ] + M . v vmax vmax

i lygi tiesiniai grafikai pateikti 3.11 pav.

112
BIOFIZIKA

3.9.2. Fermentins reakcijos, turinios slopinomj kinetik Fermentinse reakcijose gali dalyvauti molekuls, mainanios reakcijos greit. ie junginiai vadinami slopikliais (inhibitoriais). Slopikliai bna konkurenciniai ir nekonkurenciniai. Konkurencinis slopinimas atsiranda kai kita, ne substrato S, molekul Ik uima aktyvj fermento centr ir sudaro kompleks EIk (3.12 pav.).
EIk Ik k+k k-k

S+E

k +1

k 1

ES k2 E + P

3.12 pav. Fermentins reakcijos konkurencinio slopinimo schema

Remiantis analogiku metodu kaip ir paprastos fermentins kinetikos atveju iam kinetikos vyksmui apibdinti papildomai traukiama EIk komplekso vyksmo lygtis ir ipleiama fermento tverms dsnio lygtis, papildoma [EIk] komplekso koncentracija:
d [ EI k ] = k +i [ E ] [ I k ] k i [ EI k ] , dt
E0 = [ E ] + [ ES ] + [ EI k ] .

Taip pat pasirinkus stacionarisias slygas [EIk ] = const. 0, ir papildiusius [ES]st. lygt, gaunama konkurencinio slopinimo fermentins reakcijos kinetikos lygtis:
v= d [ P] vmax [ S ] . = KM dt [ I k ] + [S ] KM + Kk

ia Kk = kk /k+k konkurencinio slopinimo (inhibicijos) konstanta. I lygties matyti, kad konkurencinis slopiklis Ik keiia fermentins reakcijos greiio lygt padidina Km konstant proporcingai io slopiklio koncentracijai [Ik]. Nekonkurencinis slopinimas atsiranda, kai slopiklio molekul In sudaro neaktyv kompleks ESIn (3.13 pav.). iuo atveju fermentins nekonkurencinio slopinimo reakcijos greiio lygtis gaunama naudojant fermento kiekio pusiausvyros lygt: E0 = [E] + [ES] + [ESIn], ir tada gaunama:
113
3. Biologini vyksm kinetins organizacijos pagrindai

ESIn In
+1

k+n k-n
k
2 ES E + P

S+E

k
1

3.13 pav. Fermentins reakcijos nekonkurencinio slopinimo schema

v=

vmax [ S ] d [ P] . = 1 dt ( K M + [ S ]) (1 + [ I n ]) Kn

I lygties matyti, kad nekonkurencinio slopinimo atveju slopiklio koncentracija maina vmax nekeiiant KM :
vmax = vmax . 1 1+ In Kn

ia nekonkurencinio slopinimo koeficientas Kn = kn / k+n . Konkurencinio ir nekonkurencinio slopinim naai fermentins reakcijos kinetikai vaizdiai matomi Lainuiverio ir Berko tiesi grafikuose (3.14 pav., 3.15 pav.). Konkurencinio slopinimo atveju, didjant slopiklio koncentracijai [Ik ], fermentins reakcijos ties sukasi apie ordinats aies tak 1/Vmax . Nekonkurencinio slopinimo atveju, didjant slopiklio koncentracijai [In ], ties sukasi apie absciss tak 1/KM. Tiesi lygtys gaunamos invertavus anksiau pateiktas fermentins reakcijos kinetikos abiej slopinimo atvej lygtis.

1/V

1/V

1/Vmax 1/Vmax 1/[S] 1/KM 0 1/KM 0 1/[S]

3.14 pav. Konkurencinis slopinimas

3.15 pav. Nekonkurencinis slopinimas

114
BIOFIZIKA

Dar yra alosterinis slopinimas, kuris atsiranda, kai slopiklis jungiasi su fermentu ne aktyviajame centre taip pakeiia aktyviojo centro savybes. Tai lemia kinetin lygt, kurios charakteristika gauna sigmoidin S raids form, panai kaip parodyt 3.7 pav., tik be pradins slaptosios fazs. Tokios savybs bdingos pagrindiniam lsteli veiklos gamybos elementui fermentinei reakcijai. Beveik visus virsmus energijos, mediag ir signal perneant informacij ir valdant vyksmus, vykdo fermentins reakcijos. Jos yra gyvybs biotechnologijos pagrindas. Fermentin reakcija galima vertinti kaip salygin valdymo operatori, kur techninse automatinio valdymo ir ryi (komunikacij) sistemose vykdo elektromechanins rls, elektronins lempos ar puslaidininkiniai prietaisai, arba tai, k atlieka kompiuterinio programavimo valdymo operatoriai IF (aritmetinis). Isamesni fermentins reakcijos grafikai, labai panas elektronini lemp ir tranzistori savybi grafikus, pateikti 3.16 pav. Sudtingoje biologinje sistemoje, pavyzdiui, lstelje, vienu metu vyksta imtai ir tkstaniai tam tikra valdoma tvarka skirting fermentini reakcij. Todl paprasiausi fermentin reakcij matematikai reikt rayti kaip salygin Michaelio ir Menten lygt, enklinant ferment Ei , atitinkamai enklint substrat Si ir produkt Pi bei pagrindin i-tojo fermento konstant KMi :
Si Ei Pi

k i 2 Ei [ S i ] , if Ei 0, d [ Pi ] Vi = = K Mi + [ S i ] dt 0, if Ei < 0,

k i 2 Ei 0 = Vi max .

Ei -o fermento atliekamos reakcijos, kur KMi konstant reguliuoja konkurencinio slopiklio koncentracija [Iik], o reakcijos maksimal greit nekonkurencinio slopiklio koncentracija [Iin], kinetik galima aprayti slygine lygtimi:
Ei

Si

Ei

Pi

Iik

Iin

k i 2 Ei [Si ] [I in ] 1 + K in d [ Pi ] , Vi = = K iM dt K M + [I ik ] + [Si ] K ik if Ei < 0. 0,


115

if

Ei 0, k i 2 Ei 0 = Vi max ,

3. Biologini vyksm kinetins organizacijos pagrindai

Vi =

d [ Pi ] dt
~2Ei0

Vimax ~ Ei0

Vimaxn

Vi x m a
KiMK 0 KiM

nK

Vx a m
1 1 + [ I inK ] K inK

K iKM = K iM (1 + [ I iK ] K i1 )

[Si]

3.16 pav. Fermentins reakcijos kinetin Michaelio ir Menten charakteristika

Fermentins reakcijos kinetikos lygtys ir j grafikai rodo, kad fermentin reakcija, kaip dinaminio vyksmo elementas, turi lankstaus valdymo ir reguliavimo galimybi. I toki element galima sukurti sudtingas valdomas biotechnologijas. Apibedrinta funkcinio elemento fermento kinetini savybi santrauka grafine forma pateikta 3.16 pav. Tikrovje daniausiai bna substrato Si perteklius, todl fermento buvimas ar nebuvimas nulemia vyksm eig. Sistema veikia, kai fermentas yra, ir neveikia, kai jo nera. Fermentas atlieka jungtuko valdytojo funkcij. Be to, veikiant fermentui ir slopikliams, keiiant slopikli koncentracijas, papildomai galima keisti kiekybin vyksmo eig: didinti ar mainti jautrum bei absoliutj greit, t. y. reguliuoti. I toki funkcini element galima kurti sudtingas organizuotas sistemas, kuriose vyksmai vykt ir entropijos majimo kryptimi. Savo savitumu fermentai galina imti i aplinkos laisvj energij ir j panaudoti vyksm eigai nukreipti prie gradientus, t. y. vykdyti reakcijas prieinga kryptimi nei jos vyksta natraliomis negyvybinmis slygomis. Aiku, tai manoma gyvendinti sudarius tam tikrus fermentini reakcij tinklus, kuri funkcionavimui didel tak turi reakcij bei jose dalyvaujani mediag tarpusavio sveikos. Norint suprasti visos sistemos funkcionavimo savybes, btina imokti mstyti tam tikr kintam vyksm sveikomis. Todl pirmuoju ingsniu reikia isiaikinti paprastus dviej sveikaujani vyksm savybi dsningumus.

116
BIOFIZIKA

3.10. DVIEJ SVEIKAUJANI VYKSM KINETIKA. PUANKAR MODELIS

Dviej sveikaujani vyksm kitimo matematin analiz padeda suprasti daugelio pamatini biologini reikini kinetini savybi dsningumus. Konkreiais atvejais ie paprasti vyksmai gali bti du cheminiai ar biocheminiai virsmai, dviej lsteli ar organizm populiacij sveika, dviej sveikaujani neuron reakcijos ir pan. (3.17 pav.).
1

<X1>

X1(t)

1 2

<X2>

X2(t)

3.17 pav. Dviej sveikaujani vyksm schema

Matematikas H. Puankar pateik tokios dinamins sistemos paprasiausi tiesin matematin model ir suformulavo pagrindinius savybi dsningumus. is modelis yra patogus pradinis pavyzdys rengiantis tyrinti daugiakomponentes netiesines biologines sistemas. I io modelio labai aikiai ikyla pagrindini sveik konkurencijos, amensalizmo, simbiozs, komensalizmo, parazitizmo, plros esm, paaikinami atsirandantys svyravimai ir j kilms prieastys. Isamesnis nagrinjimas padeda suprasti ir savit savybi reguliavimo, valdymo ir informacijos atsiradim. Bendruoju atveju Puankar pateikia tok dviej dinamini vyksm netiesins sveikos matematin, model:
dX 1 (t ) = A + 1 X 1 (t ) + 1 X 2 (t ) + f1 ( X 1 , X 2 ) = F1 ( X 1 , X 2 ), dt dX 2 (t ) = B + 2 X 1 (t ) + 2 X 2 (t ) + f 2 ( X 1 , X 2 ) = F2 ( X 1 , X 2 ), dt

117
3. Biologini vyksm kinetins organizacijos pagrindai

iskleist Teiloro ir Makloreno eilute. Paliekami tik pirmieji trys nariai:


dX 1 (t ) = A + 1 X 1 (t ) + 1 X 2 (t ), dt dX 2 (t ) = B + 2 X 1 (t ) + 2 X 2 (t ). dt

Toliau nagrinti paliekama tiesini sveik dalis, kur 1, 2 tiesinio kitimo, dauginimosi arba saviveikos koeficientai; 1, 2 tiesins tarpusavio sveikos koeficientai; A, B pastovieji dydiai, reikiantys itekli srautus. Pradiniu momentu laikoma, kad sistema bus tam tikros nenulins bsenos x1(0) 0 ir x2(0) 0. Laikui bgant dydiai x1(t) ir x2(t) keisis, ir sistemos bsen atitinkantis takas [x1(t), x2(t)] fazinje x1x2 erdvje juds tam tikra fazine trajektorija. Fazin trajektorija priklausys nuo pradini slyg ir ryio funkcij F. Fazini trajektorij visuma, j eima sudaro fazin portret, kurio lygtis gaunama i abiej lygi santykio, atsiribojus nuo laiko t :
dx1 F1 ( x1 , x2 ) = dx2 F2 ( x1 , x2 ) .

Isprendus i diferencialin lygt gaunama fazinio portreto lygtis:

x2 = 1 (x1, c ),

arba x1 = 2 (x2, c ),

kur c pradins slygos. ias funkcijas vaizduojant grafikai sukuriamas fazinis energinis pavirius (reljefas), panaus geografin reljefin emlap su kalnais ir rvomis, kalnagbriais ir griovomis. Takai io reljefo paviriuje vaizduoja dydius, kurie rodo sistemos bsen, t. y. sistemos tos bsenos energij ir viet erdvje. Laikui bgant kiekvienu konkreiu atveju bsena takas rieds iuo energijos reljefu tam tikra trojektorija x1(t) ir x2(t) tai ir bus fazin trajektorija. Aiku, bus riedama emyn, energijos majimo kryptimi. Dinamins sistemos energin bsena gali bti suprantama kaip sistemos disipacijos funkcija
di S [arba ( x1 , x2 , c ) ]. Tokiais atvejais, norint suprasti sistemos kaitos pobd, dt btina nustatyti ypatinguosius takus (kaln virni bei duobi koordinates), nustatyti kalnagbri takoskyras ir griov dugno linijas separatrises.

Aiku, kad atvejis

dx1 / dt = 0 , arba dx2 / dt = 0

F1 ( x2 , c) = 0 nusako dinamins sistemos F2 ( x1 , c) = 0

118
BIOFIZIKA

x (t ) = const stacionarij bsen, t. y. sistemos bsen, kai dydiai x1 ir x2 nekinta 1 . x2 (t ) = const Tai atitinka sistemos bsenos buvim duobje emiausiame, arba kalno virnje aukiausiame take. Faziniais portretais prasminga panagrinti paprasiausius atvejus, kuriuos galima suskirstyti nesusijusius ir susijusius vyksmus.

3.10.1. Dviej nesusijusi vyksm modeliai Pati paprasiausia sistema, kurioje nra nei saviveikos, nei tarpusavio sveikos apibdinama lygi sistema:
dx1 dt = A = const . dx 2 = B = const . dt

Tokia sistema tai dvi savarankikos integruojanios grandys. Ypatingj tak i sistema neturi, nes ploktumos lygtis:
dx2 B ir suintegravus gaunama fazinio portreto fazins energijos = dx1 A

x2 =

B x1 + c . A

iuo atveju fazins trajektorijos, esant skirtingoms integravimo pastoviosioms c, bt lygiagreij tiesi eima, kuri krypties koeficientas tg = B/A (3.18 pav.). Pradini slyg konstanta c nustatomama i lygties, nurodius konkreias pradines x1 ir x2 reikmes.
B x01. A Geometrinis fazinio portreto vaizdas energijos pavirius nuolaidi ploktuma. Dinamines sistemos savybes apibdina jos to momento bsenos tako judjimo ia ploktuma trojektorija. Jeigu A ir B reikms teigiamieji dydiai, tai didjant vienam dydiui, dids ir kitas, t. y. takas fazinje erdvje juds dein ir auktyn; jeigu A ir B neigiami vienam dydiui majant ir kitas maja, t. y. takas juds kairn emyn; o jeigu A ir B yra skirting enkl, A < 0, o B > 0 vienam dydiui didjant kitas maja, t. y. takas juds kairn auktyn, o jeigu A > 0, bet B < 0 takas juds deinn emyn. Taigi A, B enklai ir dydiai lemia fazins ploktumos pokryp, t. y. apibdina sistemos savybes.

Kai x1(0) = x01, x2(0) = x02, c0 = x02

119
3. Biologini vyksm kinetins organizacijos pagrindai

tg = B/A
dx1 dt = A = const dx 2 = B = const dt

3.18 pav. Dviej nesusijusi vyksm faziniai portretai (paprasiausias atvejis)

Kitokia, sudtingesn, sistema bus, jei:


dx1 dt = 1 x1 , dx 2 = 2 x2 . dt

Fazin jos trajektorija bus:


dx2 2 x2 , t. y. = dx1 1 x1 dx2 2 dx1 . = x2 1 x1

Integravus lygt gaunama:


ln x2 = 2 ln x1 + C . 1

Laikant, kad C = ln(y0/x0), fazinio portreto lygtis bus:


x2 = y0 2 x1 1 . x0

Tai rodo, kad fazins trajektorijos eina per koordinai centr. J pobdis priklauso nuo 1/2 santykio ir koeficient enkl (3.19 pav.). Jei enklai teigiami ir lygs 1 = 2 = 1 fazins trajektorijos bus tiess einanios i centro, fazinis pavirius
120
BIOFIZIKA

STABILIEJI MAZGAI

1 = 2 = 1

|2| > |1|

< 0

|2| < |1|

NESTABILIEJI MAZGAI

1 = 2 = +1

|2| > |1|

|2| < |1|

1 > 0 2 < 0
BALNAI

1 < 0 2 > 0

faziniai portretai

3.19 pav. Dviej nesusijusi vyksm, esant grtamosioms saviveikoms, veikimo

apversta piramid: kai neigiamas tiess eis centr, kai 1 2 bus atitinkamai i koordinai centro ieinanios ar centr ateinanios rodiklins kreivs. Faziniai portretai, kuri fazins trojektorijos ateina centr ar bet kur kit fazins erdvs tak, vadinami stabiliaisiais mazgais, o kuri fazins trojektorijos tolsta nestabiliaisiais mazgais. 3.10.2. Dviej susijusi vyksm paprasiausi modeliai Toki dinamini sistem abu vyksmai susij tik tarpusavio sveikos koeficientais 1 ir 2. Galimos dvi situacijos: abu veiksniai vienas kit veikia tuo paiu enklu (, ) arba skirtingais enklais (, m ).
121
3. Biologini vyksm kinetins organizacijos pagrindai

Pirmuoju atveju, kai saviveikos koeficient enklai tokie patys, abu teigiamieji arba abu neigiamieji, pirmojo vyksmo greitis proporcingas antrojo vyksmo parametro reikmei, o antrojo vyksmo greitis proporcingas pirmojo vyksmo kintamajam, sistemos matematinis modelis bus:
dx 1 dt = 1 x 2 , dx 2 = 2 x1 dt

faziniai sistemos portretai yra hiperboliniai balnai (3.19 pav.). Antruoju atveju, kai saviveikos koeficient enklai skirtingi, matematinis sistemos modelis bus:
dx 1 dt = 1 x 2 dx , 2 = m 2 x1 dt
X2

X1 0

gaunami svyravimai, nes faziniai sistemos portretai yra udar kreivi elipsi eima (3.20 pav.). Pirmuoju atveju fazinio portreto diferencialin lygtis bus:

3.20 pav. Svyruojaniosios dinamins sistemos fazinis portretas

dx2 2 x1 = , dx1 1 x2
o j integravus gaunama fazinio portreto hiperboli eim:
2 x2 x2 m 1 = C 2, 2 / 2 1 / 2

kurios grafinis fazinio portreto vaizdas bus balnai, parodyti 3.19 pav. Fazini trojektorij kryptis lemia sveikos koeficient enklai didjimo kryt rodo teigiamasis koeficientas. Antruoju atveju, kai tarpusavio sveikos koeficient enklai skirtingi, fazini trojektorij matematins lygtys yra elipss (3.20 pav.):
2 x2 x2 + 1 = C2 . 2 / 2 1 / 2

Tai nulemia dinamins sistemos kintanij dydi svyruojamj pobd, nes sistemos vyksmai yra vis laik kintanti bsena, riedanti viena i i elipsine trojektorija.
122
BIOFIZIKA

Sistemos bsenos kitimo projekcijos ayse x1(t) ir x2(t) yra periodikai svyruojantys harmoniniai vyksmai, pastumti vienas kito atvilgiu faze per /2:
x1 (t ) = X 10 sin(t ), x2 (t ) = X 20 cos(t ).

Konkrei fazin trojektorij, didisias svyravim reikmes X10 ir X 20 lemia koeficient dydiai ir integravimo konstanta C, o faz stebjim pradios tako koordinats x10 ir x20, pradins slygos. 3.10.3. Dviej sveikaujani vyksm kinetikos bendrasis atvejis Dviej inertik vyksm, kurie sveikauja tarpusavyje tiesikai pagal 3.17 pav. schem, matematinis modelis bus ireiktas lygi sistema:
dx1 dt = 1 x1 + 1 x2 + A . dx 2 = 2 x1 + 2 x2 + B dt

Sistemos savybes lems pradins slygos ir dinaminis vyksmas pereinant i pradins stacionariosios bsenos x10 ir x20 nauj stacionarij bsen x1st , x2st , esant A ir B poveikiams (plaukoms). Jei A = const. 0 ir B = const. 0 , tada: x1(t) = x1st+ x1d(t) x2(t) = x2st+ x2d(t). Jei A = 0 ir B = 0, modelis bus tiesini homogenini lygi sistema:

dx1d dt = 1 x1d + 1 x2 d dx 2 d = 2 x1d + 2 x2 d , dt


kurios dinaminiai sprendiniai, vaizduojantys jos savybes, gali bti pavaizduoti centruotu faziniu portretu, t. y. orientuotu pagal koordinai centr. Tokia sistema yra tikra tik tuo atveju, jeigu yra ios lygi sistemos bendrosios lygties aknys, t. y. jeigu koeficient matricos determinantas nelygus 0:
1; 1; 0, arba 1 2 1 2 0 . 2; 2;
123
3. Biologini vyksm kinetins organizacijos pagrindai

Esant A ir B pastoviems poveikiams (plaukoms), homogenins diferencialini lygi sistemos dinaminio sprendinio fazinis portretas pasislinks i koordinai centro kit fazins erdvs tak, kur nusako stacionarieji sprendiniai x1st ir x2st:
A; B; = 1 ; ; 2 1 ; 2 ; , 1 ; 2 ; 1 ; ; = 2 1 ; 2; A ; B ; . 1 ; 2 ;

x1st

ir x1st

Bendroji sistemos lygtis gaunama kaip determinantas:


1 ; 1 ; 2 = 0 , arba ( 1 + 2 ) + ( 1 2 1 2 ) = 0 , 2; 2 ;
2 arba traukus kitus paymjimus 2 2 + 0 = 0 .

ia: = (1 + 2)/2 , turi sistemos slopinimo koeficiento prasm, o 0 = (1 2 1 2 )1/2, vadinamas sistemos nuosavuoju svyravimo kampiniu daniu. Bdingosios lygties aknys bus:
(1 + 2 ) (1 + 2 ) 2 2 (1 2 1 2 ) , arba 1, 2 = 2 0 , 2 4 kitaip pertvarkius: 1, 2 = (1 + 2 ) (1 2 ) 2 + 1 2 . 2 4 Turint bendrosios lygties aknis: 1, 2 =

x1d (t ) = A1 e 1t + B1 e 2t x2 (t ) = A2 e 1t + B2 e 2t .
ia A1, A2 ir B1, B2 koeficientai, priklausantys nuo pradini slyg. Tarus, kad ie vyksmai yra fazinio portreto atvaizdas, pagal j galima apibdinti sistemos dinamines savybes, esant tam tikriems 1, 2, 1, 2 koeficientams. Tokios kinetins sistemos savybes rodo 3.21 pav. bendrosios lygties akn grafikas. Gerai matomos 6 kokybikai skirtingos dinamins bsenos: Stabilieji ir nestabilieji mazgai. Stabilieji ir nestabilieji idiniai (spirals). Dviej orientacij balnai. Svyravimai apie centr.
124
BIOFIZIKA

42 = 20

3.21 pav. Ypatingj sistemos bendrosios lygties reikmi sritys, nusakanios jos savybes

Nestabilum lemia teigiamasis (+) enklas. Svyruojamsias reakcijas lemia bendrosios lygties akn neigiamasis () diskriminantas, t. y. jei 2 < 02. ia 1 = j. aknys pasidaro kompleksins, atsiranda menamoji dalis et = exp{ t } = exp{( j)t}. Remiantis Oilerio formule: exp{( j)t} = exp{t} exp{j} = exp{t} [cos(t) j sin(t)]=Re1, 2 + jIm1, 2 , Im1, 2 menamoji eksponent reikia svyravimus, kuri kampinis danis:
2 = 0 2 .

Balnai, lemiantys dinamins sistemos trigerin reim, t. y. vieno vyksmo inykim o kito vyksmo nesulaikom didjim, turi atitikti nelygybes: (0)2 > 0 ir 2 > (0)2 , t. y. diskriminantas teigiamas, o akn 1 ir 2 reikms tikros skirtingos, kuri viena teigiama, kita neigiama. Tiesini sistem atveju tai rodo nestabili dinamin sistem, kurios vieno vyksmo dydis didja begalyb.
125
3. Biologini vyksm kinetins organizacijos pagrindai

Jei lygties aknies slopinimo koeficientas lygus nuliui ( = 0), o diskriminantas neigiamas, sistema pasidaro harmonini, t. y. sinusini svyravim generatorius. i analiz atskleidia daug sveikaujani dinamini sistem kinetikos savybi, kurios stebimos biologini sistem vyksmuose. Daugeliu atvej kitim pobd galima numatyti inant tik sistemos koeficient enklus. 3.10.4. Sveikaujani vyksm sistemos kokybin kinetika Dviej sveikaujani vyksm sistemos kinetik kokybikai galima vertinti atsivelgiant keturi koeficient 1, 2, 1, 2 enklus. Yra (24) = 16 skirting enkl matric,

1 2

1 2

parodani tam tikras dinamins sistemos kinetines savybes. Ne visos jos turi tikr reikm, bet daugumos j savybms galima suteikti net biologin pavadinim. Tam tikromis situacijomis turi prasm ir nulini dydi koeficient reikms. Vadinasi, teorikai gali bti net 81 enklo matric, tik ne visi j deriniai yra prasmingi. Dinamins sistemos kinetikos pobd apibdina kokybin sistemos matrica Q, kuri yra Jakobio matricos arba Jakobio koeficient J enkl (sign) matrica:
F1 F , sign 1 sign1 , sign1 x y = Q = signJ = . F2 F2 sign 2 , sign 2 sign , sign x y sign

ios matricos enkl deriniai lemia atitinkam fazin sistemos portret, kuris akivaizdiausiai rodo sistemos kinetikos pobd. Be to, i pradi paprasiau nagrinti, jei koeficient dydiai bt |1| = |2| = || ir |1| = |2| = ||. Galima iskirti dviej vyksm tris rykiai skirting kinetini savybi dinamines sistemas: kooperacin simbioz; konkurencij; plrnasauka simbioz. Kiekviena j savo ruotu dar gali bti skirstomos maesnes dalis: Kooperacin simbioz protokooperacin, mutualizm, komensalizm ar altruizm. Konkurencij ir amensalizm. Plrnas ir auka simbioz ir parazitizm.
126
BIOFIZIKA

Dar galimas nepriklausomybs sambvis, kai visi nurodyti sveik koeficientai yra nuliai. Tokios dinamins sistemos kinetika atitikt nesusijusi vyksm matematin model (3.18 pav.). Protokooperacin simbioz. Jei vis koeficient enklai yra teigiami (+ ir + ), sveikos enkl matrica: + + + +

rodo, kad abu vyksmai didja savaime ir taip pat vienas kit skatina didti (+). Teigiamieji koeficientai rodo, kad abu vyksmai didja ir be tarpusavio pagalbos. Tokio sambvio sistema, remiantis biologija, yra simbioz protokooperacija. iuo atveju bendrosios aknys:

1,2 = 1 = + , 2 = .
Jeigu > , abi aknys bus teigiamos, fazinio portreto lygtys:
x1d (t ) = A1 e + 1t + B1 e 2t , x2 d (t ) = A2 e + 1t + B2 e 2t ,

fazins trojektorijos rodo abiej vyksm didjim (3.22 pav.). Akivaizdu, kad tokia sistema pleiasi, didja proporcingai, klesti. Simbiozmutualizmas. Tokios sistemos saviveikos koeficientai yra neigiami (). Vadinasi, visi vyksmai nesaveikaudami maja, bet j tarpusavio sveikos koeficientai (+) teigiami. Sveikos enkl matrica: + +

Tokia simbiozkooperacija, remiantis biologija ir ekologija, vadinama mutualizmu (tarpusavio pagalba). Matematinio modelio teigiamj tarpusavio ryi sambvio iraika rodo, kad vyksmai, atitik tam tikras slygas, gali didti. Jiems esant ne nulins pradins bsenos, esant tam tikriems, gana svarios tarpusavio sveikos koeficientams (+) ir poveikiams (tekjimams) (A, B), visa sistema gali ne tik nemati, bet, vyksmai, palaikydami vienas kit, didti. Tokios sistemos bendrosiosios lygties aknys bus:

1,2 = .
127
3. Biologini vyksm kinetins organizacijos pagrindai

Kai || > || , 1= + , 2= ( + ).

Tikrosios skirting enkl teigiamoji ir neigiamoji aknys rodo, kad iuo atveju fazinis portretas yra balnas, kurio vyksm kryptis bus nukreipta striaine tolyn nuo koordinai centro (3.22 pav.):

x1d (t ) = A1 e + 1t + B1 e 2t , x 2 d (t ) = A2 e + 1t + B2 e 2t .
Jei sistemoje yra poveikiai (tekjimai) A, B, tada koordinai centras bus paslinktas x1st, x2st padt (3.22 pav.). Akivaizdu, jei momentin dinamins sistemos bsena, jos vyksm x1(t) + x2(t) suma yra take emiau x1st+ x2st , t. y. jei x1(t) + x2(t) < x1st+ x2st , dinamin sistema slinks koordinai centro kryptimi, mas ir inyks. Jeigu x1(t) + x2(t) > x1st + x2st, tada ji dids ir klests:

x1 (t ) = x1st + A1 e + 1t + B1 e 2t , x2 (t ) = x2 st + A2 e + 1t + B2 e 2t .
Mutualizmo sveik savybs teorikai nra gerai itirtos, bet jos turi didiuls reikms biologini ir socialini sistem raidai.

x2st x1st

PROTOKOOPERACIJA

MUTUALIZMAS

3.22 pav. Kooperacins tarpusavio teigiamos sveikos dinamins sistemos faziniai portretai

Komensalizmas, altruizmas. Protokooperacijos sambvis, kai vienas tarpusavio saveikos koeficientas yra labai maas, nulinis, arba net neigiamas, biologijoje ir ekologijoje vadinami komensalizmu ar altruizmu. Komensalizmas tai toks dviej vyksm sambvis, kai vienas j naudojasi kitu, pastarajam neturdamas jokios takos. Altruizmas daniausiai suprantamas kaip vieno vyksmo teigiama parama kitam vyksmui, kai is jam silpnai kenkia.
128
BIOFIZIKA

Sveikos enkl matricos bus:


+ 0, + +

arba

+ +

0, +

iuo atveju vienas vyksmas aktyvus didjantis > 0, o kitas pasyvus majantis ( < 0). Aktyvusis teigiamai veikdamas pasyvj ( > 0), sukelia dar didesn aktyviojo didjim. Bendrosios lygties aknys bus:
1; 2 = 2 + 2 , 1 = + 2 + 2 , 2 = 2 + 2 .

aknys realios ir skirting enkl, fazinis portretas balnas, tai rodo abiej vyksm didjim (3.22 pav.). Dinaminis altruizmo, amensalizmo vyksmas yra kooperacinis lengvesnmis slygomis nei mutualizmas. Parazitizmas. Dviej sveikaujani vyksm dinamin sistema, kurioje vienas j kit veikia teigiamuoju sveikos koeficientu, o tas pirmj neigiamai, jam kenkia, arba net naudodamasis pirmojo teigiama parama, atsako neutralumu, nuliniu poveikiu, vadinama parazitizmu. Tokios sistemos sveikos enkl matricos bus:
+, 0 , 0 + +

arba

+ +

, 0 +,

Jos rodo teigiamj koeficient vyravim, bet vienas i tarpusavio sveikos koeficient sistemai reikmingai neigiamas ar net nulinis. Jei vienas i protokooperacijos vyksm kito veikl slopina, kenkia ( 0), o kitas jam padeda ( > 0), enkl matrica rodo, kad kenkiantysis yra parazitas. Tokios sistemos bendrosios lygties aknys yra kompleksins, nes > , arba diskriminantas yra tik neigiamas 2 :
1; 2 = 2 = i ,

1 = + i , 2 = i ,

ir vyksm matematinis modelis:


x1 d ( t ) = A1 e + t e + i t + B1 e + t e i t , x 2 d ( t ) = A2 e + t e + i t + B 2 e + t e i t ,

rodo didjanius ar majanius (gstanius) svyravimus (3.23 pav.).


129
3. Biologini vyksm kinetins organizacijos pagrindai

>0

<0

3.23 pav. Parazitavimo vyksm faziniai portretai stabilusis ir nestabilusis idiniai

Konkurencija ir amensalizmas. Tai toks dinaminis vyksm sambvis, kai vienas vyksmas kitam kenkia. Konkurencija yra daugiausia itirta ir bandymais pagrsta sambvio forma. Ji lengvai parodoma praktiniais pavyzdiais. Konkurencijos sveikos enkl matrica yra prieinga mutualizmui:
+ +

Tam tikra konkurencijos variacija, kai vienas i tarpusavio sveikos koeficient yra nulinis, kitam nei kenkia, nei padeda, tokia dinamin sistema vadinama amensalizmu. Galimos dvi simetrikos amensalizmo sveikos matricos:
+ 0 + + 0 +

Konkurencins dinamins bendrosios lygties aknys bus: 1,2 = , 1= + ( + ), 2= ( ), kai > , ir 2 = + ( ), kai < . Konkurencija pasireikia esant || > ||, t. y. kai neigiamoji (viena kitai kenkianti) tarpusavio sveika veikia stipriau nei saviveika. Tokios dinamins sistemos kinetinis modelis fazinis balno portretas orientuotas kita kryptimi nei mutualizmo atveju. Vadinasi, ioje dinaminje sistemoje dydiai kinta taip, kad sistemos vienas kintamasis vyksmas didja artdamas prie koordinai aies, o kitas nyksta (3.24 pav.). Konkurencins dinamins sistemos veikia kaip trigeriai, t. y. atsivelgiant esamos bsenos arba/ir iorinius poveikius, jose vyrauja tik vienas vyksmas. Bet kuris kitas, silpnesnis, slopinamas. Tokiai dinaminei sistemai bdinga sudtingumo mainimas, skaidymasis, isigryninimas. Ekologija i savyb apibdina kaip Gauzs dsn.
130
BIOFIZIKA

Fazin kokurencins sistemos balno portret vertinant kaip disipacijos (energin) funkcij matyti, kad tai yra energinis pavirius, kurio kalnagbris eina striaine, o laitai nusileidia ai x2st link. Todl dinamins sistemos bsena, vaizduojama fazine trojektorija tako riedjimu energiniu paviriumi vyksmo pltros krypt tos aies link, kuri lems laito, kuriame yra sistemos bx1st senos takas, orientacija. Vyraus tas vyksmas tos 3.24 pav. Konkurencins tarpusavio nei- koordinai aies link, kurios i / i santykis giamosios dinamins sveikos fazinis por- didiausias. tretas Konkurencinis modelis taip pat yra ir maksimumo filtras. Dl slopinamosios veikos visada, kai || > ||, aktyvesnis vyksmas visada nuslopins kit, maiau aktyv. Tai rodo daugelio tarpusavyje konkuruojani vyksm sistem teorija ir praktika. Ilieka vyrauti vienas aktyviausias. Tai ir yra Gauzs dsnio esm. Amensalizmo atveju, kai sistemos bendrosios lygties aknys teigiamieji dydiai, dinamin sistema rieds neslopinamojo vyksmo neribojamo didjimo kryptimi. Plrumas, plra (plrnas ir auka sistema). Dinamin dviej vyksm sistema, kurios vienas vyksmas turi didel saviveik, didel aktyvum, o kitas vyksmas priklauso nuo pirmojo, ir jo aktyvumo rezultatais maitinasi, sudaro plrno ir aukos simbiozs sistem. Toks sambvis, remiantis biologija, ekologija, net sociologija, vadinamas plrumu, arba plra. Vienas j yra, plrnas, kitas, kuriam bdingas greitas didjimas gamintojas (producentas) yra plrno itekliai maistas. Sveikos enkl matricos yra:
, 0 + + arba + + , 0

iuo atveju vyksmas plrnas yra tas, kurio 0 ir > 0. Vadinasi, plrnas maitinasi kitu producentu arba auka. Aukai bdinga > 0 ir < 0, vadinasi, ji didja pati savaime, o j naikina kitas plrnas. Teorikai plrno gali bti neigiamas arba bti lygus nuliui, < 0, = 0. Todl galimos papildomos enkl matricos variacijos. Bdingosios lygties aknys:
1; 2 = 2 2 ,
131
3. Biologini vyksm kinetins organizacijos pagrindai

1 = + 2 2 ,

2 = 2 2 .

Jei || > ||, |1| = |2| , = 0, tada sistemos bendrosios lygties aknys bus:
1 = +i 2 2 , 2 = i 2 2 ,

gaunami periodiki svyravimai:


x1d (t ) = c1 cos(t + 1 ) , x2 d (t ) = c2 cos(t + 2 ) ,

ia =

2 2 , o c1, c2 koeficientai, priklausantys nuo pradini slyg.

Faziniai i kinetik portretai parodyti 3.20 pav., 3.21 pav. ir 3.25 pav. Sistemos auka sugeba imti iteklius i aplinkos, yra poveikis (plaukos) A, todl svyravimai vyks ne apie nulin koordinai pradios tak, bet apie stacionarisias bsenas x1st , x2st . Tokia savyb rodo tam tikr reguliavimasi, t. y. palaikomas dydi kaitos tam tikr reikmi diapazonas.
X2(t) = X2st + C2 sin(t + 2)

X1(t) = X1st + C1 cos(t + 1)


3.25 pav. Plros sveikos dinamins sistemos fazins trojektorijos skleidimo grafikai

132
BIOFIZIKA

Pateiktas tiesinis plros modelis yra idealizuotas, nes jam gyvuoti btina stabiliai ilaikyti bendrosios sistemos lygties akn nulin realij dal ( = 0). Tokia tiesini sistem pusiausvyra tikrovje nemanoma. Tikrovje, kad modelis bt gyvendintas, reikalingi netiesikumai. Dinamins plrnas ir auka sistemos vienos fazins trojektorijos (sistemos bsen raida apskritimu ar elipse), iskleistos laiko koordinatse grafinis vaizdas pateiktas 3.25 pav. Tiesins sistemos atveju kintamieji dydiai yra pavaizduoti fazine trojektorija judanio tako padties projekcijomis x1(t), x2(t) koordinai ayse. Tai harmoniki svyravimai apibdinami sin(t + ) matematine formule. Atsivelgiant dsn, svyruoja abiej vyksm, aukos ir plrno dydiai, bet tarp j yra fazinis poslinkis per /2. Plr lyginant su konkurencija pastebima, kad konkuruodamas aktyvusis vyksmas stengiasi visikai nustelbti maiau aktyv j nustumti nulin lyg numarinti. Taiau plrnas aukos gamintojo (producento) visisikai nesunaikina, bet jo dyd reguliuoja svyruojamai, ilaiko tam tikras ribas, nes auka yra plrno itekliai. Inyks auka, turs inykti ir plrnas. Tai savita plros sambvio savyb.

* * *
Aptarti dviej tiesini vyksm bdingiausi sveik modeliai sudaro teorin pagrind daugiakomponeni ir netiesini dinamikai sveikaujani sistem tyrimams. Kooperacija, konkurencija ir plra yra pagrindins sambvio formos. Visos kitos yra tik tarpins j bsenos. Daugiakomponents dinamins sistemos pasiymi visais sveik bdais ir sudaro daug sudtingesnius darinius. ie pirminiai modeliai yra tiesiniai, vadinasi, jie yra idealizuoti. I tikrj visk keiia ir lemia netiesikumai. Taiau danai netiesini sudting dinamini sistem kinetikai aikinti tiesiniai modeliai yra pamatiniai, padedantys vertinti sudtingiausias situacijas.

3.11. DAUGELIO VYKSM DINAMIN SISTEMA

Tikrovje yra daug sveikaujani vyksm, danai vadinam molekuli, lsteli, organizm sveikaujaniomis populiacijomis daugiakomponentmis dinaminmis sistemomis. Tai ekologins, bioekologins, socialins, ekonomins ir kitokios ilgainiui kintamos dinamins sistemos. Jos vertinamos ir nagrinjamos sudtingais matematikos metodais, nes ios dinamins sistemos kartu yra ir netiesins. Jas tirti ir kurti manoma iuolaikinmis kompiuterijos priemonmis. Taiau sudarant sudting sistem konceptualius ir kompiuterijos modelius, tenka remtis klasikiniais tiesini sistem metodais.
133
3. Biologini vyksm kinetins organizacijos pagrindai

3.11.1. Kokybin dinamins sistemos matrica Daniausiai sveikaujani vyksm sistema yra netiesine. Ji gali bti kiekybikai apibdinta atitinkamo skaiiaus netiesini diferencialini lygi sistema, kurios lygi skaiius atitikt sistem sudarani vyksm kiek. Tada visos konkretaus momento sistemos bsenos gali bti apibdintos tiesiniu modeliu, tiesini koeficient matrica arba, vertinus tik koeficient enklus kokybine matrica Q. Jeigu nagrinjamoje sistemoje yra n dedamj, tai jos kinetikos pobdis t momento bsen gali bti atspindtas n x n tiesini koeficient ar net enkl matrica. Tokios matricos pagrindins striains koeficient ii enklai rodo pai vyksm saviveikos aktyvum tendencij (augim bei didjim, esant enklui +; majim bei nykim, esant ), o dydis ios tendencijos ireiktum. Visi kiti koeficientai ij rodo tarpusavio sveikos pobd bei ireiktum.

11 , 1i , 1 j , 1n ,

ii i1 , ii , ijij in , ,

j1 , jiji, jj , jn , jj nn , ni , nj , nn ,
Tada pagrindines daugelio vyksm dinamins sistemos savybes atspinds simetrikai pagrindins striains atvilgiu isidst tarpusavio sveikos koeficientai ij ir ji, taip pat ir atitinkami pagrindins striains koeficientai ii ir jj . Vis sistem galima pradti vertinti porini sveik deriniais, vadinant biologiniais vardais: konkurencijos ir amensalizmo, kooperacijos ir komensalizmo, plros ir parazitizmo, taip pat ir nepriklausomumo (neutralizmo). Sudtingas daugelio vyksm dinamines sistemas galima nagrinti kokybikai, vartojant kokybin matric, pasinaudojus paprast porini sveikos modeli enkl matricomis, vertinant tik tam tikr atvej tiesinio modelio koeficient enklus. Daugiakomponent enkl matric dydio n n galima skaidyti n(n 1) paprastj porini matric, kiekvienai j suteikti kokybin vard. Taip galima vertinti sveik vyravimo pakopas ir apibdinti kokybin daugelio vyksm sistemos pobd. Isamesn analiz gali bti atlikta sudarius vis tiesin diferencialini n lygi model, inoma, turint tiesini koeficient reikmes. Praktikai jie taip paprastai nenustatomi. Tipikos paprastj porini sveik matricos yra:
134
BIOFIZIKA

+ 0 + 0 konkurencijos , + + 0 0 + + 0 + amensalizmo , + 0 + mutualizmo

protokooperacijos

+ + + + 0 + + 0 + + + 0 + + + kooperacijos , + + + + + + 0 + 0 + 0 + + + +

+ 0 + + komensalizmo , + + 0 + + + 0 + + + + + + + plros ir parazitizmo , + + + + 0 + + + + + + 0 0 0 0 + neutralizmo 0 + 0 0 0 0

0 0 + .

Esant n vyksm ar populiacij dinaminei sistemai, turiniai tam tikras sambvi formas, i viso galima iskirti:
n (n 1) 2 porini sveik. Laikant, kad sveikos pobd lemia saviveikos koeficient enklai, taip pat ir nulins reikms bei j deriniai, manoma kiekybikai vertinti sudtingos dinamins sveikaujanios sistemos tos akimirkos bsen: t. y. vertinti 4 sambvi formomis, kiek yra konkurencijos, kiek kooperacijos ir kiek plros ar net neutralizmo (nepriklausomumo). Jeigu sistemoje sveikauja n vyksm, kurie tiksliai vertinti enklais (be nulini,

derini, t. y. tiek kokybikai neutralizmo vertinim), vadinasi, i viso gali bti 3 2 skirting sistem. Sistemini ri gali bti daug maiau: jos nustatomos suskaiiavus, kiek yra por kooperacijos, konkurencijos ir plros, ir irikiavus iuos tris skaiius pagal j dyd. Toki rikiavimo derini bt 3! = 6 (3.26 pav.). Kiekybikai vertin, kiek yra konkurencijos nkonkurencijos , kiek kooperacijos nkooperacijos ir kiek plros porini sveik nplrumo , ias reikmes irikiav pagal dyd (majimo kryptimi) gautume 6 irikiavimo derinius. ia nkonkurencijos + nkooperacijos + nplros = 3
n ( n 1) 2

n( n 1)

Papildomai vertinus ir nulines (0) sveik bei saviveik galimybes, galima tikslinti sudtingos dinamins sistemos kokybin vertinim, iplsti daugiau vertinimo pakop.
135
3. Biologini vyksm kinetins organizacijos pagrindai

KOOPERACIJA

KOOP>PL R>KONK

KOOP>KONK>PL R

PL R>KOOP>KONK

KONK>KOOP>PL R

PL R>KONK>KOOP PL RA

KONK>PL R>KOOP KONKURENCIJA

Pl ros sistemos

PL R > KOOP > KONK PL R > KONK > KOOP KONK > PL R > KOOP KONK > KOOP > PL R KOOP > KONK > PL R KOOP > PL R > KONK

Konkurencin s sistemos

Kooperacin s sistemos

3.26 pav. Bioekologini sistem bsenos trij sveik vyravimo erdvje

iuo atveju populiacij sveik ris reikt papildyti dar trimis sveikomis, t. y. amensalizmu, komensalizmu ir parazitizmu. Tada i viso galt bti 6! = 720 skirting sistem ri. Papildius tik neutralizmu galima turti 4! = 24 sistem ris, arba net 7! = 5040 sistem kokybini atmain vertinant dar ir amensalizmu, komensalizmu ir parazitizmu. Vertinant trij kokybini poymi konkurencijos, kooperacijos ir plros sveikas, rikiuojant pagal i poymi skaitinius dydius, galima sudaryti 6 prasmingas klini (faktorialines) bsenas. Jos grafikai parodytos 3.26 pav. Vyraujantis poymis lemia dinamins sistemos pagrindin apibdinim, antrasis dydis turi maesn reikm, o maiausi tak turi treiasis dydis. Remiantis ia seka, kiekviena vyraujanios ries sistema konkurencins, kooperacins ir plros dar gali bti dviej skirting savybi. Pavyzdiui, daugelio vyksm dinamin sistema, kurioje vertinti 5 sveikaujantys vyksmai (populiacijos), turi kokybin matric:
136
BIOFIZIKA

+ + + + + + + + + + + + +

Sistem vertinant kokybiniais vienetais ir atsivelgiant porines enkl matricas, gaunama: kooperacijos (4), > konkurencijos (3), plrumo (3). Tai kooperacij sistema, kurios konkurencins ir plros sveikos yra antrojo reikmingumo lygio. I viso joje = (5 4)/2 = 10 porini sveik. Tiriant daug kokybini poymi turini sistem, j sudtinga pavaizduoti grafikai. Akivaizdu, kad tai klini arba faktorial matematini derini procedros, kurios veikiamos matematins abstrakcijos ir kompiuterijos metodais. 3.11.2. Hierarchin ir visika plra Ypa dmesio vertos daugelio vyksm sistemos (mitybins piramids), kuriose vyrauja hierarchins plros sveikos. Hierarchinei plrai bdinga kiekvienas kitas auktesnio lygio vyksmas yra pirmesnio plrnas, o jis savo ruotu yra dar auktesnio hierarchinio lygio auka. Kokybinei matricai bdinga savita struktra, galimyb pagrindinje striainje enklus irikiuoti kaitaliojam enkl grandine:
+ 0 0 + + 0 0 0 + 0 0 0 + 0 0 0 0

0 + 0 0 0 + + 0 0 0 +

+ 0 0

0 + 0 . 0 + 0 0 +

Nesunku pastebti, kad antroji matrica, perstaius antrj eilut ir stulpel paskutinisias matricos pozicijas, tampa pirmj. Vadinsi, ji yra ta pati hierarchinio plrnavimo sistema. Tokios dinamins struktros tiesini diferencialini lygi matematinis modelis sudaryt penki lygi sistem, kurios struktrin schema pavaizduota 3.27 pav. Tarkime, vis vyksm koeficientai yra tiesiniai, j virsmai vertinami statiniais perdavimo koeficientais Hi (arba net perdavimo funkcijomis). Tada hierarchins plros sistemos perdavimo koeficientas ar funkcija turt laiptuot trupmenin form:
X1 = H1 A H1 H 2 1 H2 H3 1 H H 1 3 4 H4 H5

137
3. Biologini vyksm kinetins organizacijos pagrindai

<X5>
dX 1 dt dX 2 dt dX 3 dt dX 4 dt dX 5 dt = A + 1 X 1 1 X 2
X4(t) +

X5(t) +

<X4>

= 2 X 2 + 21 X 1 23 X 3 = + 3 X 3 + 32 X 2 34 X 4 = 4 X 4 + 43 X 3 45 X 5 = + 5 X 5 + 54 X 4
X2(t)

<X3>
+

X3(t)

<X2>
+

A +

<X1>

X1(t)

3.27 pav. Hierarchins plros sistemos matematinis modelis ir schema

I jos matyti, kaip nesunkiai bt galima didinti hierarchikum, apskaiiuojant ar modeliuojant kiekybinius poveikius. Kitokia kratutin, visikos plros sistema, sudaryta i vieno aktyvaus vyksmo aukos (producento) ir daugelio kartu su iuo vyksmu plros sveikomis susijusi vyksm, gali bti apibdinta kokybine matrica:
+ + + + + + + + + + + .

ios dinamins sistemos kokybins matricos pagrindins striains visi enklai, iskyrus vien teigiamj, yra neigiamieji. Matrica padeda nesunkiai sudaryti visos sistemos schem ir pagal j sudaryti matematin model. Panaiai, pagal bet koki kokybin matric galima sudaryti daugelio vyksm sistemos schem arba pagal schem sudaryti kokybin matric ir atitinkam tiesin matematin model. I i pavyzdi matyti, kad nebt didesni sunkum pagal kokybines matricas, pasirinkus tam tikr vyksm tiesikum, nagrinti ir kurti sudtingas daugelio vyksm sveikaujanias sistemas. Daug sudtingesns situacijos yra netiesiniais atvejais.

138
BIOFIZIKA

3.12. NETIESINS KINETIKOS MODELIAI

Aikinant sudting biologini sistem dinaminius efektus, gana danai remiamasi keliais netiesins kinetikos atvejais. Tai Lotkos ir Volteros, Turingo, Belousovo ir abotinskio bei kiti modeliai. Jie aikina daug gyvj sistem savybi, bding molekulinei biologijai, fiziologijai, ekologijai ir sociologijai. Lotkos ir Volteros modelis A. D. Lotka 1926 m., teorikai tyrindamas fermentins reakcijos kinetik, pateik chemins reakcijos su grtamuoju netiesiniu ryiu matematin kinetikos model, pritaikyt vyksm schemai:

k0 X

k1 Y

k2

i reakcija gali bti iskaidyta tam tikromis chemins kinetikos lygtimis. Jomis remiantis ir taikant veikianij masi dsn sudaroma diferencialini lygi sistema:
dX = k 0 A k1 X Y , dt dY = k1 X Y k 2 Y , dt dB = k2 Y . dt

X A
k0

X + Y k1 2Y Y k 2 B

Tarkime, itekliai A = const. yra pastovus dydis. B vyksmai atmetami, nes neturi takos pirmiesiems vyksmams. Tada dviej netiesini diferencialini lygi matematinis modelis tampa tokiu paiu, kaip 1931 m. pateiktas matematiko V. Volteros modelis, aikinantis gyvn (uv) populiacij dinamins sistemos plrnas ir auka vyksmus. Jei dinamins sistemos pradins salygos yra X(0) = X0, Y(0) = Y0, nustatomos dvi galimos stacionariosios bsenos:
dX dY = =0 dt dt

bus, kai

Xst = Yst = 0 ir X st =

k3 k A ; YYst = 1 . 2 k2
139

3. Biologini vyksm kinetins organizacijos pagrindai

ios dinamins sistemos kinetika, fazinis jos portretas gana sudtingas, priklauso nuo koeficient, ypa j enkl. Isamesnei matematinei analizei reikalingos papildomos priemons. Toki netiesini lygi sistem tyrimams jos pateikiamos bendresnio pavidalo. Klasikinis Lotkos ir Volteros dinamins sistemos matematinis modelis sudarytas i dviej netiesini diferencialini lygi. Jis panaus tiesin Puankar model, skiriasi tik netiesikumu vyksm tarpusavio sveikos ireikiamos abiej vyksm dydi X Y sandauga:
dX dt = 1 X m 1 X Y , dY = X Y m Y . 2 2 dt

ia 1 = k1 A, 1 = k2, 2 = k3, 2 = k2. Daug kur Lotkos ir Volteros modelis pateikiamas plrnas ir auka dinaminei sistemai aikinti, bet j galima taikyti ir kitoms, anksiau nagrintoms sistemoms. matematin model Voltera ityr visapusikai, vertino atuonius galimus koeficient enkl derinius. Nenagrinjo devintojo simbiozsmutualizmo derinio, nes man, kad tokia dinamin sistema gamtoje negalima (3.28 pav.). V. Voltera didiausi dmes skyr konkurencijos (7) ir ypa plros (8) sambviams aikinti (3.29 pav.). Jis parod konkurencijos sambvio balno fazin portret ir ypa pabr svyruojaniuosius plrno ir aukos sistemos vyksmus. Svyruojaniaisiais plrnas ir auka sistemos vyksmais Voltera paaikino Viduremio jros uv populiacij tankio kait. Jis visai neatkreip dmesio simbioz ir mutualizm (9), nors ir nagrinjo simbioz protokooperacij (1), pabrdamas abiej vyksm didjim.

1 A Y(t) X 1 2 Y 2 X(t)

1 2 3 4 5 6 7 8 9

1 + + + + + + + +

1 + + + + +

2 + + + +

2 + + + + +

3.28 pav. Dviej populiacij dinamini sveik Volteros modelis, vertinus tik koeficient enklus

140
BIOFIZIKA

1 1

1 1

2 2

2 2

3.29 pav. Volteros dinamins sistemos netiesikai sveikaujani populiacij modelio faziniai portretai

Apskritai, netiesinis Lotkos ir Volteros modelis turi visas tas paias kokybines savybes kaip ir tiesinis Puankar modelis. Naudojamas netiesikumas rodo neharmoninius nesinusinius ikraipytus svyravimus ir kitas, artimesnes tikrovei vyksm fazines trojektorijas. Netiesikumas, ireiktas abiej vyksm X Y sandauga ir turintis skirtingus tarpusavio saveikos koeficient enklus, rodo neigiamj plrnas ir auka sambvio grtamj ry. Netiesikumas ir neigimasis gritamasis ryys tokiai dinaminei sistemai suteikia stabilaus svyravimo galimybes. Sakoma, kad tokia sistema reguliuojasi. Lotkos ir Volteros netiesin dinamin sistema, virtusi klasikine, yra skmingai modeliuojama skaitmeniniais kompiuterijos metodais. Ji daugelyje vadovli ir program sistemose yra pateikiama kaip testinis tam tikr netiesini analizs procedr udavinys. Briuseliatorius Turingo modelis Kit sudtingesns klasikins netiesins kinetikos matematin model, turint panaius kaip ir Lotkos ir Volteros gritamuosius ryius, yra pateiks A. Turingas. iuo modeliu Tiuringas band aikinti modeliavo biologins morfogenezs vyksmus. I. Prigoinas, R. Lefevras ir G. Nikolsas (Briuselio mokykla) sukr ios netiesins dinamins sistemos fizikochemin model. Fizikocheminmis priemonmis jie modeliavo takinio (lokaliojo) Turingo matematinio modelio vyksm kinetik. Toks modelis plaiai inomas Briuseliatoriaus vardu. Briuseliatoriaus chemins kinetikos lygtis yra:
141
3. Biologini vyksm kinetins organizacijos pagrindai

A 2X +Y B+ X X

k1 k2 k4

X 3X k3 Y+D E

Kinetin schema gali bti pateikta kaip netiesin dinamin sistema, turinti grtamuosius ryius (3.30 pav.). Turingo netiesins dinamins sistemos matematinis modelis diferencialini lygi sistema:
dX 2 dt = k1 A + k 2 X Y k3 B k 4 X , dY = k X 2 Y + k B X . 2 3 dt

Kaip ir Lotkos ir Volteros plros modelyje, Turingo matematinio modelio abiejose lygtyse yra prieing enkl netiesiniai tarpusavio sveikos nariai X 2 Y, kurie ir lemia periodikai svyruojanius vyksmus. Tai atviroji dinamin sistema, kuri i D Y aplinkos teka srautas A, o i sistemos iteka srautas E. Grtamasis ryys yra sudtingas vyksmas, nes turi tarpinio proB dukto Y grand, kurio sintez i X itekli lemia pagalbiniai molekuliniai kofakE X A toriai B ir D. Todl atsiranda sudtinga netiesin grtamoji vyksm sveika. 3.30 pav. Briuseliatoriaus, arba Turingo, takinio (lokaliojo) disipatyviosios sistemos modelio kinetin Briuseliatoriaus fazinio portreto poschema bdis ir savaiminiai svyravimai parodyta 3.31 pav.

3.31 pav. Briuseliatoriaus, arba Turingo,takins (lokaliosios) disipatyviosios sistemos fazinis portretas ir savaimini svyravim pobdis

142
BIOFIZIKA

ios sudtingos netiesini diferencialini lygi sistemos sprendimai rodo, kad ji gali taip pat sukelti (generuoti) svyruojamuosius vyksmus. Ji skiriasi nuo Lotkos ir Volteros tuo, kad svyravimai nepriklauso nuo pradini salyg. Ji tokio svyravimo savybi gyja dl netiesikum, kurie grafinse schemose ireikiami kaip netiesiniai grtamieji ryiai. Belousovo ir abotinskio modelis (oregonatorius) Dar 1959 m. fizikochemikas B. P. Belousovas pastebjo, kad oksiduojant citrin rgt bromatu ir cerio jonams esant katalizatoriu, bandymais matomi periodiki spalviniai terps svyravimai, turintys apie ~100 sekundi tarpsn. Vliau, 19641974 m., vyksm isamiai ityr A. M. abotinskis. Jis pateik ir taip pat ityr ios chemins reakcijos, netiesins dinamins sistemos matematin model. Belousovo ir abotinskio savaiminio svyravimo (autosvyravim) fizikochemin sistema ireikiama chemins kinetikos lygtimis:
A+Y X +Y A+ X 2X Z k1
k2

X+P

2P k3 2 X + 2Z k4 P+ A k5 Y

arba kinetine schema, turinia grtamuosius ryius (3.32 pav.). Belousovo ir abotinskio savaimini svyravim fizikochemin sistema tai organins rgties (malono) oksidacija kalio bromatu, esant cerio, mangano arba feroino katalizatoriams. Panai fizikochemini reakcij schem R. M. Noiesas (Noyes) ir jo bendradarbiai pavadino oregonatoriumi. Matematin oregonatoriaus model sudaro trij diferencialini lygi sistema:
dX 2 dt = k1 A Y k 2 X Y + k3 A X 2k 4 X , dY = k1 A Y k 2 X Y + v k5 Z , dt dZ dt = 2k3 A X k5 Z .

Tai daug sudtingesn sistema, nei anksiau pateikti Lotkos ir Volteros bei Turingo modeliai. Ji taip pat turi udarojo pobdio fazin portret, kuris rodo periodikai svyruojanias reakcijas. Fizikocheminis oregonatoriaus modelis susideda i keliolikos stadij, vykstani homogeninje aplinkoje (cheminje stiklinje). Suprastint model sudaro trys svarbios dalys:
143
3. Biologini vyksm kinetins organizacijos pagrindai

1. HBrO2 , atliekantis tarpinio perjungiklio funkcij. 2. Br jonai, kontroliuojantys tarpinius junginius. 3. Katalizatorius Ce4+ . i medig tarpusavio netiesins dinamins sveikos ir sukelia svyruojanisias fizikochemines reakcijas. Demonstraciniuose modeliuose stebima, kaip periodikai kinta skystos terps savybs tai rgtin, tai armin. Tok vyksm lengva ir paprasta stebti spalviniais indikatoriais. i sistema yra netiesin dinamin sistema, susidedanti i trij sveikaujani dinamini dali, todl matematinis modelis atitinkamai sudarytas i trij diferencialini lygi. Ji sprendiama pritaikant tiesinius Puankar analizs metodus stacionarij bsen takams arba modeliuojant kompiuterijos priemonmis. Matematiniam dinamins sistemos modeliui pritaikius tam tikras tiesines aproksimacijas, gaunama bendroji kubins parabols lygtis:
3 c 2 + b a = 0 ,

kurios aknys, esant tam tikriems koeficient a, b, c dydiams, ir stacionariosioms bsenoms X 0, Y 0, Z 0, turi sudtinius arba net menamus sprendinius. Tai ir rodo svyruojamojo pobdio reakcijas, tokios sistemos svyravimo vyksm tikrovikum.

HBrO Z Y

Ce+4 X

BrMR

Ce Pastaraisiais deimtmeiais toki (Br) (HBrO3) savaiminio svyravimo reakcij realybe nebeabejojama. Tiesa, kuriami matek3 matiniai biologini ir ekosistem mok1 k5 k2 k4 deliai yra gana sudtingi. Matematinms lygtims sprsti ir modeliams tirti yra sukurta ir kuriama daug programini priemoni kompiuteriams. i fizikochemini savaiminio svyravimo vyksm tyrintojai taip pat pastebjo ir j bang pobdio sklidimus atitinkamoje terpje. Juos vienas pirm3.32 pav. Oregonatoriaus arba Belousovo ir abotinskio j matematikai apra A. Turingas lokaliojo kinetinio modelio schema ir svyruojamieji vykskaip disipacines (sklaidos) struktras. mai
+3

144
BIOFIZIKA

3.13. DISIPACIN STRUKTRA

domiausius fizikinius ir cheminius efektus galima sukelti kuriant netiesines dinamines sistemas, sudarytas i daugybes analogik struktr, sustatyt linijoje, ploktumoje ar trimatje erdvje ir turini tam tikrus jungiamuosius ryius. I pradi suadinami vienas ar keli disipacijos elementai. Kilus j autogeneracijai, jie iek tiek udelsus suadina aplinkinius, kurie adina kitus aplinkinius elementus ir pan. Taip, remiantis ryi geometrija, difuzikai pradeda sklisti bangos. Savaiminio svyravimo (autosvyruojamieji) vyksmai sklinda tam tikrose disipacinse struktrose. Tiuringo disipacins struktros matematinis modelis, rodantis difuzin sklidim ploktumoje, susideda i dviej bangini lygi:
dX 2 X 2 dt = k1 A + k 2 X Y k3 B k 4 X + DX r 2 , 2 dY = k X 2 Y + k B X + D Y . Y 2 3 dt r 2

is matematinis sklaidos modelis paaikina disipacini struktr susidarymo galimybes, padeda aikinti vadinamuosius savaimins organizacijos vyksmus. Sklisdamos dviej proces X ir Y bangos r erdvje (vienmatje, dvimatje ar trimatje), kuri sudaryta i tokias savaiminio svyravimo savybi turini tarpusavyje susijusi element, sukelia interferencijas. Jos ir sukelia tam tikra nevienalyt, koncentrikai, spiralikai, vairiausi rat bgani ir kintam disipacin struktr. Tokie vyksmai bdingi ne tik fizikochemijai, bet ir irdies raumens veiklai, nervinei sistemai, stebimi daugelyje gamtos ir socialini reikini. Tokias disipacines struktras galima stebti kaip cheminio oregonatoriaus vyksmus ploktumoje, augant mikrobiologinms kultroms Petri lktelje, labai panas disipacini struktr vaizdai yra matomi kerpi kolonij forma (3.33 pav.).

3.33 pav. Cheminio oregonatoriaus reverberacijos ir kerpi Paramelia centrofuga kolonija

145
3. Biologini vyksm kinetins organizacijos pagrindai

Turingas iais efektais band paaikinti biologinius morfogenezs mechanizmus. Atrodo, kad tokiais dsningumais galima paaikinti daugel biologini vyksm. Toki reikini esm netiesiniai grtamieji ryiai ir sklidimo galimybs erdvje.

3.14. KITI GRTAMIEJI RYIAI

Netiesiniai grtamieji ryiai lemia daug sudting nauj savybi, nauj kokybi atsiradim dinaminse sveikaujaniose sistemose. Jie nagrinjami daugybje vairiausi mokslini krypi laboratorijose. iais ryiai bandoma paaikinti ne vien gyvybs paslapt, savitvarks (organizavimosi) principus ir raid. Daugelio vyksm dinamins sistemos, turinios tam tikrus netiesinius grtamuosius ryius, nagrinjamos savitvarks (savaiminio organizavimosi), chaoso, fraktal bei katastrof poiriais, suteikiant joms atitinkamus vardus. Joms bdinga labai vairios, net sunkiai numatomos savybs. iuo poiriu verti dmesio molekuliniai netiesini grtamj ryi kinetiniai modeliai, nustatomi gyvosiose sistemose: autokataliz, autoinhibicija, krymin kataliz ir galim kit vairiausi sveikos derini struktros.
AUTOKATALIZ + AUTOINHIBICIJA

P
KRYMIN KATALIZ

S1

+ +

P1

S2

P2

Suprantama, vyksm kinetik galima apibdinti matematiniais modeliais. Be abejons, tai bt netiesiniai modeliai, turintys vairiausi savybi, kurios aikint nemaai biologini ir ekologini sistem ypatybi. Galima daryti ivad, kad netiesiniai dinaminiai grtamieji ryiai sudaro galimybes atsirasti naujai kokybei. i nauja kokyb ireikiama savokomis reguliacija, valdymas, kodavimas ir dekodavimas, informacija bei tikslinga veikla. Pastaraisiais deimtmeiais didelis dmesys skiriamas dinaminms sistemoms, turinioms netiesinius grtamamuosius ryius katastrof ir ypa chaoso bei fraktal sistemoms.
146
BIOFIZIKA

3.15. KATASTROFOS

Daugelio vyksm sistemos, ypa turinios netiesinius grtamuosius ryius, gyja labai keist savybi: tolydiai kintant vienam dydiui, kitas dydis kinta uolikai sukelia katastrofas. Daniausios katastrofos yra klosts ir raukls. Sudtingesni katastrof modeliai, kaip parod matematikos tyrimai, pvz., R. Tomo (Ren Thom, 19232002 ) matematin katastrof teorija, gali bti iskaidyti paprastesnes katastrofas klostes ir raukles. Vienas paprasiausi netiesikum, kuris gali padti suprasti katastrofos raukls esm, yra kubins parabols lygties analiz ir grafinis sprendinio vaizdinys, atsivelgiant dviej koeficient a ir b dydius (3.34 pav.). Nagrinjant nesudting kubins parabols lygt, keiiant du koeficientus, gaunama labai vairios dydio X priklausomybs.

x 3 x = 0 x (x 2 ) = 0
B0

A0

X(, )

3.34 pav. Katastrofa raukl ir netiesikum kaitos pobdis kintant koeficientui , kai > 0, = 0, <0

Keiiantis koeficient a ir b dydiams ir esant tam tikroms j reikmms galimos vienintels X verts, esant kitokioms dvi arba net trys skirtingos. Jei tokias savybes turinios grandys eina dinamins sistemos struktr, pavyzdiui, grtamuosius ryius, sistema sukelia naujas nelauktas kokybines savybes, tarp j ir vadinamj chaos.
147
3. Biologini vyksm kinetins organizacijos pagrindai

3.16. CHAOSO SISTEMOS IR FRAKTALAI

Dinamins apibrtos sistemos, turinios netiesinius grtamuosius ryius, rodo daugyb nelaukt ir ne visada net suprantam efekt. Vienas j chaosas (3.35 pav.). Chaosas tai neatsitiktins (determinuotos) dinamins sistemos vyksmai, kurie vyksta tarsi bt atsitiktinis reikinys, t. y. jos kintani dydi kitimas niekada nesikartoja. Jos svyravimai beveik vienodi, bet niekada nebna visikai tie patys. Esant tam tikriems dinamins sistemos parametrams, kurie ireikiami koeficientais, dinamins apibrtos sistemos nusistovi tam tikra pusiausvyra. Jos reakcijos gali nekisti bti stacionarios. Keiiant ryi koeficientus, gali atsirasti periodiki savaiminiai svyravimai autosvyravimai. Tiesini dinamini sistem atveju vyksta harmo- y niniai (sinusiniai) nekintamo periodo. Didinant netiesins dinamins sistemos grtamj ryi koeficientus ar susijusi kintamj skaii, svyravimai dvigubja, atsiranda du ir daugiau dani. Esant tam tikriems, net ir labai maai pakitusiems stabiliems koeficientams savaimini svyravim (autosvyravim) pasikartojamumas dingsta atsiranda tokie tiksliai nesikartojantys x periodiniai savaiminiai svyravimai, kurie vaa) dinami chaosu. Ypa jie bdingi daugelio vyksm netiesinms dinaminms sistemoms, kurios turi netiesinius grtamuo- x sius ryius. Paveiksle pateikta netiesins dinamins t sistemos, gyvendinanios dviej vyksm netiesin sveik pagal Diufingo matematib) n model, kurio struktroje yra kubins parabols netiesikumas (3.35 pav.): X(t) dX dt = Y , t dY = X X 3 Y + cos(t ). dt c) iuo atveju akivaizdiai matoma chaoso sis- 3.35 pav. Diufingo chaoso sistemos fazin trojektemos veikimo fazin trojektorija. Jos savai- torija, laike kintanti reakcija ir reakcijos spektras
148
BIOFIZIKA

minio svyravimo (autosvyravimo) vyksmai turi svyravim dani sudting spektrin sudt. Aiku, chaoso vyksmai bdingi tik tam tikriems koeficient dydiams. Esant kitiems koeficient dydiams, i sistema gali veikti kaip periodini autosvyravim, periodini dvigubinto danio svyravim, kvaziperiodini autosvyravim ar dar kitoki panai svyravimo vyksm generatorius. Biologini sistem poiriu svarbi chaoso sistema Lorenso (E. N. Lorenz) atraktorius, kurio matematinis modelis sukurtas sukriniams (turbulenciniams) vyksmams aikinti. Ji panai biochemini reakcij kinetikos, ekologinius populiacij bei neuron struktr vyksmus, turinius netiesinius grtamuosius ryius ir savybes. Lorenso atraktoriaus matematinis modelis yra trij diferencialini lygi netiesin sistema:
TX dX 1 = X 2 X1 , dt

dX 2 = r X1 X 2 X1 X 3 , dt dX 3 = X1 X 2 b X 3 . dt

Ji panai Lotkos ir Volteros sistem, kurios vyksmus nulemia 3 koeficientai: Tx , r ir b. Mai i koeficient pokyiai visikai keiia sistemos savybes fazin jos portret. Jei Tx = 0,1, b = 8/3, tai svarbiu chaos valdaniu parametru bna koeficientas r. Esant maoms r reikmms, bdingi stabils pagrindiniai sprendiniai periodiniai svyravimai. Taiau jei r didesnis kaip 24, 74, atsiranda nestacionarieji chaotiki svyravimai. Tada fazinis sistemos portretas bna sudarytas i daugybs apie tam tikrus 2 takus spiralikai besisukani fazini trojektorij, o sistemos kintamieji dydiai svyruoja keistu netaisyklingu, vadinamu chaosu, pobdiu (3.36 pav.). iandien keistosios chaoso sistemos traukia daugelio biolog ir kit srii gyvybs tyrintoj dmes. Per jas bandoma engti ingsn i negyvj sistem gyvybs link. Tam tikri ios srities tyrinjimai vadinami organizuotomis sistemomis. Tomo (R. Thom) katastrof teorija atsirado deimtmeiu anksiau u chaoso teorij. Dar iki chaoso teorijos atsiradimo jis aikino netiesini dinamini sistem reakcij sunkiai numatomus kokybinius pokyius labai maai pakitus parametrams. Chaoso teorija reikin vadina drugelio efektu mosteljo drugelis sparnais ir prasidjo kaln gritis. Taip aikinami staigs ir galingi biologins ar socialins evoliucijos virsmai. Chaoso sistemoms bdinga savyb keiiantis atitinkamiems parametrams, netiesini diferencialini lygi koeficientui ar koeficientams, sistemos reakcija i stacionariosios bsenos pereina savaiminio svyravimo (autosvyravimo) bsen, o dar labiau pakeitus, autosvyravimuose pastebimas danio dvigubjimas ir perjimas netvarking chaoso dinamik (3.37 pav.)
149
3. Biologini vyksm kinetins organizacijos pagrindai

30 20 10 0 10 20 30

10

15

Laikas

20

25

30

35

3.36 pav. Lorenso atraktoriaus fazinis portretas ir Y kintamojo chaoso dinamika

X
SVYRAVIMAI PUSIAUSVYRA

SVYRAVIM DVIGUBJIMAS

CHAOSAS

Laikas

3.37 pav. Netiesins dinamins sistemos vyksm raida, keiiant valdomj koeficient, pereinant chaos

Pastebtina, kad Tomo katastrof teorija, kaip ir Turingo disipacini struktr teorija, atsirado bandant paaikinti biologinius lsteli morfogenezs ir diferenciacijos reikinius, kurie ypa akivaizds ir nesuprantami nagrinjant organizmo embriogenezs vyksmus.
150
BIOFIZIKA

Nagrinjant chaoso sistem, taip pat ir kit netiesini sistem dinamik, taikant Puankar atvaizd metodika, diferencialins lygtys pakeiiamos skirtuminmis, gerai suprantamoms kompiuterijai: Xk+1 = F1(Xk, Yk, Zk), Yk+1 = F2(Xk, Yk, Zk), Zk+1 = F3 (Xk, Yk, Zk). ia Fi netiesins funkcijos. Tokiu bdu gali bti nagrinjamos ne tik daugelio kintamj, bet ir vieno kintamojo netiesins dinamins sistemos, j vyksmai. Skirtumins lygtys padeda jas sprsti kompiuterijos metodais. Todl galima sudaryti Puankar pjvius ir juos pavaizduoti. Puankar pjviai padeda n-mats kintamj fazini portret savybes nagrinti n-1 eils erdvje, sudaryti Puankar atvaizdus, kuriais remiantis aikinamos netiesins chaoso sistemos, aikinamos dinamins savybs. Visa tai atlieka specialios kompiuterijos programos. Tokiose netiesinse dinaminse struktrose bandoma velgti tam tikrus organizuot ir tarp j biologini sistem veiklos principus. ios sistemos priskiriamos prie sudting (complex) sistem klass. Akivaizdu, kad netiesiniai grtamieji ryiai jiems yra svarbiausi. Panaiomis kompiuterijos programomis gaunamos biologijai domios figros fraktalai. Fraktalas (lot. fractus susidedantis i dali, fragment) struktra. Tai tam tikra skirtumins, kaip ir chaoso, dinamins sistemos sukurta struktra, susidedanti i dali (fragment), kurie kakokiu tai poiriu yra panas vis struktr. Pagrindin fraktal savyb jie panas save. Fraktalai skirstomi geometrinius, algebrinius ir atsitiktinius (stochastinius). Fraktal krimo (generavimo) algoritmas uraomas apibendrinta skirtumine lygtimi: Zk+1 = Zk Zk + C, kur Zi ir C, bendruoju atveju kompleksiniai kintamieji dydiai, bet gali bti ir geometrins figros. Paprasiausias algebrinio fraktalo pavyzdys visiems gerai inomas binomini koeficient skaiiavimo bdas Paskalio trikampis jo krimo algoritmas. O geometrinio fraktalo Serpinskio trikampis, jo krybos taisykl (3.38 pav.). Daug geometrini fraktal panas augal formas, gyvj organizm morfogenez, lsteli struktras. Pavyzddiui, geometrinis fraktalas medis, jo formavimo kelias, labai panaus augal augimo bdus (3.39 pav.). Atrodo, kad gyvieji organizmai naudoja panaius, o gal ir tokius paius struktr auginimo ir dauginimo bdus.
151
3. Biologini vyksm kinetins organizacijos pagrindai

Paskalio trikampis
1.........................................................0; 1..1; 1 2 1..............2; 1 3 3 1.3; 1 4 6 4 1..5; 1 5 10 10 5 1..6; .....; ...n; 1
k Cn =

n! , k!( n k )!

k = 0, 1, 2, 3, , n.

Fraktalas Serpinskio trikampis

3.38 pav. Paskalio trikampis ir Serpinskio faktalas trikampis

3.39 pav. Fraktalas medis

Katastrof, chaoso sistem ir fraktal aptarti tyrim ir krybos metodai rodo, kad tokios sistemos, vadinamos sudtingomis (complex) sistemomis, turi labai daug vairiausi galimybi ir savybi. Vis j galimybi, joms sudtingjant, itirti nemanoma. Tenka iekoti tam tikr alternatyvi bd, btina atlikti tyrimus, aikinanius gyvj sistem savybes. Vienas i i bd organizuot kibernetini sistem metodai organizuot sistem teorija.
152
BIOFIZIKA

TEORINIAI ORGANIZUOT SISTEM PAGRINDAI (vadas kibernetik)

153
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

... organizuot ir gyv materij turi veikti kakokia ypatinga jga, kuri j ali, beform ir nejaudri sudlioja organik form ir sujungia Neatsivelgdami jos prigimt, toliau j vadinsime organizuojanija, arba organine, jga. ANDRIUS SNIADECKIS Organini btybi teorija, Vilnius,1804 m.

Gyvyb organizuota sistema, kuri sugeba pasiimti i aplinkos laisvj energij bei reikalingas mediagas ir palaikyti ne tik nekintam, bet net ir mainti sistemos entropij. Vadinasi, ji geba organizuotum didinti augti, daugintis ir sudtingti. Neorganizuotoms sistemoms bdingas prieingas vyksmas entropijos didjimas, t. y. organizuotumo majimas. Sudtingos disipatyviosios sistemos, kurias aikina sinergetikos ir chaoso teorijos, yra tarpins sistemos tarp neorganizuot ir organizuot. Jos rodo sugebjim tik isaugoti nekintam entropij ir organizuotum. Gyvosios sistemos engia toliau jos rodo galimyb evoliucionuoti sudtingjant, todl virsta patvarikesnmis (stabilesnmis) ir gebaniomis prisitaikyti (adaptuotis). Mokslas, aikinantis organizuotas valdomas sistemas ir funkcinius j organizacijos principus, yra kibernetika. Taip pat kaip ir fizika mokslas, aikinantis energijos virsmus, bei chemija mokslas aikinantis mediag virsmus, kibernetika yra taip pat pamatinis (fundamentalusis) mokslas aikinantis savit organizuot sistem savyb informacin valdym. Kibernetika traukia nauj pamatin vertyb informacij. Ja remdamasi kibernetika aikina funkcikai tiksling, organizuot vyksm, t. y. sistem valdym ir j organizuotumo esm.
154
BIOFIZIKA

A P L I N K A

INFORMACIJOS SRAUTAI
K O D A V I M A S

INFORMACINIO VALDYMO (ATMINTIES) STRUKTROS

INFORMACIJA
DEKODAVIMAS KODAVIMAS

D E K O D A V I M A S

A P L I N K A

ITEKLIAI

MEDIAG ir ENERGIJOS (FIZINI) VIRSM STRUKTROS

VEIKSMAI ATLIEKOS, TARA

4.1 pav. Funkcin organizuotos sistemos struktra

Organizuotos sistemos visada sudarytos i dviej visikai skirting posistemi: mediag ir energijos virsm, ir informacinio valdymo (4.1 pav.). Organizuot biologini sistem poiriu gyvyb, taip pat vis organizuot sistem vyksmus lemia mediagini vyksm dinamins sveikos. ios sveikos per kodavimo ir dekodavimo procedras gyvendina funkcikai tiksling informacin valdym. Jas gyvendina atitinkami mechanizmai. Udarojo kodavimo ir dekodavimo samprata sujungia ir logikai paaikina pagrindines kibernetikos svokas informacij, signalus, reguliavim, valdym bei funkcin tikslingum ir organizuotum. Kodavimas tai materiali (fizini) dinamini virsm ar posistemio bsen atspindjimas apibendrinta (koduota) forma stabilij bsen atminties struktroje (informacinio valdymo posistemyje) taip, kad bt galima atitinkama grtamoji dekodavimo procedra patvarij (stabilij) bsen grtamasis atspindjimas pirminio materialiojo posistemio dinaminiuose virsmuose. Udarasis kodavimas ir dekodavimas yra tiesiogiai susij su kibernetine santykins informacijos samprata. i kibernetin samprata taip pat rodo ir fizikins struktrins informacijos viet organizuotoje sistemoje ir jos kiekybinio vertinimo metod prasm. Dekodavimas gali bti suprantamas kaip sistemos valdymas informacija t. y. materialij dinamini vyksm posistemio bsenos neapibrtumo panaikinimas. iam valdomajam posistemiui suteikiama tam tikra, stabilios atminties struktroje esanios informacijos nulemta bsena. Tai ir yra funkcikai tikslinga veikla valdymas informacija arba informacinis valdymas. Udarasis kodavimas ir dekodavimas atsirado i plrnas ir auka tipo grtamojo ryio dinamins sveikos. Paprasiausia plrnas ir auka tipo dinamin sistema gali evoliucionuoti kibernetin reguliatori. Jame atsiranda vieno bito informacin udarojo kodavimo ir dekodavimo veikla. Dl to atsiranda visikai nauja, kitokia nei energi155
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

jos ar mediag virsm kokybin savyb valdymas informacija, vykdanti reguliavimo, valdymo ir koordinacijos procedras. Atsiranda tikslingas funkcionavimas mediag, energijos virsmus ir informacijos srautus nukreipianti tam tikra funkcikai prasminga, t. y. tikslinga kryptimi informacin veikla. tiksling kryptingum lemia patvarij bsen (stabilios) atminties struktroje koduota forma nustatytos konkreios bsenos, danai vadinamos programomis, projektais arba modeliais. Informacija, kuri yra nemateriali (t. y. jai netaikytinas materijos tverms dsnis), visada yra gyvendinama per materialisias struktras ir vyksmus (mediag ir energijos virsmais), kurie vadinami signalais. Signalai yra nematerialios informacijos materialieji neikliai.

4.1. UDAROJO KODAVIMO IR DEKODAVIMO SAMPRATA

Apibendrinta udarojo kodavimo ir dekodavimo esm, remiantis gyvybs painimo teorijomis, pateikta 4.2 pav. Organizuota sistema visada yra supama aplinkos realaus fizinio pasaulio, kuriame vyksta fiziniai mediag ir energijos virsmai. Akivaizdu, organizuotoje sistemoje turi bti ir specialios atspindjimo atminties struktros. Jose tikroji aplinka atspindima abstrakia modelio forma tokia, kuri pritaikyta kuo veiksmingiau atspindti ir pagal tai atlikti vairiausius veiksmus. Pagal aplinkos model, informacin koduot program sistema gali kryptingai veikti aplink ir valdyti savuosius veiksmus. Tai ir yra informacinio kodavimo ir dekodavimo bei valdymo procedros, be kuri nesuprantama jokios organizuotos sistemos veikla.

FIZINIS PASAULIS

VIRTUALUS,TARIAMASIS, INFORMACINIS PASAULIS gyvajame organizme

Fizin gamta ar biotechnologinis vyksmas

KODAVIMAS

arba koduotas fizinio vyksmo ar sistemos atspindys atmintyje PROJEKTAS-PROGRAMA fizins sistemos ar vyksmo sintezei

MODELIS

DEKODAVIMAS

4.2 pav. Udarojo kodavimo ir dekodavimo bendrosios sampratos schema

156
BIOFIZIKA

Abstrakios formos atspindiai organizuotoje sistemoje sudaro jo abstrakt, vadinam tariamuoju (virtualiuoju), simboli aplinkos pasaul, dar kitaip vadinam modeliu. Modelis, arba koduotas tikrovs atspindys, gali bti tam tikras projektasprograma, kuriuo remdamasi organizuota sistema veikia aplink. Vadinasi, kodavimas yra veiklos modelio krimas, o dekodavimas modelio iskleidimas t. y. gyvendinimas. Pateikta organizuotos sistemos schema taikytina ne tik organizmo santykiams su aplinka aikinti, bet ir organizuotos sistemos vidiniam funkcionavimui suprasti. Juk organizmo viduje taip pat vyksta daugyb biotechnologini vyksm, kurie ir yra paios sistemos funkcionavimas. Analogikai j valdymas vykdomas per vidini sistemos vyksm atspindius modelius. Juos taip pat vykdo kodavimo ir dekodavimo procedros. Organizuotoje sistemoje visada turi bti ir vidiniai paios sistemos, ir aplinkos modeliai. Be j, organizuotos sistemos funkcionavimas gana ribotas. Technins kibernetikos ir tam tikros gyvosios gamtos sistemos daugeliu atvej bna paprastesns. Jose vykdomos tik dalins kodavimo ir dekodavimo procedros: tik kodavimas, kuris gali bti sutapatinamas su klasifikacija, arba tik dekodavimas, kur galima sutapatinti su paprastu komandiniu valdymu. Bna ir labai paprastos udarojo kodavimo ir dekodavimo procedros, pavyzdiui, sistemos atitinkamo parametro dydio palaikymas pastoviu kintant aplinkai reguliavimas. Tokiu bdu kodas ir kodo samprata yra svarbi svoka aikinant organizuotas sistemas, o kodo iifravimas svarbus udavinys tiriant ir pastant ias sistemas. Kibernetika ir informacijos teorija kod aikina kaip taisykli rinkin, lentel arba algoritm, kuriuo remiantis vienos sistemos bsenos atspindimos ar perveriamos (transliuojamos) kitos sistemos bsenomis. Pavyzdiui, gyvosios gamtos, organizm biologinis ar genetinis kodas. Tai taisykli rinkinys kaip keturi simboli nukleorgi kalba uraytas organizmo biotechnologinis modelis-projektas, perraomas 20-ties simboli baltym kalb. Ms kasdienio gyvenimo akivaizdiausios kodavimo ir dekodavimo procedros yra skaiiavimo sistemos (deimtain, dvejetain, atuntain ir pan.) bei raymas, skaitymas, kalba ir pan. Klasikinje enono (C. E. Shannon) informacijos perdavimo ryio linija schemoje (4.3 pav.) kodavimas ir dekodavimas pateikiamas kaip tam tikr simboli perdavimas atviruoju ryio kanalu ar simboli raymo atmint ir atkrimo i atminties sistema. Kodavimas reikalingas tam, kad simboli signalai bt suderinti su atminties struktr ar ryio linijos savybmis. Pagrindin tokios sistemos funkcija kuo patikimiau, idealiu atveju be klaid, perduoti simbolius. ioje atvirojoje sistemoje paalinamas subjektas siuntiklis, ir subjektas primiklis, kuriems svarbi perduot simboli prasm, dar kitaip vadinama semantika. Ir todl enono informacijos teorija gan sunkiai taikoma aikinant biosistemas.
157
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

R E C E P T O R I A I

KODAVIMAS K O D E R I S

DEKODAVIMAS D E K O D E R I S

ar RYIO KANALAS

ATMINTIS

TRIUKMAS

E F F E K T O R I A I

4.3 pav. Klasikin atviroji vienkrypt kodavimo ir dekodavimo anono sistema

STABILIJ BSEN ATMINTIS, arba VALDANTYSIS POSISTEMIS (G) (Nukleorgtys)

DEKODAVIMAS

KODAVIMAS

DINAMINIAI TECHNOLOGINIAI VYKSMAI arba VALDOMASIS POSISTEMIS (Fermentins reakcijos)

(M)

4.4 pav. Udarosios kodavimo ir dekodavimo sistemos schema

Udaroji kodavimo ir dekodavimo sistema organizuota sistema. Ji sudaryta i dviej posistemi: valdomojo (M) ir valdaniojo (G) (4.4 pav.). Antrojo paskirtis yra informacin gauti, perdirbti, saugoti ir sisti informacij, taip lemti visos sistemos funkcionavimo tikslingum. Funkcin tikslingum lemia valdaniojo posistemio atmintyje esantys modeliai programos, uraytos koduota forma valdaniojo posistemio atminties struktrose. Daug aikesn kodavimo ir dekodavimo funkcin paskirtis bna sudarius udarj sistem, informacinio kanalo galais sujungus objekt. Tada informacijos kanalas gali vykdyti funkcikai tikslingus veiksmus ir tokioje sistemoje jau galima matyti funkcin informacini procedr prasm (semantik). Irykja santykins informacijos prasm ir struktrins ar fizikins informacijos svarba. Udarajai kodavimo ir
158
BIOFIZIKA

dekodavimo sistemai paaikinti reikia daug glaudiai tarpusavyje susijusi svok, kurios ne taip lengvai matomos ir suprantamos atvirojoje kodavimo ir dekodavimo sistemoje. Todl i pradi i savok esm reikia paaikinti trumpai, sistemikai, remiantis udarojo kodavimo ir dekodavimo sistemos poiriu, vliau isamiai ir nuodugniai. Santykin, arba kibernetin, informacija. Filosofin kibernetika apibria, kad jeigu vienos sistemos (posistemio) ar objekto (G) pakyiai atspindi kitos sistemos (posistemio) ar objekto (M) pokyt, galima teigti, kad pirmoji sistema-objektas (G) yra informacijos apie antrosios sistemos-objekto (M) vyksm neiklis. Sistemos-objekto (M) pokyiai, atsirad dl kitos sistemos-objekto (G) takos, yra ne iaip sistemos (M) charakteristikos, o virsta funkcionavimo veiksniu informacijos apie (G) teikju. Santykins informacijos samprata rodo kodavimo ir dekodavimo procedr organizuotose sistemose svarb. Dekodavimas tokiose sistemose vertintinas kaip paprastesnis informacinis valdymas, t. y. valdymas informacija. Dekodavimas yra informacinis valdymas veiksm ir vyksm nukreipimas tam tikra, dekoduojamos informacijos nulemta kryptimi. Tai yra vienos i daugelio galim, funkcikai tikslingos veiksm krypties irinkimas sistemos bsenos neapibrtumo mainimas ar panaikinimas. Sumajs ar panaikintas bsenos neapibrtumas ir yra perduota informacija. Jos kiek galima ireikti kiekybikai, remiantis klasikiniu struktrins informacijos kiekio nustatymo algoritmu Bolcmano ir anono formule. Struktrin (fizikin) informacija suprantama kaip sistemos bsenos neapibrtumas. Ji vertinama fizikine arba Bolcmano entropija, kartais dar vadinama ir anono informacine entropija. Santykins informacijos poiriu ji yra tik pavienio posistemio (G) arba (M) bsenos neapibrtumo vertinimas. Tokios informacijos sampratos poiriu funkcinis semantinis poiris nebtinas, vertinama simboli derini tikimybiniais dydiais. Kodavimas sudtingiausia organizuotos sistemos procedra. Kodavimo procedr metu tikrovs vyksmai atspindimi ir persiuniami ir/arba ufiksuojami tam tikrose atminties struktrose speciali simboli ir signal priemonmis. Daniausiai tam vartojamos diskreiosios struktros, turinios baigtin bsen kiek. Akivaizdiausias kodavimo pavyzdys tam tikro mogaus sukurtos kiekio vertinimo skaii kodavimo sistemos ir ypa j evoliucija (4.5 pav.). Kodavimas tai modeliavimas. Kitu poiriu kodavimas gali bti suprantamas kaip modeliavimas, nes tai yra vienos sistemos (posistemio), objekto arba vyksmo tam tikr savybi atspindjimo procedra kitoje, daniausiai abstrakiosios atminties savybi turinioje sistemoje. Modelis tai tikrovs objekto arba vyksmo kai kuri savybi atspindys, apibdintas tam tikra kodine, simboliais-signalais ireikta forma atminties struktroje. Visikai
159
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Finikiei

4.5 pav. Taut skaii kodavimo simboliai ir sistemos (palyginti su deimtaine)

160
BIOFIZIKA

Romn

Palmir

Egiptiei
Asir

Graik

Sir

organizuota sistema turi sugebti kurti modelius ir pagal juos valdyti, t. y. vyksmus, veiksmus nukreipti tam tikra, funkcikai tikslinga kryptimi. iuo poiriu modelis gali bti tikslingos veiklos programa ir projektas. Funkcinis tikslingumas savita organizuotos sistemos savyb derinti pavieni proces vyksmus tam tikru laiku ir erdvje taip, kad bt kuo tiksliau gyvendinami modeliai-programos. Kitu poiriu veikti entropijos mainimo (arba organizuotumo didinimo) kryptimi. Funkcin tikslingum rodo organizuot gyvj sistem anatomija ir morfologija visiems organams, organelms ir j dalims bdinga funkcikai tikslinga paskirtis, kuri nulemia j form ir viet organizme.

4.2. KODO SAMPRATA

Kaip jau rayta, kodas, kodavimas ir dekodavimas lengviausiai suprantamas kiekio arba skaii iraikos pavyzdiu. Kiekio kodavimas ir dekodavimas parodytas 4.6 paveiksle. Kaip matyti, vienas, du arba trys konkrets objektai (paukiukai, gils ar glyts) tikroviki objektai, esantys realiajame posistemyje (M), atspindimi atminties struktroje (G) kaip bendra kiekio savyb paenklinti simboliais I, II, III. Dekoduojant (iifruojant), simboliai jau gali reikti ne tik paukiukus, giles, ar glytes, bet vertins ir kitoki objekt kiek (skaii). Atsiranda abstrakti svoka kiekis. Toks abstraktus savybs atspindys atminties struktroje (G) yra modelis. Esant dekodavimo, t. y. grtamojo atspindjimo atminties struktros (G) modelio atspindjimo tikrovs posistemyje (M) galimybei is modelis atlieka kodavimo funkcij. Atsivelgdama j, organizuota sistema gali pasirinkti veiksm, kuris priklauso nuo tam tikr esam objekt rinkinio ir kiekio. Kodavimo ir dekodavimo procedr metu visada yra kodo elementai. Kodo elementai. Pagrindiniai kodo elementai yra simboliai ir padtys (pozicijos). Kiekio arba skaii kodavimas, jo simboliai, padtys ir j prasm tai skaiiavimo ar skaii ireikimas organizuotose sistemose. Pavyzdiui, iuo metu populiariausia deimtain kodavimo (arba skaiiavimo) sistema vartoja 10 simboli (0, 1, 2, 3, 4, 5, 6, 7, 8, 9). Nuo ireikiamo kiekio-skaiiaus priklauso ir padtys (pozicijos): skaiiams iki 10-ties viena padtis (0 9), iki 100-to dvi padtys (00 99), iki 1000 tris ir pan. Taiau ne visada abstrakti svoka kiekis buvo koduojama deimtaine (remiantis deimties rank pirt kompiuteriu) sistema. Atrodo, senieji frankai ir actekai naudojo 20-tain skaiiavimo sistem (simboliais vartojo ne tik rank, bet ir koj pirtus), kompiuteriai ir kompiuterininkai (programuotojai) vartoja dvejetain, atuntain, e161
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

ioliktain sistemas. Ir dabar dar taikoma romn skaiiavimo sistema, kuri vartoja septynis simbolius (I, V, X, L, C, D, M). Pavyzdiui, 100-ajam ireikti pakanka vieno simbolio ir vienos padties C, o 1000-ties simbolio M. Taiau skaiiui atuoni ireikti reikia net 4 padi (VIII). Kiekio kodavimo ir ymjimo raida tarp tam tikr taut buvo gan vairi. Ji parodyta 4.5 pav. Koduojamos ne tik kiekio svokos. Rayba ir raymas taip pat yra kodavimas, vartojami tam tikri simboliai ir padtys. Daugiausia (bet ne visada) rayba modeliuoja moni informacijos perdavimo ir primimo, bendravimo kodavimo ir dekodavimo priemon kalb. iam tikslui Europos tautos vartoja keli deimi simboli (raidi ir skiriamj enkl) rinkin, ir informacij urao arba perduoda dideliu kiekiu padi (pozicij). Taiau Ryt kultros kinai, japonai turi labai daug tkstan-

ABSTRAKIOJO ATSPINDJIMO ATMINTIES STRUKTRA perduodanti I N F O R M A C I J 1 I I III

KODAVIMAS

DEKODAVIMAS

TIKRASIS POSISTEMIS

4.6 pav. Skaii kodavimas ir dekodavimas organizuotoje sistemoje

162
BIOFIZIKA

ius simboli (hieroglif). T pai informacij jie gali perduoti vartodami daug maiau padi (plonesnmis knygomis). Kodavim ir dekodavim taip pat vartoja net ir paios primityviausios gyvybs formos. Biologijos specialistai neabejoja genetiniu kodavimu, kurio pirmin kod eina 4 simboliai (A, G, C, T, arba A, G, C, U). mogaus genomas genetin informacija taip pat ukoduota 4 simboli kalba ir sudaro apie 3,2 milijardus padi (tiek azotini bazi por ireikta mogaus biotechnologijos genetin programa, arba gamybos projektas). Gyvj lsteli vyksmai daniausiai susij su transliacijos procedra. Tai yra informacin dekodavimo procedra. Informacija, ukoduota 4 simboli kodavimo sistemoje, perkoduojama (transliuojama) 20 simboli vykdanij struktr (aminorgi, baltym) kodavimo sistem. Daugialsiuose organizmuose, be genetinio kodavimo, dar yra auktesnio lygio kodavimo procedros. ie organizmai vartoja savitus simbolius. Jie gyvendinti specialiais signalais hormonais, feromonais, o gyvn dar ir neuron tinklais. Niekam nekyla abejoni, kad nerv sistema, kaip kompiuteri ir ryi kanaluose, funkcionuoja daug lanksi ir greit informacijos kodavimo ir dekodavimo procedr. Jos kol kas dar yra apgaubtos paslaptimis ir yra nesuprastos. Visos organizuotos sistemos, kuriose vyksta informacins kodavimo ir dekodavimo procedros, vartoja vairiausius kodus, specialias kodavimo ir dekodavimo sistemas, turinias savo simbolius ir padtis. Tikrovje egzistuojanios biologins ir socialins sistemos vartoja labai sudtingas, sunkiai matomas kodavimo procedras. Jas lengviau yra suprasti pasinaudojus mogaus sukurtomis techninmis sistemomis. Vliau, pritaikius analogij kodavimo ir dekodavimo metodus, galima aikinti gyvj organizm analogik funkcij veikl. Organizuota sistema, kurioje darniai veikia kodavimo ir dekodavimo procedros, taip pat yra ir kibernetin valdoma sistema. Jos valdantysis posistemis turi bti sudarytas i daug speciali informacij perdirbani struktrini grandi, sudarani darniai ir funkcikai tikslingai veikiant valdantj posistem.

4.3. ORGANIZUOTA VALDOMA SISTEMA

Visos organizuotos sistemos veikia funkcikai tikslingai. Todl jos valdaniojo posistemio atminties struktroje koduota forma turi bti rayti veiklos tikslai (4.7 pav.). Valdymas ir organizuotos sistemos tikslai neatsiejamos svokos. Valdantysis posistemis, kurio funkcin paskirtis yra efektyviai perdirbti informacij ir j panaudoti valdymui, turi sugebti:
163
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

gauti informacij apie aplink ir kurti informacin aplinkos model; turti informacij apie visos sistemos galimybes ir gauti informacij apie vidin sistemos bsen, t. y. turi sugebti kurti paios savs informacin model; kurti informacinius tiksl siekimo veiklos planus modelius; nusprsti, kada, kokiomis aplinkybmis ir kokius veiksmus atlikti; nusprsti, kada, kokiomis aplinkybmis ir koki informacij sisti aplink.

A P L I N K A

ORGANIZUOTA SISTEMA
TIKSLAI Informacija apie aplink Siuniama informacija aplinkai

VALDANTYSIS POSISTEMIS DAN


A P L I N K A ITEKLIAI Informacija vykdymui Informacija apie vidin sistemos bsen

A P L I N K

INFORMACIJOS PERDIRBIMAS

VAL VALDOMASIS POSISTEMIS

B S E N O S

1 i n

MEDIAG ir ENERGIJOS VIRSM POSISTEMIS

VEIKSMAI ATLIEKOS TARA

ATSITIKTINIAI POVEIKIAI

4.7 pav. Organizuotos sistemos informacinio valdymo schema receptoriai, sensoriai, jutikliai, pirminiai koderiai, efektoriai, dekoderiai, bsen jungiklis, arba vykdantysis dekoderis

164
BIOFIZIKA

Akivaizdu, kad organizuota sistema turi bent dvi, tarpusavyje susijusias udarojo kodavimo ir dekodavimo struktras: vidin, kuri vertina ir valdo pati save, ir iorin, kuri vertina aplink ir valdo (koordinuoja) savus veiksmus aplinkos atvilgiu. Realybje visos sistemos yra veikiamos atsitiktini poveiki , kurie trukdo sistemai siekti tiksl. Kovai su trukdiais organizuotoje sistemoje taip pat yra specialios priemons. Daniausiai tam vartojama informacija, gaunama per grtamuosius ryius. Grtamj ryi informacija gaunama per specialiuosius jutiklius (receptorius, sensorius) ir atitinkamus koderius, o grtamj reakcij atlieka vykdaniosios grandys efektoriai. Jutikliai, receptoriai, sensoriai kodavimo ir dekodavimo poiriu yra pirminiai koderiai, o efektoriai, dekoderiai. Vykdantysis arba valdomasis posistemis, dar kitaip vadintinas mediag ir energijos virsm posistemiu, turi sugebti pasiimti iteklius i aplinkos ir juos nukreipti funkcikai tikslingos veiklos kryptimi bti valdomas. Sakoma, valdomajame posistemyje itekliai kryptingai, nukreipiami funkcikai tikslingai, yra valdomi. Valdomajam posistemiui specialiomis vykdanij struktr priemonmis suteikiama tam tikra vykdymo bsena. Vykdantieji posistemiai yra nestabils, nes yra veikiami atsitiktini poveiki ir j bsenos gali priimti bet koki tolydiai kintam bsen. Todl valdantysis posistemis, galintis priimti patvarias (stabilias) diskreisias bsenas, dl valdanij signal ir grtamojo ryio informacijos sugeba vis organizuot sistem valdyti tiksliai suteikti sistemai stabili, funkcikai tiksling bsen. Paprasiausia organizuota kodavim ir dekodavim vykdanti sistema, turinti tik dvi bsenas ir atliekanti konkrei tiksling funkcij specialaus sistemos parametro dydio stabilizavim, yra reguliatorius. Jis kildintinas i biologijoje gerai inomos, save reguliuojanios plrnas ir auka sveik dinamins sistemos.

4.4. REGULIATORIUS PAPRASIAUSIA KODAVIMO IR DEKODAVIMO SISTEMA

Dinamin plrnas ir auka sistem biologai ir ekologai danai vadina reguliuojanija sistema. Sakoma, plrnas yra reguliatorius, platesne samprata valdytojas. Kaip rayta anksiau, tokia tikrovs sistema yra netiesin ir turi neigiamj grtamj ryi. Ji sudaryta i dviej glaudiai sveikaujani posistemi ar grandi: aukos ar producento, kuriam bdinga teigiamoji saviveika, veiksmingas didjimas, augimas, dauginimasis, ir plrno, kuris minta auka producentu. Plrnas sukelia aukai nei165
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

giamj grtamj poveik plrno kiekiui didjant, aukos kiekis mainamas. Kintant tam tikriems ios dinamins sistemos koeficientams, plrnas ir auka sistema virsta reguliatoriumi, kurio valdantysis informacinis posistemis perdirba apie vien bit informacijos, arba kitaip sakant, virsta paprasta udarojo kodavimo ir dekodavimo sistema, vartojania du simbolius +, reikiant aukos augim didinti, ir , aukos augim mainti. 4.4.1. Dinamin sveika plrnas ir auka reguliuoja Sveikaujani dinamini sistem teorija rodo, kad keiiantis saviveikos ir tarpusavio sveikos koeficientams, keiiasi ir visos sistemos veikla. Biologini organizuot sistem poiriu ypa domi plrnas ir auka dinamins sistemos raida kibernetinio reguliatoriaus link. Plrno grandis gali virsti reguliuojania arba informacij perdirbania grandimi, neigiamuoju grtamuoju ryiu apkabinania reguliuojamj objekt auk. Plrnas ir auka dinamins sveikos tiesinis Puankar matematinis modelis gali bti ireiktas dviej tiesini diferencialini lygi sistema (4.8 pav.):
dX (t ) = A + + 1 X (t ) 1 Y (t ), dt , dY (t ) = + 2 [ X (t ) X 0 ] 2 Y (t ) , dt

kur X(t) aukos, o Y(t) plrno kiekio ar tankio kitimo funkcijos, o

X0 Pl r nas X(t) X0 dX (t ) = A + + 1 X (t ) 1 Y (t ), dt , dY (t ) = + 2 [ X (t ) X 0 ] 2 Y (t ) AUKA ar PRODUCENTAS dt ITEKLIAI A Y(t) X'(t)

dX (t ) = A + + 1 X (t ) 1 Y (t ) dt

X(t)

Atsitiktiniai poveikiai

4.8 pav. Plrnas ir auka dinamins sistemos schema

166
BIOFIZIKA

1, 2 1, 2 A X0

didjimo ar saviveikos koeficientai; tarpusavio sveikos koeficientai; aukos, ar producento, i aplinkos imami iekliai; atsitiktiniai poveikiai; poveikis plrnui ar slenksio, jautrumo dydis.

Nagrinjant ios dinamins sistemos raid, saviveikos koeficientus reikia ireikti per inertikum, eksponentini reakcij laiko pastovisias, t. y. pakeisti T1 = 1/1, T2 = 1/2. Jei 2 , tada T2 0. Jeigu T1 >> T2 , pasirinkus T2 0, plrno lygtis gali bti paprasta algebrin. Tada:
0 = + 2T2 [ X (t ) X 0 ] Y (t ) ,

ir plrnas ir auka dinamins sistemos matematinis modelis supaprastja:


dX (t ) = ( A + ) T1 + X (t ) 1T1 Y (t ), , dt , Y (t ) = + 2T2 [ X (t ) X 0 ] T1

o aukos ar producento dinaminis modelis ireikiamas viena pirmosios eils diferencialine lygtimi:
dX (t ) = ( A + ) T1 + X (t ) 1T1 2T2 [ X (t ) X 0 ] , dt kuri sutvarkius gaunama: T1
T1 dX T1 TT = ( A + ) X + 1 2 1 2 X 0 . 1 + 1 2T1T2 dt 1 + 1 2 T1T2 1 + 1 2T1T2

I ios nehomogenins pirmosios eils diferencialins lygties matyti, kad producento reakcijos X(t) staigius uolikus poveikius bus eksponentins, kuri laiko pastovioji:
T=

T1 1 + 1 2T1T2

dX o stacionariosios, nusistovjusios bsenos, kai = 0, X(t)~ = Xst , ir bus ireikta dt lygtimi:

X st = X 0

1 1 + 1 2T1T2

X0 +

T1 1 + 1 2 T1T2

( A + ).

Jei 1 + 1 2T1T2 +, tai pasiekiama didinant tarpusavio sveikos koeficientus 1 ir 2, dinamin plrnas ir auka sistema pavirsta reguliatoriumi, t. y. palaiko aukos ar producento dyd beveik pastovaus dydio, X(t) ~= X0, kintant aplinkos slygoms A ir .
167
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Kaip matyti i isamesns sistemos reakcijos lygties, toks reguliavimas neigiamuoju grtamuoju ryiu visada turi dviej prieasi paklaidas: statin, kuri lemia uduotas dydis X0 ir aplinkos poveikiai A ir . Taiau visada paklaidos gali bti sumaintos iki reikiamo dydio, didinant tarpusavio saviveikos koeficientus 1 ir 2. iuo principu veikia kibernetikos technikoje naudojami statiniai reguliatoriai, pavyzdiui, termostatai. Sudtingesniems astatiniams reguliatoriams statins paklaidos nebdingos. Tai yra idealizuotas tiesinis reguliavimo modelis. Gamtai bdingos rykiai netiesins sistemos, panaios Lotkos ir Volteros modelius. Reguliacines jo savybes rodo udarieji faziniai portretai rodo svyruojamj reakcijos pobd. Netiesikumai per grtamj ry suteikia galimyb sistemos bsenas keisti: aukos X kiek (dyd) mainti, kai plrno Y atsiranda daug, ir X didinti, kai plrno Y labai sumaja. Taip nepertraukiamai grtamuoju ryiu keiiant bsenas techninse reguliavimo sistemose specialiais slenkstiniais (rli) elementais palaikomas norimas, reikalingas X0 dydis vyksta reguliavimas arba stabilizavimas. Reguliavimo sistemos grtamojo ryio kanal galima vertinti kaip informacijos kanal, arba paprasiausi informacin procesori, kuriame veikia dviej simboli kodavimo ir dekodavimo kaita. 4.4.2. Kibernetinis reguliatorius kaip informacijos grandin kanalas Kibernetinis reguliatorius bendruoju atveju yra netiesin sistema. Jos grtamojo ryio grandinje daniausiai bna bent vienas netiesinis slenkstinis rels elementas (4.9 pav.).

TIKSLAS X0
INFORMACIJOS KANALAS

~1/K0

K0 Y(t) ITEKLIAI A +

X0 X

K 1+sT

~K0
R X(t)

0 X0

Atsitiktiniai poveikiai

4.9 pav. Statinio reguliatoriaus funkcin schema ir fazinis jo portretas

168
BIOFIZIKA

Matematinis kibernetinio reguliatoriaus modelis turi identik iraik kaip ir plrnas ir auka dinamin sistema. Informacin (plrno) grtamojo ryio grandin galima vertinti kaip informacin procesori, informacijos kanal. vertinant skirtum X0 X(t), receptoriumi R vertinamas reguliuojamas dydis X(t) ir jis palyginamas su tikslo dydiu X0. Kaitaliojant reguliuojamojo objekto bsenas reliniu perjungikliu , itekliai A nukreipiami didinimo kryptimi, jeigu X < X0 , arba X mainimo kryptimi, jeigu X > X0. Norimas tikslumas pasiekiamas didinant informacijos kanalo jautrum didinant K0. Taip reguliuojamas X dydis, stabilizuojamas ties ~X0 lygiu. Statinio reguliatoriaus matematinis modelis yra:
T1 dX (t ) = K ( A + ) X (t ) + {Y (t )} dt Y (t ) = K 0 [ X 0 X (t )],

o astatinio, kurio grtamojo ryio grandyje yra integratorius:


T1 dX (t ) = K ( A + ) X (t ) + {Y (t )} dt

Y (t ) = K 01 [ X 0 X (t )] + K 02 [ X 0 X (t )]dt ,

kur slenkstin (relin) valdym vykdanti grandis atlieka reguliuojamo objekto bsen kaitos funkcij.
{Y } =
1, kai Y < 0 + 1, kai Y > 0,

Astatinis reguliatorius nuo statinio skiriasi tik tuo, kad grtamojo ryio grandinje papildomai turdamas integruojani struktr, didina funkcionavimo tikslum reguliuoja be statini paklaid. Kibernetinis reguliatorius yra akivaizdus pavyzdys, demonstruojantis paprasiausi informacin valdymo (reguliavimo) veikl, siekiant tikslo: X(t) = const. = X0. Informacijos funkcij atlieka grtamojo ryio grandin. J sudaro trys dedamosios: R receptorius, jutiklis arba pirminis koderis; X lyginimo su tikslo dydiu X0, arba sprendim grandis, procesorius; ir vykdanti grandis arba efektorius (dekoderis), nukreipiantis iteklius A X didinimo, kai X < X0 ir X mainimo, kai X > X0, kryptimis. Taip mainama sistemos neapibrtumo bsena, arba kitaip sakant sistema vykdo paprasiausi valdym reguliuoja.
169
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Receptorius R arba pirmin koderio grandis vertina (pamatuoja) reguliuojamj dyd X(t). J paveria tokiu fiziniu dydiu signalu, kuris bt priimtinas tolesniam signaliniam informacijos perdirbikliui procesoriui. Reguliatoriaus procesorius lygina tikslo dyd X0 su atsistu i R signalu, daniausiai iekoma skirtumo Y(t) = X0 X(t). Patikimumo ir tikslumo sumetimais skirtumo signalas K0 kart sustiprinamas ir pagal Y(t) enklo pasikeitim, neatsivelgiant funkcijos pobd, dekoderiu {K0Y(t)} sistemos bsen perjunginja taip, kad itekliai bt nukreipiami pagal reguliatoriaus tikslo funkcijos reikalavimus. Tai yra, X didinimo kryptimi, jeigu skirtumas neigiamas, ir X mainimo kryptimi, jeigu skirtumas teigiamas. Statinio reguliatoriaus veikla parodyta 4.10 pav. Matyti, kad informacin grtamojo ryio grandin (informacijos kanalas) valdo objekt ar valdomj mediag ir energijos virsm posistem, kurio perdavimo funkcija yra pirmosios eils inertin grandis, ar- Y ba operacin jos perdavimo funkcija yra:
K (s ) = K , (1 + sT )
+ 0

ia s Laplaso operatorius (s = + j) (r. p. 200). Tokios funkcins organizacijos reguliatorius, kaitaliodamas bsen, suteikia sistemai vien i dviej galim bsen, kurios atitinka kodavimo simbolius + ir . Tai nulemia, kad X(t) eksponentikai svyruoja apie tikslo X0 dyd. X(t) nuokryp nuo tikslo dydio X0 galima kiek norima sumainti, didinant K0. Kitaip sakant, didinant grtamojo ryio jautrum. Paklaida ~1/K0. Informacin grandin, reguliuodama grtamuoju informaciniu ryiu, vis laik stengiasi mainti sistemos neapibrtum dviej bsen dekoduojamja priemone: didinant X, kai Y = []; mainant X, kai Y = [+]. Jeigu sumins mainimo ir didinimo trukms lygios, vadinasi, bsen tikimybs yra lygios. Tokiu atveju laikoma, informacin grandis perdirba 1 bit informacijos. Vieno, ar ~1 bito informacijos pakanka atlikti paprasiausi valdym reguliavim, siekiant tikslo sistemos atitinkamo parametro dydio palaikymo pastovaus didumo X0 kintant aplinkos slygoms. Kitaip sakant, dyd (parametr) stabilizuoja.
170
BIOFIZIKA

(Y)

X0 _

diS/dt

X0

4.10 pav. Statinio reguliatoriaus funkcionavimo diagramos

4.4.3. Reguliatorius disipatyvioji sistema Reguliatori vertinant termodinamikos poiriu, nesunkiai galima pastebti, kad jam bdingas Prigoino principas. Jis teigia, kad:
di S dt min,

t. y. atvirosios termodinamins sistemos entropijos prieaugis natraliomis slygomis mainamas iki minimumo (4.10 pav.). Vadinasi, sistema keiiasi slinkdama stacionariosios bsenos kryptimi, juda tokios bsenos link, kurioje naudoja maiausiai laisvosios energijos, t. y. vyksta maiausia disipacija (energijos sklaida). Galima sakyti, kad sistema, kaip rieda akmuo nuo kalno, ieko optimaliausios energins bsenos, optimaliausiu keliu rieda galim makroenergijos duob. Disipacinius reguliatoriaus vyksmus galima suprasti, matuotuojant reguliatoriaus sunaudojamus iteklius, tiksliau matuojant imam itekli gali, sistemos parametro dydiui X nukrypstant nuo tikslo dydio X0. Aiku, maiausiai sunaudojama itekli bus tuo atveju, kai X = X0, nes esant tokiai bsenai, pavyzdiui, termostato, nereiks nei ildyti, nei aldyti, nereiks naudoti papildomos laisvosios energijos ildytuvui ar aldymo kompresoriui. Taiau X dydiui nukrypus nuo X0 reikms, nesvarbu kuri pus, reiks naudoti papildomus iteklius dydiui X0 atkurti. Bendruoju atveju, juo bus didesnis nukrypimas, juo daugiau reiks papildomos laisvosios energijos. Reguliuojamasis grtamasis ryys sukurs disipacin energins sklaidos duobs formos funkcij, kuri visada reguliatorius rieds savaime kaip atvirosios termodinamins sistemos stacionarij bsen. Kibernetikos poiriu i bsena ir yra organizuotos sistemos reguliatoriaus tikslas. Vertinant reguliatori disipatyvijs sistem teorijos poiriu, galima sakyti, tai makrosistema, sudaranti galimas energini bsen duobes bei utvaras (barjerus) norimose vietose ir norim dydi. Jos priklauso nuo grtamojo ryio informacijos kanalo procesoriaus atliekam Y = f (X) funkcij. Jei jo atliekama funkcija yra z ties, kaip parodyta 4.10 pav., tai bus tik viena galima duob take X0. Jeigu funkcija bus netiesin ir ji kirs X a daugel kart, t. y. funkcija turs daug reali akn, tai tose vietose, kur ais X bus kertama i + , X didjimo kryptimi, t. y. turs neigiamj ivestins enkl, susidarys patvarios (stabilios) duobs. Ten, kur kirtimai bus i + pereinant , turini teigiamj ivestin, bus nestabilios bsenos galimos utvaros (barjerai). Utvaros dyd lems netiesins funkcijos koeficientai. Tokiais atvejais sistema, turinti netiesini grtamj ryi, turs ne vien, bet daugel stabilij bsen. Taip galima formuoti sudting disipatyvij sistem, atitinkamai parinkus netiesin grtamojo ryio funkcij procesoriui, specialiai sudarius grtamj informacijos kanal.
171
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

4.4.4. Reguliatorius paprasiausia organizuota sistema Kaip buvo parodyta, dinamin sistema reguliatorius palaiko pastov reguliuojam dyd X = const. = X0 veikiant sistem tam tikrais poveikiais, perdirbant ~1 bit informacijos grtamojo ryio grandinje. Vadinasi, reguliatorius yra organizuota sistema, nes jame informacija valdo itekli (energijos) naudojim tikslingai veiklai. Tokia sistema, bdama vairiausi bsen, sugeba iteklius nukreipti tikslui siekti reikiama kryptimi. Reguliatorius yra sistema, sudaryta i dviej, organizuotai sistemai btin sudedamj dali posistemi: informacins (G), kuri perdirba informacij ir valdo, bei mediag ir energijos virsm (M), kuri yra valdoma. Kartu reguliatorius yra kodavimo ir dekodavimo sistema, turinti akivaizdi semantin dviej simboli valdymo struktr. Tai paprasiausia organizuota sistema, nes statinis reguliatorius, turintis dvi alternatyvias bsenas, perdirba maiausi informacijos kiek. Bendruoju atveju perdirba maiau kaip 1 bit informacijos, nes tikrovs aplinkybmis retai kada bna, kad abi reguliuojamojo objekto bsenos turt lygias tikimybes. Reguliatorius yra labai patogus pavyzdys aikinti santykin ir struktrin informacij. Taip pat labai paprastai galima paaikinti bsen ir bito reikm (semantik). Viena bsena reikia reguliuojamj dyd reikia didinti, kita reguliuojamj dyd reikia mainti. Reguliatoriaus pavyzdyje akivaizdiai matomas funkcinis tikslas. Yra aiki informacijos vieno bito funkcin prasm semantika. Taip pat aikus kodavimas kaip sistemos bsenos vertinimas, ir dekodavimas kaip sistemai suteikimas reikiamos bsenos, siekiant tikslo. Suprantama ir klasikins termodinamikos minimalios disipacijos Prigoino princip apibdinanti charakteristika. Vadinasi, paprasiausia organizuota sistema reguliatorius yra patogus pavyzdys pradedant nagrinti naujus, daug sudtingesnius biologini organizuot sistem informacinio valdymo principus, juos vykdanias struktras, informacijos ir valdymo sampratas.

4.5. INFORMACIJA REIKALINGA VALDYMUI

Organizuot sistem mokslas kibernetika teigia, kad informacija reikalinga valdymui, t. y. mediag, energijos virsmams ir informacijos srautams nukreipti reikiamu momentu reikiama kryptimi taip, kad bt gyvendintas sistemos valdymo posistemio nustatytas tikslas ir programa (algoritmas). Sistem teorijos poiriu tai yra valdymas informacija, dekodavimu. Informacijos svoka yra daugiausia sunkum ir nesusipratim kelianti pamatin mokslo vertyb. Ji yra neatsiejamai susijusi su gyvybs esme, todl j btina vertinti tam tikrais poiriais.
172
BIOFIZIKA

Informacija, dekodavimas, valdymas pagrindins neatskiriamos, vienos kitas pildanios svokos. Be j, nemanoma paaikinti funkcins organizuot sistem struktros. Tiesa, ios svokos nevis moksl apibriamos vienprasmikai. Informatika teigia, kad svoka informacija kilusi i lot. informatio ir veriama lietuvi kalb susipainimas, iaikinimas, vaizdinys, svoka. Nors dar Aristotelio gr. % %# (idjos, idja) forma jau reik idj ireikt materijos forma in forma reik informacij. Labai danai odio informacija samprata painiojama su odio inios samprata. Klaidinamai laikoma, kad tai yra sinonimai odiai, turintys t pai prasm. Susidarant informacinei visuomenei, sitvirtinant moksliniam mstymui, informatikos ir kibernetikos svokoms, informacij reikia apibrti tiksliau. Informacija suprantama kaip logikas ini rinkinys, kaip inojimas inios, sudarytos tam tikra tvarka ir padedanios suprasti, pamatyti keli, kaip pasiekti tiksl. inios, sugrupuotos tam tikr tikslingai logik grandin, kitaip vadinamos programa ar projektu. Dar kitaip visa tai gali bti vadinama panaikintu neapibrtumu. Tai ir yra informacija. Apibriant informacijos ar informacin visuomen industrijos poiriu teigiama, kad informacijos visuomens itekliai, aliavos yra inios, o gaminys (produkcija) informacija. iuo poiriu enciklopedija yra tik inios, o sumanymai (projektai), programos jau yra informacija, nes maina ar panaikina neapibrtum, siekiant tikslo. Informacijos svoka visada glaudiai ir neatsiejamai susijusi su tikslo ir valdymo svokomis, t. y. kibernetikos ir organizuot sistem pagrindine vertybe. 4.5.1. Informacijos istorija Informacija, kaip ir kitos pamatins mokslo vertybins, svokos fizikos energija ar chemijos mediaga pradjo formuotis XX imtmeio pradioje, atsirandant kiekybinio jos vertinimo metodikoms, sprendiant technikos ryi klausimus. Tiesa, pirmj kiekybinio informacijos vertinimo algoritm pateik dar 1872 m. L. Bolcmanas. Tai buvo energins entropijos lygtis, kuria buvo vertinamas fizikins termodinamins sistemos energins bsenos neapibrtumas. Kit kiekybin informacijos vertinim 1918 m. pateik statistikas R. A. Fieris kaip bandymo duomen teikiam informacijos kiek. 1929 m. Bolcmano entropij iplt fizikas L. Szilrdas (Le Szilrd, 18981964), iekodamas kreivs vertinimo maiausio matavim kiekio. 1928 m. in. R. V. L. Hartleyus (Ralph Vinton Lyon Hartley, 18881970) Belo kompanijos leidiamame urnale publikavo straipsn Informacijos perdavimas, kuris pradjo informacijos teorijos pradi. Taiau tradicin informacijos teorijos pradia laikoma 19481949 m., kai tos paios kompanijos urnale buvo atspausdinta C. E. enono su bendraautoriais straipsniai matematins komunikacij ryi
173
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

teorijos klausimais. Tais paiais, 1948, metais informacij, kaip pagrindin kibernetikos mokslo vertyb valdymo sistemose, pagrind matematikas N. Vyneris. inoma, net ir ie mokslo darbai nra patys pirmieji. Dar 1922 m. D. R. Karsonas (J. C. Carson) skelb teorin darb apie elektrini signal moduliacijos metodus, kuriame pastebjo, kad yra ryys tarp dani juostos ir perduodamos informacijos greiio. O 1924 m. du mokslininkai JAV H. Naikvistas (Harry Nyquist) ir Europoje K. Kupfmuleris (Karl Kpfmller) tyrinj telegrafini siunt greit ryio linijose, pastebjo, kad is greitis tiesiai proporcingas linijos pralaidumo dani juostai. Antrojo pasaulinio karo metais vis kariaujani valstybi mokslininkai ininieriai, kurdami atskirai karinio ryio prietaisus, nagrinjo panaius informacijos teorijos klausimus. J laimjimai mokslo spaudoje pasirod tik po karo. Dar 1941 m. V. R. Benetas (W. R. Bennett) publikavo signal diskretizavimo btinj slyg. Pamintina ruso V. A. Kotelnikovo signal diskretizacijos teorema. Ji yra tiesiogiai susijusi su Naikvisto daniu bei Vynerio ir anono signal diskretizavimo teorema. Ryi (komunikacij) teorijos pradia galima bt laikyti Nobelio premijos laureato, holografijos idjos autoriaus D. Gaboro (Dennis Gabor Gbor Dnes, 19001979) darb, paskelbt 1946 m. iame darbe dar nebuvo nagrinjama viena svarbiausi informacijos perdavimo klii triukmo jo vertinimo ir kovos su juo klausimai. Pirmasis juos nagrinjo 1947 m. Vyneris. Jau kitais metais i esms iuos klausimus nagrinjo ir pateik teorines rekomendacijas kuriam technini informacini sistem pltrai anonas. Daug matematik, dalyvaujani kuriant informacinius prietaisus ir mainas, atkreipdavo dmes gyvj ir technini sistem analogijas. Jie yra padar nemaai reikming teorins biologijos tyrim, padariusi didel tak biokibernetikos ir bioinformatikos raidai. Be jau mint N. Vynerio kibernetikos, valdymo ir informacijos mokslini idj, btina paminti iuolaikini kompiuteri teorijos pagrindj A. Tiuring, taip pat padjus ir teorin matematin biologins morfogenezs aikinimo pamat. Btina paminti Don von Noiman, konkrei kompiuteri sukrj, ir taip pat idjin krj main, kurios gamina ir tobulina savo kopijas, teorijos pradinink. Pastarasis, dar neiaikinus biologinio kodo, jau samprotavo apie kodinio modelio btinum tokiose mainose. Visi i darb autoriai tikrieji mokslins informacijos kiekio ir informacijos svokos pagrindiniai tvirtintojai, yra tikslij moksl atstovai, o didiausi informacijos vartotojai ir stichikai informacijos klausimus tiria humanitarai ir biologai. 4.5.2. Informacija ir jos kiekio samprata Visas informacijos sampratas galima suvesti du aspektus: struktrin ir santykin informacij.
174
BIOFIZIKA

Struktrin informacija ir jos kiekis. Struktrin informacija suprantama kaip sistemos (materialiosios struktros) bsenos neigiamoji entropija (negentropija). Tai fizikin fizikochemin samprata, neorganizuotos sistemos energins bsenos apibdinimas. Ji ireikiama L. Bolcmano formule:

S = k ln ,
kur S energin sistemos entropija, k Bolcmano konstanta, termodinamin sistemos bsenos tikimyb, kuri visada didesn kaip 1 ir lygi: =
N! n1!n2 !... nm !

ia n1, n2, , n m yra sistemos erdvskyrose esani ir stochastikai fliuktuojani element (daleli) kiekis, o visas j kiekis:
N = n1 + n2 + ... + nm =
m

ni ,
i =1

esant m erdvskyr. Atvirktinis dydis yra matematin tikimyb p = 1. Tada struktrin informacija I ireikiama:
I ~ S = k ln p

Tai ir yra ios struktros arba sistemos energins bsenos neapibrtumo matas. Jeigu tokios struktros bsenos gali nekisti, vadinasi, ji gali atsiminti praeities bsenas ir poveikius, gali bti vartojama kaip atminties struktra. Atminties struktra vertinama informacijos talpiu Q. 4.5.3. Informacijos talpis ir dekodavimo medis Struktros, galinios priimti ir fiksuoti bsenas, sugeba bti organizuot sistem sudedamosiomis dalimis kaip emesnio lygio posistemio bsen atspind struktra atmintis. iuo atveju vartojame dekodavimo (kodavimo) ir santykins informacijos samprata. Visos informacijos kodavimo struktros ar sistemos (posistemiai) vertinami informacijos talpiu Q. Jo esm didiausias atminties struktros galim bsen kiekis, ireiktas logaritminiais informacijos kiekio vienetais (bitais, baitais ar pan.). Jeigu koduojanioji ar atminties struktra vartoja m simboli ir n padi (pozicij), vadinasi, ji daugiausia gali atspindti:
175
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

N = mn kitos sistemos (posistemio) bsen. iuo atveju sakoma, kad koduojaniosios ar atminties struktros informacijos talpis Q yra:

Q = log 2 N = log 2 m n = n log 2 m bit.


Q daniausiai vertinamas informacijos kiekio vienetais bitais (angl. BIT Binary digit dvejetainis enklas, kartais raoma Q = ld N, logaritmus dualis). Vadinasi, maiausiai reikalinga atlikti Q dichotomini (dvinari) sprendim, kuriuos atlikus bt dekoduotas simboliais ireiktas uraas. Kodinio medio schema, grafikai aikinanti dekodavimo procedr, deifravim vienos bsenos i 8 galimybi, parodyta 4.11 pav. Tam reikalinga pereiti 3 dvinares krykeles, kiekvienoje j panaikinti po 1 bit neapibrumo. Pavyzdiui, paprasiausias tik dviej spalv raudonos ir alios viesoforas neturintis papildom enkl. Jis, valdydamas (arba reguliuodamas) judjim gatve, gali perduoti tik 1 bit informacijos. Jo informacijos talpis yra vienas bitas, kurio signalai reikia: alia vaiuoti galima, arba raudona vaiuoti negalima. Jis naikina dviej galim bsen neapibrtum.

Neapibr tumo b sena 3 bitai

Pirmasis bitas

Antrasis bitas

Tre iasis bitas

4.11 pav. Esant 8 lygiareikmms bsenoms, reikia gauti 3 bitus informacijos iam neapibrtumui panaikinti, t. y. pasirinkti vien konkrei bsen, pvz., 6-tj i 8

176
BIOFIZIKA

Trij spalv viesoforas jau vairina valdomj bsen, atsiranda dar viena galimyb kodin bsena geltona. Ji dekodavus reikia laukti pasikeitimo. Pridtos papildomos sekcijos didina valdomj galimybi vairov, vadinasi, didina informacijos talp. Informacini, tarp j ir biologini, sistem atminties struktr talpis labai ir labai didelis. iuolaikini asmenini kompiuteri atminties talpa tokia didel, kad vertinama jau ne bitais, kilobitais, megabitais, bet kilobaitais, megabaitais, gigabaitais. Didjimui galo nematyti. Baitas (angl. BYTE) daugiausia vartojamas informacijos ir informacijos talpio vienetas.Vienas baitas lygus 8 bitamas, vadinasi, 1 baito atminties struktra turi 28 = 256 bsenas. Be bait (BYTE), dar vartojami NAT-ai bei DIT-ai. Kai bsen kiekis logaritmuojamas natriniu pagrindu, gaunami NAT-ai, o kai deimtainiu DIT-ai. Pavyzdiui, 1 BYTE = lg256 DIT = ln256 NAT = log2256 BIT, arba 1 BYTE = 2,41 DIT = 5,5 NAT = 8 BIT, arba 1 NAT = 1,44 BIT, arba 1 DIT = 3,32 BIT. Svarbiausios biologins sistemos atminties struktros pavyzdiui: mogaus genomo informacijos talpis Qm = ~log2 43 200 000 000 = 6 400 000 000 bit. Pagrindinio atminties organo mogaus smegen atminties informacijos talp sunku vertinti. Jis daug didesnis. Sudtingesnei informacinei struktrai, turiniai daugiau bsen, bdingas didesnis informacinia talpia. Vadinasi, gali atspindti didesn emesnio lygio posistemio bsen kiek. Atitinkamai, viesoforas, turintis papildom gelton vies, jau sugeba perduoti ir daugiau komand, vienu metu dviej degani spalv deriniais didina eism valdanij (reguliuojanij) komand vairov. Papildomi enklai prie viesoforo dar daugiau vairina galimybes. io vyksmo padarinys tobulja transporto veikla. Informacijos talpis rodo didiausi galim atminties struktros naudojimo galimyb. Ji tikrovje perduoda ar priima maiau informacijos, nes simboli pasirodymo tikimybs nebna lygios. Tokiais atvejais informacijos kiekis nustatymas specialiais algoritmais. 4.5.4. Priimtas ar perduotas informacijos kiekis Informacijos kiekis suprantamas kaip sistemos ar posistemio sumaintas ar panaikintas bsenos neapibrtumo dydis, ir dar vadinamas informacine entropija. Atj sistem signalais perduodami informaciniai poveikiai (informacija), suteikia jai atitinkam nauj bsen. Jeigu yra inomos sistemos bsen tikimybs, o pri177
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

imto simbolio (signalo) bsenos tikimyb yra pi , tai to informacinio poveikio atnetas informacijos kiekis Ii arba tos bsenos neapibrtumo dydis Hi bus:
I i ~ H i = pi log 2 pi , bit.

Grafikai i funkcija turi maksimum kintant bsenos tikimybei pi = (nuo 0 iki 1) reikmi (4.12 pav.). Vaizdiai parodoma, kad esant ribins bsenos tikimybms 0 arba 1, neapibrtumas Hi lygus 0. Vadinasi, tokiais atvejais informacija nepriimama ir neperduodama. Kol sistemai (posistemiui) nra suteikta konkreti bsena, iki informacijos poveikio, jos bsenos vertinamos neapibrtumo dydiu informacine entropija Hj . Ji matuojama bitais ir vertinama taip pat kaip ir informacija informacijos kiekio vienetais. Informacij perduodant dviem alternatyviais signalais-simboliais (pvz., raudona arba alia viesoforo spalva) taip arba ne, kurie pasirodo atsitiktinai, ir j pasirodymas vertinamas nevienodomis tikimybmis p1 ir p2, kai p1 + p2 = 1 (p1 = p, o p2 = = 1 p), tada neapibrtumo dydis laukiant signalo H(X), arba gautas informacijos kiekis jam pasirodius I(X) (kai usiiebia kuri nors spalva), atsivelgiant vien i j signalo tikimyb p bus: I(X) = H(X) = H1(X) + H2(X) = p1 log2 p1 p2 log2 p2 . i klasikin informacijos teorijos priklausomyb rodo, kad informacija neperduodama, kai signalas niekada nepasirodo, ir kai jis visada yra. Didiausias informacijos kiekis, iuo atveju 1 bitas, perduodamas tada, kai abu signalai pasirodo vienodai danai: p = 1/2 = 0,5. Esant bet kurioms kitokioms signal pasirodymo tikimybms, perduodamas informacijos kiekis maesnis kaip 1 bitas (4.13 pav.).

Ii ~ Hi

e-1 log2e = 0,53

H(X)
,

pi 0 e = 0,36
-1

p
, ,

4.12 pav. Informacijos neapibrtumo funkcijos grafinis vaizdas

4.13 pav. Dviej signal-simboli informacijos kiekio perdavimo funkcija

178
BIOFIZIKA

Kodavimo atvejais, kai vartojama m simboli, kodas vertinamas apibendrinta kodavimo sistemos (kodo) informacine entropija H. Ji reikia vieno simbolio pasirodymo informacinio neapibrtumo dyd H, arba vieno atsiradusio (bet kurio) simbolio atnet informacijos kiek I. Informacinje sekoje atsiradus konkreiam simboliui, jeigu simboli pasirodymas nesusijs, o j atsiradimo tikimybs skirtingos, tada kodo informacin entropija H bus apskaiiuojama vadovaujantis anono formule:
I =H =
m j =1

p j log 2 p j bit.

I ~ H bitai

Esant lygioms simboli atsiradimo tikimybms, jei pj = 1/m, tada pasiekiama maksimali entropija H0 (4.14 pav.): H0 = log2 m. Jeigu informacij perduodantys simboliai (signalai) ireikti tolydiuoju atsitiktiniu dydiu X, kurio tikimyb apibdinama skirstiniu (tikimybi tankio funkcija) i(X), tada informacin entropija vertinama taikant formul:
H ( X ) = i ( X ) log 2 i ( X ) dX .
+

H0 = log2 m

pi 0

popt = 1/m

4.14 pav. Kodo informacins entropijos, esant lygi tikimybi nesusijusiems simboliams, funkcijos grafinis vaizdas

Variacinio skaiiavimo metodais nustatyta, kad informacin entropija H didiausia, kai tolydiojo simbolio (signalo) X skirstinys (tikimybs tankio funkcija) atitinka normalj arba Gauso dsn:

(X ) =

X2 1 }, kur D tolydiojo simbolio (signalo) X dispersija. exp{ 2D 2D

iuo atveju informacins entropijos dydis, remiantis pateikta integraline formule, yra:

H ( X ) = log2 2eD = log 2 [ 2e ],


kur = D yra vidutinis kvadratinis tolydiojo atsitiktinio simbolio (signalo) nuokrypis. Jei simboli tikimybs lygios, bet j pasirodymai priklausomi (koreliuoti) (pvz., raytiniuose tekstuose didesn tikimyb kad po balss bus priebals, o po priebalss bals), informacin kodo entropija vertinama sudedant slygines simboli tikimybes:
H =
i
m j =1

p( j / i ) log 2 p ( j / i ),

179
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

o jei simboliai yra susij (koreliuoti) ir turi skirtingas tikimybes:


H =
m i =1

p (i )

m j =1

p ( j / i ) log 2 p ( j / i ).

inant informacin kodo entropij H, t. y. vieno simbolio atneam informacijos kiek, perduotas ar priimtas informacijos kiekis nustatomas H padauginus i pasirodiusi simboli kiekio n: I = n H. Jei atminties ar kodavimo struktros bsen kiekis didinamas, n = n1 + n2 + n3 + ..., tai galim bsen kiekis didja geometrikai:
N = m n1 + n2 + n3 +... = m n1 m n2 m n3 .... .

Dl informacijos kiekio logaritmini savybi informacijos kiekis didja ne geometrine, bet aritmetine progresija sudedant: I = nH = n1H + n2H + n3H + ... = I1 + I2 + I3 + ... .

4.5.5. Informacijos perteklius Kodo veiksmingumas vertinamas informacijos pertekliumi R.


R =1 H H H = 0 = 1 h. . H0 H0

ia formule galima vertinti simboli atsiradimo informacijos siuntose vienodum ir nepriklausomum. Juo informacijos perteklius maesnis, juo maesniu padi kiekiu gali bti koduojama informacija. ia santykis:
h= H vadinamas santykine entropija. H0

4.5.6. Klasikin kodavimo ir dekodavimo struktra (anono ryio linija) Informacijai perduoti ryio linija, siminti atminties struktrose ar informacij perduoti sprendim primimo struktroms (procesoriams), taikoma anono kodavimo ir dekodavimo bei informacijos perdavimo teorija. Ji pagrsta ryi linijos schema, parodyta 4.15 pav. Ryi linijos pradioje joje receptoriai, sensoriai arba jutikliai priima iorinius fizinius poveikius signalus ir juos paveria tokia abstrakia fizine-signaline for180
BIOFIZIKA

ma, kuri atitikt ryio linijos ar atminties struktros fizines-funkcines savybes. Tai ir yra kodavimas, vartojant atitinkamus simbolius ir padtis. Remiantis informacijos teorijos reikalavimais ir algoritmais, kodas kiekybikai vertinamas informacine entropija H(X). Prieinga procedra dekodavimas vykdomas ryio linijos gale ijoje dekoderiu, kai signalas i abstrahuotos bsenos atkuriamas tokios formos, kokia ji buvo receptorinse struktrose ir atkuriamas dekoderio struktrose efektoriuose. Dekodavimas kiekybikai vertinamas informacine dekodavimo entropija H(Y). Pagrindinis informacijos kanalo reikalavimas tikslus, patikimas ir greitas simboli perdavimas i koderio dekoder. Arba tikslus, patikimas ir greitas simboli raymas atminties struktroje ir atkrimas. Visose perdavimo linijos grandyse veikia vairiausi triukmai, todl procedros negali ivengti klaid, patikimumas blogja. Norint klaidas vertinti, ie trukdiai apibendrinami bendru linijos triukmu, kuris lemia ir sukelia kodavimo ir dekodavimo procedr klaidas. Tam ir vartojama anono informacijos perdavimo teorija. Norint suprasti jos esm, vaizdiausia ryi linij pavaizduoti kaip mygtuk (receptori) ir usidegani lempui (efektori) laidais sujungt sistem (4.15 pav.).

X1 K O D E R I S X2 * * * Xi * * * Xj * * * Xm

Y1 Y2 * * * Yi

D E K O D

Klaidos ir triukmai

* * * Yj * * * Ym

E R I S

4.15 pav. Informacijos atminties ar ryio linija

181
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Jeigu sistema bt ideali, tai kiekvienas mygtukas udegt tik jam skirt lemput ir nebt klaid. iuo atveju sakoma, linija dirba be triukmo, ji idealiai perduoda tik siuniamus simbolius. Tikrovje taip nebna. Dalis simboli perduodama tiksliai, kita dalis klaidingai. Paspaudus vien mygtuk ar pasiuntus simbol, turt usidegti atitinkama lemput ar sureaguoti t simbol atspindintis elementas. Gana danai reaguoja visai ne tie elementai, kurie turt reaguoti. Klaidos vyksta dl vairiausi prieasi. Visas jas galima apibendrinti tikimybiniu vertinimu, nustatyti vis galim situacij tikimybes. Bandymais ir tam tikrais teoriniais skaiiavimais galima nustatyti vis perduodam simboli situacij tikimybes, koreliacijos koeficient matric (r. 4.1 lentel), i kurios galima apskaiiuoti tiksliai perduot informacijos kiek. Informacijos teorijos esm geriausiai aikina dvikomponent X ir Y simboli rinkini perdavimo sistema. Aiku, tai atsitiktins situacijos, nagrinjamos tikimybi teorijos priemonmis. Paymima, kad koderio siuniamo simbolio X numeravimas j, o dekoderio gaunamo simbolio Y numeravimas i. Atitinkamai simboli atsiradimo tikimybs p(j) ir p(i). Kodavimo ir dekodavimo kombinacini situacij [(X = j), (Y = i)] tikimybs p(j, i). Turint koreliacin tikimybi lentel, nesunkiai apskaiiuojami ie neapibrtumai ios informacins entropijos:
H ( X ) = p ( j ) log 2 p ( j ) ,
j =1 m

H (Y ) = p(i) log 2 p(i ) ,


i =1

H ( X , Y ) = p (i, j ) log 2 p(i, j ) .


i =1 j =1

Isamiau nagrinjant vartojamos slygins tikimybs, kurios reikia: pj (i ) . tikimyb, kad {Y = i, jeigu X = j}, p i (j) .. tikimybe, kad {X = j, jeigu Y = i}. Atlikus algebrini pertvark sek, nustatoma:
H x (Y ) = p( j ) p j (i ) log 2 p j (i ),
j =1 i =1 m m m

H Y ( X ) = p (i ) pi ( j ) log 2 pi ( j ) ,
i =1 j =1

182
BIOFIZIKA

4.1 lentel. Informacijos perdavimo ryi kanalu triukm takos tikimybiniai vertinimai
Y2 p (i) p (1) p ( 2) p( j ) p ( m) 1,00
m

Y1 Yi -p(m) log2 p(m) H (Y ) = p(m) p (m, m) p ( j , m) p ( 2, m) p (1, m) p (1, i ) p ( 2, i ) p ( j, i ) p ( m, i ) p(i) Ym -p(i) log2 p(i)

p log2 p p (1) log 2 p (1) p ( 2) log 2 p ( 2) p ( j ) log 2 p ( j ) p ( m) log 2 p ( m) H(X ) =


m

X1

p (1,1)

p (1,2)

X2

p (2,1)

p (2,2)

Xj

p ( j ,1)

p ( j ,2)

Xm

p ( m,1)

p ( m, 2)

p(j)

p(1)

p(2)

p( j ) log
j =1 2

p( j )

183

p (i ) log 2 p (i )

-p(1) log2 p(1)

p(i) log
i =1

p (i )

4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

I(X, Y) = H(X) + H(Y) H(X, Y) = H(X) HY(X) = H(Y) HX(Y) atkurtas ar perduotas informacijos kiekis informacin koderio entropija (neapibrtumas) informacin dekoderio entropija (neapibrtumas) visos kodavimo ir dekodavimo sistemos neapibrtumas koderio nevienprasmikumas dekoderio nevienprasmikumas

I(X, Y) H(X) H(Y) H(X, Y) HY(X) HX(Y)

H(X)

HY(X)

I(X,Y)

HX(Y)

H(Y) H(X,Y)

4.16 pav. Informacijos perdavimo ryi linija, veikiant triukmams, schema

i kur, taikant slygini tikimybi teorem:


H x (Y ) = H ( X , Y ) H ( X ), H Y ( X ) = H ( X , Y ) H (Y ) .

Perduotas informacijos kiekis bus nustatomas formule:


I ( X ,Y ) = H ( X ) + H (Y ) H ( X ,Y ) = H ( X ) HY ( X ) = H (Y ) HY (Y )

Vaizdiausiai perduotos informacijos kiek, esant triukmams, ir triukm poveikio pobd rodo matematins formuls schema (4.16 pav.). Juo maesnis triukmas, maiau klaid, juo didesnis koderio ir dekoderio informacini entropij persidengimas, juo didesnis perduotos informacijos kiekis. Informacin entropija vertinama dvinari veiksm (operacij) kiekiu, bitais: H(X) nustatant X; H(Y) nustatant Y; H(X, Y) nustatant vis sistem; I(X, Y) nustatant ir X, ir Y. Idealioje informacinje sistemoje, kurioje nra triukm ar jie visikai paalinti, perduotas ar atkurtas informacijos kiekis bus uraomas formule: I(X, Y) = H(X) = H(Y) = H(X, Y). i informacijos perdavimo situacij, triukmo sukeliamus padarinius,
H(X) I(X, Y) H(Y) H(X, Y)

4.17 pav. Informacijos perdavimo ryi kanalu, nesant triukm, schema

184
BIOFIZIKA

H(X) HY(X) H(X,Y)

H(Y) HX(Y)

4.18 pav. Informacijos perdavimo ryi kanalu, esant dideliems triukmams, schema

vaizdiausiai rodo 4.17 pav. Idealiai persidengia abi informacins entropijos koderio H(X) ir dekoderio H(Y), kurios yra lygios perduotam informacijos kiekiui I(X,Y). Taiau didelis triukmo kiekis sukelia visikai kitokius padarinius. Informacin sistema, kurioje triukmai tokio dydio, kad informacija visikai nebeperduodama ar nebeatkuriama, I(X, Y ) = 0, atitinka lygyb: H(X) + H(Y ) = H(X, Y). i situacija vaizdiai pateikta 4.18 pav. Akivaizdu, kad iuo dideli triukm atveju informacija neperduodama. Pateiktos ribini informacijos kanalo savybi grafins diagramos, t. y. idealiai perduodant informacij, kai triukmai visai nedaro takos ir kai triukmas visikai sudarko kanalo darb, vaizdiai parodo matematini iraik esm. Pagrindin enono kodavimo ir informacijos perdavimo teorema nesant triukm teigia:
Jeigu informacijos linijos (kanalo, atminties struktros) galimyb perduoti C bit per sekund ir i linij koderio siuniamos informacijos kodo informacin entropija H(X) bit vienam simboliui, tai geriausia kodavimo sistema gals perduoti informacij ne didesniu greiiu Vinf max kaip:

Vinf max =

C simboli per sekund. H(X )

Matematin informacijos teorija rodo, kokias slygas reikia vykdyti, kad bt veiksmingiausiai perduodama informacija, esant triukmams, netikslumams ir klaidoms. Pagrindiniai kodavimo reikalavimai: informacijos siuntose bt kuo vienodesns simboli tikimybs; simboli atsiradimas informacijos siuntose bt kuo maiau tarpusavyje susijs (koreliuotas).
185
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Todl informacinse sistemose, kurioms svarbiausia ne energijos virsm naudingumo koeficientas, bet kuo greitesnis ir patikimesnis neapibrtumo panaikinimas informacijos gavimas efektyvumui didinti taikomi ie metodai: dekoreliacijos, pasiekiama hierarchiniu perkodavimu, vedant naujus, didesns informacins reikms simbolius; ekstrapoliacijos arba prognozavimo; perduodant tik pokyius. Kovojant su triukmais, naudojamos papildomos informacins priemons ir perteklinis kodavimas. Paprasiausios priemons: daugkartinis kartojimas; daugkartinis sumavimas; specials vairiausi koreguojamieji kodai. Remiantis informacijos teorija informacija skirstoma: atsivelgiant ini sritis biologijos, technikos, ekonomikos, medicinos, kultros ir pan.; atsivelgiant fiziologin suvokimo prigimt regimoji, girdimoji, skonin ir pan.; atsivelgiant jos matavimo bd. Pataroji, matavimo bdai, dar skirstoma 3 ri informacij: parametrin informacija duomen registrai bankai, matuojam dydi, parametr reikmi rinkiniai, tyrinjim, analizs, kontrols rezultat kiekybins iraikos; topologin informacija geometriniai vaizdai, emlapiai ir pan.; abstrakioji informacija matematiniai modeliai, apibendrinti vaizdai, schemos, svokos ir pan. Visos ios priemons taikomos tiek technikai, tiek ir gyvosios gamtos organizm bei gyvn signal perdavimo ir perdirbimo procedroms. Ypa tai akivaizdu nagrinjant kalbas. Kalba tipika per evoliucijos vyksmus susidariusi informacinio kodavimo ir dekodavimo procedra. Rayba akivaizdiausias mogaus sukurtas simbolinio kodavimo ir dekodavimo pavyzdys. Vienas pagrindini informacijos teorijos sunkum, taikant j biologijai ir kasdieniam moni gyvenimui, yra i signalini informacijos vyksm funkcins prasms vertinimas semantika. Teorinio semantikos mokslo pagrindin svoka semantin informacija. Ji aikina informacij neani simboli ir signal prasm, funkcin svarb, vertybes tam tikru informacijos veiksmingumo poiriu. Klasikin informacijos teorija, pagrsta atvirojo kodavimo ir dekodavimo procedromis, sematik atmeta. Tokia informacijos
186
BIOFIZIKA

teorija skmingai vartojama kuriant ryi ir komunikacij technines sistemas, bet nepakankama aikinant biologinius, humanitarinius ir socialinius reikinius organizuot sistem veikl. Udarojoje organizuotoje sistemoje reikiasi informacin semantika, nes dl kodavimo ir dekodavimo organizacinio udarumo, kodai visada susieti su funkcine sistemos veiklos reikme.

4.6. DEKODAVIMAS KAIP VALDYMAS

Paprasiausiu atveju dekodavimas yra atvirktin kodavimui procedra koduoto objekto ar vyksmo atspindio, esanio atmintyje, grtamasis atspindjimas realioje mediag ir/arba energijos virsm erdvje. Dekodavimas suprantamas kaip atminties posistemio bsenos atspindjimas realiame mediag ir/arba energijos virsm procese. Tai yra sistemai (vykdaniajam posistemiui) suteikima tam tikra virsm bsena arba sistemos valdymas informacija (4.19 pav.). i procedra tiesiogiai susijusi su santykins informacijos samprata. Ji rodo, kad virsmai vyksta ne atsitiktinai, ne pagal neorganizuot sistem dsningumus, kuriuos lemia termodinamikos dsniai, bet paklsta informacini slyg tikslingai programai arba algoritmu nulemtai veiklai. i veikl galima ireikti slygine lygtimi:
VEIKSMAI = VIRSMAI , jeigu. INFORMACIJA. = .TAIP., 0, jeigu. INFORMACIJA. = . NE.

iuo slygini veiksm principu gali bti valdomi ne tik mediag ir energijos virsmai, bet ir informacijos srautai. Esant sudtingesniam, hierarchikai organizuotam valdymo posistemiui, kuriame vyksta bent keli lygi informacijos perkodavimo procedros, dekodavimas suprantamas kaip perjimas emesnio lygio, arba artimesniam mediag ir energijos (metabolini) virsm informacines procedras. Pavyzdiui, lstels ar kompiuteri transliacijos procedros. Kitu poiriu tai yra tiesioginis valdymas informacija. Tiesioginio valdymo sistemos. 4.19 pav. pateikta dekodavimo schema yra paprasiausia organizuota valdymo sistema, turinti tiesiogin informacin ry, kartais dar vadinama komandiniu ar instrukciniu valdymu. I aplinkos atjusi informacija suaktyvina sistemos atminties struktras, ir prasideda atitinkamos dekodavimo procedros, kurios ir paleidia sistemos veiksmus. Kibernetika tokias sistemas dar skirsto 3 pogrupius:
187
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

PATEIKIAMA INFORMACIJA

ATMINTIS N bsen Q = log2 N bit . INFORMACIJA DEKODAVIMAS ITEKLIAI MEDIAG ir ENERGIJOS VIRSMAI VEIKSMAI

4.19 pav. Dekodavimas kaip informacinis vykdaniojo posistemio valdymas organizuotoje sistemoje

tiesioginio valdymo sistemas, neturinias atminties; tiesioginio valdymo sistemas, turinias nekeiiam atmint; tiesioginio valdymo sistemas, turinias atmint, kuri kaupia informacij. Pastaroji organizuota valdymo sistema dar vadinama mokslia, ar savimoke sistema, nes sugeba kurti aplinkos modelius. Tiesioginio valdymo organizuotos sistemos koordinuoja veiksmus atsivelgdamos gaunam ar gaut i aplinkos informacij, bei i anksto nustatytus informacins veiklos algoritmus. Taiau jos nevertina esamos vykdaniojo posistemio bsenos ir jo poveikio aplinkai, nes negauna informacijos apie veiksm padarinius grtamosios informacijos. Todl tiesioginio valdymo sistemos gali labai klysti, informacij ar komand valdantysis posistemis pasiunia, o veiksmas, pavyzdiui, dl vykdanij organ gedimo, gali ir nevykti. Nuo panai klaid gelbsti informaciniai grtamieji ryiai. Grtamojo valdymo sistemos. Kibernetikos teorija ir praktika pagrindin dmes skiria organizuotoms sistemoms, turinioms ir grtamuosius informacinius ryius. Toki sistem vykdantysis posistemis yra valdomas ir tiesiogine, ir grtamja informacija, gaudama informacij apie vykdaniojo posistemio ir net aplinkos esam bsen bei bsen kait. Paprasiausias tokios sistemos pavyzdys reguliatorius (4.20 pav.). Tai organizuota sistema, kuri turi vis grtamojo ryio informacijos
188
BIOFIZIKA

POVEIKIAI A P L I N K A

TIKSLAS PROGRAMA INFORMACIJOS PERDIRBIMAS, SPRENDIMAI

Informacija apie sistemos b sen

1 i

R1

MEDIAG ir ENERGIJOS VIRSM


Ri

ITEKLIAI

S E N O S

VEIKSMAI

POSISTEMIS

Rm

4.20 pav. Informacinis valdymas organizuotoje sistemoje: R receptoriai, jutikliai, koderiai, bsen jungiklis, arba dekoderis

kanal ir koder, ir dekoder. ia koderis yra receptoriai arba jutikliai, kurie atspindi vykdaniojo posistemio reikiam valdyti parametr bsenas ir signalais informacij perduoda valdaniajam posistemiui. Valdantysis posistemis i informacij perdirba pagal jo viduje esanius tikslus bei algoritmus, o gauta informacija perduodama dekoder vykdyti. Organizuotos sistemos, turinios grtamuosius informacinius valdymo ryius, taip pat skirstomos pogrupius: grtamojo ryio valdymo sistemas, neturinias atminties; grtamojo ryio valdymo sistemas, turinias nekintam atmint; grtamojo ryio valdymo sistemas, turinias atmint, kuri kaupia informacij. Pastaroji, kaip ir tiesioginio valdymo organizuota moksli sistema, sugeba kurti savo paios sistemos vidins veiklos modelius. Miraus (kombinuoto) valdymo sistemos. Bendresniu poiriu organizuota sistema gali turti abi tiesioginio ir grtamojo informacini ryi valdym, t. y. turti visus informacini ryi kanalus ir su aplinka, ir su vidinmis vykdaniosiomis struktromis. Kibernetika tokias organizuotas sistemas vadina miraus (kombinuoto) valdymo sistemomis. Kaip tiesioginio ir grtamojo informacini ryi valdymo sistemos, jos taip pat gali bti skirstomos pogrupius: miraus (kombinuoto) valdymo sistemas, neturinias atminties;
189
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

miraus (kombinuoto) valdymo sistemas, turinias nekintam atmint; miraus (kombinuoto) valdymo sistemas, turinias atmint, kuri kaupia informacij. Aiku, kad miraus valdymo principu organizuotos sistemos turi dar daug, 32 papildom kombinacin galimybi. Jos skiriasi pagal atminties struktras ir j savybes, keiiant tiesioginio ir grtamojo ryi atminties struktras. Tiesioginiais ir grtamaisiais informaciniais ryiais sudarytos informacinio valdymo sistemos atlieka procedras, kuri galimybs didesns u paprastos ryio linijos ar atminties kodavimo ir dekodavimo operacijos bei funkcijos. Jos sudaro sudting informacinio valdymo posistem procesori, kuris valdo visos organizuotos sistemos veikl, lemia jos veiksmus. Isamesn miraus (kombinuoto) valdymo organizuotos sistemos struktra pavaizduota 4.20 pav. Joje yra informaciniai kanalai struktros, teikianios valdaniajam posistemiui informacij apie aplink ir apie paios organizuotos sistemos vykdaniojo posistemio bsenas. Tokiose sistemose tam tikros struktrins grandys atlieka pirminio kodavimo, sprendim gyvendinimo dekodavimo procedras. Pirminiai koderiai receptoriai, sensoriai ar jutikliai R atspindi ir aplinkos, ir vykdaniojo posistemio bsenas, ir signal forma siunia informacij valdymo posistemio struktras. Informacijos perdirbimo ir sprendim primimo posistemis vertina tikrj vidin sistemos bsen, aplinkos bsen ir gaut informacij lygina su tikslais ir programomis. Prims informacin sprendim, valdo dekoder . Dekoderis, vertindamas gaut informacij, naudoja iteklius tikslinms programoms vykdyti 1, 2, , i, , n, reikiamiems veiksmams/virsmams atlikti. Miraus (kombinuoto) valdymo principais organizuotos sistemos turi abiej tiesioginio ir grtamojo informacinio ryio valdymo sistem privalum: tiesioginio valdymo sistem greit reakcij ir galimyb numatyti (prognozuoti) bsimus aplinkos poveikius, o grtamojo informacinio ryio sistem galimyb vertinti ir veikti pageidaujamu tikslumu. Tokios sistemos turi dvi udarojo informacinio kodavimo ir dekodavimo kilpas: vidin, lemiani paios sistemos vertinim ir bsenos valdym, ir kit udaryt per aplink, kuria vertinama aplinkos bsena bei paios sistemos poveikiai aplinkai. Visoms organizuotoms sistemoms didiausi tak turi informacij neantys signalai ir signalus perdirbanios struktros.

4.7. SIGNALAI ARBA ATSPINDIAI

Vis organizuot sistem, turini informacin valdym, aikinimui reikia apibdinti informacijos ir signal samprat. gyvendinant informacines procedras neapsieinama be vien fizini objekt ir vyksm atspindjimo kitose fizinse sistemose. Akivaizdu,
190
BIOFIZIKA

mediag ir energijos virsmus abstrahuotas kodines informacines procedras vykdo fizins grandys, sudarydamos tam tikras struktras. Grandys ir j struktros atlieka tam tikrus signal virsmus per kitus fizinius vyksmus. Pavyzdiui, visiems suprantamas informacijos perdavimas telefono kanalu. Tai nuosekliai sudliota grandin vairiausi fizini atspindjim: oro molekuli virpjimai (slgio kitimai) kalbant; mikrofono membranos virpjimai; anglies milteli suspaudimo kitimai mikrofone ir elektrins varos kitimai; elektrins srovs kitimai; telefono ausins elekromagnetuko magnetinio lauko kitimai; telefono ausins membranos virpinimas, kuris ir vl sukelia oro molekuli tokius paius virpjimus kaip ir grandins pradioje. Pirminis informacijos altinis siuntjas (mogus) sukuria signalus oro molekuli virpjimus, o primjas (mogus) taip pat gauna tokius pat fizinius oro molekuli virpjimus, kurie jam perduoda informacij, panaikina primjo tam tikr neapibrtum. Panas fiziniai kitimai, atliekantys informacines procedras, vyksta visose gyvosiose fiziologinse, ekologinse sistemose, visuomenje, bet ne visose techninse mogaus sukurtose mainose. Tai bdinga vadinamosioms organizuotoms sistemoms. Norint suprasti organizuot sistem veikl, reikia susipainti ir su signal atspindjimo bei j virsm teoriniais elementais signal ir juos perduodani grandi teorija.

4.7.1. Signalai ir grandys Priimant arba perduodant informacij, koduojant ir dekoduojant neapsieinama be materialij informacijos neikli signal. Informacins procedros visada vykdomos fizinmis fizikinmis ir/ar cheminmis priemonmis. Todl j vykdymas yra speciali materialij vyksm virsmai, kuriuos gyvendina atitinkamos grandys. Grandyse vykstantiems signaliniams virsmams taikytini fizikos ir chemijos dsningumai. Jos signalus perduoda ir/ar priima pagal signal teorijos dsnius. Signal dsniai formuluoti vadovaujantis neorganizuot sistem teorija, remiantis poveikio ir reakcijos principais. Signal ir neorganizuot sistem teorijos pagrindinis elementas grandis visus perduodamus signalus transformuoja pagal tos grandies savybes. Savybes lemia ios grandies impulsin reakcija h(t), t. y. grandies reakcija (t) funkcij blyksn, kuri grandies reakcija y(t ) ~ h(t) (4.21 pav.). Grandys gali bti pasyviosios ir aktyviosios. Aktyviosios grandys skiriasi nuo pasyvij tik tuo, kad patikimai signalams perdirbti naudoja papildom energij, kuri neturi takos signal transformavimo dsningumams. Tiesini grandi signal virsmams apibdinti taikomi tam tikri metodai. Klasikinis grandi kiekybinio apibdinimo metodas yra paremtas dani perdavimo sa191
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Energija

x(t)

h(t)

y(t)

x(t)

h(t)
Ieikvota energija

y(t)

4.21 pav. Signalus perdirbanios grandys: pasyvioji ir aktyvioji

vybmis. Jos gaunamos bandymais, per grandis leidiant vairiausio danio harmoninius signalus sinusinius X0 sin(t) ar kosinusinius X0 cos(t), nustatomi j perdavimo koeficientai, amplitudi ir fazi perdavimo funkcins savybs. Modernesn signal teorija pagrsta integralinmis ssk transformacijomis ir impulsini reakcij funkcijomis (impulsiniais atspindiais). Tiesins nevaldomos grandies reakcija arba atspindys (refleksija) matematikai ireikiamas sskos integralu, arba sska. Ssk iraikos gali bti vairios, bet j esm reikia tok pat vyksmo x(), vykstanio erdvje , atspindjim erdvje t , t. y. kaip vyksm y(t):
y (t ) =
+

t t t x( ) h(t ) d = x(t ) h( ) d = x( ) h( + ) d = x(t + ) h( ) d 2 2 2

Glaustai matematin sskos iraika uraoma poveikio signalo x(t) ir grandies impulsinio atspindio (reakcijos) funkcijos h(t) jungimu vaigdute *:
y(t) = x(t) * h(t),

ia x(t) poveikio ar jos signalas; y(t) atspindtas, ijos, ar reakcijos signalas; h(t) impulsinio atspindio, arba grandies impulsin reakcija, apibdinanti grandies signal perdirbimo savybes. Impulsin reakcija h(t) rodo perduodanios grandies ar sistemos reakcij (t) jim, t. y. x(t) = (t) * h(t) ~ h(t), ia:

(t ) =

max, ... t = 0, kur 0, ... t 0,

(t )dt = 1 .

Bandym metu daniau pateikiamas signalas bna ne impulsas, kitaip dar vadinama Dirako funkcija (t), bet slenkstin vienetin funkcija (t):
192
BIOFIZIKA

(t ) =

1, ... t 0, 0, ... t < 0.

(t ) =

ios abi paprastos funkcijos, plaiai vartojamos apibdinant gran0 t di savybes, dar vadinamos ypatingomis (singuliariosiomis) t 1 funkcijomis. Jos yra susijusos tar (t ) = ( ) d , pusavyje diferenciavimo ir integravimo veiksmais (4.22 pav.). 0 t Signalo atspindjimo pobdis kitoje fizinje erdvje matema4.22 pav. Singuliariosios funkcijos tikai gali bti ireiktas determinuotomis algebrinmis lygtimis ir/ar tikimybinmis formulmis, atspindiniomis grandyse vykstanius fizinius virsmus. Turint tiesins grandies impulsin reakcij h(t) nesunkiai teorikai, matematikos metodais nustatomos ir dani perdavimo savybs (charakteristikos). Pakanka atlikti jos Furj transformacijos F1 procedras: H(j ) = F 1 {h(t)}. Todl impulsins reakcijos yra vaizdesns ir patogesns vertinant grandi bei j grandini savybes. Grandys tiriamos ne tik ypatingosiomis (singuliarinmis) funkcijomis (signalais), ar harmoniniais (sinuso ar kosinuso formos signalais), bet ir Baltuoju triukmu signalais, kurie sudaryti i vis harmonini nesinchronizuot vienod energij ir dani signal. Organizuot sistem atvejais naudojamos ne tik pasyviosios ir aktyviosios, bet dar ir valdomosios grandys, kurioms yra pateikiami valdymo signalai, lemiantys grandies jungim ar ijungim (4.23 pav.).
VALDYMO SIGNALAS

d (t ) , dt

x(t)

h(t)

y(t)

4.23 pav. Valdomoji grandis

193
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Valdomosioms grandims bdingas virsm ar signal transformavimo atspindjimo procesas tik tada, kai yra valdymo signalas:
Y (t ) = y (t ), jeigu .VALDYMO SIGNALAS. = .TAIP., 0, jeigu .VALDYMO SIGNALAS . = . NE.

Daniausiai, valdymo signalas tai poveikis, kuriam reikia maai energijos ir mediag jungiant ar ijungiant daug didesns galios ar apimties vyksmus. Tokios grandys atlieka slygines operacijas ar procedras, kurios kompiuteri programavimo kalbose vadinamos slyginmis operacijomis loginiais ar aritmetiniais IF. Panaias valdymo galimybes turi beveik visos biologini sistem tam tikr funkcionavimo lygi grandys. Tai ir fermentins lsteli reakcijos, ir raumen miocitas, ir organizmo organas, ir vabzdys bei mogus populiacijose. Nagrinjant signal virsmus biologinse organizuotose sistemose kodavimo ir dekodavimo poiriu, didelis dmesys skirtinas tolydios erdvs signalams atspindti diskreiosiose struktrinse erdvse ir atvirkiai diskreij erdvi signal atspindjimui tolygiosiose erdvse.

4.8. INTEGRALINS TRANSFORMACIJOS KAIP KODAVIMO IR DEKODAVIMO PROCEDROS

Tam tikros biologins struktros, vykdanios virsmus ir atliekanios signal atspindjimus transformacijas gali bti apibdinamos matematikai. Signal teorija plaiai vartoja tokias signal, ireikt matematinmis formulmis, procedras paprastas algebrines ir integralines transformacijas. Atlikus specialius matematinius veiksmus, signal matematiniai modeliai, esantys vienoje abstrakioje erdvje (koordinai sistemoje), perkeliami kit abstraki erdv, kitoki koordinai sistem taip, kad bt galima juos atkurti pirminje matematinje signal erdvje. Naujoje erdvje sudtingi matematiniai veiksmai virsta paprastesniais, ir juos atlikus naujoje erdvje, grtamosiomis (atvirktinmis) procedromis galutinis rezultatas grinamas pirmin erdv. Visiems yra inoma logaritmavimo ir antilogaritmavimo, tiesiogini ir atvirktini trigonometrini funkcij skaiiavimai bei kitos procedros. Pavyzdiui, logaritmavimu logaritminje erdvje sandaugos virsta sudtimis, dalijimai atimtimis, klimas laipsniu sandauga. Suskaiiavus logaritminje erdvje rezultat ir j antilogaritmavus nustatomas galutinis rezultatas pirminje erdvje. Kodavimo ir dekodavimo poiriu ypatingo dmesio vertos integralins transformacijos, ireiktos sskomis. Sska gali bti vertinama kaip viena i kodavimo ir dekodavimo form.
194
BIOFIZIKA

4.8.1. Sska kaip kodavimo ir dekodavimo procedra Kodavimas tai informacin procedra, dl kurios erdvje X esanios posistemio (struktros) bsenos u(x) atspindimos kitoje erdvje U(). Signal atspindiai transformuotoje erdvje vadinami atvaizdais. Dekodavimas yra prieinga procedra. Atvaizd erdvje esani posistemio (struktros) bsen U() dekoduoti atspindiai pirmojoje X (ar jai atitinkamoje X) erdvje, yra io posistemio (struktros) bsenos u(x) (arba u(x)) (4.24 pav.). Tokios procedros matematikai gali bti ireikiamos integralini transformacij pavidalu. Jos bna paprastsns ir sudtingesns. Atspindjimo pobdis priklauso nuo integralins transformacijos branduolio (x, ), ar (x, ), t. y. funkcijos, kuriomis remiantis sujungiamos abi erdvs darni logik grtamj sistem. Paprastesns integralins transformacijos vadinamos sskomis. Joms bdinga erdvini koordinai sujungimas j skirtumo operacija x, arba x . Vadinasi, transformavimo pobdis nepriklauso nuo erdvs vietos, o priklauso tik nuo transformavimo vyksmo integravimo branduoli (suriimo funkcij) ar erdvini koordinai nuotoli. Kalbant apie ssk vykdanias struktras, sakoma, kad sska rodo homogenin transformavimo struktr turi tas paias priklausomybes kiekvienai erdvs vietai.

U( )

KODAVIMAS

(x, )

(x, )

DEKODAVIMAS

X u(x)

4.24 pav. Kodavimas ir dekodavimas kaip integralin transformacija

Integralin transformacija

Sska

U ( ) = u ( x) ( , x)dx,

U ( ) = u ( x) ( x)dx,

u ( x) = U ( ) ( x, )d .

u ( x) = U ( ) ( x )d .

195
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

(x ) u(x)

( x)

x x

4.25 pav. Grafinis sskos aikinimas

Sskos matematins transformacijos esm parodyta 4.25 pav. Branduolio funkcija, turinti neigiamj argumento enkl (funkcija prieingos krypties), slenka per jimo signal ir iekomas i funkcij persidengimo sandaug plotas. Jei branduolio funkcijos argumento kryptis yra tos paios krypties kaip ir signalo, kada (x), argumento enklas nepakeistas, sska virsta koreliacine integraline transformacija. Atlikus i matematin transformacij gaunama koreliacin funkcija, rodanti abiej signalo ir branduolio funkcij panaum, esant tam tikroms postmi padtims. 4.8.2. Diskretusis kodavimas ir dekodavimas Biologinms sistemoms danai tenka atspindti (koduoti) tolydiosios erdvs vyksmus diskreiojoje erdvje, versti diskreiaisiais signalais. Dekodavimo atvejais pagal diskreiai koduoto atvaizdo signal atkurti vyksmus ar signalus tolygiojoje erdvje. Tolygiosios erdvs signalus atspindint koduojant diskreiosiose erdvse, kodavimo ir dekodavimo procedrose vartojamas begalinis 0(x), 1(x), i(x), k(x) funkcij rinkinys. Kodavimo integralais:

Ui =

u ( x ) i ( x ) dx

nustatomas diskreij dydi rinkinys U0, U1, Ui, Uk ... Tai ir yra koduotas vyksmo u(x) atspindys, o funkcij i(x), rinkinys kodas. Tada dekodavimas, kaip atvirktin procedra, virsta dekoduojani funkcij i(x), turinius atitinkamais svorinius koeficientus Ui, sumavimu:

u ( x) =

k i =0

U i i ( x)

kur 0(x), 1(x), i(x), k(x) yra dekodavimo funkcij rinkinys.


196
BIOFIZIKA

Tokiu bdu kodavimas yra sudting signal skaidymas analiz, o dekodavimas sintez. Signal ir informacijos teorija rodo, kad veiksmingiausiai informacins kodavimo ir dekodavimo procedros atliekamos, kai kodavimo ir dekodavimo funkcijos yra ortogonalios, arba kvaziortogonalios (beveik ortogonalios). Tai atspindi kodavimo ir dekodavimo funkcij ar simboli nepriklausomum. Tais atvejais ortogonalij funkcij rinkinys turi tenkinti matematin slyg:
+

i ( x ) j ( x)dx = j ( x ) i ( x)dx =
+

E , i = j 0, i j E , j = i 0, j i

= E ij , = E ji ,

kur E =

[( x)

( x) dx , ir E atitinkamai.

ia ij Kroneckerio funkcija, o (x) svorio funkcija. Esant tik diskreiosioms informacinms struktroms, kodavimo ir dekodavimo transformacijos atliekamos per sumavimo procedras:
U ( j) = u (i ) =
n 1 i =0 n 1 j =0

u (i ) (i, j )

U ( j ) ( j, i)

arba t pat galima urayti algebros matric ir vektori sandaugomis: U = [] u , u = [] U, kur U ir u yra vektoriai stulpeliai, o [] ir [] matricos, apibdinanios tikslias kodavimo ir dekodavimo operacijas kod. Kad dekodavimas idealiai atkurt tai, kas buvo atspindta koduojant, t. y. kad kodavimo ir dekodavimo procedros funkcionuot idealiai, turi bti vykdomos ortogonalumo slygos: tolydij signal kodavimo ir dekodavimo atvejais:
+

( x, ) ( , x)d = ( x),

197
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

diskreij signal atvejais matric sandauga [] * [] = I, bt vienetin matrica I. ios matematins slygos rodo, kad tokios kodavimo ir dekodavimo procedros sugeba iskaidyti ir vl atkurti didiausi dani signal funkcij, arba vien piksel diskreiojo kodavimo atvejais. 4.8.3. Laplaso ir Furj integralins transformacijos kodavimas ir dekodavimas Tiesini dinamini sistem analizs ir sintezs vairiausi vyksmai apraomi tiesinmis diferencialinmis ar integralinmis lygtimis. Tam tikromis integralinmis transformacijomis T 1 galima pereiti toki abstrakij erdv, kurioje matematins diferencijavimo ir integravimo operacijos virsta algebrinmis dauginimo ir dalijimo operacijomis. Abstrakiojoje erdvje isprendus algebrines lygtis, galutinis sprendinys gaunamas vykdius grtamj integralin transformacij T +1. Taip sprendinys siekiamas rezultatas perkeliamas pirmin erdv (4.26 pav.). Tiesini sistem atvejais signalams atspindti abstrakiojoje erdvje ir atkurti plaiai taikomos Laplaso L1, L+1 , Furje F 1 , F +1 ir kitos tiesiogins ir atvirktins integralins transformacijos. Todl reals signalai atspindti abstrakioje, vadinami atvaizdais (anksiau mklomis), kompleksinio kintamojo s = a + j erdvje (Laplaso transformacija) arba menamojoje dani erdvje j (Furj transformacija) taip, kad bt galimas visavertis grimas pirmin reali erdv. ios procedros vertintinos kaip kodavimas ir dekodavimas. Laiko funkcij signal vienpus Laplaso transformacija atliekama matematinmis procedromis:

s=a+j T1 T+1

4.26 pav. Integralini tiesiogini ir atvirktini T

transformacij grafinis aikinimas

198
BIOFIZIKA

H ( s ) = L1 {h(t )} = h(t ) = L+1 {H ( s )} =

h(t ) exp{ s t } dt ,
+

1 j 2

H ( s ) exp{+ t s} dp

Tada atspindys y(t) kaip x(t) sska, Laplaso erdvje bus algebrin lygtis:
Y (s) = H (s) X (s) .

Singuliarieji signalai Laplaso erdvje bus L1{(t)} = 1, o L1{ (t)} = s. Atitinkamai diferencijavimo ir integravimo veiksmai virsta dauginimu ar dalijimu:
L1 d ... = s, dt

L1

...dt =

1 . s

Laplaso transformacijos taikytinos laike kintamiems vyksmams koduoti. Furj transformacijos, kurios taikytinos laiko ir erdvs signalams koduoti, yra panaios Laplaso transformacijoms, tik atspindio (atvaizdo) erdv (argumentas) yra menamasis dydis danis j. Furj transformacij esm signal skaidymas tam tikr dani sinusais ir kosinusais bei j sintez i sinus ir kosinus. Matematikai tai atliekama sprendiant tam tikrus integralus:
H ( j ) = F 1{h(t )} =
+1 +

h(t ) exp{ j t} dt ,
+ j

1 h(t ) = F {H ( j )} = j 2

H ( j ) exp{+ t j} d .

Eulerio funkcijos exp{ j } = cos( j ) j sin{ j } poiriu, kompleksin trigonometrin lygtis rodo, kad skaidymas kodavimas arba sintez dekodavimas vykdoma kartu dviem nepriklausomomis procedromis, kuri viena j cos atspindi lygines (simetrikas ordinai atvilgiu) signal savybes, o kita sin, simetrikas koordinai centro atvilgiu nelygines savybes. Kitu poiriu ios savybs ireikia harmoninio (sinusinio) signalo faz. Furj transformacijos yra taikomos ne tik tolydiesiems, bet ir diskretiesiems signalams koduoti ir dekoduoti. Yra sukurta daug labai veiksming transformavimo metod ir j taikym vairiausioms techninms priemonms. Tai plaiausiai naudojama kodavimo ir dekodavimo procedra.

199
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

4.8.4. Kitos ortogonaliojo transformavimo, arba kodavimo ir dekodavimo, sistemos Be aptart ir plaiai taikom Laplaso ir Furj integralini transformacij arba kodavimo ir dekodavimo procedr, tam tikr fizini bei ininerini sistem analizei ir sintezei naudojamos transformacijos, taikytinos ir aikinant (modeliuojant) biologines sistemas: elektroininerijos Hevisaido; optikos Frenelio; laiko erdvje kintantiems signalams Lagero; erdvje kintantiems signalams Ermito (Hermite); dvejetainikai koduojamiems signalams Adamaro (Hadamard) ir Volo (Walsh). Hevisaido transformacija tai beveik ta pati Laplaso transformacija, tik skiriasi papildoma sandauga sL1 . Ji rodo signal skaidym atsakais ne impulso funkcijas (t), bet vienetini uoli funkcijas (t). Frenelio transformacija yra sskin transformacija, turinti ir sskos, ir Furj transformacj savybi. Jos kodavimo ir dekodavimo branduolio funkcija:
( x) = exp m j ( x) 2 .

Lagero ir Ermito transformacijos taikomos atspindint ir koduojant tolydius laiko ir erdvs signalus diskreiosiose erdvse. Lagero transformacijos kodavimo ir dekodavimo branduoliai Lagero funkcijos:
l n (t ) = 1 t exp Ln (t ) , n! 2

kur Ln(t) Lagero daugianariai (polinomai). Ermito kodavimo ir dekodavimo branduoliai Ermito funkcijos:
hn ( x) = x2 exp H n ( x) , 2 2 n n! 1

kur Hn(x) Ermito daugianariai (polinomai). Labai svarbios kodavimo ir dekodavimo procedros vykdomos Adamaro ir Volo funkcijomis. Jos akivaizdiai rodo galimyb tolydiuosius signalus atspindti dvinari veri diskreiojoje erdvje, turint galimyb dekoduojant signalus vl atkurti tolydiojoje erdvje. Aiku, dvisimbolinio kodavimo ir dekodavimo matricos turi tenkinti tam tikras slygas.
200
BIOFIZIKA

Adamaro matricos. Daugiakanali lygiagretaus informacijos (signal) kodavimo ir dekodavimo procedrose vartojamos Adamaro matricos, turinios ortogonalumo ir kvaziholografini savybi. Ypa jos domios, nes yra dviej reikmi, tiksliau, dviej enkl ir + matricos. Kodavimas Adamaro matric principu padeda suprasti biologini eksperiment planavim, kodavim ir dekodavim neuron struktrose bei genetini kodavim atvejus. Adamaro n-tosios eils kvadratin (n, n) matrica, sudaryta i element aij = {+1, 1}, kur i, j = 1, 2, 3, , n :
a11 An = a21 ... a12 ... ... a1n ... ...

a22 ... a2 n

an1 an 2 ... ann ,


T tenkinanti ortogonalumo reikalavim, turi tenkinti slyga An An = n I , kur T rodiklyje matricos transponavimo enklas, o I vienetin matrica:

1 I= 0 0

0 ... 0 1 ... 0 0 ... 1 .

... ... 1 ...

i lygyb reikia, kad dvi bet kurios matricos An eiluts yra ortogonalios. Kodavimo atvejais matricos eiluts gali bti vartojamos kaip ortogonalaus (nepriklausomo) kodavimo rinkiniai. Paprasiausios Adamaro matricos yra:
+1 +1 +1 1 A1 = [+ 1]; A2 = ; A41 = +1 1 1 +1 +1 1 +1 1 +1 +1 +1 +1 +1 +1 +1 +1 ; A42 = 1 +1 1 1 +1 +1 1 +1 +1 1 +1 +1 1 +1 . +1 +1

Didesnes matricas galima gauti atliekant Kroneckerio matric dauginimo procedr (pateikiami tik enklai):
+ A2 + = A2 + + + + + + + . ir pan. +

A2 A2 =

A2 A2

201
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Gauta matrica yra anksiau pateikta A41 matrica, nes skiriasi tik eilui idstymo tvarka. Matricos, didesns u 2 (n > 2) turi bti kartotins 4. Matricos, kuri dydiai yra 2n, daug kuo sutampa su plaiai iuo metu taikomomis Volo (Walsh) funkcijomis, kurios yra tam tikras Adamaro ir Furj kodavimo ir dekodavimo princip hibridas. Joms bdingos lygins cal(k, x) ir nelygins sal(k, x) dvinario diskreiojo kodavimo ir dekodavimo savybs. Wal (k, x) = cal(k, x) +jsal(k, x).

4.8.5. Kodavimas diskretizavimas (enono ir Kotelnikovo teorema) Tolydiuosius signalus u(t)veriant diskreiaisiais diskretizuojant arba j tolydiuosius dydius u(ti ) atspindint koduojant diskreiojoje erdvje Ui , taip pat juos atkuriant, vadovaujamasi enono ir Kotelnikovo teorema. Jos esm sskin transformacija, kurios branduolio, arba atskait funkcija n yra: , arba

, kur T diskretizavimo ingsnis, o: . Diskretizavimo ingsnis T, arba Naikvisto intervalas, esant didiausiam signalo daniui max:
T=

1 . = max 2 f max
dar vadinamas Naikvisto daniu . Jis

Atvirktinis Naikvisto intervalo dydis

rodo, kad diskretizavi mo danis turi bti toks, kad jis 2 kartus pamatuot (diskretizuot) signalo struktr einant didiausio danio fmax period Tmin. ie teoriniai samprotavimai turi didiul praktin reikm diskretizuojant signalus ir sintetinant diskreisias signal analizs, sintezs, taip pat vykdant kodavimo ir dekodavimo procedras.
202
BIOFIZIKA

Jeigu inoma signalo trukm ar jo ilgis t, o Naikvisto danis , tai vartojama neapibretumo taisykl:

t =
Konstantos reikm priklauso nuo koduojamo signalo formos ir reikalingo tikslumo. Pavyzdiui, staiakampi signal atveju danai pakanka pasirinkti = 1. Norint vertinti tiksliau, konstanta dvigubinama. 4.8.6. Kitokios kodavimo ir dekodavimo sampratos Praktikai biologinse ir techninse sistemose kodavim ir dekodavim vykdo tam tikros grandys, vien fizin dyd paversdamos kitu fiziniu dydiu. Akivaizdiausias pavyzdys temperatros matavimas: gyvsidabrinis termometras temperatr paveria gyvsidabrio stulpelio aukiu; gyvn termoreceptoriai sukuria (generuoja) bioelektrini potencial skirtum ar nervini impuls sekos dan ir panaiai. Apibendrintai kodavim signal transformavimo poiriu galima vertinti kaip funkcin vieno dydio priklausomum nuo kito. Matematikai kodavim galima ireikti funkcija Y = f (X ) arba per bandym pamatuoti. Tai gali bti statistinis regresijos priklausomumas ar tikimybin funkcija. ie funkciniai priklausomumai grafikai gali bti pavaizduoti kaip vienos erdvs X bsen atspindjimas kitoje Y erdvje (4.27 pav., 4.28 pav.). Idealiais atvejais danai siekiama, kad is atspindjimas bt kuo isamesnis ir tolydesnis, siekiama tiesins tolydios priklausomybs. Taiau praktikai to padaryti nemanoma, nes tenka tolydisias vieY nos erdvs riboto dydio bsenas atspindti baigtinse diskreiosiose struktrose. Todl tolygioji erdv X kvanY5 tuojama remiantis reikiamais vienodais intervalais X, visiems jiems erdvje Y Y4 suteikiant diskreiuosius atatikmenis Y3 (4.27 pav.). Tikrovje tai retai pasiekiama. Y2 Skirtingai kvantuojami X reikmi inY1 tervalai, du ar net daugiau interval tuX ri atitikmenis vienai diskreiajai kitos 0 X1 X2 X3 X4 X5 Y fizins erdvs reikmei. Bna ir nekoduojam erdvs srii aklos sri4.27 pav. Tolydiojo dydio tiesinio kodavimo aikinamasis grafikas tys ir panaiai (4.28 pav.).
203
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

Y Y5 Y3 Y2 Y4

Y1 0 X1 X2 X3 X4 X5 X6 X7

4.28 pav. Tolydiojo dydio netiesin kodavim aikinantis pavyzdys

Tok netiesin kodavim galima suprasti nagrinjant odi sinonimus ir nekamosios kalbos odi daugiaprasmikum (4.28 pav.). Tai galt bti Y2 reikm, kai net trys X erdvs intervalai X2 , X4 ir X6 turi Y2 reikm ar prasm. Aiku, nevienprasmis organizuot sistem kodavimas yra klaid prieastis ir jo vengiama. Tam tikri kodavimo erdvs ikraipymai turi taikomj prasm. Labai danai vartojama logaritminio pobdio priklausomyb, padedanti maas fizini dydi X pokyi reikmes isamiau atspindti Y skalje, labiau itempiant Y erdv, o didelius fizini X dydi kitimus atspindti ne taip tiksliai, suspaustoje Y erdvje maoje Y kitim erdvje. mogaus sukurtos technins ryi ir informacinio valdymo sistemos paremtos tiksliais kiekybiniais skaitiniais vertinimais. Nagrinjant natraliai susidariusi biologini ir socialini sistem veikl, tiksliais skaitiniais vertinimais abejojama ir iekoma tikslios veiklos aikinimo alternatyv. Signal kodavimas ir dekodavimas bandomas aikinti nekiekybiniais simboliais, turiniais funkcin prasm semantik, kaip atitinkam enkl (simboli) kalb. Kuriama nekategorik simboli (fuzzy) kodavimo teorija, kitur vadinama idjos autoriaus Zad (L. Zadeh) aibi teorijos vardu. Pavyzdiui, signalais vartojamos lingvistins kokybins iraikos: daugiau, maiau, lygu ir panaios. Zad teorija rodo, kad tokiomis priemonmis galima atlikti net labai tikslius sprendimus. Manoma, kad panaiais principais gali bti grindiama signalin biologini sistem informacinio valdymo veikla.

204
BIOFIZIKA

4.9. ORGANIZUOT SISTEM VALDYMO PRINCIPAI

Organizuotos sistemos skiriasi nuo paprast neorganizuot tuo, kad joms didiausi tak turi valdymo posistemiai. Jie kodavimo ir dekodavimo principais gauna, priima, perdirba, saugo, siunia informacij ir taip valdo organizuot sistemos veikl. Organizuotos sistemos, atsivelgiant valdymo pobd, skirstomos tris pagrindines klases: 1. Valdomas tiesioginio ryio informacija. 2. Valdomas grtamojo ryio informacija. 3. Valdomas miraus (kombinuoto) ryio informacija. Organizuotoms sistemoms didel tak turi atmintis. Atsivelgiant informacijos struktr ir atminties funkcionavimo principus, organizuotos sistemos, kaip buvo rayta, gali bti skirstomos : sistemas, neturinias atminties. sistemas, turinias nekintam atmint. sistemas, turinias kintam atmint. Pastarosios organizuotos sistemos, turinios kintam atmint, dar vadinamos moksliomis ar net adaptyviosiomis sistemomis. Organizuotos sistemos, neturinios atminties sunkiai suprantamos kaip organizuotos. Tai pavieniai elementai ar struktros, kuriose sunku iskirti sudedamsias dalis, vadintinas atmintimi. Tokios sistemos tik pagal ateinanius signalus vykdo tam tikras specialias slygines operacijas. Atmintis jose yra, bet kaip speciali vykdanioji operacija ar funkcionavimo tvarka, bet ne kaip konkreti atminties struktra. Pavyzdiui, paprasiausi reguliatoriai. Taiau ir paprasiausias reguliatorius yra organizuota sistema joje yra valdymas, valdymas informacija. Aiku, bet kokia organizuota sistema gali bti valdoma keliais bdais. 4.9.1. Valdymo bdai Valdymo bdai skirstomi atsivelgiant tai, koki informacij vartoja organizuotos sistemos valdantysis posistemis priimdamas sprendimus atlikti veiksm. Anksiau buvo minta, kad organizuotose sistemose valdymui vartojama informacija gaunama: tiesiogiai i aplinkos, grtamoji gauta vertinant atlikt veiksm, ir miri ir tiesiogin, ir grtamoji. Atsivelgiant tai, skirstomi organizuot sistem valdymo bdai (4.29 pav.). Tiesioginiam valdymui bdinga greita reakcija informacij, gaut i aplinkos, bet daromos didels klaidos pasirodius nenumatytam atsitiktiniam poveikiui. Norint
205
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

VALDANTYSIS POSISTEMIS

VALDANTYSIS POSISTEMIS

INFORMACIJA

VALDOMASIS POSISTEMIS

VALDOMASIS POSISTEMIS

TIESIOGINIS

VALDYMAS

VALDYMAS GRTAMOJO GYIO INFORMACIJA

VALDANTYSIS POSISTEMIS

VALDOMASIS POSISTEMIS

MIRUS (KOMBINUOTAS) VALDYMAS

4.29 pav. Organizuot sistem valdymo bdai

tok valdym tobulinti reikalinga kuo galingesn atmintis. Atmintyje sukaupta didiul informacija, vadinama patirtimi, sukuriami tikslesni informaciniai modeliai padeda vykdyti tikslius veiksmus numatant galimybes. Tai padeda nedaryti klaid ar jas mainti. Toks valdymas geriausiai tinka pasikartojanioms situacijoms. Taiau atsiradus naujoms, nelauktoms ir nebuvusioms situacijoms, daromi klaidingi net lemtinti veiksmai. Norint gerai valdyti, reikalingos galingos informacins technologijos. Tai strateginis, krybikas valdymas, vadovaujantis teoriniais modeliais. Kitaip vadintinas valdymu per sintez ar dedukciniu valdymu.
206
BIOFIZIKA

Valdymas grtamja informacija pasiymi pavluota reakcija pokyius, taiau tiksliau vertina momentin situacij ir pagal tai atlieka taktinius veiksmus. Valdymui vartojama taktin informacija, vertinanti momento padarinius pagerjo ar pablogjo organizuotos sistemos veikla po paskutiniojo veiksmo. Valdomasis posistemis, valdomieji objektai daniausiai bna dideli ir inertiki, todl grtamoji informacija, reikalinga valdymui, gaunama udelsiant. Tai silpniausia tokio valdymo savyb. Toks valdymas visada vyksta vertinant paklaidas, kurias galima mainti, didinant gritamojo ryio informacin tikslum. Valdymas grtamojo ryio informacija yra paprastas nereikia didels patirties, atminties ir kit informacijos technologij. Tai valdymas vadovaujantis aplinkybi informacija, nereikia teorini modeli. Kitaip vadintinas indukcinis, arba analitinis, valdymas. Mirus (kombinuotas) valdymas jungia abu valdymo bdus vartojama tiesioginio ir grtamojo ryio informacij. Todl iam valdymo bdui bdinga ir greita reakcija, ir vyksm tikslumas. Toks valdymo bdas jungia ir teorinio, ir praktinio valdymo teigiamsias savybes. Tai geriausias valdymo bdas, bet reikalingos sudtingos informacijos technologins priemons. Mirus valdymo bdas vadintinas simbioziniu valdymu, nes jungia indukcin analitin ir dedukcin sintetin informacijos perdirbimo bdus. Konkreiose organizuotose sistemose vartojami vairiausi valdymo bdai.

4.10. KIBERNETINS VALDYMO SISTEMOS, ATSIVELGIANT PASKIRT

Atsivelgiant valdymo paskirt ir funkcionavimo pobd, organizuotos sistemos gali bti skirstomos : Komandinius (loginius) automatus. Reguliatorius arba stabilizatorius. Sekimo, arba servosistemas. Programinio valdymo sistemas. Optimalaus reguliavimo sistemas. Prognozinio valdymo arba antisipacines sistemas. Adaptyvisias arba adaptyviojo valdymo sistemas. Kartais dar iskiriamos savitvarks (self-organizing) sistemos, save referuojanios (self-refering), autopoetins (autopoietic), gaminimosi (self-production), sudtingos (complex), chaoso (chaotics) ir kitos sistemos.

207
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

4.10.1. Komandiniai (loginiai) automatai Komandinis automatas tai paprasiausia tiesioginio valdymo ar dekodavimo organizuota sistema, vykdanti santykinai nustatyt veiksm pagal tam tikr login slyg, login funkcij. Funkcin tokio automato schema pateikta 4.30 pav. Komandinis automatas yra primityvaus loginio valdymo sistema, kuri vykdo santykini veiksm operacijas. Komandiniai automatai gali neturti atminties struktr ir jas turti. Paprastas loginis automatas, neturintis atminties, yra santykin vykdomoji grandis, pavyzdiui, jungtukas. Jeigu atsiranda signalas, neantis informacij, jis jungia ar sustabdo virsm (virsmus). Tokio automato pavyzdys miesto apvietimo jungimo ir ijungimo sistema vakare sutemus ar ryte pravitus. Panaios gyvojo pasaulio reakcijos yra fototaksis ar tam tikr vabzdi ir moliusk reagavimas vies. Sudtingesnis komandinio valdymo automatas, turintis atminties struktras, gali reaguoti ne tik paprastus i iors atjusius signalus, bet atliks tarpinius perkodavimus, turi vairesni funkcini galimybi, gali vykdyti sudtingesnes logines funkcijas. Juo didesnis informacins atminties talpis, juo didesnis sistemos galim bsen kiekis, juo didesn tokio automato funkcin vairov. Dar sudtingesnse sistemose gali keistis atminties struktra, t. y. kauptis patirtis. Tai priklauso nuo jimo signal atjusios informacijos. Atj signalai gali keisti atminties struktrose atliekamus perkodavimo algoritmus. iuo atveju organizuota sistema gyja tam tikr paprasto mokslaus, ar adaptyviojo, automato savybi. Komandinio valdymo automatams kurti ir aikinti vartojama speciali automat teorija. ios teorijos pagrindas matematins logikos teorija. Pastebtina, kad automat teorija buvo pltojama bandant aikinti nerv sistemos, neuronini tinkl veikl. iuo metu nagrinjami determinuotieji, tikimybiniai, nerykiosios logikos (fuzzy, Zadhe) automatai, kuriais aikinama daugelio biologini sistem funkcin veikla.

ATMINTIS INFORMACIJA VIRSMAI INFORMACIJA VIRSMAI

4.30 pav. Paprasiausios organizuotos sistemos komandiniai (loginiai) automatai, neturintys atminties ir turintys atmint

208
BIOFIZIKA

4.10.2. Reguliavimo sistemos (reguliatoriai ir stabilizatoriai) Sistemos (automatai), kurios palaiko tam tikrus savo parametr ar kintamj dydius nekintamais, pastoviais, keiiantis aplinkos savybms, grtamuoju ryiu, t. y. informacija apie i sistemos dydi pokyius, vadinamos reguliatoriais ar stabilizatoriais. Kaip ir komandinio valdymo sistemos, reguliatoriai taip pat turi paprasiausi informacijos primimo, perdirbimo ir siuntimo, t. y. informacinio valdymo, struktras (4.8 pav, 4.9 pav., 4.29 pav.). Informacinio valdymo struktra i receptori (sensori) gauna informacij apie esamus reguliuojamojo dydius. i informacija signal forma perneama lyginimui struktr, kurioje yra reikiamo dydio pavyzdys (etalonas) siekiamojo tikslo dydio stabili informacija. Pagal lyginimo rezultat, ar reguliojamasis dydis yra maesnis, ar didesnis u siekiamojo tikslo (etalono) dyd, neigiamuoju grtamuoju ryiu itekliai nukreipiami: reguliuojamajam dydiui didinti jeigu maesnis, arba mainti jeigu didesnis. Reguliatoriaus valdantysis posistemis perjungindamas sistemos bsen vien i dviej galim bsen, gali perdirbti ne daugiau kaip vien bit informacijos. Tokiu bdu sistema reguliuojamj dyd palaiko artim reikiamam tikslo dydiui, sakoma stabilizuoja. Organizuota sistema reguliatorius, kurios valdantysis posistemis perdirba apie vien bit informacijos, sugeba gyvendinti paprast valdymo tiksl dydio palaikymo pastoviu, nekintamu. Akivaizdu, kad grtamasis ryys yra informacijos kanalas, vykdantis paprasiausi informacinio lyginimo procedr. Toki sistem veikl nagrinja automatinio reguliavimo teorija. Automatinio reguliavimo teorija akivaizdiai rodo, kad grtamojo ryio informacinio valdymo principas visada reguliuoja su tam tikra paklaida. Taiau didinant grtamojo ryio jautrum, paklaid galima sumainti iki norimo mao dydio. Tokios organizuotos sistemos yra tikslingai veikianios, nes j valdaniajame posistemyje, jo atminties struktroje, yra informacija apie siekiam reguliuoti dyd. Jeigu io tikslo dydis keiiasi, reguliavimo sistema pavirsta sekimo (servomechanizmu) ar programinio valdymo sistema. 4.10.3. Sekimo sistemos (servosistemos) Sekimo sistema tai organizuota sistema, kuri stengiasi kartoti (mgdioti) tam tikras veiklos formas ar aplinkos vyksmus. Reguliatoriaus veiklos principais veikianti sekos sistemos tikslo funkcija yra u sistemos rib, iorje aplinkoje, stochastikai kintantis dydis X0(t). Tokios sistemos valdomasis dydis X iuo atveju stengsis mgdioti aplinkos dyd, t. y. siekti tikslo, kad bt X(t) = X0(t) (4.8 pav., 4.9 pav.). Informacij apie sekimo arba tikslo funkcij X0(t) organizuota sistema gauna per receptorines (sensori) struktras, kurios signalais perduoda valdomojo posistemio
209
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

lyginimo struktrai. ioji, informacijos lyginimo struktra, vertinusi tikslo funkcijos ir tikrosios situacijos neatitikimus, reguliatoriaus neigiamojo grtamojo ryio principu neatitikimo dyd maina, artina nuliniam dydiui. Tokiu bdu sekimo sistema mgdioja iorin vyksm. Sekimo sistemos daniausiai valdomos tik grtamojo ryio principu. Jos gali turti ir tam tikras tiesioginio informacinio valdymo prognozuojamsias struktras, kurios padaro sekimo procedras greitesnes. Tai tipikos mgdiojimo ar kopijavimo sistemos, plaiai taikomos technikai. Labai panaiai elgiasi gyvnai ir mons. Pagrindinis sekimo sistemos reikalavimas kaip ir reguliavimo sistem mainti paklaidas. Tikslas, tikslo funkcija X0(t), daniausiai bna atsitiktin funkcija. Todl pagrindinis visos sekimo sistemos reikalavimas darnus vis sistemos grandi greitas veiksmingumas, kuo dinamikesns savybs. Jos turi bti ne ltesns, palyginus su iorinio sekamojo vyksmo greitumu turti geresnes dinamines savybes. Dinamins sekimo sistemos savybs vertinamos amplitudinmisfazinmis charakteristikomis. Atsivelgiant jas, vertinamos sistem greito veiksmingumo galimybs. Sekimo sistemos, papildomai turinios atminties struktras, gali vyksmus numatyti (prognozuoti) ar net kaupti informacij patirt. Tokios sekimo sistemos gali kurti aplinkos modelius ir formuoti naujus veiklos algoritmus. Jeigu sekimo sistemos tikslo funkcija yra ne iors vyksmas, bet jos vidaus atminties struktroje urayta tikslo funkcija ar programikai keiiam tikslo dydi seka, tokios organizuotos sistemos vadinamos programinio valdymo sistemomis. 4.10.4. Programinio valdymo sistemos Programinis valdymas tai organizuotos sistemos veiksm valdymas, atsivelgiant valdaniojo posistemio atmintyje esamus veiklos modelius programas siekiant tam tikr tiksl. Taip veikia grtamojo ar miraus (kombinuoto) valdymo sistemos, kuri tikslai keiiami nuosekliai programikai, sistem paveikus tam tikrais ioriniais poveikiais. Paprasiausios programinio valdymo sistemos funkcins organizacijos schema pavaizduota 4.31 pav. Programinio valdymo sistema yra reguliavimo sistema, kurios tikslai vis laik keiiasi programikai. Valdomasis posistemis valdaniojo posistemio tikslo informacijos keitimais veriamas priimti vis naujas ir naujas bsenas. Iorinio poveikio reikm jai yra tik vyksmo pradios signalas. Tiksl keitimo tvarka programa yra paios sistemos viduje, valdaniojo posistemio atminties struktrose nulemta i anksto. Iorinis poveikis atlieka tik programos paleidimo pradms (starto) funkcijas. Programinio valdymo sistemos gali bti tiesioginio valdymo ir/ar valdomos grtamojo ryio informacija. Paprasiausia programinio valdymo sistema yra komandinis (loginis) automatas, turintis atmint. Tokia valdymo sistema neturi grtamojo ryio.
210
BIOFIZIKA

INFORMACIJOS

SRAUTAI

ATMINTIS PROGRAMOS A P L I N K A
PRADMS SIGNALAS

TIKSLAI

X0

REGULIATORIUS X0 X(t)

ITEKLIAI

MEDIAG ir ENERGIJOS VIRSMAI

VEIKSMAI X(t)

TARA

4.31 pav. Programinio valdymo sistema

Akivaizdiausi programinio valdymo biologiniai vyksmai yra: augalo ar grybo augimas, embriogenez, morfogenez, vabzdi elgsena ir pan. Gyvojoje gamtoje, esant tam tikriems ioriniams veiksniams, danai stebima tokio pobdio programika elgsena. Gyvn elgsenos tyrintojai etologai vabzdius, remdamiesi j elgsenos pobdiu, net vadina program respublikomis, o moliuskus tik refleks respublikomis. Aiku, sudtingesns programinio valdymo sistemos funkcin struktr btinai turi eiti atmintis. Joje koduota forma yra uraytas tam tikr igyventi reikaling program komplektas. Atsivelgiant aplinkos ir sistemos vidin bsen, gali bti pradedama vienos ar kitos programos veikla. 4.10.5. Optimalaus reguliavimo sistemos Gamtoje danai stebimi organizm elgsenos reikiniai, rodantys j savyb susirasti tinkamiausias optimalias funkcionavimo bsenas. Technin kibernetika kuria optimali bsen iekojimo sistemas optimalius reguliatorius, kitaip dar vadinamus optimizatoriais. Optimalaus valdymo atvejais turi bti parinktas ar pasirinktas optimalumo kriterijus . Tai gali bti maiausias itekli sunaudojimas gyvendinant tiksl, trumpiausiu keliu ar greiiausiai pasiekti tiksl, ir pan. Optimalaus reguliatoriaus tikslas ne konkretus dydis, bet kriterijaus maksimumas ar minimumas, t. y. toks reguliatorius turi rasti toki dekoderio itekli valdymo bsenos padt, kad sistema funkcionuot didiausiojo (maksimumo) ar maiausiojo (minimumo) reimo slygomis (4.32 pav.).
211
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

3 2 1
17 15 13 9 8 2 3 1 4 10 11 6 5 12

X0

Xopt

4.32 pav. Optimalumo kriterijaus funkcija, jos slinktys ir optimumo iekojimo ingsniai

Aiku, tarp kriterijaus ir valdomojo sistemos parametro X, yra netiesin priklausomyb, turinti maksimum arba minimum. Jis gali slankioti, kisti tai priklauso nuo daugybs neinom iorini ar/ir vidini prieasi. Nepaisant i prieasi, sistema turi surasti t optimumo viet Xopt , kad ios, geriausios bsenos padt palaikyt net ir optimumui kintant. Tokios valdymo sistemos funkcin organizacija turi turti bsenos paiekos, arba iekojimo informacin struktr, kuri vertint kriterijaus kitim keiiantis sistemos bsenai. Todl vis laik itekli kreipiklis dekoderis daro maus ingsneli pokyius X. Po tam tikro laiko, dl sistemos inertikumo pakitus XX, pakinta ir kriterijaus dydis. Informacin optimumo iekojimo struktra, vertinusi kriterijaus poslinkio enkl ir ingsnelio X krypt(enkl), priima sprendim dl kito veiksmo: ingsniuoti ta paia kryptimi, jeigu kriterijus pakito norima tendencija, arba keisti ingsnelio krypt (enkl), jeigu kriterijus pakito ne siekiama tendencija (atsivelgiant siekiamo kriterijaus pobd maksimizuoti ar minimizuoti kriterij). Pavyzdiui, esant pradinei bsenai X0 padaromas ingsnelis 1. Kriterijaus dydis sumaja, todl ingsnelis 2 keiia enkl, einama atgal, ir dar daug ingsneli 3, 4, 5 ta paia didinimo kryptimi, kol kriterijaus dydis pradeda mati. Kriterijui sumajus, vl pakeiiamas ingsnio X enklas prieinga kryptimi. Ir taip dl toki iekojim sistema klaidioja svyruoja optimumo Xopt aplinkoje, net ir optimumo dydiui ir vietai kintant. Jeigu optimizuojama pagal kriterijaus ne didiausij (ne maksimali), bet maiausij (minimali) kriterijaus reikm, t. y. kriterijaus funkcija ne kalnas, o duob, tada vykdomas toks pat optimumo iekojimo algoritmas, tik keiiama ingsnelio X
212
BIOFIZIKA

INFORMACIJOS

SRAUTAI X

OPTIMUMO IEKOJIMO
INFORMACIN STRUKT RA
TIKSLAS X0 + ( X)

A P L I N K A
ITEKLIAI

REGULIATORIUS X0 + ( X) X(t)
MEDIAG ir ENERGIJOS

X
X(t) VEIKSMAI

VIRSMAI
TARA

4.33 pav. Optimalaus reguliavimo sistemos funkcin schema

enklo taisykl prieinga: ingsnelio enklas keiiamas dydiui padidjus, ir paliekamas tas pats sumajus. Optimalaus reguliavimo sistemos funkcins organizacijos schemoje, be vis reguliatoriams bding sudedamj dali, dar turi informacin optimumo paiekos struktr (4.33 pav.). Ji turi gauti informacij apie dekoderio padaryt ingsnelio X ir sensori bei koderio vertinamojo kriterijaus kryptis (enklus). i informacij apdorojusi optimumo iekojimo struktra priima sprendim apie kito ingsnelio krypt. Optimalaus reguliavimo sistema suradusi optimum Xopt veikia svyruojamai, nes po kiekvieno ar dar po paskesnio ingsnelio tenka keisti jo krypt (enkl). is periodikai svyruojantis efektas pasireikia visose optimalaus reguliavimo sistemose. Jis rodo optimizatoriaus iekojimo struktros funkcionavimo dan. Toki optimumo paiek galima atlikti tam tikrais bdais ar technikos priemonmis, tobulinant reguliatori j paveriant optimizatoriumi: X ingsniukai sumuojami vertinant enklus pridedama esant pliusui, ir atimant esant minusui. Tada klasikinio reguliatoriaus tikslo X0 dyd sistema nustatyt pagal algoritm X0 + (X). Aiku, atsitiktiniai triukmai, vairiausi svyravimai imua iekojimo sistem i periodiko svyruojamojo reimo. Pagrindin ios sistemos paskirtis bti optimaliausios funkcionavimo bsenos. Jos funkcionavimo tikslumas priklauso nuo koderio, dekoderio ir informacini struktr tikslumo, jautrumo ir dinamini j savybi. Sudtingesns optimalaus reguliavimo sistemos vienu metu gali optimizuoti ne pagal vien, bet pagal kelius vertinamus dydius. Tam reikalingos sudtingos informacij perdirbanios struktros, daniausiai kompiuteriai.

213
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

4.10.6. Anticipacins prognozuojaniosios sistemos Gyviesiems organizmams, ypa auktesnio organizacijos lygio gyvnams, iltakraujams, bdinga elgsenos savyb veikti numatant ateit (prognozuojant). Tai bdinga organizuotoms sistemoms, kuri veikl lemia informaciniai modeliai, vertinamos bsimj situacij galimybs valdoma prognozuojant. Pastaraisiais deimtmeiais, R. Rozeno iniciatyva tokios sistemos vadinamoms anticipacinmis. Anticipacins sistemos funkcins organizacijos schema pateikta 4.34 pav. Aiku, joje turi bti informacins struktros, sugebanios kurti ne tik savos sistemos, bet ir aplinkos modelius. Pagal juos organizuota sistema gyja savyb numatyti bsim vyki galimybes ir parengti programas, planus atitinkamoms funkcijoms. Visi ie modeliai informacija koduot signal forma urayta atitinkamose atminties struktrose. Nekelia joki abejoni, kad veiksmingos anticipacins sistemos geba nusprsti, vertindamos aplinkos ir paios savo modeli santykius. Anticipacins sistemos funkcins organizacijos struktra nuo anksiau aptart organizuot sistem skiriasi tuo, kad turi informacinio modeliavimo ir prognozavimo struktr, didel atmint. Tai yra miraus (kombinuoto) valdymo organizuotos sistemos, vertinanios informacij, gaunam ne tik i aplinkos specialiais koderiais (receptoriais, jutimo organais, sensoriais), bet ir i vidini koderini struktr, vertinani paios sistemos esam bsen. Be to, kad anticipacin sistema tikimybikai numatyt galimas situacijas, j galimybes ateityje, jos atmintyje turi bti sukaupta ir vis laik kaupiama patirties infor-

INFORMACIJOS

SRAUTAI

ATMINTIS APLINKOS M O D E L I A I

A P L I N K A

PROGRAMOS
PROGRAMINIS VALDYMAS

TIKSLAI REGULATORIAI
SISTEMOS MODELIS

ITEKLIAI

FIGURE 12. An organized anticipatory MEDIAG ir ENERGIJOS Fig. 5. Life as an organized VIRSMAI

Veiksmai X(t)

8.34 pav. Anticipacin organizuota sistema

214
BIOFIZIKA

macija. Ir i informacija turi bti ne enciklopedin, ne idealiai virtualiai atkartojanti buvusias situacijas, bet turi sugebti buvusias situacijas atspindti modeliuoti apibendrintai sukurti naujas organizuotos sistemos veiklai bdingas savybes. Tokiu bdu anticipacin sistema yra labai veiksminga informacijos kaupimo ir apibendrinimo sistema. Dl to ji yra evoliucionuojanti ir adaptyvi organizuota sistema. 4.10.7. Adaptyviosios sistemos Adaptyviosiomis, arba prisitaikaniosiomis, sistemomis vadinamos tokios organizuotos sistemos, kurios keisdamos savo struktr pagerina bties stabilum. Vidaus struktros kitimus gali sukelti pakitusios iors slygos. Vidaus struktra gali kisti vis laik keiiantis ar ir nesikeiiant aplinkos slygoms, kaip ir optimizavimo sistemose. Visais atvejais adaptyviosioms sistemoms bdingas sugebjimas siekti tam tikr strategini tiksl. Strateginiai j tikslai nekinta, kinta tik tiksl siekimo keliai, metodai, veiklos algoritmai. Adaptyvija sistema laikoma visa gyvoji gamta, tam tikros populiacijos ir organizmai. Tai biologijos svoka, kuri pastaraisiais deimtmeiais vartoja ir kibernetika. Taip pat yra kuriamos adaptyviosios technologins sistemos. Kibernetikos teorija nagrinja dvi adaptacijos ir adaptyvij sistem sampratas struktrin ir informacin: Adaptyvioji sistema struktros poiriu tai sistema, kuri keisdama savo vidin struktr, struktrin organizacij, gerina veikmingum kintamomis aplinkos slygomis. Adaptyvioji sistema informaciniu poiriu tai sistema, kuri keisdama savo valdymosi (funkcionavimo) algoritmus gerina veiklos veiksmingum kintant aplinkai. sigilinus, abu ie adaptyvij sistem vertinimai reikia t pat. Tik pirmuoju poiriu pabriama sistemos struktros pokyi svarba, antruoju informacin valdomoji veikla. Adaptyvioji sistema yra organizuota sistema, t. y. sudaryta i valdaniojo informacij apdorojaniojo posistemio, ir valdomojo vykdanio mediag ir energijos virsmus posistemio, todl abiej samprat skirtumai slypi posistemiuose. Vertinant struktros poiriu daugiausia dmesys skiriamas mediag ir energijos virsm veiklai, o informacinio algoritmo poiriu valdomajam posistemiui (8.35 pav.). Sistem vertinant mediag ir energijos virsm dinamika, pagrindin dmes skiriant vykdomajam posistemiui, jos veikla apraoma netiesinmis dinaminmis lygtimis. Tokios adaptyviosios sistemos matematinis modelis bendruoju atveju btu uraytas kaip n-tosios eils vektorin diferencialin lygtis:
an ( X , t ) dnX d n 1 X d2X dX + a n 1 ( X , t ) n 1 + ... + a 2 ( X , t ) 2 + a1 ( X , t ) + a 0 ( X , t ) X = P (t ), n dt dt dt dt

215
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

INFORMACINIS VALDYMO POSISTEMIS ADAPTACINIS POVEIKIS


VALDOMASIS POSISTEMIS

P(t)

ITEKLIAI

MEDIAG ir ENERGIJOS VIRSMAI

VEIKSMAI

X(t)

8.35 pav. Bendroji adaptyviosios sistemos schema

ia iorinis sistemos poveikis P(t) turi atsispindti koeficient ai (X, t) pokyiuose. Jie lemia sistemos struktr, kuri kinta bgant laikui, ir taip takoja sistemos funkcionavimui. Be to, bendresniu atveju struktros koeficientai gali kisti dl iorini poveiki P(t), arba kaip ai [X, P(t), t]. Pirmuoju atveju sistema bus grtamojo ryio adaptyviojo valdymo sistema, antruoju miraus (kombinuoto) adaptyviojo valdymo sistema. Adaptyvumo esm valdymas per struktros koeficient keitim. Jei adaptyvusis valdymas vertinamas informacinio valdymo poiriu, j veiklos algoritm keitimo poiriu, sistemai siekiant tam tikr tiksl, diferencialinis modelis bna algoritmins veiklos padarinys. Svarbiausias adaptyvij sistem klausimas yra funkcionavimo algoritmai ir j veiksmingas parinkimas kintant aplinkai poveikio funkcijai. Tokia adaptyvij sistem samprata beveik atitinka biologini sistem raidos samprat, nes struktros pokyiai siejami su pirminiais informacini program pakitimais. Tai yra, pirmiau turi pakisti informacija, vykti informacini struktr pokyiai, ir tik vliau keiiasi materialij veiksm bei vykdanij mechanizm struktros. Aiku, sistemos siekiami strateginiai tikslai ilieka tie patys. Keiiami taktiniai tiksl siekimo algoritmai. Adaptyvij sistem veikla daugiausia nagrintina biologijos, ypa biologins evoliucijos teorijos poiriais. Juk tai yra vienas pagrindini gyvosios gamtos supratimo sieki. iuo metu, vertinant biologinius reikinius, skiriami du pagrindiniai informaciniai prisitaikymo (adaptacijos) mechanizmai: genetiniai, paremti stochastiniais genetins informacijos pokyiais mutacijomis, ir nerviniai per individualiosios patirties informacijos kaupim.

216
BIOFIZIKA

4.10.8. Savitvarks (save organizuojanios) ir kitos organizuotos sistemos Kai kurios sudtingai funkcionuojanios biokibernetins sistemos vadinamos savitvarkmis (save reguliuojaniomis), moksliomis (sugebaniomis mokytis), semiotinmis ar biosemiotinmis ir panaiai. Visi ie pavadinimai atsiranda pltojant dar jaun, nauj organizuot sistem moksl kibernetik. Vos tik sukuriama originali technin informacin sistema, nagrinjamas sudtingas biologinis ar socialinis reikinys, atsiranda nauj svok naujai sistem riai apibdinti. XIX imtmetyje fizikas teoretikas Deimsas Maksvelas (J. C. Maxwell), matematikos metodais paaikins kibernetinio Deimso Uato (James Watt, 17361819) garo reguliatoriaus veiklos esm ir nordamas suprasti antientropinius savaimin entropijos mainimo (negentropijos) galimyb, pateik gradient krimo teorin model Maksvelo Demono sistem. Ji mokslo literatroje tuo metu buvo pavadinta savitvarks vardu. Jam prisireik Demono, kuris sugebt be energijos nuostoli pamatuoti molekuli judjimo greiius ir pagal tai atidarint ar udarint vartelius skirtingais greiiais judanioms dalelms. Maksvelui prireik informacinio valdymo struktros Demono. Kibernetikos mokslo atsiradimo pradioje angl kibernetikas psichiatras U. R. bis (W. R. Ashby) pateik teorin savitvarks (besiorganizuojanios) sistemos bio homeostato model. Jo sistema, sudaryta i keli (arba daugybs) struktros element, tarpusavyje susijusi keiiamaisiais ryiais (konkreiu atveju rodyklini matavimo prietais sujungt reostatais), kuri rodomos reikms gali kisti tik iki tam tikr dydi. Ryi kryptys (enklai) ir stiprumo dydiai keiiasi, priklauso nuo atsitiktinumo principu (stochastikai) besiblakani struktros element bsen, j dydiams (matavimo prietais rodyklms) atsitrenkus ribines struktros element (matavimo prietais) reikmes. bis parod, kad po tam tikro laiko toks homeostatas suranda stacionariosios bsenos padt. bio homeostatas tai netiesin dinamin sistema, stochastikai keisdama savo struktr suranda stacionarij bsen, t. y. toki bsen, kai visi elementai yra tarpins stabiliosios bsenos. ios bsenos metu n vienas elementas nra atsirms kuri nors ribin maiausi ar didiausi bsen, ir niekas nebekinta. Vadinasi, netiesin dinamin sistema, turinti tam tikr ryi keitimo algoritm, stochastikai kaitaliodama ryius, susireguliuoja suranda stabili stacionarij bsen. Sakoma savaime organizuojasi. Savitvarkmis sistemomis taip pat buvo vadinamos mokslios atpainimo, arba mokslios sistemos. Pradedant amerikieio psichologo F. Rozenblato (F. Rosenblatt) Perceptronu atsirado sistemos, modeliuojanios smegen sugebjim mokytis atpainti vairiausius regimuosius, girdimuosius ir kitokius vaizdus. Analogikai bio homeostatui, sistema keisdama ryi tarp struktros element koeficientus, gyja sugebjim klasifikuoti objektus. Tiksliau klasifikuoti objekt atspindius informacinse
217
4. Teoriniai organizuot sistem pagrindai (vadas kibernetik)

struktrose. iuos sugebjimus jos gali gyti esant mokytojui ir be mokytojo savaime funkcionuojant, per vis gyvenim. Taip aikinama mokslij, arba susitvarkanij sistem sampratos esm. Kitonikas poiris savitvarkes ir organizuotas sistemas formuojasi kuriantis disipatyvij struktr, katastrof, chaoso ir sudting (complex) sistem teorijoms. ie teoriniai tyrimai rodo, kad daugiakomponents dinamins sistemos, turinios netiesinius grtamuosius ryius, gali bti daugybje, sunkiai numatom bsen. Visos ios teorins sampratos, labai danai atsiradusios bandant paaikinti sudtingus biologinius reikinius ir sistemas, akivaizdiai rodo tikrai didiules gyvosios gamtos bsen vairoves. i bsen vairovms, kurios yra tikresni gyvybs modeliai, paaikinti atsakymo kol kas nra. Kibernetinis organizuot sistem aikinimas per funkcin tikslingum ir informacines sistem valdymo, kodavimo ir dekodavimo procedras, susiaurina teorini paiek rat kuriant gyvybs teorij, iandien pradedam vadinti ALIFE (artificial life) mokslo vardu.

218
BIOFIZIKA

LSTEL ORGANIZUOTA SISTEMA

Omnis cellule ex cellula. Visos lstels atsiranda i lstels. RUDOLFAS VIRCHOVAS, 1858

Lstel maiausia ir universali biologin organizuota sistema (organizmas). Visos lstels funkciniu poiriu yra sudarytos i dviej pagrindini posistemi valdaniojo ir mediag bei energijos virsm. Pirmoji saugo, perdirba, priima ir siunia informacij, kuri valdo antrosios veikl mediag ir energijos virsmus (mediag apykait). ie abu posistemiai veikdami kartu ir sudaro darni organizuot sistem. Jie yra reals posistemiai, todl atsispindi lstels morfologinje struktroje. iuolaikin molekulin biologija aikiai rodo, kad visi tie vyksmai yra susij su nukleorgtimis (DNR ir RNR) ir fermentais. Nukleorgtys lemia informacin valdym, organizuot lstels veikl. Fermentai ir kiti baltymai yra savitos molekuls elementai, dinamikai sujungiantys informacines procedras su mediag apykaita mediag ir energijos virsmais. Kaip rayta, lstel yra universalus visos gyvybs funkcinis elementas. Ji termodinamikos poiriu turi unikali savyb laikui bgant ne tik nesuyra, nesunyksta, bet prieingai didina organizuotum. Tai pasireikia biologinmis augimo ir dauginimosi savybmis. Be to, lstelei bdingas prisitaikomumas (adaptyvumas) sugebjimas, valdant vidaus funkcionavim, vis geriau ir geriau prisitaikyti prie nuolat kintam aplinkos slyg. Pavyzdiui, dl lstels, esanios daugialsio organizmo audinyje, paaid ar struktr susidvjimo stringant organizuotai veiklai gresia mirtis ar tis, lstelje pradeda veikti (sijungia) specialios vyksm programos, valdanios tvarking jos struktr inarstym, vadinam apoptoze. Sukuriama galimyb aplinki220
BIOFIZIKA

nms lstelms pasiimti tai, kas dar gali bti naudingai panaudota, stengiasi ukirsti keli neorganizuotam savaiminiam lastels sunykimui nekrozei. Lstel persiorientuoja apoptozei programuotai miriai. Visas ias ir daugyb kit savybi lemia lstels valdymo posistemis, informacin jo veikla. Lstels funkcins organizacijos principai atskleidia pagrindin ne tik lstels, bet ir vis organizm informacins programins veiklos svarb. iuo metu moksliniai biologijos tyrimai daugiausia dmesio skiria lstels molekulini vyksm ir mechanizm tyrimams, ir per j supratim bandoma aikinti lstels funkcionavimo esm. Taiau vis labiau pasigendama sisteminio poirio, sistem biologijos. Lstels biologij aikinant molekuli virsmais, vis didesn svarba nurodoma signalams, signalini molekuli funkcionavimo mechanizmams, reguliacijai ir valdymui, taip pat btinoms genetinio kodavimo ir dekodavimo procedroms, genetinei informacijai. Tai lemia lstels, kaip organizuotos sistemos funkcins organizacijos, aikinim. Jo esm informacinio valdymo procedr, vykdom molekuliniais virsmais, pagrindimas kibernetika. Biofizikos poiriu tik tam tikr molekulini struktr funkcin organizacija, pagrsta informaciniu valdymu, gali padti suprasti lstels ir gyvybs esm. Lstels geba palaikyti didiul organizuotum chaotikoje gamtoje. Tai priklauso nuo molekulini signal ir genetins informacijos, genetini program veiklos procedr valdant mediag apykaitos vyksmus. Tuo pripastama, kad lstel yra organizuota sistema. Tokiu atveju funkcin lstels organizacij lemianti vertyb yra genetin informacija, kuri saugoma tam tikrose lstels struktrose. ios genetins informacins struktros pasireikia ne kaip nekintamos (statikos) struktrins bsenos, bet veikia dinamikai funkcikai tikslingai tam tikrose vietose, tam tikromis aplinkybmis, tam tikru momentu tai jungiant, tai ijungiant tam tikrus genus. Taip funkcikai tikslingai lstels yra valdomos. Lsteli funkcijas vykdantys mechanizmai biochemins reakcijos. Tokiu bdu i fizikini ir chemini vyksm tam tikrais principais sudarytos dinamins struktros sukuria kokybikai naujas, visikai kitonikas savybes turinias sistemas, vadinamas lstelmis. Jos ir lemia tai, k mes vadiname gyvas. Lstels ir kit, auktesns organizacijos biologini vyksm esm pradedama grsti ne vien fizikiniu bei cheminiu poiriu per mediag ir energijos virsmus, bet ir kibernetiniu, signal, informacinio valdymo poiriais, kodavimo ir dekodavimo procedromis. Aikinamajam lstels modeliui keltini ie reikalavimai: lstel turi bti patikimai atribota nuo aplinkos, bti savarankika (autonomika) erdvskyra, nes tik ribotoje erdvje galima sukurti entropij mainani struktr, todl lstel turi sugebti imti i aplinkos kokybikas mediagas ir laisvj energij, todl
221
5. Lstel organizuota sistema

lstelje turi bti veiksmingos informacinio valdymo struktros, kurios turi gauti informacij apie aplink ir ja remiantis priimti sprendimus veiklai, kuri lemt jos ilikim atsikuriant ir auginant vis laik nykstanias struktras bei susinaikinant ar gaminant panaias lsteles. Vienas pirmj bandym teorikai, teorins sintezs ar dedukciniu metodu paaikinti lstels, kaip mainos, ypating savyb daugintis ir keistis, yra Dono von Noimano save gaminanio automato modelis. is modelis nebuvo tiesiogiai skirtas biologins lstels funkcinei organizacijai aikinti, taiau iuo metu biosistem teorija Noimano automato, kuris gamina savo kopijas ir tobulinasi, model pateikia kaip vien i teorins biologijos hipotezi.

5.1. NOIMANO AUTOMATAS LSTELS MODELIS

Remiantis Neumano teorija, mainos S, sugebanios gaminti savo kopijas ir jas tobulinti, privalo turti 3 sudedamsias funkcines dalis (5.1 pav.): A gamybos ir pernaos priemones; I nuorodas apie gamyb (dabar vadinama technologine programa, informacija) bei ias nuorodas saugani atminties struktr; K nuorod kopijavimo struktras.
A2 A1

A0
ITEKLIAI

GAMYBOS DALIS
ATLIEKOS I0 NUORODOS (INFORMACIJA) IM IS K0
NUOROD KOPIJAVIMO SRUKTRA

APLINKOS ATSITIKTINIAI POVEIKIAI NUORODOMS

5.1 pav. Noimano automato S mainos sugebanios gaminti savo kopijas ir kopijas tobulinti, funkcin schema

222
BIOFIZIKA

To pakanka, kad maina gamint tikslias savo kopijas. Bet iuo atveju kopijos nesikeis, t. y. neturs galimybs tobulti. Kad ji gyt galimyb keistis, jos nuorod struktra turi susidti i dviej dali: patvari, nekintam nuorod struktr IS , ir galini kisti nuorod IK : I = IS + IK . Tada S = A + I + B = A + (IS + IK ) + K. Noimanno teorikai sugalvotas automatas (maina), sugebantis daugintis ir keistis, anksiau nei buvo nustatyta lstels DNR ir genetinis kodas, akivaizdiai parod, kad tokia sistema privalo turti atminties struktras (nuorodas I ). Jose bt uraytas technologinis gamybos projektas. Aiku, tai yra informacija, urayta tam tikra koduota forma. Taip pat tokios mainos veikla nemanoma be gamybos ir pernaos priemoni A. Jos i aplinkos paima iteklius, pernea gamybos proceso metu ir atliekas imeta aplink. Treioji btina sudedamoji dalis speciali gamybins informacijos, gamybos modelio (projekto) I kopijavimo K struktra. Taip vertinant, automato dauginimosi esm yra informacija, automato gamybos modelio (projekto) I kopijavimas ir dauginimas. Nuorod kopijavimo struktra K gija didiul svarb. Dauginantis, gaminant sav kopij, pirmiausia turi bti kopijuojamos ir dauginamos nuorodos. Aiku, tai informacini technologij programos. Pagal nukopijuot pirminio A0 automato nuorod informacij gaminamas antrinis automatas A1. Tokiu bdu atliekamos grandinins dauginimo procedros. Teorinis automatas, galintis bti gyvybs modeliu, privalo turti savyb keistis, evoliucionuoti. Todl atmintis arba informacini nuorod struktros sudaromos, kaip minta, i dviej dali nekintamos IS ir keiiamos IK , kur I = (IS + IK). Nekintamos nuorodos IS informacija lemia automato r, o kintamoji IK dalis lemia atsitiktines arba kryptingas kaitas. Akivaizdu, kad Noimano automato funkcins organizacijos esm informacijos dekodavimas. Koduoto nuorod informacinio projekto ar technologins programos formavimosi principai iame darbe neaptariami. Nra jokios abejons, kad biologin lstel funkcionuoja remdamasi iais principais.

5.2. BENDROJI BIOLOGINS LSTELS STRUKTRA

iuo metu ini, bandymo duomen net apie pai paprasiausi lstel yra tokia daugyb, kad kyla dideli sunkum visa tai sistematizuojant. Duomen vis daugja. Todl ikyla lstels teorijos lstels, kaip biologins sistemos poirio poreikis. No223
5. Lstel organizuota sistema

rint suprasti ir vertinti duomen reikm suprantant funkcin lstels organizacij, lstels esm, btina ias inias susisteminti schematizuoti organizuot sistem teoriniu poiriu. Reikia iskirti pagrindines funkcins veikos struktros dalis ir irykinti j santykius, funkcin j paskirt. Jau tradicin biologija pateikia lstels schemas ir pabria genetins informacijos svarb. Paprasiausios prokariotins lstels apibendrinta struktra pateikta 5.2 pav., o sudtingesns eukariotins 5.3 pav. Remiantis Noimano automato ir organizuotos sistemos konceptualiniu poiriu, galima iskirti morfologini lstels struktr funkcines paskirtis. Vidinje lstels dalyje esantys fermentai atlieka A struktr funkcijas: perdirba mediagas, vykdo energijos virsmus, lemianius funkcikai tiksling sintez ir mediag pernaas. Laisvj energij lstelei teikia chlorofilai kartu su tilakoid struktromis, vykdo fotosintez. Kai kurios lstels iai funkcijai atlikti naudoja rodopsinus, isidsiusius paviriuje. Jie gali atlikti ir jutimin viesos funkcij, kaip informacijos signal suklikliai, fotoreceptoriai, lemiantys organizmo elgsen, pavyzdiui, fototaksius. Mezosomose, manoma, vyksta biologiniai energijos vyksmai, aprpinantys lstel didiaergini ryi molekulmis. iomis molekulmis energija tiekiama universalia chemini ryi forma. J organizmas lengvai gali versti visomis kitomis organizmui reikalingomis energijos rimis. Pavyzdiui, tokia energija varomos lsteli mechaninio judjimo organels iueliai ir blakstienls. 5.2 pav. Bendroji prokariot lstels schema Mediag itekliai tiekiami ir atliekos alinimos pro membranas, ribojanias lstels erdvskyr nuo aplinkos. Memranos nra pasyvios struktros. Jose yra daug speciali atrankiosios molekuli pernaos struktr pr ir aplink vertinani molekulini koderi receptori. Organizuot sistem teorijos poiriu, turt bti ir receptori, vertinani lstels vidaus molekulin struktr. Remiantis i receptori reakcija, gaunama informacija valdo mediag mim i aplinkos ir atliek ali5.3 pav. Bendroji eukariot lstels schema
224
BIOFIZIKA

nim. Lstels centre yra DNR arba RNR molekuls atminties molekulins struktros, kuriose yra lstels vyksm valdymo informacija lstels biotechnologins programos. i informacija valdo visus lstels vyksmus ir procedras dekodavimo principu. Vis reikiam funkcini program darn vykdym, j traukim aktyvinim ar vykdymo draudim (tildym), nutraukim slopinim galima aikinti kaip tam tikro programinio automato, programinio valdymo posistemio veikl. Eukariotins lstels bendroji schema yra daug sudtingesn. Tai simbiozin prokariotini lsteli sistema, sudaryta i funkcionuojani organeli. Jos turi savas nukleorgi struktras, kuriose slypi j veiklos valdymo informacija. Chemins energijos gamyba fotosintez vykdoma plastidse. Specializuotos kvpavimo organels mitochondrijos yra energijos didiaergini chemini ryi ATP sintezs stotys. Bdinga, kad beveik visos organels turi savas nukleorgtis (NR).Vadinasi, visos organels, kaip funkcins dirbanios struktros, yra valdomos autonomikai, t. y. turi savas informacinio valdymo ir dekodavimo programas, esanias DNR ar RNR atminties laikmenose. Be to, j veikla signaliniais informaciniais ryiais yra sujungta su paia svarbiausia informacinio valdymo struktra branduoliu. Jame yra susikaupusios centrinio valdymo genetins atminties struktros chromosomos. Tai pagrindinis eukariotins lstels valdymo posistemis, kurio atmintyje yra vis kit dali koordinavimo programos. Be to, iose informacins atminties struktrose yra ir mitozs nuorod kopijavimo programos. Jos aktyvinamos paleidiamos funkcionuoti susidarius reikiamai vidinei lstels bsenai. Eukariotinse lstelse mediag ir energijos pagrindini virsm funkcins struktros, kaip ir prokariotini lsteli, yra citoplazmoje, vairiausi fermentini reakcij tinklai. Analogikai mediag perna tarp aplinkos ir lstels atlieka iorins membranos signalais valdomos pr struktros. Eukariotinse lstelse visa citoplazma pripildyta daugybs prisiraizgiusi membran. Jose yra tkstaniai vairiausi, funkcikai prasmingai sujungt fermentini reakcij tinklas. Visi i fermentini reakcij tinklai yra darniai organizuoti. Juos lemia valdo nukleorgi atminties struktrose esanti informacija. Be to, ferment sukurt reakcij produktai signaliniais grtamaisiais ryiais reguliuoja ir valdo kit susijusi fermentini reakcij vyksmus.

5.3. LSTELS GYVAVIMO CIKLAI VALDYMO BIOLOGINE INFORMACIJA PROCEDROS

Lstels gyvavimo ciklas rodo jos biologini informacijos (bioinformacini) technologij vyksmus ir procedras. Po prastos mitozs atsiradus naujai lstelei, jeigu lstel neukonservuojama G0 fazs bsena, prasideda informacins m-RNR ir gamybos priemoni reikiam ferment sintez, vadinama lstels ciklo G1 faze (5.4 pav.).
225
5. Lstel organizuota sistema

5.4 pav. Lstels gyvavimo ciklas ir ciklo bsen fazi valdymas signalinmis molekulmis ciklinais schema

ios fazs metu lstel labai auga ir dauginasi organels. Tokias procedras, kaip ir per kitas lstels ciklo fazes, valdo specialios baltym molekuls ciklinai. Jie sudaro kompleksus su kitomis specialiomis kiekvienos lstels fazs baltym kinazmis. Po tam tikro laiko, pasiekus atitinkam lstels brandos lyg, G1 faz keiiasi S faz. Lstel pradeda rengtis dalijimuisi pradeda veikti informacijos kopijavimo struktra, prasideda DNR sintez replikacija. Matomas chromosom dvigubjimas. ias biologini informacijos technologij procedras atlieka gamybos priemons specials fermentai. J sintezei reikaling informacij tiekia informacins m-RNR. Be to, vyksmams valdyti atsiranda papildomai specializuotai aktyvinti ciklinai, kuri santykiniai dydiai ir lemia procedr kait. Pasibaigus chromosom dvigubinimo bioinformacinei procedrai, lstel pereina nauj G2 faz. Jos metu atliekami parengiamieji biotechnologiniai veiksmai bsimam lstels dalijimuisi. Dalijimosi procedra susideda i dviej procedr mitozs ir citokinezs. Mitozs metu pagrindinio valdymo branduolio informacins struktros dvigubinasi. is vyksmas susideda i keli nuosekliai atliekam procedr profazs, metafazs, anafazs ir telofazs. Tai akivaizdi mechanikai valdomo biotechnologinio vyksmo eiga, kopijuojant centrinio informacinio valdymo struktras. Citokinez, kita po mitozs lstels faz, yra pagrindini mediag apykaitos gamybos struktr dalijimosi procedra. Dl jos susidaro dvi savarankikos antrins lstels.
226
BIOFIZIKA

Nekelia abejoni, kad lstels gyvavimo ciklas turi daug informacini valdymo procedr. J metu reikia ne tik speciali signalini molekuli, pavyzdiui, ciklin, bet ir kitoki molekulini signal virsm, kaip lstel skatinanio veiksnio (MPF) ar kit aktyvum reguliuojani veiksni. Lytini lsteli, gamet, formavimo procedros vykdomos panaiais valdymo principais. Oocito mejozs valdymo ciklo metu pastebimi dviej tarpini pertrauk etapai: pirmoji pertrauka profazs ir antroji metafazs metu. Specialios signalins procedros stabdo lytini lsteli dalijimosi procedras ir laukia signal i iors. Pavyzdiui, i antrosios pertraukos tolesn lytins lstels vystymsi iveda apvaisinantis spermatozoidas. Akivaizdu, kad lstels ciklo vyksm analiz rodo lemiam informacin signalin valdymo veikl, kuri neatsiejama nuo kodavimo ir dekodavimo procedr. Danai lstels bioinformacinio kodavimo ir dekodavimo procedros aikinamos tik transliacijos baltym sintezs vyksmais. Taiau informatikos teorijos poiriu baltym sintez yra tik maa kodavimo ir dekodavimo procedr dalis, perkoduojanti genetin informacij, urayt nukleorgtyse 4 simboli kodu 20-ties simboli baltym kodavimo sistem. Signalini molekuli, ciklin, molekulini lstels receptori ir kitoki informacines procedras vykdani struktr iaikinimas akivaizdiai rodo lstels bioinformacins valdymo veiklos svarb. Virus sugebjimas sijungti lstels genetins atminties DNR ar RNR informacinius mechanizmus gali bti suprantamas ne tik kaip parazitizmas, bet ir aikintinas genetins informacins atminties talpio didinimo procedra. Apskritai, pavyzdiui, lstels ciklo schem (5.4 pav.) vertinant kitu poiriu, galima pastebti jame vyraujanias informacinio kodavimo ir dekodavimo procedras. Lstels gyvavim galima vertinti kaip vientis bioinformacini technologij vyksm. Jo metu vis laik sintetinamos (gaminamos) molekuls, sauganios, perdirbanios, priimanios informacij kaip valdanios ne tik informacines procedras, taip pat ir mediag apykaitos vyksmus.

5.4. LSTEL INFORMACINIO VALDYMO ORGANIZUOTA SISTEMA

Remiantis gausia lstels faktine informacija ir organizuotos sistemos poiriu, lstels vyksmus ir procedras galima scheminti (5.5 pav.). ios schemos poiriu lstelse vyksta informacin sklaida trimis pagrindinmis kryptimis: mediag ir energijos apykaitos vyksm valdymas, mitoz ir mejoz. Visos lstels gyvena kit lsteli aplinkoje, todl jos turi ir daugiau specializuot informacini signalini ryi su aplinkinmis lstelmis. Taiau tai ne pagrindins, antraeils lstels informacins funkcins organizacijos struktros, kurios bdingos tik tam tikr, specializuot lsteli aplinkai.
227
5. Lstel organizuota sistema

NAUJA LSTEL

SPOROS SKLOS

KITA LSTEL

Lytins lstels Gametos

MITOZ

INFORMACIJOS KOPIJAVIMAS INFORMACIJOS KAUPIKLIS

MEJOZ

PATEIKIAMA INFORMACIJA A P APLINKOS INFORMACINIS TRIUKMAS L I N K A VEIKSMAI

D NR
BIOTECHNOLOGINIS PROJEKTAS

VIRUSAS

. INFORMACIJA

BIOTECHNOLOGINIS VYKSMAS

ITEKLIAI

MEDIAG ir ENERGIJOS VIRSMAI DEKODAVIMAS

(FERMENTINS REAKCIJOS)

TARA

5.5 pav. Informaciniai lstels vyksmai ir lstels biotechnologini projekt dekodavimas valdymas

Mediag ir energijos virsmai yra informacija valdom dekodavimo procedr padarinys. Tai aikinama prasta gen raika (gen ekspresija). Kiti du informacijos kopijavimo ir plitimo keliai yra itirti klasikins citologijos, kaip mitozs ir mejozs vyksmai. Lstel termodinamikos poiriu yra atvira sistema. Ji keiiasi su aplinka ne tik mediagomis ir energija, bet ir informacija. Pavyzdiui, virusai, patek lstel, siterpia pagrindin genetin lstels informacin struktr, parazitikai traukia molekulinius jos gamybos mechanizmus savo genetinei struktrai dauginti. Kartu yra didinama informacijos kaupiklio DNR ar RNR informacijos talpis. Lytinio dauginimosi ir
228
BIOFIZIKA

mejozs derms produkto lytini lsteli susiliejmo procedros labai didina tos paios ries bsim organizm vairov. Pervelgus lsteli gyvavimo ciklo fazes, matyti, kad didiausi veiklos dal uima informacijos transformavimo vyksmai. Juk genetinse struktrose 4-ri simboli (A, G, T, C) kodavimo kalba yra ireiktas ne tik bsimos lstels ar organizmo gamybos biotechnologinis projektas (planas). Jis yra pritaikytas tam tikriems itekliams i aplinkos pasiimti, t. y. gyventi esant tam tikroms slygoms. is genetinis-informacinis planas, tai bsimo organizmo modelis. Lstels gyvenimo ciklas io modelio dekodavimo ir tolesnio informacijos perraymo procedros. Postmitozins fazs G1 metu lstel gamina RNR ir baltymus. Tai sudaro apie 3040% jos ciko laiko, kurio trukm prokariotini lsteli yra deimtys minui, o eukariotini deimtys valand. Nesidalijani lsteli, kurios yra patvari organizmo struktr sudedamosios dalys, vyksmai G0 fazs metu, daugiausia susij su mediag apykaita, kompensuojania oksidacij (entropijos didjim). iuo atveju vyksta maiausioji (minimali) RNR sintez. S faz tai genetins informacijos kopijavimo vyksmas DNR dvigubinimas. Ji uima apie 30% ciklo trukms. Kitos dvi ciklo fazs G2 ir mitozs susij su lstels dalijimosi ir pasirengimo dalijimuisi procedromis. ia vyrauja ne informacins procedros, bet mediag ir energijos virsmai auginant naujoms lstelms reikalingas struktras. ie virsmai yra valdomi informacinmis priemonmis. Informacini procedr poiriu yra svarbs lsteliniai vyksmai, susij su spor, kiauini ir skl gaminimu. Kibernetika tai vertina kaip bioinformacin nauj modifikuot tos paios ries individ informacini gamybos projekt technologij. Apvaisinus lytines lsteles sukuriama tai paiai riai priklausantys, bet kitoniki bsim individ modeliai-projektai. Jie, esantys sporose ar sklose, esant atitinkamoms slygoms, pradeda ir valdo organizmo auginimo sudedamj dali sintetinimo genetines programas. Nekelia abejoni, kad augimas tai dekodavimo procedra. Informacinio valdymo vyksmus rodo lsteli, lsteli programuotos mirties apoptozs reikiniai. Biologiniai tyrimai rodo, kad lstels mirtis daugialsiame organizme tai nra vien paprastas nykimas, bet tikslingas, programinis organizuotas struktros tvarkingas inarstymas. Stebint gyvojo pasaulio reikinius, pavyzdiui, augal ydjim, lytinius aidimus, augimo, dauginimosi, mirties ir daug kit vyksm, nagrinjant funkcin j prasm, galima teigti, kad gyvasis pasaulis tik tam ir sukurtas, kad vis laik gamint, modifikuot ir platint informacij, savo ries genetines, hormon ir nerv veiklos sistem programas. Tai akivaizdus bioinformacini technologij vyksmas, kurio pirmin ir visuotin pagrind sudaro informacinis lstels valdymas. Tokio valdymo esm kodavimo ir dekodavimo procedros.
229
5. Lstel organizuota sistema

5.5. LSTEL KODAVIMO IR DEKODAVIMO SISTEMA

Lstels funkcionavimas, kaip bioinformacini dekodavimo procedr veikla, lengvai sivaizduojamas vyksmas. Seniai inomas Virchovo teiginys, kad visos lstels gimsta i lstels biologams akivaizdus. Tad dekodavimo procedr buvimas ir genetins informacijos program dauginimo replikacijos procedr buvimas nekelia joki abejoni. Daugiausia nesuprantama, kaip gamta kuria bsimo organizmo projekt formuoja kod ir vykdo kodavim? Apie tai samprotaujama teorikai, biologins evoliucijos poiriu. iuo metu replikacijos ir dekodavimo mechanizm aikinimai ugoia sunkiau suprantam, daug neaikesn kodavimo procedr. i procedra tai genetins programos, bsimosios lstels arba net organizmo gamybos projekto-programos, urayto nukleorgi (NR) keturi simboli kodavimo sistemoje suformavimas sintez. Mitoze ir mejoze kopijuojamos genetins programos rodo nauj organizm atsiradimo bdus. Per ias procedras sukuriami jau pilnutiniai bsim organizm funkcionavimo biotechnologiniai projektai-programos. Neaikus lieka genetins atminties didjimas ir prasming simboli azotini bazi A, G, C, T sek surikiavimas. Nustatyti virus veiklos principai, sukurti gen ininerijos metodai ir lytinio apvaisinimo mechanizmai rodo, kad genetins atminties struktr (DNR) informacinis talpis gali didti prisijungus naujiems DNR intarpams. Aiku, ie intarpai atkeliauja i aplinkos. Juos molekuliniai lstels mechanizmai jungia, terpia bendr veiklos sistem. Vadinasi, toks kodavimo sek didjimas, kaip genetinio projekto pltra, gali bti atsitiktinis informacijos terpimas. Dl io vyksmo atsiradusios naujos genetinio projekto variacijos dekodavimu bus prigaminta daug panai, bet iek tiek kitoki organizm. Daugiausia prisigamina toki variacij, kurios bus adaptyvesns aplinkai ir daugiau gamins saviki, intensyviau eikvos aplinkos iteklius. Maiau aktyvias genetines programas turinios variacijos, kurios maitinasi tais paiais itekliais, bus pasmerktos inykti. Esant ribotiems itekliams, vyks atrankos procesas. Tai darvinins evoliucijos kelias. Vadovaujantis iais samprotavimais, lstels funkcionavim kodavimo ir dekodavimo poiriu galima schematizuoti (5.6 pav.). Kodavimo, nauj kodini sek, biologini ri susidarymo procedr tenka ikelti u lstels rib, populiacij gyvenim. Vadinasi, atsitiktiniai aplinkos poveikiai DNR struktroms ir vliau prasidedanti darvinin atranka per evoliucijos procedras, kuria naujas gen kodines sekas, naujas gyvybs ris. Tokiu bdu organizmus galima vertinti kaip vis laik evoliucionuojanias kodavimo ir dekodavimo sistemas. Jose nukleorgtys yra patvars informacijos neikliai (signalai), atliekantys pagrindin lstels informacijos atminties funkcij, o baltymai
230
BIOFIZIKA

STABILIJ BSEN STRUKTRA KODUOTAS BIOTECHNOLOGINIS PROJEKTAS


AGCTAGCTAGCTAGCTAGCTAGCTAGCTGCTAGC | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | TCGATCGATCGATCGATCGATCGATCGACGATCGA

P L I N

(N U K L E O R G T Y S)

K A

DEKODAVIMAS

KODAVIMAS
PER APLINKOS ATSITIKTINIUS POVEIKIUS IR ATRANK

REALUS BIOTECHNOLOGINIS VYKSMAS


E1 ITEKLIAI E2 E3 Ej Ei VEIKSMAI TARA

FERMENTINI REAKCIJ KOMPLEKTAI

5.6 pav. Lstel kodavimo ir dekodavimo procedr poiriu

fermentai yra informacijos program skleidimo padarinys, j veiklos procedr gyvendintojai. Tam tikr fermentini reakcij struktros sudaro funkcikai svarbius biotechnologini virsm tinklus. Jie kryptingai perdirba mediagas ir energij, yra lstels, kaip organizuotos sistemos, valdomasis posistemis. Patys fermentai atlieka dekoderi funkcijas. Nukleorgi sistemos yra informacijos, t. y. valdaniojo posistemio, struktros. iuo poiriu nukleorgtys yra materialieji informacijos neikliai, kibernetikos kalba vadinami signalais. Informacijos esm sudaro kodavimo simboli sekos azotini bazi isirikiavimo tvarka, lemianti konkreias funkcijas. Dekodavimo procedroms reikia daug vairiausi tarpini bioinformacini priemoni. Jas, kaip ir visas kitas molekulines lstels procedras, atlieka specials fermentai. Tai akivaizdios bioinformacini technologij procedros, nes informacij perraant ir perkoduojant vis laik atliekamos tam tikros molekulins sintezs.
231
5. Lstel organizuota sistema

Tad didesn ciklo dalis skiriama informacinms procedroms atlikti. Informacins procedros sudaro lstels esm. Mitozs ir mejozs vyksmai, susij su lsteli dauginimu, vairinimu ir plitimu aplinkoje, yra atliekami kaip bioinformaciniai lstels vyksmai. Bioinformacins azotini bazi sekos, patekusios tinkam aplink, dekoduojamos, ir taip gyvendinama nauja lstelinio organizmo funkcionavimo struktra. Be jokios abejons, lstel yra organizuota sistema. Jos esm informacins procedros, valdanios mediag ir energijos virsmus pagal tam tikr plan, kryptingai, tikslingai ir organizuotai. Norint geriau ir giliau suprasti iuos vyksmus, reikia nagrinti atitinkamus modelius. Taiau remiantis termodinamika, i informacini procedr simbioz su mediag ir energijos virsmais sudaro organizuot dinamin struktr, sugebani ne tik palaikyti entropij nekintam, net gali entropij mainti. Aiku, tie vyksmai gali vykti tik tam tikroje vietoje, atskirtoje nuo visos kitos aplinkos erdvskyroje. Jos viduje yra terpiamos specialios biotechnologini ir bioinformacini procedr vykdymo programos. Norint geriau suprasti funkcin lstels organizacij, btina iaikinti tam tikr sudedamj dali naus. Pirmiausia reikia suprasti genetinio kodo esm ir erdvskyr susiformavimo sien, atribojani lstels vid nuo iors susidarym.

5.6. GENETINIS KODAS

Genetiniu kodu vadinamas taisykli rinkinys (lentel), rodantis, kaip nukleorgi azotini bazi sekos, genetins programos perraomos aminorgi sekas. Aiku, tai tik dalin dekodavimo procedros dalis. Visa lstels dekodavimo procedra turi atspindti visus ferment ir kit baltim komplektus, atliekanius konkreias funkcijas. Pavyzdiui, akivaizdiausias visas dekodavimo reikinys tretins ir/ar ketvirtins struktros fermentas, perdirbantis konkrei molekul substrat S kit konkrei molekul produkt P, t. y. atlieka konkret, turint funkcin (semantin) prasm, mediagos virsm. Teigiama, kad tai yra vieno geno dekodavimas. Isamesnis dekodavimas visas ferment komplektas, atliekantis konkrei fiziologin funkcij, pavyzdiui, glikoliz, Krebso cikl ar pan. Genetinio kodo elementai. Jau prie pus imtmeio nustatyta, kad vis organizm genomai genetiniai projektai yra urayti diskreiosiomis 4 simboli kodavimo sekomis molekulinse atminties struktrose nukleorgtyse (DNR ar RNR). ie keturi simboliai azotins nukleorgi bazs A, G, C, T. Tai adeninas (A), guaninas (G), citozinas (C) ir timinas (T). Pastarasis (T) tam tikr organizm ir tarpini informacijos perraymo procedr yra pakeistas arba keiiamas urocilu (U). Taip pat nustatyta, kad per pirmj dekodavimo procedr transliacijos arba genetins informacijos perraymo i 4 simboli nukleorgi kodavimo urao
232
BIOFIZIKA

GUU GUC GUA GUG


Val

CCU CCC CCA CCG


Pro

ACU ACC ACA ACG


Thr

GCU GCC GCA GCG


Ala

GGU GGC GGA GGG


Gly

Valinas

Prolinas

Treoninas

Alaninas

Glicinas

UGU UGC
Cys

UUU UUC
Phe

UAU UAC
Tyr

GAA GAG
Glu

GAU GAC
Asp As

Cisteinas

Fenilalaninas

Tirozinas

Glutamatas AAU AAC


Asn

Aspartatnas Aspartatas AAA AAG


Lys

CAU CAC
His

CAA CAG
Gln

Histidinas

Glutaminas

Asparaginas

Lizinas

20 simboli baltym kodavimo aminorgtimis ura procedros metu, trij azotini bazi linijinis uraas tripletas, arba kodonas lemia tam tikr aminorgt linijinje baltymo struktroje. Tokio perkodavimo taisykli lentel, vadinama genetiniu arba biologiniu kodu, yra perteklin, nes net keli tripletai reikia vien ir t pai aminorgt. Pavyzdiui, yra 5 grups triplet, kuri keturi skirtingi kodonai atitinka t pai aminorgt. Dvi aminorgtis lemia tripletins grups, sudarytos net i 6 skirting kodon. Tik dvi aminorgtys koduojamos po vien triplet kodon. Vienas i j Starto arba metionino kodonas. Trys kodonai baigms (terminatoriai), dekodavimo semantiniu poiriu reikiantys Stop. Kita trij kodon grup lemia aminorgt izoleocin. Daugum 9 aminorgtis koduoja grups, sudaranios po 2 skirtingus kodonus. Esant nepertekliniam kodavimui, utekt 22 kodon: 20-iai aminorgi ir dviej pradiai ir pabaigai skirti. Genetiniame kode yra 3 arba net 4 Starto ir Stop kodonai (r. 5.7 pav. lentel). Tikriausiai, visi jie taip pat turi tam tikr skirting funkcin paskirt.
233
5. Lstel organizuota sistema

ANTROJI TRIPLETO PAD TIS

PIRMOJI TRIPLETO PADTIS

5.7 pav. Genetinio kodo lentel

Informacinis genomo talpis. Remiantis informacijos teorija, atminties struktros informacinis talpis nustatomas logaritmuojant galim jos bsen kiek N. Pavyzdiui, biotechnologinis mogaus projektas genomas (arba atminties molekuli azotini bazi por DNR rinkinys) ireiktas per ~3,2 milijardus padi (pozici234
BIOFIZIKA

TREIOJI TRIPLETO PADTIS

j) uimaniu urau. Vadinasi, galima turti N = 43 200 000 000 skirting individ projekt, kuris skiriasi nors viena azotins bazs pora, simboliu. Tada mogaus genomo informacinis talpis yra: Qmogaus= log2 43 200 000 000 = 6 400 000 000 bit = 800 000 000 bait = = 762,9 megabait. 1 megabaitas = 1 048 576 baitai. Dekodavimas. Genetinio kodo lentel yra dekodavimo lentel. Pirminis dekodavimo ingsnelis yra genetins informacijos sekos, uraytos tik 4-riais simboliais, perkodavimas (transliavimas) 20-ties ar 22-j simboli urau. 20 simboli yra baltym aminorgtys. Dar du simboliai turi sekos pradios ir pabaigos funkcines prasmes. Funkcin aminorgi prasm yra fizikochemins j savybs, kurios sudtingense balymo struktrose suteikia speciali funkcini katalizini savybi savitumo. Aminorgi savybs. Visoms aminorgtims, sudaranioms pirmin grandinin baltymo molekuls struktr, bdingos tam tikros fizikochemins savybs. Dalies j radikalai turi teigiamj (++++) Arg, His, Lys, arba neigiamj (- - - -) Glu, Asp elektros krv. Daugumos kit aminorgi radikal (.....) Phe, Leu, Pro, Ile, Met, Val, Ala yra nepoliniai bdingos hidrofobins savybs, o Ser, Thr, Cys, Trp, Asn, Gln, aminorgtys, turinios polini hidrofilini ( ) radikal. ios fizikochemins radikal savybs ir nulemia atitinkam baltymo konfigracij ir jo funkcij atliekant tam tikras specialias fermentines reakcijas. Radikal savybs parodytos genetinio kodo lentelje (5.7 pav.). Atitinkami langeliai upildyti enklais + + +, - - -, rodo aminorgi radikal fizikochemines savybes, o langeliai be enkl rodo hidrofines savybes. Genetinis kodas yra universalus visiems organizmams: ir prokariotams, ir pirmuonims, ir grybams, ir augalams, ir gyvnams. Tai akivaizdiai rodo bendros, informacin funkcins organizacijos prigimt turinios, organizuotos sistemos veikl. Taip suformuotos funkcins baltymo savybs turi dekodavimo prasm atlieka vien dekodavimo ingsnel. Tiesa, pavien aminorgtis funkcini poiriu nra svarbi, bet didiuls toki aminorgi grandins jau sukuria tam tikr funkcij, vykdo ir katalizuoja tam tikr fermentin reakcij. Tam tikromis aplinkybmis svarbias reakcijas atlieka keli ferment molekulinis agregatas. Specialus rinkinys, susidedantis i vairiausi fermentini reakcij ir sudarantis tam tikra funkcikai tiksling tinkl, jau gali atlikti krypting, funkcikai svarb fiziologin dekodavimo vyksm. Toki fiziologini vyksm tinklas sukelia organizmo veiksm, t. y. reali reakcij aplinkoje. Tai ir yra visikas informacins programos dekodavimas arba veiksmas bei reakcija, kitaip suprantama kaip organizmo valdymas informacija.
235
5. Lstel organizuota sistema

Genetinio nukleorgi kodo informacin entropij HGenomo , arba vienos pozicijos siuniam informacijos kiek, galima nustatyti pamatavus vis genomo DNR 4 azotini bazi padi (pozicij) procentin kiek, ireikus tikimybmis pA , pG , pC , pT : jeigu azotins bazs genome yra tarpusavyje nesusijusios (nekoreliuotos) HGenomo = (pA log2 pA + pG log2 pG + pC log2 pC + pT log2 pT ) bitai; jeigu azotins bazs nesusijusios (nekoreliuotos) ir j komplamentari por tikimybs lygios: pA = pT = p, o pC = pG = q, tada: HGenomo = 2(p log2 p + q log2 q) = 2[(1 + k)plog2 p + kplog2 k] bitai. Esant vienodam azotini bazi skirstiniui k = 1 ir nesant tarp j ssaj (koreliacijos labai maos, artimos nuliui), veiksmingiausio kodavimo atveju genomo vienas simbolis sist 2 bitus informacijos. Jeigu k 1, tai informacin entropija bt maesn kaip 2 bitai. Analogikai galima vertinti ir aminorgi kodo informacin entropij HAR arba vienos baltymo aminorgties siuniam informacijos kiek. Tarkime, aminorgtys baltymuose bus nesusijusios (nekoreliuotos) ir jos turi vienodus danius, kurie ireikti tikimybmis pAR , tai: HAR = 20 pAR log2 (pAR ) = +log2 (20) = 4,32 bitai (be Starto ir Stop bsen). Pradties ir baigmens kodins bsenos turs labai maas tikimybes ir koreliacijas, nes i informacijos teorijos inoma, kad: limp0 (log2 [p / p j )] 0, tai dvi Starto ir Stop labai retos kodins bsenos, daug retesns nei bet kuri kita aminorgties kodin bsena, sudarys imtsias ir tkstantsias bito dalis. Visas atitinkamos informacins molekuls neamas informacijos kiekis nustatomas padauginus tos kodavimo sistemos informacin entropij H i padi (pozicij) kiekio n: I = n H. Tokiu bdu galima kiekybikai vertinti molekulini struktr neam informacij. Pavyzdiui, laikant, kad bakterijos fermentas susideda i ~150 aminorgi grandins, jo siuniam informacijos kiek bt galima vertinti I = 150 4,32 = 648 bitais. Geno, ireikto per DNR sektori, kurio sekos ilgis sudaro ~500 azotini bazi pad236
BIOFIZIKA

bei q/p = k,

i (pozicij), apskaiiuojama I = 500 2 < 1000, ne daugiau kaip 1000 bit. Informacin genetinio kodo entropija negali bti didesn kaip 2 bitai. Aiku, tai formals skaiiai, kuriais tik pradedama kiekybikai vertinti informacija. Daug svarbesni yra dekodavimo ingsni kokybiniai vertinimai funkcins svarbos supratimas. J galima pasiekti tik nustaius visos lstels funkcionavimo bendruosius dsningumus, inant funkcin schem, kai yra aiki vis dekodavimo ingsneli funkcin prasm ir naas vis procedr. Pirmiausia reikia suprasti lsteles kaip savarankik, nors ir atvir aplinkai struktros vienet erdvskyr, kurios viduje vyksta ios savitos dekodavimo procedros.

5.7. FOSFOLIPIDINS ERDVSKYROS LSTELS SIENOS

Termodinamikos dsniai akivaizdiai rodo, kad organizuot sistem galima suformuoti tik baigtinio dydio erdvje erdvskyroje, kuri atitinka atvirosios sistemos reikalavimus. Vadinasi, tarp erdvskyros vidaus ir aplinkos turi vykti mediag ir energijos kaita. Gyvyb, kaip rodo evoliuciniai tyrimai, isivyst vandenyne, todl lstels susidarymo erdv silpna elektrolitin terp. Joje vyrauja vandens molekuls, tarp kuri yra vairiausio dydio ir krvio jon. Vandens molekuls dl nesimetrikos kvantins mechanikos ryi struktros yra polins, todl turi elektrin dipol elektrikai ireikt + ir struktr, jonai yra hidratuoti apsupti orientuot elektriniame lauke vandens molekuli. Lstels susidar ir susidaro i vandens ir vandenyje, tiksliau silpn elektrolit fiziologinje aplinkoje. Fizikocheminiai lstels tyrimai parod, kad pagrindin lstels erdvskyr ribojimo priemon yra fosfolipidai, sudarantys dvigub fosfolipidini membran sluoksn. J susidarymas lengvai suprantamas i lipidini molekuli fizikochemins sveikos su vandeniu. Riebalai lipidai ir fosfolipidai yra molekuls, turinios vien poliarij hidrofilin struktr ir kit struktrikai ilg hidrofobin (5.8 pav.). Lipidins molekuls, upurktos ant vandens paviriaus, aptraukia vandenins terps paviri tam tikra plvele, molekuls orientuojasi hidrofilinmis struktromis vandenyje, o hidrofobinmis vir. Purslojant arba veikiant iorinms jgoms, vandens laeliams iokant vir vandens paviriaus, jie su savimi nusinea ir dal lipidinio sluoksnio, hidrofilinmis struktromis lael apkibusi lipid. Toks laelis krisdamas atgal vanden, kurio pavirius aptrauktas lipidiniu sluoksniu, ir panirdamas dar kart apsitraukia antruoju lipidiniu sluoksniu, turiniu kit orientacij. Dabar lipidins struktros vien dl i molekuli sveikos su vandens molekulmis savybi suformuoja dvigub membranin lipid sluoksn. Toki fosfolipidin sien membran turi visos biologins
237
5. Lstel organizuota sistema

VANDUO

O CH2 O

O C H

O CH2

O P=O O

5.8 pav. Erdvskyros sien fosfolipidins membranos fizikocheminio susidarymo aikinamoji schema

organizacijos. Jos yra vientisa statybin erdvskyr sudarymo priemon gyvojoje gamtoje. Taip fosfolipidins membranins sienos suformuoja erdvskyras. Molekuliniai lstels biologijos tyrimai rodo, kad fosfolipidinse membranose yra vairiausi baltymini molekuli, atliekani specialias funkcijas: siunianias lstel ar/ir imetanias i lstels vidaus tam tikras molekules bei jonus. Tam tikros molekuls per molekulinius receptorius membranoje lstelei signalizuoja apie iorin aplink. Be to, yra dar daug kit molekulini struktr, kurios atlieka lstels konstrukcijos palaikymo ir kitas funkcijas. Lsteli membranose yra ir baltymini struktr, turini tam tikras fizikochemines savybes, todl membraniniams paviriams bdingos ir savitos fizikochemins savybs. Joms bdingos ir elektrokinetins savybs, elektrokinetiniai dzeta potencialai, elektroforetiniai ir elektrinio osmoso vyksmai. Bendru atveju membranos yra labai svarbios funkcins lsteli struktros. Jos turi daug funkcini lsteli struktros savybi, tarp kuri svarbiausios gyvybs sienos ir vartai. Kad lstel bt organizuota sistema, reikia (be membranini pernaos ir konstrukcijos palaikymo element), kad jos viduje bt informacinio valdymo programa ar program valdymo komplektai. Paprasiausia prokariotin lstel valdanti sistema yra operonas. Jos veiklos schem dar 1961 m. nustat akobas (P. Jakob) ir Mono (J. Monod). Teorikai, operon struktros, patalpintos fosfolipidini membran atribotoje erdvskyroje, padeda toki sintetin lstel matyti kaip organizuot sistem.
238
BIOFIZIKA

5.8. LSTELS ORGANIZUOTOS SISTEMOS SCHEMA

Visos lstels prokariotins ir eukariotins visada sudarytos i bent dviej funkcini dali, kurios yra udarojo kodavimo ir dekodavimo procedros ir: vertina aplink ir valdo lstels bv aplinkoje; vertina vidin savo sistemos bsen ir atlieka savivald. Apibendrinta tokios lstels organizuotos sistemos schema pateikta 5.9 paveiksle. Remiantis organizuotos sistemos samprata, pavien udarojo kodavimo ir dekodavimo funkcins struktros dalis savo ruotu yra sudaryta i: 1. Informacini valdymo struktr, kurios lstelse gyvendintos inaudojant nukleorgi ir signalini molekuli savybes. Jos atlieka lstels atminties ir informaci valdymo program valdymo modeli saugojim ir veikl. Tai lstels genomas ir signaliniai molekuli tinklai. 2. Mediag apykaitos, mediag ir energijos virsm, vykdani lstels veiksmus aplinkai ir sistemos viduje. Kad lstel patikimai egzistuot, ji turi ne tik turti viduje veiklos programas, bet ir vis laik gauti signalais informacij apie aplink ir vidin savos sistemos bsen, vertinti ir funkcikai prasmingai reaguoti. Taip pat turi signalin informacij sisti aplink. Aiku, tarp abiej aplink ir lstels vid vertinani ir valdani signalini informacini struktr turi bti koordinuojantys ryiai. Jie lemia lstels, kaip orgaSignalai i aplinkos A P L I N K A
ITEKLIAI

Signalai aplink VALDYMO PROCEDROS INFORMACIJOS SRAUTAI A P L I N K A


VEIKSMAI ir ATLIEKOS

MEDIAG ir ENERGIJOS VIRSM SRAUTAI

Atsitiktiniai aplinkos poveikiai

5.9 pav. Apibendrinta lstels organizuotos sistemos schema

239
5. Lstel organizuota sistema

nizuotos sistemos, savybes. Pagrindinius informacinio lstels valdymo veiksmus, informacijos srautus koordinuoja lstels genomas. Jis lemia reikiam mediag reikiamu momentu patekim lstel ir atliek imetim, taip pat ir aplinkos signal primim bei reikiam signal sintez ir siuntim aplink. Taip pat genomin struktra valdo ir signalini mediag sintez lstels viduje keiia funkcin lstels bsen. iuo metu molekulin lstels biologija jau nemaai ino apie konkrei lsteli konkreias molekulines struktras, atliekanias nurodytas funkcijas, bei biocheminius j veiklos mechanizmus. Jau galima daugeliui bandomj lstels molekulini tyrim duomenis sudlioti atitinkam funkcikai svarbi vyksm vienov. Tokia apibendrinta funkcin molekulini lstels struktr organizacija pateikta 5.10 paveiksle. Svarbs molekuliniai kompleksai atrankiai (selektyviai) pernea mediagas i aplinkos lstels vid ir i vidaus aplink. Tai vairiausi kanalai ir atitinkami neikliai, esantys iorinse membranose. Kanalai atidaromi ir udaromi pakitus tam tikr signalini molekuli ar tam tikr baltym bsenoms. Tam tikri kanalai membranose vadinami promis. Kitos, didesns struktros perneamos atrankiai valdomai ir nevaldomai paprastosios fagocitozs bei endocitozs bdais. Iorinse membranose gali bti terptos valdomos judjimo organels, judinamieji (motoriniai) efektoriai iueliai, blakstienls suteikiantys lstelms galimyb atlikti mechanini judesi funkcijas. Aiku, iuos efektorius taip pat valdo specialios signalins molekuls. Lstels citoplazmoje vyksta pagrindiniai mediag apykaitos virsmai itekliai, atneti pro kanalus ir pras i aplinkos perdirbami kitas, lstelms funkcionuoS I GSIGNALAI NALAI

5.10 pav. Bendroji lstels molekulini procedr schema

240
BIOFIZIKA

ti reikalingas mediagas. Perdirbimus atlieka tam tikr ferment rinkiniai, kuriuos lemia lstels genomas. Prokariotinse lstelse iuos ferment rinkinius lemia genomo vienetai operonai esantys lstels protoplazmoje. Eukariotinse lstelse informacij apie reikiam ferment rinkinius, nustato j sintezei reikiamas slygas ir laik gen struktros, informacinis gen tinklas, esantis lsteli branduoliuose. Biochemijos duomenimis, yra apie deimt lstelse vykstani ir visiems gyviesiems svarbi mediag ir energijos (metabolini) procedr, kurios yra darniai valdomos genomo. Svarbi informacin funkcij atlieka lsteli signalai specialios molekuls ir molekuliniai signaliniai tinklai. Net mai signalini molekuli kiekiai nulemia funkcin lstels veikl. Kai kuriais atvejais iorini signal funkcij atlieka ir energijos virsmai ilumos, viesos ar mechanini virpesi impulsai. Juos, ypa molekulinius, priima specials pavirinje lstels membranoje esantys receptoriai. Receptoriai gana sudtingos molekulins struktros, atrankiai paveiktos tam tikro iors signalo aktyvinami. Jie suadinim perduoda kitoms lstels citoplazmos dalims ar atitinkamoms, funkcikai tikslingoms genomo struktroms jas suadina ar tildo, slopina. Tokia signalin informacijos primimo procedra suprastina iorinio fizinio poveikio kodavim poveikio atspindjim lstels sistemoje jai funkcikai priimtina form. Funkcikai tinkam bd suteikia organizacinis udarumas, t. y. visos informacins sistemos, turinios atitinkamas kodavimo ir dekodavimo procedras, buvimas. Kitaip sakoma, kad kodavimo, perdavimo ir dekodavimo sistema turi semantini informacijos savybi. Signaliniai iors poveikiai, priimti speciali receptorini struktr, kit speciali molekulini signal perdavimo struktr priemonmis perduodami atitinkamas citoplazmos vykdymo struktras, pvz., kanalams ar organelms valdyti, arba branduol, norint sukelti tam tikr gen raik. Gen raika nulemia tam tikr baltym, valdani kitas mediag apykaitos ar signalins veiklos funkcijas, sintez. Taip galima apibendrintai aikinti darn lstels funkcionavim, kuriam didiausi tak turi signalins informacins procedros, atliekamos biocheminmis priemonmis. Biochemijos poiriu galima iskirti tris lstels specializuotas, tarpusavyje labai glaudiai susijusias, molekulini main ris (5.11 pav.): baltym mainos, gen mainos, membran mainos. Lstel lyginant su cheminiu technologiniu kombinatu, robotu arba kompiuteriu, ios visos trij ri mainos sudaro mediagin kn, technologines priemones, technin rang, informatik vadinam hardware.
241
5. Lstel organizuota sistema

VALDYMAS INFORMACIJA GEN MAINOS Nukleotidai

BALTYM MAINOS Amino rgtys METABOLIZMAS SIGNALAI TRANSPORTAS

MEMBRAN MAINOS Lipidai ERDVSKYRA TRANSPORTAS KAUPIMAS

5.11 pav. Trys pagrindins lstels molekulini main rys

Informacinio valdymo genetins ar kitos programos, programin ranga, kurias informatikai vadina software, bdinga funkcinei gen paskiriai ir signalini keli organizacijai. ie vyksmai dar nra gerai itirti ir iuo metu kelia daug neaikum. Tam tikrus klausimus galima geriau suprasti aikinantis funkcin prokariotini lsteli operono organizacij.

5.9. OPERONAS MOLEKULIN LSTELS BIOTECHNOLOGIN DEKODAVIMO SISTEMA

Molekulins biologijos tyrimai rodo, kad paprasiausi vienalsi organizm prokariot gyvybikum lemia genetins struktros operonai. Tai tam tikros funkcikai organizuot molekulini virsm dinamins struktros, kurios valdo visas lstelse vykstanias molekulines procedras (5.12 pav.). Kibernetikos poiriu apibendrinus operono arba kitaip dar vadinam akobo (P. Jakob) ir Mono (J. Monod) prokariotini lsteli gen veiklos valdymo (reguliavimo) schem, j galima vertinti kaip pagrindin funkcin lstels vienet dekodavimo kinetins organizacijos model. (Buvo pastebta, kad konkreioje lstelje daniausiai atliekama dekodavimo procedra, o veiklos programos formavimas (kodavimas) vyksta populiacijose raidos bdu.) i schema darni funkcin sistem sujungia genetins atminties, baltym sintezs ir mediag virsm mechanizmus. Tokias operon
242
BIOFIZIKA

GR
N E I G I A M A S I S GRTAMASIS RYYS

OPERONAS - GENETIN PROGRAMA

GO R+Pn R+S R

SG1

SG2

SGi

SGn

T R A N S K R I P C I J A T R A N S L I A C I J A

E1 P1 S
E1

E2 P2
E2

Ei Pi
Ei

En Pn
En

MEDIAG IR ENERGIJOS VIRSMAI

5.12 pav. Operonas molekulin lstels organizuota dekodavimo arba programinio valdymo biotechnologin sistema

kinetines schemas terpus membrana ribot fizikochemin erdvskyr, t. y. jos elektrolitin terp, gaunamas organizuotos maos lstels modelis. Aiku, tam reikalingos ir valdomos mediag laidumo, ir signalins struktros membranose. Akivaizdu, operonas yra atvira sistema, kuri i aplinkos patenkanios mediagos mediag apykaitos aliava S bt induktorius. Pastarasis, trkstant produkto Pn , sukelt operono veikl. is vyksmas atliekamas per geno reguliatoriaus GR sintetint represori R. Represorius veikia gen operatori GO, atsivelgdamas produkt Pn ir aliav S: jeigu P nra, o S yra, R+A leidia GO veikl, informacins m-RNR sintez ir visus kitus vyksmus, susijusius su Pn gamyba. Prisikaupus Pn , aporepresoriui R didesn tak pradeda daryti ne S, bet Pn , kaip R+Pn kompleksas. is veikia GO ir vis operon, jo struktrinius genus SG blokuoja. Taip nutraukiama m-RNR sintez ir kiti vlesni vyksmai. Tai neigiamasis grtamasis ryis, kuriuo vykdomas produkto Pn reguliavimas. Tokiu bdu atliekamas dekodavimas mediag sintetinimo valdymo procedra. Tokiu bdu vykdomi mediag apykaitos virsmai, lemia lstels vyksmus. Veiksm programos, j projektai urayti genuose operatoriuos kaip struktriniai operon genai. Aiku, vienas konkretus operonas atlieka tik tam tikr vien dal fiziologini lstels procedr. Pavyzdiui, glikoliz, kuriai atlikti reikia daugiau kaip deimt speciali ri ferment, kiekvien j lemia atitinkamas struktrinis genas. Lstelje yra daug toki speciali mediag apykaitos procedr. Jas tenka visas jungti tam tikr tvarkingos nuoseklios veiklos eil. Procedras sujungia genai reguliatoriai ir sveikos tarp operon sudaromi specialij ryi tinklai. Biotechnologin vyksm aliavos (substrato) S perdirbim produkt Pn vykdo rinkinys ferment E1, E2, Ei, , En, kuriuos transliacijos procedra sintetina
243
5. Lstel organizuota sistema

organels ribosomos. Biologijoje svoka transliacija reikia informacijos apie ferment molekulin struktr, uraytos 4 simboli nukleorgi kodu, perraym 20 (ar 2224) simboli baltym-aminorgi kodu. Baltymai atlieka gamybos mediag ir energijos perdirbimo funkcijas. Nukleorgtims bdingas tik tam tikr aminorgi atrinkimas matricins sintezs savybs. Tai padeda atitinkamoms molekulms komplementariai ar kitokiu kopijavimo bdu dauginti vienodos struktros molekules. Visi duomenys informacija apie reikiam biotechnologin vyksm slypi operone DNR molekulje. Transkripcijos metu DNR azotini bazi sekos perraomos (transkribuojamos) atitinkamas informacini ribonukleorgi m-RNR sekas, pagal kurias transliuojami atitinkami fermentai. Kiekvieno fermento Ei pirmin struktr lemia tam tikra DNR dalis struktrinis genas SGi . Vis transkripcij pradeda ar stabdo genas operatorius GO, jeigu patenkinamos tam tikros jo aktyvinimo ar slopinimo slygos. ias slygas, kaip rayta, nusako dar viena DNR dalis genas reguliatorius GR. Atsivelgiant jo sek, sintetinamas specialus represoriaus R, galintis sudaryti kompleksus arba su substratu S, arba su galutiniu produktu Pn. Jei produkto nra, o substrato yra pakankamai, kompleksas R+S veikia gen operatori GO taip, kad GO pradeda transkripcij ir ferment komplekto, reikalingo mediag bei energijos virsmams, sintez. Susikaupus produkto pertekliui ar pasidarius jam nereikalingu ir dl kit prieasi kompleksas R+Pn nuslopina GO veikim ir nutraukia transkripcij. Komplekto fermentams susidvjus nutrksta ir pats biotechnologinis vyksmas. Taip dekodavimo bdu valdomi biotechnologiniai paprastos lstels vyksmai. Jame vyrauja informacins procedros. Operono schema yra prastin bioinformacins technologijos schema. Biotechnologija suprantama daug paprasiau kaip fermentini reakcij technologija, kurios esm yra mediag gaminimas biologini katalizatori priemonmis. Biotechnologija vadinama ferment iskyrimas, gryninimas ir naudojimas gamybinms technologijoms. irint ateit, biotechnologij reikt suprasti plaiau. Reikia pripainti, kad visa tai kas vyksta lstelse, taip pat yra biotechnologija, bioinformacins technologijos, nes vyksta informacinio valdymo dekodavimo procedros. Pats fermentas tai dekoduotas informacinis atspindys modelis, abstraktesnio modelio, urayto DNR ar RNR azotini bazi simboliais ir j kodavimo bdu. Kibernetikos poiriu i schema rodo, kad operonas yra daug sudtingesne valdymo sistema negu papastas reguliatorius. Tai programinio valdymo reguliatorius, turintis miraus valdymo struktr. Indukcij pirminiu substratu S galima vertinti kaip tiesioginio valdymo informacij, o produkto Pn poveik represoriui R kaip perduodam informacij grtamuoju ryiu. Struktrini gen grandin lemia vis rinkin ferment, kurie per mediag virsmus pagamina veiksmams atlikti reikalingus produktus. ie produktai yra veiksmai. Operono atmintis struktriniai genai yra bsimj
244
BIOFIZIKA

veiksm programa. Atitinkamos azotini bazi sekos nulemia tam tikrus fermentus, o ie veiksmus. Tokiu bdu operonas virsta savita lstels savivaldos sistema. i sistema nustatyta prokariotinse lstelse. Manoma, kad jos principai yra bdingi ir eukariot lstelms, ir dar sudtingesniems operon ryiams.

5.10. MATEMATINIS OPERONO VEIKLOS MODELIS

akobo (P. Jakobo) ir Mono (J. Monod) operono veiklos schema yra kokybinis paprasiausios lstels reguliuojanios veiklos modelis. Matematin ios schemos model pateik Gudvinas (B. C. Goodwin), naudodamasis chemini ir biochemini reakcij kinetikos dsningumais. Jis pateik matematin model ir rod, kad i esms tokia sistema gali bti, nes yra dinamikai patvari (stabili). Kad bt paprasiau, sudting operono sistem galima suprastinti palikti tik vien grand, turini grtamj metabolito ry (5.13 pav.). Laikoma, kad prie genetinio lokuso Li vyksta matricin sintez. Dl lokuso konkuruoja nukleotidai Z bsimj informacini mi -RNR aliava ir metabolitas Mi . Informacins mi -RNR koncentracijos kitimas X(t) yra io matematinio modelio pagrindas, nes jos kiekio kitimas yra viena sudtingiausi procedr transkripcija. Transkripcijos sintezs greitis ireikiamas apibendrinta diferencialine lygtimi:
dX = ( X ,Y , M ) b X, dt
M(t)

kurios pirmasis deiniosios puss narys SGi (X, Y, M) apibdina sintezs greit, o antrasis bX mi -RNR matricos susidmi -RNR X(t) vjimo greit, kuris bendru atveju proporcingas tos mediagos kiekiui. ia b susidvjimo koeficientas. Fermento sintezs transliacijos Ei Y ( t ) greit ribosomose lemia matricin m-RNR S Mi sintez. Jos greitis priklauso nuo matriM(t) cos kiekio X(t), o susidvjimas taip pat, kaip ir informacins m-RNR , bus pro5.13 pav. Suprastinta operono veiklos schema, atsiporcingas fermento koncentracijai: velgiant Gudvin

245
5. Lstel organizuota sistema

dY = X Y, dt ia sintezs greiio koeficientas; susidvjimo greiio koeficientas.

Metabolito Mi sintezs greit lemia fermentin reakcija. Pasirenkama paprasiausia fermentins reakcijos situacija, kai greitis priklauso tik nuo fermento koncentracijos. Tai yra situacija, kai substrato molekuli yra daug daugiau nei fermento Si >> Ei . Tada:
dM = kYrM, dt ia k metabolito sintezs greiio konstanta; r metabolito skilimo greiio konstanta.

I vis trij aptart diferencialini lygi pirmoji yra svarbiausia. Didiausi tak m-RNR sintezs greiiui turi (X, Y, M) narys. Kaip rayta, tai konkurencinio slopinimo (inhibicijos) vyksmas prie operono genetinio lokuso Li . Esant baigtiniam ir nekintamam lokuso kiekiui (L0 = const.), jo bus trys bsenos: L0 = [L] + [LZ] + [LM], ia [L] laisvojo lokuso koncentracija; [LZ] lokuso komplekso, L + Z koncentracija; [LM] lokuso komplekso, L + M koncentracija. Kompleks susidarym galima aprayti grtamosios chemins reakcijos lygtimis:
k + L+Z LZ , k L+ M

l+ LM . l

Aiku, mi -RNR sintezs greitis priklausys nuo [LZ] koncentracijos: (X, Y, M) [LZ], o [LM] veiks kaip slopinamasis veiksnys, veiks konkuruojamai. Tarkime, vyksmas yra stacionariosios pusiausvyros bsenos.Tada pusiausvyros konstantos bus:
Kz = k+ [ LZ ]st , = k [L ]st [[Z]stst [ L ]st Z ]

246
BIOFIZIKA

KM =

l+ [ LM ]st , = l [L ]st [ [Z ]st [L M

i j gaunamos kompleks koncentracij lygtys:


[LZ ]st = Kz [L ]st [Z ]st , [LM ]st = KM [L ]st [Z ]st .

Jomis pakeitus lokuso pusiausvyros lygties atitinkamus narius:


L0 =[L ]st + Kz [L ]st [Z ]st + KM [L ]st [Z ]st

gaunama laisvojo lokuso koncentracijos lygtis:


[ L ]st = 1 + KZ
.[ Z ]

L0 . st + K M [ M ]st KZ.[ Z ]st .L0 . 1 + KZ.[ Z ]st + K M.[ M ]st

ir m-RNR sintezs lygt:


( X , Y , M ) [ LZ ] =

Taip gaunama konkurencinio slopinimo lygtis. Tarkime, nukleotid itekliai yra dideli ir sintezs vyksmas nekeiia j koncentracijos, t. y. [Z]st = const., mi -RNR sintezs greiio lygt galima suprastinti:
( X , Y , M ) a , C + M (t )

ia konstanta a = o konstanta C =

KZ [ Z ]st .L0 , KM

1 + KZ.[ Z ]st . KM

Metabolito koncentracijos [M] kaita yra visos operono sistemins veiklos tikslas ir padarinys. Tai yra laiko funkcija M(t). Apibendrinus gaunamas matematinis operono veiklos modelis:

247
5. Lstel organizuota sistema

Tai netiesin diferencialini lygi sistema. Netiesikum lemia hiperbolin (X, Y, M) funkcijos iraika, kuri rodo netiesinio neigiamojo grtamojo ryio tendencij didjant produktui M mainti mi -NR sintez. Diferencialinms lygtims sprsti pritaikius skaiiavimo matematikos metodus (ESM) buvo nustatyta, kad esant tam tikriems koeficientams visos trys mediag koncentracijos periodikai svyruodamos palaiko ne nulinius, o tam tikrus teigiamuosius j koncentracij svyravimus. Vadinasi, tokia sistema gali natraliai bti. Fazinis operono portretas dinamins sistemos galimybi matematin funkcija rodo, kad tai duob, kurios dugne yra kalnas. Sistemos bsen kait (dinamik) apibdinanios fazins trajektorijos rodo trimats erdvs idin (fokus). Operono bsen kaita fazinje erdvje, jai esant stacionariosios bsenos, bt pavaizduota ovalia ar elipsoidine trojektorija. io vyksmo projekcijos koordinai ayse yra sinchronikai svyruojantys vyksmai X(t ), Y(t ) ir M(t ). Tarkime, metabolito M sintez visikai nulemia fermento kiekis, t. y.: M(t ) Y(t ), sistema suprastinama iki dviej lygi:
a dX dt = C + Y (t ) b X , dY = X Y dt
a) , Y

kuri sprendiniai vaizduojami dvimatje erdvje udaruoju faziniu portretu (5.14 pav., a). Akivaizdu, ios dinamins sistemos mediag koncentracijos keiiasi periodikai svyruodamos (5.14 pav., b).
b)
X(t ), Y(t )

, Laikas t

5.14 pav. Fazinis operono portretas ir vyksm svyruojamosios dinamins reakcijos

248
BIOFIZIKA

is modelis rodo, kad hiperbolinis operono grtamojo ryio poveikis genetinei sintezei sistem stabilizuoja, o mediag koncentracij svyruojantys vyksmai atlieka reguliavimo funkcijas. Toki vyksm konkretus pavyzdys Lac operonas.

5.11. LAC OPERONO SCHEMA

Bandymais geriausiai ityrintas laktozs skaidymo valdymas E. coli lstelse. i tyrim pradininkai okobas (J. Jakob) ir Mono (J. Monoud). Pagal Lac operon yra lyginama kit operon veikla, kuri kiekvienoje bakterijos lstelje yra gana daug.. prasta prokariotins lstels Lac operono visa veiklos schema pateikta 5.15 pav. Tai laktozs patekimo lstel ir jos perdirbimo gliukoz ir galaktoz informacinio valdymo schema.
GR

LAC-OPERONAS VALDAN IOJI GENETIN PROGRAMA


GO R+Pn R+S R T R A N S L I A C I J A SG1 SG2 T R A N S K R I P C I J A SG3

-galaksidaz

Permeaz
Transacetilaz

VALDOMIEJI MEDIAG APYKAITOS VIRSMAI

5.15 pav. Lac operono veikimo schema

249
5. Lstel organizuota sistema

GLIUKOZ

Lac operonas turi tris struktrinius genus, kuri raika nulemia trij ferment sintez. Pirmasis struktrinis genas lemia galaksidazs sintez, kuri laktoz ir alolaktoz perdirba galaktoz ir gliukoz. Antrasis struktrinis genas lemia galaksidazins permeazs sintez, kuri yra laktozs lstelinio kanalo pagrindas, lemiantis laktozs patekim lstel. Treiojo struktrinio geno nulemto baltymo funkcin reikm dar nra tiksliai nustatyta. Tikimasi, kad is baltymas yra reikalingas auktesnio lygio lstels sisteminei veiklai valdyti. Kai lstelje yra ir laktozs, ir gliukozs, pradeda veikti kitas Lac operono raikos valdymo mechanizmas, vadinamas katabolizmo represija. Operon gausa reikalauja j sveik aikinimo.

5.12. OPERON SVEIKA

Naudojant Gudvino model nesunkiai gali bti nagrinjamos ir sveikos tarp operon. Tarkime, du operonai gamina skirtingus metabolitus M1(t) ir M2(t) ir kiekvienas j gali konkurencikai veikti savo ir kito operono genetinius lokusus, suprantama, esant atitinkamiems sveik koeficientams k11, k12, k21, k22 (5.16 pav.). Vadinasi, dviej sveikaujani operon sistemos matematinis modelis bus:
dX1 a1 = b1 X 1, dt C1 + k11 M 1 (t ) + k12 M 2 (t ) dX 2 a2 = b2 X 2 , dt C2 + k21 M1 (t ) + k22 M 2 (t ) dY1 = 1 X1 1 Y1 , dt dY2 = 2 X 2 2 Y2 , dt dM1 = k1 Y1 r1 M 1, dt dM 2 = k2 Y2 r2 M 2 . dt

Pasirinkdami vairiausias operonini ryi k11, k12, k21, k22 koeficient reikmes, galime aikinti vairiausi dviej operon sveikaujanios sistemos veikl. Jeigu k12 = 0, tai pirmasis operonas, dirbantis svyravimo reimu, bus pagrindinis generatorius, o jo svyravimo M1(t) vyksmai vers svyruoti sinchronikai ir visus antrojo operono dydius.
250
BIOFIZIKA

GR1

GO1

SR1 X1(t)

SG2 X2(t) Y2(t) E2

GO2

GR2

R1+M1+M2 R1 M1(t)

E1

Y1(t)

R2+M2+M2 M2(t) R2

M1 M2

M2 M1

5.16 pav. Dviej sveikaujani operon schema

Pirmasis operonas atliks pagrindinio autogeneratoriaus funkcijas, o antrasis bus priklausomas nuo pirmojo. Keiant operonini sveik koeficientus galima sukurti vairiausius dinamikai susijusi operon sistemos reimus, pvz., simbiozs, konkurencijos, trigerinius ir pan. Be to, taikant metod galima sujungti daugyb operon sudtingas tarpoperoni sveik sistemas ir specialiomis kompiuterio programomis atlikti vairiausi galimybi kiekybinius modeliavimus. Matematinis Gudvino (B. C. Goodwin) modelis leidia teorikai nagrinti lstels genetini veiklos mechanizm padarinus ir galimybes sudaryti funkcikai prasmingas operon sistemas.

5.13. EUKARIOTINS LSTELS GEN RAIKOS TINKLAS

Pagrindin eukariotins lstels funkcin veikl valdo genai, kurie sudaro tam tikrus genetinius funkcikai prasmingus tinklus. Genetinio lstels tinklo, sudaryto i 4 gen, funkcionavimo suprastintas pavyzdys pateiktas 5.17 paveiksle. Gen raika tam tikr speciali baltym sintez, kuri lemia kit gen arba aktyvacij, transkripcij ir kit atitinkam baltym sintez, arba represij atitinkam gen slopinim (tildym). i vyksm tinklo padarinys programuota, funkcikai tikslinga, logika veiksm seka, kuri valdo visos lstels veikl. Toki genetini tinkl veiklos tyrimai kol kas manomi tik teorikai, matematikos ir kompiuterijos metodais. Daniausiai taikomi tokie metodai: 1. Sudaromos tam tikros grafins schemos ir tiriamos visos sistemos galimos bsenos.
251
5. Lstel organizuota sistema

a Baltymas ab Baltymas b GENAS A Baltymas a Baltymas b GENAS B

Transkripcija Baltymas c Represija GENAS C Aktyvacija Baltymas d GENAS D

5.17 pav. Lstels keturi gen tinklo apibendrinta veiklos schema

2. Sudaromos ir sprendiamos Baijeso tipo tikimybini lygi sistemos, nustatomos sistemos galimybs. 3. Atliekama visos sistemos bsen analiz taikant klasikini logini automat teorij. 4. Tiriamos sistemos bsenos, j kaita determinuot tiesini ir netiesini diferencialini lygi sprendimais bei kompiuteriniu modeliavimu.

5.14. LSTELS CIKLO VALDYMAS

Lstels raidos ciklas yra bdingiausias gyvos lstels bvio vyksmas, kur sudaro penkios rykesns bsenos (5.4 pav. ir 5.18 pav.): 1. G1 pirmoji interfazs stadija, kurios metu lstel auga, vyksta biosintez, dauginasi organels. i stadija sudaro apie 45 procentus viso lstels ciklo trukms. 2. S antroji interfazs stadija, kurios metu vyksta DNR replikacija, chromosom dvigubjimas. Ji sudaro apie 34 procentus viso ciklo trukms. 3. G2 treioji interfazs stadija, kurios metu lstel toliau augdama ruoiasi dalinimuisi. Jos trukm sudaro apie 16 procent ciklo.
252
BIOFIZIKA

Cdc2ciklinas B Cdc2ciklinas A

Cdk2ciklinas D Cdk4ciklinas D Cdk5ciklinas D Patikros takas

Cdk2ciklinas A Sfaktorius Cdk2ciklinas E

5.18 pav. Stuburini gyvn audinio kultros lstels ciklas ir j valdantys ciklinai bei kaspazs

4. M ypa ryki savo kaita mitozs faz, nors sudaro tik 5 procentus viso ciklo trukms. Jos metu stebimos penkios, greitai kintanios, tarpins bsenos: profaz, metafaz, anafaz, telofaz, citokinez. 5. G0 iskirtin fazin stadija, kurios metu lstel ilsisi arba kur laik bna nekintamos bsenos, tarsi ukonservuota. Organizuot sistem teorijos poiriu lstels ciklas yra sudtingos dinamins sistemos valdomi vyksmai, ir todl turi bti atitinkami bsen valdymo molekuliniai mechanizmai. ie lstels cikl valdantieji veiksniai signalins molekuls ciklinai ir valdym vykdantys baltymai kinazs cdk. Eukariotinse induoli lstelse nustatoma keliolika skirting ciklin. Daniausiai ciklinai yra ymimi D, E, A, B simboliais. Taip pat nustatomos kelios (iki 7) cdk kinazs. Jos sudaro kompleksus su ciklinais ir keiia lstels ciklo fazin bsen. Remiantis teoriniais organizuot sistem valdymo reikalavimais, lstels ciklo valdym lemia ne tik aktyvikliai ciklinai, bet ir slopikliai. Bandomj tyrim duomenimis, lstels fazins bsenos susijusios su koncentracine ciklin kaita (5.19 pav.). Manoma, kad tam tikri ciklinai, j koncentracijos lemia atitinkam fazin lstels bsen. Galima tiktis, kad vyraujant D ir esant E, gal net A ciklinams lemiama G1
253
5. Lstel organizuota sistema

CIKLIN R A I K A

ciklinas D

ciklinas E

ciklinas A

ciklinas B

G1

G2

5.19 pav. Lstels ciklo bsen valdymas ciklinais

faz. Majant E, o didjant A ir B ciklin koncentracijoms, lemia S faz. B ciklino koncentracijos vyravimas majant A ciklino koncentracijai lemia G2 faz. Greitai kintanias tarpini M fazs bsen kaitas turt lemti vis ciklin ir slopikli koncentracij kaita bei j vyravimo eilikumas, atsivelgiant j koncentracij dydius.

5.15. FIZIKOCHEMINIS LSTELS MODELIS (GIBSO IR DONANO PUSIAUSVYRA)

is lstels modelis yra vadas fizikin lstels chemij. Gibso ir Donano pusiausvyros slyga teigia, kad esant nesimetrikai silpn elektrolit sistemai, sudarytai i dviej erdvskyr, atskirt puslaidia membrana kur vienoje i j yra nepereinani pro membran stambiamolekuli anijon A, o abi erdvskyros pripildytos vandens elektrolito, pro membran pereinani, prieing polikum jon tirpalu, pavz. K + ir Cl stacionariosios tokios sistemos bsenos metu susidarys trys gradientai: pereinani jon koncentracij, elektrini potencial ir slgi skirtumai. sivaizduokime, kad silpno elektrolito aplinkos dal atskiria dvigubo sluoksnio fosfolipidin membrana (5.20 pav.). Susidaro lstel panai erdvskyra, kurios viduje yra tam tikras kiekis stambiamolekuli pro membran nepereinani baltym anijon A. Aplinkoje ir atskirtoje erdvskyroje esantys neorganiniai jonai, pvz., K+ ir Cl, laisvai pereina pro membran vid paprastosios difuzijos bdu. Prasideda jon persiskirstymo vyksmas, kurio stacionarij bsen nulemia antrasis termodinamikos dsnis. is dsnis tokiai asimetrinei elektrocheminei sistemai formuluojamas taip:
254
BIOFIZIKA

Abiej erdvskyr (vidaus ir iors) elektrocheminiai stacionariosios bsenos potencialai bus lygs. Dsningumas ireikiamas lygtimi: i = o , ia i vidinis erdvskyros elektrocheminis potencialas; o aplinkos terps elektrocheminis potencialas. Remiantis Huhenheimo lygtimi, erdvskyros elektrolite esantis jonas, kurio aktyvumas yra aj , vertinamas elektrocheminiu potencialu: j = j + z j F = 0j + RT lnaj + z j F, ia j j-tojo jono cheminis potencialas; 0j j-tojo jono standartinis cheminis potencialas; zj j-tojo jono valentingumas; aj j-tojo jono aktyvumas, danai suprantamas kaip to jono koncentracija; F Faradjaus skaiius; R idealij duj konstanta; T Kelvino temperatra.
RT F [K + ] i [K + ] o RT F [Cl ]o [Cl ]i

E = i o =

ln

ln

K +o

K +i i Cl
o

Cl

+E

[ K + ]i [ Cl ]i = [ K + ]0 [ Cl ]0
[ K + ]i [ Cl ]0 = = KD [ K + ]0 [ Cl ]i

5.20 pav. Gibso ir Donano sistema fizikocheminis lstels modelis

255
5. Lstel organizuota sistema

Tada visos elektrochemins sistemos abiej erdvskyr, vidaus i ir iorins o fizikocheminis Huhenheimo modelis galima urayti lygtimis:
0 K + + RT ln aK 0+ + F 0 = 0 K + + RT ln aK i+ + F i , 0Cl + RT ln aCl 0 F 0 = 0Cl + RT ln aCli F i .

ia jonai yra vienkrviai, todl z ireikiamas tik enklu: kaliui +1, chlorui 1. Be to, kiekviena erdvskyra turs ilaikyti elektroneutralum, kuris ireikiamas lygtimis:
aK 0+ aCl 0 = 0, aK i+ aCli A = 0 .

[ ]

I pirmosios lygi poros nesunkiai ivedama:


i 0 = RT aK0+ RT aCli , ln = ln F aK + F aCl
i 0

o i ia
ln aK +
0

aK +
i

= ln

a Cl
i

a Cl
0

arba

aK +
0

aK +
i

a Cl
i

a Cl
0

= K D , i kur

[ K + ]i [ Cl ]0 = = KD , [ K + ]0 [ Cl ]i

arba [ K + ]i [ Cl ]i = [ K + ]0 [ Cl ]0 .

ia KD Donano koeficientas, rodantis jon pasiskirstymo tarp erdvskyr netolygum. Todl Gibso ir Donano pusiausvyros taisykl teigia, kad esant nesimetrinei elektrolitinei sistemai praeinantys jonai persiskirsto netolygiai, kuri netolygumo dyd apibdina Donano koeficientas. Gana danai vietoje aktyvum vartojamos jon [K +] ir [Cl] koncentracijos. Tada Donano pusiausvyra ireikiama kaip vienos erdvskyros pereinani pro membran jon koncentracij sandaug lygi kitos erdvskyros praeinani jon koncentracij sandaugai. Kartais Donano pusiausvyra apibriama koncentracij santykiu, o kitais kartais kaip koncentracij sandaug lygyb. Kaip matyti i ankiau pateikt lygi, abiej erdvskyr pereinani jon koncentracij nelygyb lemia elektrini potencial skirtum tarp erdvskyr:
E = i 0 = RT ln K D . zF

Tai Nernsto lygtis, danai ireikiama per jon koncentracij santykius:


256
BIOFIZIKA

E=

RT [ K + ]i . ln zF [ K + ]0

Daniausiai, esant standartinms laboratorinms slygoms, kai T = 293 0K, arba 20C, vartojama suprastinta lygtis:
lg E = 58 ln

[ K + ]i mV. [ K + ]0

Vadinasi, jeigu vienos erdvskyros pro membran laisvai pereinaio jono, pvz., [K+], koncentracija 10 kart didesn u to paties jono koncentracija kitoje erdvskyroje, tai tarp i erdvskyr bus elektrini potencial skirtumas, lygus 58 mV. Nernsto lygtis rodo pagrindin vis lstels ir kit bioelektrini vyksm genezs mechanizm. Jon gradientai sukelia elektrini potencial skirtum, kuris yra proporcingas jon koncentracij santykio logaritmui. Naudojantis trimis anksiau pateiktomis jon aktyvumo lygtimis, galima apibdinti tam tikr jon aktyvum matematines lygtis, kuriomis vertinama nepereinani anijon A taka:
2 1 a K + = 2 ( [ A ] + 4 a0 + [ A ]),
i

2 1 aCl = 2 ( [ A ] + 4 a0 [ A ]) ,
i

ia a0 = a K0+ = aCl0 . Remiantis vant Hofo osmosinio slgio formule:


= R T a,

vertinus vis jon suminius slgius, gaunamas slgi membran skirtumas:


= R T ([ A ] + a K + + aCl 2 a0 ) .
i i

Lygt galima suprastinti remiantis ankstesne aktyvumo samprata:


2 = R T ([ A ] + [ A ]2 + 4 a0 2 a0 ) .

Matome, kad dl nesimetrikos jon struktros toje erdvskyroje, kurioje yra stambiamolekuliai anijonai A, slgis yra didesnis u slg kitoje erdvskyroje, kurioje toki anijon nra. Vis i elektrolitais pripildyt fizikochemini erdvskyr savybi pagrindin prieastis nepereinantys stambiamolekuliai jonai A ir membranos. Tai yra lsteli daugelio savybi pagrindas. Esant daug daugiau jon ri ir erdvskyr, susidaro sudtingesni dsningumai. ie visi aptarti dsningumai neatskiriami vieni nuo kit, vieni sukelia kitus.

257
5. Lstel organizuota sistema

5.16. MEDIAG PERNAA LSTELJE

Lstel yra atvira ir funkcikai darni organizuota sistema. Ji sugeba imti i aplinkos mediagas ir jas perneti reikalingas struktras ir organeles. Lstel naudoja daug mediag pernaos priemoni, kurias galima skirstyti tris pagrindines ris: pasyvisias, aktyvisias ir pernaas, susijusias su lstels struktr kitimu. Pasyvioji pernaa pernaos metodai, kai mediagoms perneti nenaudojama laisvoji energija. Tai natrals fizikocheminiai reikiniai difuzija, osmosas, palengvintoji difuzija, vyksmai, natraliai lemiami antrojo termodinamikos dsnio mediagos juda gradient inykimo kryptimi. Aktyvioji pernaa pernaos bdai, kuri metu naudojama laisvoji energija. ie pernaos bdai yra labai svarbs aikinant gyvyb, nes lstels yra rykiai nepusiausvirios termodinamins sistemos, ir j organizuotumui, gradientams palaikyti btina laisvoji energija. Tai svarbiausia, bet ne vienintel btinyb. Pernaa, keiianti lsteli struktr. ie gyvybei bdingi ekzocitozs ir endocitozs vyksmai, susij su membran virsmais, dideliais pokyiais, kai lstel neama, lstels viduje perneama arba i lstels imetama stambs objekai ar mediag kiekiai. Pavyzdiui, gliukozs tirpalo laelis, krakmolo gumullis, melsvadumblio lstel. Glaustai aptarkime konkreius pernaos bdus. Difuzija apibendrinama Fiko lygtimis. Esant koncentracij gradientui, mediagos element (molekuli, daleli) pernaos greitis pro paviri, kurio plotas A, ireikiamas lygtimi:
dn dc = D A , dt dx

ia D difuzijos koeficientas. Tai pirmoji Fiko lygtis. Difuzijos pro membran greitis, kur lemia koncentracij skirtumas tarp abiej membranos pusi C1 C2, ireikiamas diferencialine lygtimi:
dn = D A ( C1 C2 ) . dt

Koncentracij kitimo greit apibdina antroji Fiko, difuzinio bangos sklidimo lygtis:
c 2c = D 2 . t x

Tai pagrindiniai difuzijos dsniai, urayti matematinmis lygtimis, plaiai naudojami pernaai biologinse sistemose, lstelse vertinti ir modeliuoti. Pagrindini
258
BIOFIZIKA

difuzijos vyksm dsningum, Fiko matematini lygi esm grafikai parodyta 5.21 pav. Osmosas tirpiklio lstelje vandens molekuli difuzija pro puslaides membranas, stengiantis ilyginti mediag koncentracijas. Osmoso vyksmams bdingas osmosinis slgis . Remiantis vant Hofo formule:
= i RT C ,

MOLEKULI JUDJIMO KRYPTIS

arba vertinant itirpusi mediag koncentracij skirtum tarp gretim erdvskyr abiejose membranos pusse C1 C2, osmosini slgi skirtum apibdina lygtis:
= i R T ( C1 C2 ) ,

c x

ia R idealij duj konstanta ir vartojama tik esant silpniems tirpalams, i disociacijos konstanta.

5.21 pav. Difuzijos vyksm dsningum grafinis vaizdas

Esant daug neelektrolitini mediag, suminis osmosinis slgis ireikiamas sumine lygtimi:
= R T ( C1 + C2 +K + Cn ) , ...

ia koreguojamasis vant Hofo daugiklis, nustatomas i fizikochemijos inyn. Palengvintoji difuzija atrankioji pernaa pro membran, nenaudojant papildomos energijos. Molekules pro membran pernea membranose esanios stambiamolekuls, prisijungusios perneamsias molekules ir keiianios savj padt membranoje. Pernaai bdinga Michaelio ir Menten kinetika:
d [ S ] vmax [ S ] , = dt KT + [ S ]

ia [S] perneamos mediagos koncentracija, vmax didiausiasis pernaos greitis, KT pernaos konstanta. Aktyviajai pernaai bdingas laisvosios energijos eikvojimas, nes mediagos perneamos atrankiai i maesns mediag koncentracijos erdvskyros didesns me259
5. Lstel organizuota sistema

diag koncentracijos erdvskyr. iai pernaai, kaip ir palengvintosios difuzijos atveju, bdingas Michaelio ir Menten kinetikos modelis. Daniausiai is vyksmas panaus fermentins reakcijos kinetik, kuriai btina ATP molekuli neama energija. iuo principu veikia molekuliniai lsteli siurbliai, kurie lstelse sukuria ar palaiko tarp erdvskyr vairiausius gradientus. Jie lemia nepusiausviriosios termodinamins sistemos lstels bsen, bt. Tai Na +K, Ca ++ arba (Ca++ -ATP-az), NaCa++ bei kiti siurbliai. Siurbli pernaai bdingi trys etapai pirminis, antrinis ir tretinis. Etapai skirstomi atsivelgiant pernaos papildomos laisvosios energijos naudojim. Apibendrinant mediag perna pro membran bdus, BENDROJI PERNAA juos galima riuoti tris: vienna (uniport), sna (simport) ir priena (antiport) (5.22 pav.). Darni dviej mediag pernaa pro membran, nesvarbu, ar tai bt snaa, ar prienaa vadinama bendrja pernaa (kotranportu). Tokie mechanizmai nustatomi PRIENAA VIENNAA SNAA perneant jonus H+, Na+, Cl , K+, Ca++. 5.22 pav. Lsteli perna bdai

5.17. BIOELEKTRINIAI LSTELS POTENCIALAI

Lstels gali bti ramybs ir sujaudintos bsenos. Pastebta, kad gyvos lstels, esanios ramybs bsenos, tarp vidaus ir iors yra gana stabilus elektrini potencial skirtumas ramybs potencialas ER . Jo dydis kelios deimtys milivolt, daniausiai neigiamojo lstels vidaus enklo palyginti su jos aplinkos potencialu. Tam tikras lsteles paveikus fiziniais dirgikliais (elektriniais, cheminiais, mechaniniais ir pan.), jose galima sukelti sujaudinim. ios bkls metu vyksta rykus trumpalaikis elektrini potencial skirtumo pakitimas, net enklas pakeiiamas prieingu, kuris vadinamas veikimo potencialu Ev (5.23 pav.). Aiku, elektrines lstels savybes lemia joniniai membranos vyksmai. Netolygus jon koncentracij persiskirstymas lstels viduje ir iorje, kaip rodo Nernsto lygtis, sukuria elektrini potencial skirtum. Taiau Nersto lygtis taikoma vienos ries jonams. Lstelje vienu metu veikia daug vairi jon. Esant daug jon ri lstelje,
260
BIOFIZIKA

(kyij atvoi jon pernaa)

5.23 pav. Bioelektrini potencial genezs schema

dl skirting j koncentracij ir netiesini sveik tarp jonini mechanizm, elektrini potencial skirtumui tarp erdvskyr vertinti vartojama sudtingesn formul, vadinama Goldmano, Hodkino ir Katco vardais. i formul vertina trij jon K+, Na+ ir Cl tak bioelektrini potencial genezei:
E= RT PK [ K + ]o + PNa [ Na + ]o + PCl [ Cl ]i . ln F PK [ K + ]i + PNa [ Na + ]i + PCl [ Cl ]o

Ramybs ir sujaudinimo bsenas rodo jon laidumo koeficientai PK , PNa , PCl . Empyrikai pamatuoti santykiniai laidumo koeficient dydiai ramybs potencialui nustatyti: PK : PNa : PCl = 1 : 0,04 : 0,45, o sujaudinimo, veikimo potencialo didiausiam dydiui nustatyti: PK : PNa : PCl = 1 : 20 : 0,45.
261
5. Lstel organizuota sistema

Laikoma, kad ramybs bsenos metu lstels elektrini potencial dyd lemia [K +] jonai, ir todl:
ER RT PK [ K + ]o . ln F PK [ K + ]i

Analogikai, sujaudinimo atveju laikoma, kad veikimo potencialo dyd lemia [Na +] jonai, todl:
EV RT PNa [ Na + ]o . ln F PNa [ Na + ]i

Apskritai, lstels perjimo i ramybs sujaudinim ir grimas ramybs bsen gana sudtingas, netiesinis vyksmas, kur lemia [Na+], [K+], [Ca++] ir kit jon pernaos mechanizm veikla, jon kanalai. Hodkinas ir Hakslis yra pateik gana sudting netiesins [Na+], [K+] jon reikms lstelse elektrin model. Hodkino ir Hakslio modelis lstels elektrini potencial kitim aikina elektrins grandins veikimu, esant sujungtiems lygiagreiai trims elektrovaros altiniams ENa, EK ir ECl , turintiems savas vidaus varas, taip pat membranos elektrins talpos CM ir aktyvios elektrins varos RM elementus (5.24 pav.). Laikoma, kad majant lstels elektrini potencial skirtumui, ramybs potencialui ER pasiekus kritin slenksio dyd, Na+ jonai i aplinkos pradeda skverbtis lstels vid, rykiai didja Na+ jon laidumas GNa (maja vara RM = 1/ GNa), ir liau laidumas K+ jonams plsti i vidaus ior GK . Laidumas kitiems jonams nepakinta (5.23 pav., 5.24 pav.). i trij jonini elektros potencial generatori, sujungt lygiagreiai, esant membranos elektrinei talpai

IORIN MEMBRANOS PUS

iC
EM iNa CM ENa + EK + ECl +

rNa

iK

rK

iCl

rCl
EM

LSTELS VIDUS

5. 24 pav. Membranos elemento ekvivalentin elektrin schema

262
BIOFIZIKA

CM ir laidumui GNa , matematiniais ir elektriniais modeliais gautos lstels elektrins reakcijos gerai atspindi bandym duomenis. Bandymais pastebta, kad labai didel reikm elektriniams membranos potencialams, j kaitos savybms turi kalcio jonai Ca++. Taiau dar nra sukurta atitinkam pagrst ir akivaizdi modeli.

5.18. VEIKIMO POTENCIALO SKLIDIMAS (KABELIO TEORIJOS TAIKYMAS)

Nervins ir raumenins lstels bei tam tikros j dalys, galinios bti sujaudintomis, t. y. tam tikrose vietose generuoja veikimo potencialus, taip pat turi veikimo potenciai1 r1 r1
Zm membranos

AKSONO IOR r1

r1

U1

i3 im Cm Em i4 r4 i2 + -

i3 i4 Cm AKSONO VIDUS Em + r4

i3 i4 Cm Em + r4

r2

r2

r2

r2

U2

i2
U Ev Ev Ev

Q 0 X

y = x vt

5.25 pav. Sujaudinimo sklidimo aksonu elektrinis modelis

263
5. Lstel organizuota sistema

lo sklidimo erdvje galimyb. Geriausiai yra itirtas nervins lstels neurono veikimo potencialo nervinio impulso sklidimas aksonu. i savyb aikinama elektrinio kabelio teorija. Tai vamzdin ar pavirin struktra, sudaryta i tarpusavyje vietikai susijusi jaudri membranos element, kuri ekvivalentinis elektrinis modelis yra elektrins RC grandinls, turinios elektrinio kabelio savybi. Nervins lstels neurono ataugos aksono ekvivalentin elektrin schema pateikta 5.25 paveiksle. Remiantis Omo dsniu, lstels potencial skirtumas arba membranos potencial skirtumas uraomas lygtimi: U(t) = U1 U2 = Zm im ,
U 1 U 2 = r1 i1 , ir = r2 i 2 . t t Jei yra tik vietins elektros srovs ir vietiniame elemente nra tekani srovi, o:

kur

i1 + i2 = 0, tada
i1 i = 2 = im , t t ir pasinaudojus ia lygtimi gaunama tiesin elektrinio kabelio bangin lygtis, apibendrinanti signalo, t. y. nervinio impulso sklidim neurono atauga aksonu:
2 i i 2U = r1 1 + r2 2 , arba U = (r1 + 2 ) im . 2 t t t t 2

Kai i m = i3 + i 4 = C m

U 1 + ( E m U ), t r4

tada bangin lygt sutvarkius ir suprastinus gaunama:

2
kur =

2U U = + U Em , 2 x t
r4 , ir = r4 C m . r1 + r2

ir yra pagrindiniai membranos, kaip elektrinio kabelio, savybes apibdinantys dydiai, vadinami: lstels arba jos membranos banginiu ilgiu, ir lstels arba membranos laiko pastovija.
ie dydiai rodo sujaudinimo silpnjimo pobd erdvje ir per tam tikr laik. Bangin lygtis yra tiesin, todl jai nagrinti vartojamas naujas kintamasis: y=xvt,

264
BIOFIZIKA

ir bangin lygtis paveriama antrosios eils tiesine nehomogenine diferencialine lygtimi:

d 2U dU = v + U Em . 2 dy dy

Jos sprendinys yra eksponent. Svarbiausias i eksponent apibdinantis dydis yra banginis ilgis . Tarkime, kad sujaudinimo potencialas laikui bgant nekinta, bet sklinda aksono ilgyje, t. y. nagrinjame sujaudinimo sklaid erdvje daug trupesniu u 3 ar net 5 laiku, ir viename aksono sujaudinimo take ilieka maksimalus veikimo potencialas Ev dydio, tada sprendinio eksponent galima urayti lygtimi:
U ( y ) = E v exp y

I ios matematins lygties matyti, kad banginis ilgis rodo sujaudinimo potencialo silpnjim tolstant nuo tam tikros sujaudinimo vietos. Tai rodo, kad u 35 membranos veikimo potencialas silpnja ir jo dydis sumaja iki ramybs potencialo dydio. Veikimo potencialas kyla neurono aksono kaklelyje ir toliau sklinda mielinizuotu aksonu. Depolerizacijos dydis sklinda po mielininiu apvalkalu eksponentikai madamas. 5.25 pav. parodytas grafikai veikimo potencialo atkrimas kitose Ranvj ssmaukose. Sujaudinus tarpin Ranvj ssmauk, sujaudinimas sklis abi aksono puses. Taiau veikimo potencialas, natraliai kils aksono kaklelyje, dl membranos visiko refrakterikumo savybs, t. y. dl visiko nejaudrumo tam tikr laiko trukm po veikimo potencialo atsiradimo, sklis tik viena kryptimi ta kryptimi, kur sujaudinimo artimiausiu laiku nebuvo. Banginio ilgio konstantos dydis gigantikuosiuose aksonuose, kuri skersmuo yra deimtys arba net imtai mikron, = ~2,55 mm. Vadinasi, u ~35 , t. y. u 825 mm nuotolio nuo Ranvj ssmaukos aksono depolerizacija daniausiai baigtsi ir nebebt jokios galimybs sukelti nauj sujaudinim signalas nebt perduodamas. Tad nuotoliai tarp dviej gretim Ranvj ssmauk turi bti banginio ilgio konstantos dydio. Laikines, sujaudinimo sklidimo greit lemianias savybes, rodo membranos arba lstels laiko pastovioji = r4 Cm . Bandymais pamatuot tam tikr gyvn gigantikj akson memban elektrin talpa Cm = ~1 F/cm2. Membranos vara r4 = ~700 5000 cm2, o laiko pastovioji = ~0,75 mS. Sujaudinimo arba veikimo potencialo sklidimo greitis aksonu priklauso ir nuo aksono skersmens: v = ~0,62,3 m/S nemielinizuotose skaidulose, ir v = ~5120 m/S mielinizuotose. Nustatyta, kad priklausomyb tarp sujaudinimo sklidimo greiio ir laiko pastoviosios yra sudtinga. Akivaizdu, kad juo didesn , juo sklidimo greitis ltesnis.
265
5. Lstel organizuota sistema

Tokie potencial arba lsteli sujaudinimo sklidimai vyksta ne tik aksonuose, bet ir dendrituose, raumenyse, irdies miokardo audinyje ir kitur. Daniausiai ie vyksmai aikinami tiesiniais modeliais, kurie apraomi tiesinmis algebrinmis ir diferencialinmis lygtimis. Taiau bandymais gauti duomenys akivaizdai rodo esminius netiesikumus.

5.19. ELEKTRINI MEMBRANOS SAVYBI NETIESIKUMAS

Lstels membranos elektrochemini, t. y. elektrini ir jonini, savybi tyrimai akivaizdiai rodo, kad membrana, j vertinant elektros laidumo poiriu, yra netiesinis elementas. Rykiausia netiesikum rodant savyb veikimo potencialo generavimas. Specialiomis bandomj tyrim metodikomis nustatyti membranos varos kitimai rodo N-tipo formos voltamperines priklausomybes. N-tipo netiesikumai parodyti 5.26 paveiksle. Jeigu lstels membran elektrins savybs bt tiesins, tai j voltamperins charakteristikos bt tiess (5.26 pav. brknine linija), einanios per koordinai pradi. Koordinai pradia iuo atveju bt lstels membranos ramybs bsena, turinti tam tikr ramybs potencial UR ir membrana tekani ramybs elektros IR srov. Mainant lstels depoliarizacij, dl daugybs membranos molekulini ir fizikochemini tarpusavyje susijusi savybi, membranin vara pradeda didti, t. y. tekan-

IM
Elektros kr vio ikrova

I 0R
UR UV

Elektros kr vio krova

5.26 pav. Netiesins N-tipo membranos voltamperins priklausomybs

266
BIOFIZIKA

ti ja elektros srov gali mati net iki tiek, kad pasikeiia jos tekjimo kryptis prieinga. Tai ir yra veikimo potencialo suklimas generavimas. Membranos, turinios tokias elektrines savybes voltamperini savybi priklausomyb yra tarsi dinamins sistemos fazinis portretas, rodo tris bsenas: dvi stabilias ir vien nestabili. Nestabilioji rodo slenkstin dyd, neapibrtumo bsen, kai membranos depoliarizacija savaime nesustabdomai didja ir pereina veikimo potencialo suklimo (generavimo) faz UV . Taip pat membranos bsena gali grti ir fazin ramybs bsen UR . Veikimo potencialo suklimo (generavimo) fizikochemin aikinim galima pateikti kaip membranos elektrinio kondensatoriaus CM krovim, bei jo ikrov. Aiku, tai yra tam tikros molekulins mainos veikla perduodant signalus, neanius informacij.

5.20. ELEKTROKINETINIS POTENCIALAS

Lsteli ir organeli paviriai aptraukti vairiausiomis baltym struktromis. inoma, kad elektrolitinje terpje baltymai gyja pavirin krv, kuris priklauso nuo aplinkos pH. Tokiu bdu is pavirinis krvis, sveikaudamas su aplinkoje esaniais jonais, sukelia tam tikrus elektrokinetinius ir elektroosmoso reikinius. Visus juos lemia elektrokinetinis (dzeta) potencialas. Jo prigimtis ir esm parodyta 5.27 paveiksle. Biologins membranos daniausiai turi neigiamj pavirin krv. Lstels, jos organels ar net membranos lopo pavirius elektrolitinje terpje pirmiausia apsitraukia vandens molekuli dielektriniu sluoksniu, u kurio susidaro teigiamj (arba neigiamj, priklauso nuo pavirini baltym polingumo) jon debeslis. Jo tankis hiperbolikai maja r tolstant nuo paviriaus. is tankis atspindi elektrostatinio lauko stiprum, o tankis prie paviriaus elektrokinetinio (dze ta) potencialo dyd. [mV] Toks potencialas vadinamas elektrokinetiniu, nes patalpinus struktras elektriniame lauke, prasideda baltym komponeni judjimas atitinkamo 0 X elektrodo kryptimi. Judjimo greitis priklauso nuo dzeta potencialo dydio, 5.27 pav. Lsteli arba organeli elektrokinetinio o kryptis nuo enklo. potencialo sampratos schema
267
5. Lstel organizuota sistema

Priklausomum nusako Smoluchovskio formul:


4 u , D E ia dispersins aplinkos klampos koeficientas; u dispersins fazs dalels judjimo greitis; D dielektrin konstanta; E iorinio lauko sukurtas elektrinis gradientas. =

i formul gana tiksli, jei organels ar lstels skersmuo daug didesnis u elektrinio sluoksnio stor, kuris vidutinikai yra 108 cm. Maoms dalelms, baltym molekulms taikoma panai Debajaus ir Hiukelio formul, kuri tikslinama dauginamuoju koeficientu. Elektrokinetinis dzeta potencialas gana danai vartojamas vertinant fiziologin lsteli bsen. Nesudtingais renginiais pamatavus lsteli judjimo greiius elektriniame lauke, 5.1 lentel. Gyvn eritrocit elektrokinegalima apskaiiuoti j potencialus. Pavyzdiui, tiniai potencialai tam tikr gyvn eritrocit elektrokinetini poGyvnas , mV tencial dydiai pateikti 5.1 lentelje. Triuio 7,0 ie elektrini potencial dydiai yra gan staKiauls 12,5 bils. Pakit i potencial dydiai rodo fizioJr kiaulyts 14,2 loginius sutrikimus. Tam tikrais atvejais j pomogaus 16,3 kyiais remiamasi diagnozuojant ligas, pavyzdiui, kraujo, onkologines. Makakos rezus 17,0 Elektrokinetiniai potencialai padeda suprasKats 17,8 ti ir paaikinti daug elektrokinetini vyksm iurks 18,6 elektroforez, elektroosmos, tekjimo ir sediuns 21,1 mentacijos potencialus.

5.21. LSTELI AUGIMO DSNIAI

Lstels augim, remiantis atvirj sistem termodinamikos dsniais, lemia du prieingai veikiantys veiksniai: lstels sklaida (disimiliacija, disipacija), t. y. irimas, ir atsikrimas bei nauj struktr susidarymas (asimiliacija, organizavimas). Akivaizdu, kad disipacij lemia visas lstels tris V, o atsikrim ir nauj struktr susidarym btinas itekli tiekimas i aplinkos. Itekli tiekim i aplinkos lemia lstels pavirins membranos plotas P.
268
BIOFIZIKA

Tarkime, kad tyrinjamas tam tikro lstels parametro X (ilgio, storio, mass) didjimas. Tada bendroji augimo diferencialin lygtis:
dx = P V , dt

ia asimiliacijos (sintezs) koeficientas; disimiliacijos (disipacijos ) koeficientas. Aiku, kad lstels geometrija turs didel tak jos didjimo pobdiui. Atsivelgiant lsteli geometrij, yra vartojami du lstels augimo dsniai: eksponentinis ir proporcingasis. Eksponentinis augimo dsnis taikomas cilindrinms lstelms, vertinant j ilgio l didjim. Tarkime, kad cilindrins lstels tris V bus: V = r2 l , ia r cilindro vidinio skersmens spindulys, o paviriaus plotas P: P = 2 rl + 2 rl
2

= 2 r (l + r).

Tarkime, kad l >> r ir r = const., tada lstels ilgjimo diferencialin lygtis bus:
dl = ( ) l l, nes V l ir P l. dt

Isprendus i diferencialin lygt gaunama eksponentinio lstels augimo dsnio algebrin lygtis:

l (t ) = l0 e ( )t .
5.28a paveiksle grafinis vaizdas rodo, kad esant > lstel ilgja, greitdama dvigubja ir, pasiekusi 2l0 ilg skyla pusiau. ia l0 pradinis lstels ilgis. Matyti, kad augimo greiius lemia asimiliacijos (anabolizmo) ir disimiliacijos (katabolizmo) koeficient skirtumas. is skirtumas lemia ir augimo trukm, ir dalijimosi laiko moment. Kai = , lstels augimas sustoja. Proporcingasis augimo dsnis taikomas rutulinms (sferinms) lstelms, o vertinamasis dydis yra lstels mas m (arba tris). Pagrindinis rutulins lstels geometrinis dydis yra jos spindulys r, todl vertinant mass didjimo greit, paviriaus ploto iraik tenka ireikti trio arba mass vienetais. Tada rutulins lstels augimo diferencialin lygtis bus:
2 dm = m3 m , dt

nes V m, o P = V 3 (V = 4 r 3 ; P = 4 r 2 ). 3
2

269
5. Lstel organizuota sistema

l 2l0 dl l0

< = >

a)

0 dm dt
m03
2

T1 m

T2
3

m0 =

m
b)

m2

5.28 pav. Lstels augimo dsniai: eksponentinis ir proporcingasis

Tai netiesin diferencialin lygtis, kurios bendrj sprendin nustatyti sunkiau. Taiau i 5.28b pav. grafiko matyti io netiesinio vyksmo stacionarioji bsena. Lstel auga iki mass m0, kai asimiliacijos ir disimiliacijos vyksmai susilygina ir stabilizuojasi, t. y. m(t) = const. Tai suprantama, nes rutulinei (sferinei) lstelei didjant, jos tris didja greiiau nei paviriaus plotas. Kai
2 dm = 0 = m03 m0 , dt

akivaizdu, kad m0 = . Gaunama didiausios rutulins lstels mas. inant lyginamj lstelins mass svor, nustatomas jos tris, skersmuo ir spindulys. Pateikti lsteli, turini didiausias labai paprastas geometrines formas, augimo modeliai padeda suprasti ir vertinti bendruosius io vyksmo dsningumus. Sudaromos galimybes nustatyti sudtingesni form lsteli augimo dsnius. Neabejojama, kad lsteli augimo vyksmas yra grindiamas tam tikra, programikai apibrta procedra, kuri galima apibdinti kaip dekodavim. Tai biotechnologins programos dekodavimas arba ireiktos nukleorgi kodavimo kalba programos skleidimas biotechnologini lstels augimo vyksm valdymas genetine informacija. Lstels yra dar270
BIOFIZIKA

nios organizuotos sistemos, taiau tam tikri j funkcionavimo mechanizmai susidvi. Jie nebesugeba kompensuoti atkurti sunykusi sudedamj lstels dali, organeli ir nebesugeba ilaikyti net ir nekintamos organizuotumo visumos. Lstel irsta, jos entropija pradeda didti. Ateina lstels ties metas. Nustatyta, kad ir lstels mirtis yra taip pat programuota procedra. Ji net turi pavadinim apoptoz.

5.22. APOPTOZ PROGRAMUOTA LSTELS MIRTIS

Lstels, kaip ir visos natralios sistemos ar mainos, yra veikiamos antrojo termodinamikos dsnio susidvi. Sunyksta tam tikros, gyvybikai svarbios struktros. Jos reikiamai nebeatlieka savo funkcij, lstel neivengiamai turi mirti, nors jos veikla dar yra darni, veikia visos valdymo struktros. Daniausiai pirmin ties prieastis bna susidvjusi tam tikra informacin valdymo struktra, atsakinga u svarbi fiziologini vyksm valdym. Daugialsi organizm lsteli mirtys skirstomos nekrozes ir apoptozes (5.29 pav.). Nekroz lstels mirtis, kai susidvjus ar sutrikus svarbioms lstels fukcinms dalims, lstelje prasideda nevaldomas disimiliacijos procesas, virijantis asimiliacij. Valdymo procedros nebesugeba sustabdyti irimo proces, ir lstels nykimas vyksta nevaldomai ir nebesustabdomai. Vyksta savaiminis lstels irimas. Daugialsio organizmo irimo produktai tam tikros sudedamosios dalys pasklinda tarp kit sveik lsteli. Aplinkins lstels ukreiamos nuodingais irimo produktais. Panas irimo procesai prasideda ir jose, masikai, prasideda biologini audini gangrena. Daugialsiui organizmui tai labai kenksmingas vyksmas. Jis danai nustatomas tiriant onkologinius sutrikimus ir traumas. Biologai stebi ir kitokius lsteli mirties atvejus, kai sutrikus tam tikriems lstels mechanizmams, ji pati save pradeda tvarkingai programikai iardyti. i biologin lstels mirtis vadinama programuota lstels mirtimi apoptoze. Apoptoz programuota lstels mirtis, yra tvarkingas lstels iskaidymas. Jis atliekamas tikslingai, aplinkins lstels pasisavina mirusios lstels dalis, jas fagocituoja. Toks vyksmas apsaugo aplinkines lsteles nuo kenksming irimo produkt ir padeda taupiai naudoti dal funkcikai sveik struktr kitose lstelse. Apoptozs vyksmai bdingi gyvn ir augal lstelms. Susidarius tam tikrai bklei, pavyzdiui, tam tikras patogenas veikia lstels paviriuje esanius molekulinius receptorius, sukelia molekulinius autogeneratorinius stiprinimo (kaskadinius) vyksmus. Taip sustiprinamas poveikis ir prasideda grandin reakcij, kurios lsteles inarsto, sklaida. ios grandinins dinamins procedros vyksta gana sudtingai. Bandymais matomos tiksliai programuotos veiklos procedros, bet kol kas jos dar neiaikintos.
271
5. Lstel organizuota sistema

NEKROZ

APOPTOZ

5.29 pav. Nekroz savaiminis lstels irimas, apoptoz programuota lstels mirtis,

Abejojama dl nukleorgi dalyvavimo apoptozs procedrose, nors sutariama, kad apoptozs vyksm struktra susideda i tokios grandins: signalas =>receptoriaus =>transkripcijos =>baltym sintez => =>baltym veikla => mirtis. rodius, kad i schema galioja, tai bt dar vienas akivaizdus lstels, kaip programinio valdymo biotechnologinio vyksmo, pavyzdys. Atmetus i schem, tekt atmesti ir informacines transkripcijos procedras. Vadinasi, reikt iekoti nauj programins veiklos priemoni. ios naujovs lemt nauj biologini kokybi atradim. Iki iol vyrauja nuostata, kad veiklos programos lstelse saugomos nukleorgi atminties struktrose.
272
BIOFIZIKA

Iorinis kelias
Fas ligandas TNF ties receptorius

Vidinis kelias
DNR paaidos PKC slopinimas

Kaspaz 8 Citochromas c Prokaspaz 3 (neaktyvi) Kaspaz 3 (aktyvi) Kaspazs 6 ir 7 Suskaidyti baltymai Kaspaz 9

5.30 pav. Apibendrintos lsteli apoptozs vyksm schema

Nekrozs ir apoptozs vyksmus galima lyginti su seno namo ardymo procedromis. Namas gali griti savaime tai idealus negyvosios gamtos antrojo termodinamikos dsnio pavyzdys. Nam galima sudeginti tai greitesnis irimo metodas. Nam galima tvarkingai iardyti pagal tiksl plan program: pirmiausia tvarkingai nuimti stog, ardant sienas numeruoti sien dalis, graiai iimti langus, duris ir ir pan. Pirmieji du griovimo variantai bt analogiki nekrozei, o treiasis atitinka apoptoz. Programines apoptozs procedras atlieka speciali molekuli kaspazi rinkiniai. Suprastinta kaspazi reikm apoptozs vyksmui parodyta 5.30 paveiksle. Tam tikri aplinkos signalai, mitochondrij bsena per kaspazi rinkinius, tam tikrus kaspari tinklus, molekuli signaliniais keliais vykdo lsteli ardymo programas. Galimas ir poveikis genom, kuris sukelia reikiam lstel inarstani ferment ir signal sintez. Tai dar vienas lstels, kaip organizuotos sistemos, veiklos pavyzdys.

* * *
Lstel ir prokariotin, ir eukariotin yra organizuota sistema. Didiausi jai tak daro informacins valdymo procedros. Nukleorgtys yra pagrindiniai i informacini procedr neikliai signalai. Baltymai programas gyvendina vykdo. Lstelms sudarius lsteli agregatus, audinius, atsiranda naujas daugialsi organizm lygis. Jis kartu su genetins informacinio valdymo procedromis sukuria naujas, lsteli informacinio valdymo struktras susidaro organizmai daugialsts organizuotos sistemos.
273
5. Lstel organizuota sistema

tuias

274
BIOFIZIKA

ORGANIZMAS ORGANIZUOTA SISTEMA

Ontogenez yra greitas ir trumpas filogenezs pakartojimas. E. HEKELIS, Pagrindinis biogenezs dsnis, 1866

Organizmas, biologijos poiriu, yra funkcikai tikslinga organizuota sistema. Ji susideda i daugybs skirting sudedamj dali organ, atliekani tam tikras svarbias funkcijas. Viena i pagrindini organizmo ypatingj savybi yra jo daugybs pavieni ir skirting sudedamj dali darnios veiklos, gyvendinant funkcikai prasmingus tikslus. Tam btinas informacinis valdymas. Organizm apibdinant kibernetikos poiriu, visi jo organai ar j dalys, atsivelgiant funkcijas, turi bti priskiriami prie vieno i dviej pagrindini posistemi: vykdanij organ posistemiui, kuris perdirba mediagas ir energij. Gav informacinius signalus, reikiamu metu ir reikiamoje tam tikroje vietoje ar organe veikl aktyvina, arba j veikl stabdo, t. y. vykdo funkcikai tikslingus, valdomus mediag ir energijos virsmus; valdymo posistemiui, kuris formuoja valdaniuosius, informacij neanius signalus. Pastarasis, valdantysis posistemis priimantis, saugantis, perdirbantis ir siuniantis informacij lemia sistemos funkcins veiklos organizuotum. Jo veikla lemia vis vykdanij organ koordinacij, kontrol, reguliavim, darni veikl, t. y. valdym. Remiantis iuo skirstymu, tam tikroms organizmo dalims, organams (grandims) galima taikyti atitinkamus vertinimo ir analizs metodus: fizikos, chemijos mediag
276
BIOFIZIKA

ir energijos virsm dsnius vienoms, ar informacijos, kodavimo, dekodavimo, signal ir valdymo teorijas kitoms. ie abu posistemiai organizme turi atitinkamas morfologines ir anatomines struktras. emiausio lygmens vienalstis gyvybs organizmas kiekviena lstel turi valdomj ir valdymo posistemius: valdomasis tai fermentini reakcij komplektai, atliekantys konkreius mediag ir energijos (metabolinius) virsmus, ir valdantysis nukleorgi ir signalini molekuli struktros. Daugialsiame augalo ar grybo organizme, be visose lstelse esani dviej funkcikai ir morfologikai susijusi atitinkam lstelini struktr, dar yra auktesnio, virlstelinio lygio taip pat dviej sveikaujani posistemi organizacija. Tai daugyb mediag bei energijos virsmus ir j perna atliekantys lsteliniai kompleksai organai, ir signalines molekules hormonus sintetinanios ir organizmo lsteli aplinkoje skleidianios, bei organizmo ior siunianios lsteli struktros. Daugialstis gyvnas, be hormonini valdymo struktr, turi dar vien auktesnio funkcinio lygio speciali nervini lsteli tinklin valdymo struktr, kuri koordinuoja vis kit emesnio lygio jo valdomj organ darni veikl (6.1 pav.). Tokiu bdu gyvas organizmas, kaip organizuota sistema, yra sudarytas i hierarchikai susijungusi funkcini valdymo ir valdomj struktr. Jos turi anatominius ir morfologinius atitikmenis ne tik visose lstelse, bet ir daugialsiame organizme: virkinimo, kraujotakos, kvpavimo, raumen ir griaui struktros yra vykdanij arba valdomj organ dalys, o hormon, feromon, nerv ir jutimo organ valdymo posistemio struktros. Isamiau nagrinjant nurodyt lygi biologini tyrim duomenis galima pastebti nuodugnesn hierarchin vis lygi vidaus diferenciacij. Ypa rykus nervini
INFORMACIJOS SRAUTAI

A P L I N K

A P L I

NERVINIAI TINKLAI

HORMONAI GENAI MEDIAG ir ENERGIJOS VIRSMAI VEIKSMAI

N K A

A ITEKLIAI

ATLIEKOS TARA

6.1 pav. Gyvnas hierarchikai organizuota kodavimo ir dekodavimo sistema

277
6. Organizmas organizuota sistema

struktr smegen skirstymas anatomines sudedamsias dalis, funkcin j paskirt ir raid evoliucijos poiriu. Tokiu bdu daugialst organizm bendruoju poiriu reikia vertinti kaip hierarchikai organizuot kodavimo ir dekodavimo dinamin sistem, kurioje rykiausiai matomi trys lygiai: gen kiekvienoje lstelje; hormon paprastesns organizacijos daugialsiuose organizmuose; ir dar nerv gyvnuose. Daugialsio organizmo kaip organizuotos valdomos gyvosios sistemos aikinim prasminga pradti nuo tarplstelini molekulini sveik.

6.1. DAUGIALSTIS ORGANIZMAS

Daugialsiai organizmai isivysto i tam tikr lsteli joms dauginantis. Jau paviens lstels yra savaime organizuotos sistemos, t. y. jos turi savas informacines valdymo struktras, vykdanias kodavimo ir dekodavimo procedras. Lstelms dauginantis ir susidarant lsteli agregatams, jie pradeda specializuotis ir koordinuotis. Atsiranda poreikis vienoms lstelms sveikauti su kitomis, ypa tarp aplinkini lsteli. Daugialsiui organizmui augant, daugjant jo lsteli, susidaro tam tikr lsteli audiniai ir prasideda funkcinis struktr formavimasis. Rykiausias io vyksmo pavyzdys embriogenez (6.2 pav.). Biologiniai tyrimai akivaizdiai rodo, kaip viskas prasideda i vienos lstels ar tai bt zigota, susiliejus
LYTINS LSTELS

EKTODERMA MEZODERMA

ZIGOTA

ENDODERMA GASTRUL

MORULA

6.2 pav. Daugialsio organizmo vystymosi schema

278
BIOFIZIKA

BLASTULA

2-j 4-i 8-i Lsteli stadijos

dviem lytinms lstelms (gametoms) ir sudarius vis genetini biotechnologini program komplekt, ar tai klonavimui paruota lstel, jau turinti vis genetini program komplekt. Visais atvejais pirminje lstelje turi bti informacins atminties struktros, kuriose yra bsimojo organizmo biotechnologinis gamybos projektas. Klasikins biologijos specialistai tai vadina genomu. Embriogenezs schemose vaizduojant vyksm paymimas lstels centras. Tai rodo pavieni lsteli branduoli informacini genetinio valdymo struktr svarb. Pirminiai lstels dalijimaisi, dviej, keturi, atuoni lsteli bei moruls ir gastruls stadijoms vargu ar ryki aikesn lsteli specializacija. Morfologin i stadij struktra beveik idealiai simetrika. Vadinasi, visos lstels atlieka beveik tapaias funkcijas. Taiau gastruls stadijos metu neabejotinai atsiranda paviens struktros vienet bei j tam tikr lsteli specializacija. Biologija tai vardija lsteli diferenciacija ir morfogeneze. Kad bt vaizdiau, pateikiama ios raidos schema:
ZIGOTA MORUL LSTEL | BLASTUL AUDINYS GASTRUL NEURUL MOGUS ORGANAS ORGANIZMAS | |

Teorins biologijos poiriu iki moruls stadijos visas daugialstis organizmas vertinamas atsivelgiant vienos lstels savybes. Blastuls stadijos tarpsniu vertinamas biologinis daugialsio organizmo audinys, gastruls ir neuruls stadij metu pabriami organai, ir tik vliau matomas visas daugialstis organizmas. is daugialstis organizmas sudarytas i daugelio gana savarankik funkcini vienet, kurie turi ir atitinkam morfologin struktr. Tai akivaizdiai matoma daugialsio organizmo struktrins organizacijos schemoje (6.3 pav.).

ORGANIZMAS MOGAUS

ORGANAS SMEGENYS

AUDINYS NEURON TINKLAS

LSTEL NEURONAS

6.3 pav. Hierarchins daugialsi struktr sistemos

279
6. Organizmas organizuota sistema

Organizmas mogus, sudarytas i daugybs organ. Vienas i i organ yra smegenys. Organas smegenys sudarytas i audini nervini tinkl. Audinys nervinis tinklas sudarytas i tam tikr lsteli t. y. neuron. Organizmas sudarytas i lsteli, kurios savo ruotu paios taip pat yra organizuotos sistemos. Neabejotinai rykiai matoma struktrin ir funkcin hierarchija. Aiku, visoms ioms struktroms bdingos kitokios, tik j funkcionavimui bdingos savybs. Aikinantis organizmo susiformavim i vienos lstels, tikslinga vadovautis Noimano save gaminani automat teorine samprata. Ji teigia, kad save gaminanios ir tobulinanios mainos turi turti programines gaminimo nuorodas informacinius projektus bei j dekodavimo ir kopijavimo struktras. Todl nagrinjant pirmin daugialsi organizm organizavimsi lstelms dalijantis, pagrindin dmes reikia skirti operonams ir panaioms operonus struktr sveikoms, funkcinei sveik organizacijai. Kiekvienos daugialsi organizm lstels funkcins organizacijos struktra lemia vis bsim organizm, genomo gyvendinim. Organizmo genomas lemia ir pavieni lsteli tam tikr specializuot veikl, ir lsteli sveikas. Tai informacini struktrini atminties vienet gen raikos ir tildymai. Vis i daugialsio organizmo formavimosi pagrindas pirminis dviej, naujai atsiradusi dukterini lsteli, lemiani funkcikai specializuot audini gyvendinim, supratimas. iuos vyksmus paaikina akobo ir Mono trigerins schemos.

6.2. LSTELI DIFERENCIACIJOS MODELIS (Trigerin akobo ir Mono schema)

Lstelei pasidalijus ir joms visikai neatsiskyrus, tarp j lieka slyio ryiai. Tam tikros molekuls gali pernaos bdu keliauti i vienos lstels kit. Taip keiiamasi mediagomis, energija ir informacija. ie apsikeitimai lemia i lsteli veikl ir funkcin j paskirt: lsteles specializuoja diferencijuoja. Diferenciacija prasideda, kai viena lstel gamina tam tikras mediagas (metabolitus) Mi , o kitai lstelei jas gaminti neleidia slopina (blokuoja). Tuo metu kita lstel gamina visikai kitus metabolitus, ir ji udraudia juos gaminti aplinkinms lstelms. Tai nulemia i lsteli funkcines paskirtis, vadinasi, jos specializuojasi diferencijuojasi. Paprasiausi dviej lsteli diferenciacijos kokybin aikinimo model operon sveika yra pateik akobas ir Monodas. io modelio ir jo variacij kiekybin analiz matematiniais metodais atliko D. S. ernavskio (. . ) teorins biofizikos grup. Modelio schema pateikta 6.4 paveiksle.
280
BIOFIZIKA

1.
SG1

GR1 GO1

GR2 GO2 SG2

2.

X1(t)

X2(t)

Y1(t) S

Y2(t) M1 M2

E1

E2

6.4 pav. Dviej alia esani lsteli tos paios paskirties sveikaujani operon trigerin akobo ir Mono schema

Tarkime, dviej dukterini gretim lsteli 1 ir 2 atsiradimo pradioje funkcionuoja tapats operonai, o j sintetinami tapats metabolitai M1 ir M2 keliauja gretimas lsteles ir atlieka represori funkcijas. Indeksai prie vardyt dydi rodo lsteli numer, bet ne skirting mediag. Tokios sveikos, atrodo, turt lemti trigerin dinamins sistemos bsen, t. y. vienai lstelei pradjus intensyvesn metabolito sintez, ji turt tos mediagos sintez kitoje lstelje nuslopinti. Ar bus vykdytos trigerinio darbo reimo slygos, galima patikrinti matematikai, pasinaudojus Gudvino (B. C. Goodwin) operono matematiniu modeliu. Dviej operon sveikos matematinis modelis eeri diferencialini lygi sistema:
dX 1 a1 = b1 X 1 , dt C1 + M 2 (t ) dX 2 a2 = b2 X 2 , dt C 2 + M 1 (t ) dY1 = 1 X 1 1 Y1 , dt dY2 = 2 X 2 2 Y2 , dt dM 1 = k1 X 1 r1 M 1 , dt dM 2 = k 2 X 2 r2 M 2 . dt

Tarkime, abiej lsteli dinamins sistemos idealiai tapaios. Tada atitinkami koeficientai turi bti lygs:
281
6. Organizmas organizuota sistema

a1 = a2 = a, b1 = b2 = b, C1 = C2 = C, 1 = 2 = , 1 = 2 = , k1 = k2 = k, r1 = r2 = r, ir model galima suprastinti:


a dX 1 dt = C + M (t ) b X 1 , 2 dX 2 a dt = C + M (t ) b X 2 , 1 dY1 dt = X 1 Y1 , dY2 = X Y , 2 2 dt dM 1 = k Y r M , 1 1 dt dM 2 = k Y2 r M 2 . dt

Tai netiesin diferencialini lygi sistema. Iekoma jos stacionariosios bsenos slyg sprendiama lygi sistema, laikant, kad: X1 = const., X2 = const., Y1 = const., Y2 = const., M1 = const., M2 = const. Tada diferencialini lygi sistema virs algebrini lygi sistema:
a 0 = C + M (t ) b X 1 , 2 a 0 = C + M (t ) b X 2 , 1 0 = X Y , 1 1 0 = X 2 Y2 , 0 = k Y1 r M 1 , 0 = k Y r M . 2 2

I ios algebrins sistemos paskutini keturi lygi nustatoma, kad:

X 1 = Y1 , X = Y , 2 2 k Y1 = r M 1 , k Y = r M 2 2

arba

Y1 , X 2 = Y2 , k M 1 = Y1 , r k M 2 = Y2 r X1 =

282
BIOFIZIKA

iomis metabolit M ir ferment Y proporcijomis metabolitus pirmj operon sveikos algebrinio modelio lygtyse pakeitus fermentais, gaunamas dar paprastesnis dviej hiperboli algebrinis modelis:

= =

ios algebrini lygi sprendiniai rodo dviej operon sveikos netiesins dinamins sistemos fazinio portreto pobd ir stacionarisias bsenas (6.5 pav.). Nesunku pastebti, kai viena molekul represuoja vien operon, t. y. m = 1, stacionarij slyg sprendinys yra dviej paprast hiperboli susikirtimo takas, kur, kaip galim (potenciali) bsen duob X1St , X2St dinamin sistema rieda savaime. ia yra dinamins sistemos stacionarioji bsena. Fazinio portreto pobdis stabilus mazgas. Vadinasi, tokio sambvio dinamin sistema negali bti trigeris, nes vienodai funkcionuoja abu operonai ir nra diferenciacijos savybi. Jei operon sveikos matematinio modelio hiperboli lygtys bt auktesns eils, t. y. argumento Y laipsnio rodiklis m bt ne vienetas, bet m > 2, (gali bti ir m = 2),

X2 m=1

X2 m>2

X2St

X1St X1

0 X1

6.5 pav. Trigerins akobo ir Mono sveikos dinamins sistemos fazini portret pobdis

283
6. Organizmas organizuota sistema

gaunami trys sprendiniai (6.5 pav.). Vadinasi, ios parabols susikerta trijuose takuose, i kuri vienas yra centrinis nestabilus mazgas (kalno virn), o du kratiniai galimos (potencialios) duobs stabils mazgai. ios stabiliosios bsenos rodo, kad tokiais atvejais sistemai bdingos trigerins savybs, t. y. tokios bsenos, kai viena lstel atitinkamo metabolito gamina daug, o kitai metabolit gaminti draudia slopina. Kyla klausimas, kokia yra netiesinio hiperbolinio priklausomumo rodiklio m fizin prasm. Atsakym galima rasti nagrinjant transkripcijos greiio matematinio modelio ivedim, veikianij masi dsnio logik (r. p. 97). Laipsnio rodiklis m > 2 rodo btinum, kad daugiau nei dvi metabolito molekuls turi veikti represori, nes tik tada manomos trigerinio reimo slygos ir galima diferenciacija. Kitaip sakant, metabolitui pereinant kit lstel turi veikti molekuliniai stiprintuvai autokataliziniai vyksmai. Koeficientas m yra stiprinimo dydis. Juo didesnis m , juo geresns trigerins savybs, nes tuo statesniais kampais susikerta matematinio modelio hiperbols. Galima sivaizduoti, kad panaios operoninio pobdio sveikos susidaro ir su kitomis aplinkinmis lstelmis, tarp kuri susiformuoja analogiki trigeriniai bviai. Be to, tai gali bti ir tos paios, ir skirtingos funkcins operon struktros. Atsiranda galimyb formuotis sudtingiems daugiakomponeniams trigeriams. Vadinasi, arti vienos kit esanios lstels gali gyti gana skirtingas funkcines savybes. Taip galima suprasti unikalius gyvosios gamtos lsteli, kurios dauginasi, kolonij morfogenezs ar diferenciacijos vyksmus.

6.3. ORGANIZM VALDYMAS HORMONAIS

Augal fiziologijos bandymais pastebta, kad augal molekuls fitohormonai, ir daugyb vairi ri gyvn molekuli, vadinam hormonais, labai mai kiekiai lemia i daugialsi organizm vyksmus. Gyvnai turi endokrinin valdymo posistem, sudaryt i tam tikr organ liauk, kurios reikiamomis aplinkybmis gamina hormonus ir juos sklaido organizme. i organ lsteli iskiriami hormonai valdo organizmo mediag apykait, lsteli ir audini augim, irdies ritm, arterin kraujospd ir pan. Remiantis kibernetikos poiriu, hormonai yra valdantieji signalai. Jie yra informacijos, kuri valdo ir reguliuoja darni lsteli veikl, neikliai. Aiku, hormonai, kaip ir fermentai lstelse, atlieka tam tikr dekodavimo procedr daugialstje organizacijoje. Kibernetikos poiriu, visaveriam valdymui taip pat labai svarbu, kad bt hormon grupi veikiani prieingai bt aktyvikli ir slopikli. Fiziologiniai bandymai akivaizdiai rodo, kad yra daug hormon, veikianiais kaskadinio ir grtamojo
284
BIOFIZIKA

ryio veiklos principais. Augal fitohormonai aktyvikliai vadinami auksinais, hiberelinais, citokininais, o fitohormonai slopikliai yra abscizo rgtis ir etilenas. Gyvnai turi daugiau vairiausi ri harmon, veikiani panaiais principais. Atsivelgiant chemin struktr ir poveik, jie skirstomi baltyminius ir steroidinius hormonus. Savo ruotu baltyminiai hormonai dar skirstomi : baltymus (gonadotropininiai, somatotropinas, insulinas, kalcitoninas), peptidus (antidiurezinas oksitocinas, liberinai, statinai) ir aminorgi darinius (adrenalinas, noradrenalinas, tironinai). Dar jie skirstomi atsivelgiant veikimo funkcijas ar juos sintetinanias anatomines ir morfologines struktras. Hormon vairov, juos sintetinani struktr vairov ir j veikimo sistema, perpinta daugybe grtamj ryi, rodo, kad i sudtinga kibernetin valdymo sistema dar yra gerai nesuprantama. Hormon struktr veikl reikia tirti iekant sisteminio aikinimo metod. iuo metu bendruosius hormon veiklos mechanizmus gyvuosiuose organizmuose aikina fiziologija. Biokibernetika hormon veikl susieja su visaveriu organizmo bsen reguliavimu homeostaze. Galima irykinti tik kai kuriuos bendriausius hormoninio valdymo bruous. Organizmui, sudarytam i daug vienod lsteli, darniai ir sinchronikai funkcionuoti reikia speciali priemoni. Viena j ir yra hormon veikla. Tam tikri hormonai, susintetinti atitinkamose specialiose lstelse ir pasklid daugialsio organizmo tarplstelinje aplinkoje, atrankiai priimti lsteli, lemia savitas organizm reakcijas. Atitinkamos lstels savo ruotu reaguoja ir iskiria savus molekulinius signalus, ir taip grtamaisiais ryiais reguliuojasi (6.6 pav.). Fiziologijos tyrimai rodo, kad organizm veikiant kuriam nors skatinamajam poveikiui ir atsiradus tam tikro hormono pertekliui, grtamuoju ryiu prasideda kito, t fiziologin vyksm slopinanio hor-

H1

H3

H2

6.6 pav. Organizmo valdymo hormonais sampratos schema

285
6. Organizmas organizuota sistema

mono sintez. Tokia hormon veikla daugialsiame organizme duoda peno kurti galimus organizuot sistem modelius hipotetinius harmon veiklos aikinimus. Specialius hormonus H1, H2, H3 sintetinanios atitinkam organ lstels juos paskleidia po tarplstelin terp. Joje hormonai sklinda difuzikai, ir per tam tikr laik pasiekia visas organo ar organizmo lsteles-taikinius. Lstels-taikiniai savo paviriuje turi vairiausius, iems hormonams jautrius, molekulini receptori derinius. Receptoriai, pagal receptoriaus ir hormono molekulini struktr atitikim, atsirenka tuos hormonus, kuriems jie jautrs. Lstel reaguoja, kai visi receptoriai visikai sujaudinami. Taip hormonai atlieka signalo funkcij lstelei perduoda informacij, kad visa audinio sistema yra tam tikros bsenos (tai reikia, kad yra toki hormon ir tokie j koncentracij santykiai) apibdina sistemos bsen. Priimti signalai lstelei yra pirmin informacija. Ja naudodamasi lstel-taikinys, arba kibernetikoje vadinamas agentas, gali panaikinti savo bsenos neapibrtum priimti sprendim (generuoti informacij), kuri jungia mechanizmus atlikti veiksm valdo organizm. Labai panaiu principu yra valdoma vabzdi ir tam tikr gyvn elgsena specialiomis kvapiomis mediagomis feromonais. Tai cheminiai biologini informacini ryi vyksmai. Jie skmingai gali bti aikinami veiksni (agent) principais. iuo atveju veiksnys (agentas) yra ne pavien lstel, bet visas organizmas, o sudedamosios dalys ne molekuliniai kompleksai, bet specials organai, sudaryti i daugybs vairiausios paskirties lsteli.
H3 KRAUJOTAKOS arba LIMFIN SISTEMA H2 H4

H1

6.7 pav. Gyvno audinio hormoninis valdymas per kraujotak

286
BIOFIZIKA

Gyvn, kurie turi kraujotakos ir limfines sistemas, hormonus, pavyzdiui H1, H2, H3, H4 sintetina tam tikri organai liaukos (6.7 pav.). Liaukos hormonus iskiria bendr kraujotakos ir limfos pernaos posistemius, kurie juos po organizm visoms lstelms kapiliarais ineioja kraujas ar limfa. Atitinkami organai ir j lstels taip pat valdomos toki agent principu. Tik iuo atveju hormonai daug didesniu greiiu nei difuzijos bdu ineiojami po vis organizm, ypa dideli molekulini svori hormonai. Atkreiptinas dmesys tai, kad kraujotakos sistemas turintys gyvnai mediag ir energijos pernaai skirt kraujotakos struktr naudoja ir informaciniams signalams perneti. 6.3.1. Lstels taikinio, arba agento, funkcin organizacija Lstel nagrinjant taikinio (agento) poiriu, reikia apibdinti jos viduje vykstanias sudtingas informacijos perdirbimo procedras, kurias vienaip aprao fiziologija, o kitaip vertina kibernetika. Fiziologija aikina, kad susidarius hormono ir receptoriaus kompleksui, prie receptoriaus aktyviojo centro prisijungus hormono molekulei, vykstant konformaciniams pokyiams, prasideda signalinis informacijos perdavimas lstels vid. Tai atliekama bent keliais bdais: pro membranoje esanius receptorius baltymins kilms hormonai informacij perduoda antriniams signalo perdavikliams (cAMF, cGMF, IP3, DAG, Ca2+ kalmodulinui); riebaluose tirpiems steroidiniams hormonams prasiskverbus pro membranas ir jungiantis su citoplazmoje esaniomis molekulmis; pereinant lstels branduol ir susijungus su chromatino nehistoniniais baltymais, aktyvinant struktrini gen, m-RNR sintez, t. y. transkripcij ir atitinkam baltym sintez; per lstels branduolyje esanias molekules, maos tiroidini hormon molekuls aktyvina ir sukelia transkripcij, transliacij, skatina lstels diferenciacij, dauginimsi, energijos apykait. Nurodomi ypa glauds funkciniai ryiai su nerv sistema. Kibernetikos poiriu lstels valdymas hormonais vertintinas agent teorijos poiriu ir apibriamas agento informacijos perdirbimo procedromis (6.8 pav.). Be pavirini agento receptori (jutikli) R, jame turi bti informacijos primimo ir pirminio apdorojimo funkcin struktra. Taip pat turi bti valdymo algoritmai, vertinantys lstels bsenas, priimantys sprendim atlikti veiksm, pradedantys lstels vykdanij organ jungim ir veiksm valdym. Tai dekodavimo funkcin struktra. Joje yra daug informacines procedras atliekani struktr, tarp kuri btini autokataliziniai molekuli stiprintuvai, veikiantys teigiamj grtamj ryi principu, logini veiksm struktros, nagrinjanios situacijas, nustatanios lstels (agento) bsen ir jungianios atitinkamus veiklos algoritmus.
287
6. Organizmas organizuota sistema

Rj-receptoriai
R1

BSENA
Ri

PRIMIMAS

VALDYMO ALGORITMAS

VEIKSMAS

VYKDYMAS -

SIGNALAS

Rn

A P L I N K A TARPLSTELIN T E R P

6.8 pav. Lstels taikinio (agento) funkcin schema

Daugiausia lstels (agento) reakcij lemia receptoriai, j rinkiniai. Jie yra aplinkos informacinio vertinimo pirminiai elementai koderiai. Toliau vyksta informacijos perdirbimo, sprendim atlikti veiksm primimo ir dekodavimo procedros. Galutinis rezultatas veiksmas ar signal siuntimas: aplink imetamos tam tikros molekuls tarpininks (mediators), mechaniniai veiksmai ir panaios agento reakcijos, lemianios kit lsteli veiksmus. Aiku, skirting receptori rinkiniai agento paviriuje lemia visikai kitokius aplinkini lsteli ar audini veiksmus. Daug greiiau ir sudtingiau daugialsio organizmo veikl valdo gyvn nerv posistemis nerviniai tinklai.

6.4. ORGANIZMO VALDYMAS NERVINIAIS TINKLAIS

Kitokiu principu organizuota daugialsio organizmo tam tikr lsteli ir organ veiklos koordinacija gyvn veiklos valdymas specialiomis nerv struktromis nerviniais ar neuron tinklais. Hormon posistemis informacij signal hormon priemonmis ineioja po vis sistem (organizm) vienodai, o tam tikri audiniai, j lstels, agentai, reaguoja pasirinktinai pagal savo turimus receptorius. Nerv sistema valdo kitaip. Specialiai organizuotais ryiais nervinai impulsai (signalai) informacij atrankiai siunia tik tam tikroms lstelms ar organams. Tai yra nerv sistema formuoja tam tikr informacijos perdavimo tinkl. (Akivaizdios analogijos: hormonais informacija perduodama mobiliosios telekomunikacijos principais, o nervin laidins.) Nerv sistem turi tik gyvnai. Jie yra heterotrofai plrnai, nes maitinasi gyvaisiais organizmais. Todl yra priversti aktyviai iekoti itekli, o tam reikalingas visas rinkinys tam tikr priemoni organ. Pirmiausia btini jutimo organai, kurie
288
BIOFIZIKA

receptori lstelmis savituosius aplinkos ir sistemos vidaus vyksmus atspindt receptori struktr vyksmais. Tai yra atlikt pirmin kodavim. ie vyksmai turi bti suderinti su nerv struktromis neuronini tinkl funkcionavimu taip, kad per ar kit perkodavimo ingsn bt pervesta nervini impuls siuntas. Taip vairiausios fizikochemins prigimties aplinkoje ir organizmo viduje vykstantys procesai paveriami vienariais nerviniais vyksmais suformuojami i proces atspindiai nerviniuose tinkluose, atliekama j analiz, priimami sprendimai atlikti veiksmus ir valdomos vykdaniosios struktros. Paiu paprasiausiu poiriu gyvno nerv sistema jutimo organais turi gauti informacij apie aplinkos objektus ir vyksmus, vertinti organizmo padt, poreikius, ir tiksl poiriu sukurti plan (projekt) tikslams gyvendinti. Tai yra valdyti vykdaniuosius organus taip, kad siekiai ir tikslai bt gyvendinti arba pakeisti. Visa nerv sistemos veikla yra vien tik kodavimo ir dekodavimo procedros, tiek perduodant informacij i vienos struktros kit, tiek saugant ir perdirbant gaut informacij. Nerv sistema informaciniais kodavimo ir dekodavimo ryiais yra susijusi su hormon valdaniosiomis struktromis ir visais kitais organais. Tik nerv sistema neturi tiesioginio informacinio ryio su genetine informacine sistema. i savyb lm tai, kad individo gyvenimo patirtis sukaupta informacija tiesiogiai neperduodama palikuonims genetikai. Nerv sistema taip pat yra ir atminties struktra. Vadinasi, nerv sistemai manomas informacinis mokymas ar mokymsis kaupiama individualios patirties informacija. Atsivelgiant nerv sistemos funkcins organizacijos lyg, organizmai gali bti skirstomi pagal sugebjimus mokytis ir prisitaikyti (adaptuotis) kintant aplinkos slygoms. Nerv sistema yra vyksm modeliavimo struktra. Remiantis tam tikrais sistem teorijos tyrimais, netiesin valdomojo objekto grtamojo ryio struktra, sugebanti keistis, atsivelgiant grtamuoju ryiu apkabinto objekto kintamus dydius, gali suformuoti to objekto model. Vadinasi, tokiu principu organizuota (adaptyvi) sistema gali painti objekt. i savyb lemia galimyb numatyti stebimojo ar valdomojo objekto veikl ir pagal tai j valdyti. 6.4.1. Bendroji nerv posistemio funkcin struktra Nervinio tinklo funkcines savybes lemia tam tikr nervini lsteli neuron savybs ir suformuoto tinklo struktra. Funkcin organizuotos sistemos nervinio tinklo vieta parodyta 6.9 paveiksle. Nervinis tinklas ar tinkl sistema biologijoje vadinama smegenimis. is tinklas gyvno organizme veiksmingiausiai atlieka pagrindines informacijos primimo, perdirbimo, saugojimo ir siuntimo funkcijas. Jis taip pat valdo
289
6. Organizmas organizuota sistema

APLINKA

A P L I N K A
R R R R R

R R R R R

VALDANTYSIS POSISTEMIS NERVINIAI arba NEURON

TINKLAI

(INFORMACIJOS SRAUTAI)

I N F O R M A C I J A

ITEKLIAI

VALDOMASIS POSISTEMIS MEDIAG ir ENERGIJOS

VIRSMAI

VEIKSMAI

6.9 pav. Nerviniai tinklai organizuotoje sistemoje organizme:


R

receptoriai, arba elementars koderiai, efektoriai, arba elementars dekoderiai

vykdaniuosius organus, sisdamas signalus nurodo, kada kuris organas k turi daryti. Jis visados per jutimo organ receptorius gauna informacij apie organizmo aplink ir vidaus organ bkl. Gaut informacij jis rao savo atminties struktrose, j apdoroja, vertina organizmo siekiam tiksl poiriu, formuoja veiksm planus ir valdo mediag ir energijos virsmus bei veiksmus. Nerviniai tinklai taip pat valdo ir informacijos siuntim aplink. Daugialsiai organizmai su aplinka sveikauja paviriais, todl aplinkos poveikiai arba aplinka atsispindi paviriniuose receptorini lsteli sluoksniuose. Jie yra tiesiogiai susijung su nerv struktromis ir yra pagrindiniai informacijos tiekjai. Informacij apie vidaus organ bsenas nerviniai tinklai gauna taip pat i atitinkam vidini receptori. Receptoriai vadintini koderiais, nes jie vairiausius fizinius aplinkos ir vidaus poveikius veria nerviniam tinklui priimtina ir suprantama forma. Tai tokia fizin ir signalin forma, kuri nervinis tinklas gali vairiai perkoduoti, t. y. informacij per290
BIOFIZIKA

dirbti ir priimti sprendimus atlikti veiksm. Akivaizdu, kad pagrindin nervinio tinklo funkcin paskirtis nuolatos koduoti ir dekoduoti informacij, isaugoti prasmin informacijos reikm (semantik). Veiksm valdymas rykiausias dekodavimo pavyzdys. Nerv sistemos funkcins organizacijos pagrindas daugyb kartu funkcionuojani kodavimo ir dekodavimo struktr tarpusavyje susijusi dar ir horizontaliaisiais ryiais. Visos kodavimo ir dekodavimo struktros grtamaisiais ryiais apkabina valdomj objekt, kuris atlieka funkcikai svarbias operacijas. Todl visos gyvno nervinio kodavimo ir dekodavimo informacins ryi linijos visada yra susijusios su konkreiu valdomuoju objektu organu. Ryio linija turi informacij siunianisias kodavimo, prasidedanias receptoriais (sensoriais, jutikliais), ir priimanisias dekodavimo, pasibaigianias vykdaniais organais struktras. Receptoriai ir vykdantieji organai yra prijunkti prie to paties valdomojo objekto. Jie yra susij funkcikai, tad kodai turi aiki funkcin (semantin) prasm. (Klasikinis anono informacijos kanalas ar linija yra atvira, be konkretaus valdomojo objekto. Todl kyla daug sunkum dl informacijos prasms.) Pateiktoje organizmo nervinio valdymo funkcinje schemoje akivaizdiai matomas miraus (kombinuoto) valdymo sistemos principas: kaip vidinio grtamojo ryio per nervines struktras kodavimo ir dekodavimo kanalai, taip ir iorinio grtamojo ryio kodavimo ir dekodavimo kanalai per aplink. Nervins struktros per vis gyvenim gali keistis ir tuo keisti organizmo veikl. Tam tikri ioriniai poveiki ir vidiniai organizmo vyksmai gali keisti vidin nervinio posistemio struktr ir kartu daryti organizm adaptyviu. Remiantis ia savybe galima teigti, nerv posistemis gali formuoti organizmo sistemos vidaus struktr ir aplinkoje esani objekt bei vyksm modelius ir jais vadovaudamosi valdyti savo veiksmus aplinkoje. Gyvnijos evoliucija suformavo sudting hierarchin nerv posistemio struktr, suteikdama kiekvienam jo lygmeniui atlikti vis sudtingesnes informacijos perdirbimo ir valdymo galimybes. iuo metu beveik visikai nesuprantamos nerv sistemos funkcins organizacijos paslaptys. Geriausiai yra tyrinta ir iek tiek inoma apie nuo nerv posistemio neatskiriam dali jutimo organ ir judjimo (motorikos) organizacijos veikl. inomos tik kai kurios tam tikr nervini lsteli, neuron, savybs. Todl aikinantis nerv sistemos informacines procedras reikia pirmiausia susipainti su bendraisiais jutimo organ dsningumais.

291
6. Organizmas organizuota sistema

6.5. JUTIMO ORGAN BIOFIZIKA

Jutimo organai yra gyvno informacijos apie aplink ir vidaus organus gavimo priemon. Tai akivaizdios informacijos primimo arba pirminio kodavimo struktros, vertintinos informacijos teorijos poiriu. inomi ir yra tyrinti devyni jutimo organai: regos, klausos, skonio, uosls, slgio, skausmo, ilumos, alio ir propriorecepcijos kno padties. Visiems jiems yra bdingi bendri dsningumai. Jie rodo, kaip objektyvs fiziniai poveikiai per jutimo organus atsispindi subjektyviuose pojiuose, kurie atsiranda kaip nerv sistemos veiklos padarinys. Paprasiausiu atveju jutimo organ veikl galima schematizuoti kaip objektyvius aplinkos poveikius P(t), kurie nerv sistemoje sukelia subjektyvius pojius S (6.10 pav.). Tarkime, organizmo nerv posistemyje yra subjektyvi poji matavimo prietais S, kurie atitinka subjektyvius viesos, garso, skonio, temperatros ir pan. pojius. Sudtingesnmis aplinkybmis, veikiant keliems pojiams, dl nerv posistemio veiklos susidaro svokos sudting aplinkos vyksm kodins struktros: saul, debesys, em, pauktis, jra ir pan. Remiantis ei pagrindini jutimo organ apytikriais duomenimis, galima vertinti informacinius srautus, kuriuos gauna mogaus nerv sistema. Informacinis srautas

debesys

saul pauktis em jra

6.10 pav. Jutimo organ subjektyvaus pojio priklausomybs nuo objektyvaus poveikio apibendrinta tyrimo schema

292
BIOFIZIKA

suprantamas kaip organizmo priimamas bit kiekis par sekund [bit/S]. Remiantis pirminio jutim organo receptori skaiiumi ir neuronini struktr siuniam impuls daniais yra nustatyti orientaciniai informacijos pralaidumo duomenys. Tai nra informacijos kiekis, kuriuo vertina informacijos teorija. Tai nra ir neapibrtumo panaikinimo procedra priimant sprendim. ie vertinimai atlikti vadovaujantis diskreij technini automat, kompiuteri darbo netiksliomis orientacinmis analogijomis. 6.5.1. Jutimo organ informacijos perdavimo greiiai Nekyla joki abejoni, kad jutimo organai yra informacijos primimo, perkodavimo ir siuntimo grandys, t. y. informacijos kanalo dalys. Tyrinjant jutimo organ struktr ir pritaikius paprastus informacijos teorijos metodus, yra pabandyta vertinti kiekybikai informacijos perdavimo greiius (6.1 lentel ir 6.11 pav.). Apytikriai skaiiavimai atlikti labai netiksliai, skaiiuojant tam tikr atitinkam jutimo organ informacini kanal (keli) neuron kiekius bei vertinant neuron impulsavimo dan. Rezultatai rodo, kad centrin mogaus nerv posistem (CNS) ateina ~108109 [BITAI/S], arba ~12,5125 [MEGABAITAI/S]. Smon pasiekia ~50 [BITAI/S]. Atmintyje pasilieka ~1 [BITAS/S].
6.1 lentel. mogaus jutimo organ ir informacijos sraut orientaciniai vertinimai
Pojiai Adekvatusis dirgiklis P(t) Receptori struktros Receptori skaiius Neuron kiekis CNS Informacijos srautas [bit/S] Rega Klausa Lytjimo Temper. Uosl Skonis

Elektrm. Mechaniniai Paviriaus Temperat. Cheminiai Cheminiai bangos svyravimai deformacija pokytis agentai agentai 380760 1620.000 nM. Hz Akys Tinklain 2*108 107 kolb. 108 lazd. 106 2*106 3*106 Ausys Pamatin membrana 1043*104 plauk. lst. 1042*104 Odos sluoksnis 5*105 Odos pavirius 104 il. 105 al. Nosies Lieiuvio ertms receptoriai receptoriai 107 107

104

2*103

2*103

2*104 5*104

2*105

2*103

10100

10

293
6. Organizmas organizuota sistema

Per 80 met mogaus atmintis sukaupia ~109 [BIT], arba ~250 [MEGABAIT]. (Vidutinio svorio knygos informacijos talpis ~106 [BIT], o mogaus genomo atminties informacijos talpis ~800 MEGABAIT). Pateikti skaiiai yra labai abejotini, nes ir vertinimo metodikos yra labai netikslios. Kol kas tai yra vieni i negausi kiekybini vertinim. Jie ateityje, kai bus isamiau nustatyta funkcin jutimo organ veikla, atlikti tikslesni kiekybiniai matavimai, turs keistis. Lauktina, kad informacijos perdavimo greiiai ir atminties kiekiai labai padids. H. Morovicas (H. Morowetz) yra pateiks labai idomi lyginamj gyvn ir informacijos technini rengini, socialini informacini priemoni informacijos talpi ir informacijos sraut greii schem (6.12 pav.). Taip pat vertino ir atitinkam technikos priemoni informacijos talpio ir informacijos apdorojimo greiio raidos tendencijas, pateik informacini technikos priemoni gebjim artjimo prie mogikj galimybi terminus. Jo vertinimu, rankinio skaiiuoklio (kalkuliatoriaus) atliekam veiksm greitis atitinka viruso sintezs informacinio vyksmo greit, mogaus genomo informacijos talpis, kaip jau rayta, kompaktinio disko (CD) talp. mogaus ir bakterijos genomo informacini sraut greitis prilyginamas garso kasets ir 1985-j met asmeninio kompiuterio informacijos sraut greiiui. Taiau 1996-j met kompiuteris, atsivelgiant inInformacijos srautai tam tikrais mogaus organizmo lygiais ( BITAI/S) RECEPTORIAI NERVAI INFORMACINIS LAIDUMAS

REGOS KLAUSOS SKONIO UOSL S SL GIO SKAUSMO ILUMOS AL IO

2108 3104
10
7

2106 2104 2103 2103

5108 4104 102 102

KALBA C MOTORIKA

107 5105 3106

N
10
5

S
106

104
10
3

MIMIKA

105

6.11 pav. mogaus jutimo organ priimami ir perduodami informacijos srautai

294
BIOFIZIKA

6.12 pav. Gyvj organizm ir technini informacijos priemoni informacijos talpio ir informacijos sraut greii lyginamoji schema (H. Morowitz)

formacijos srauto greit ir apimt, lyginamas su voro informacins veiklos dydiais. Apibendrintas mogaus, banginio ir dramblio informacijos talpis lygintinas su JAV Kongreso bibliotekos informacijos talpiu. Atsivelgiant mogaus informacijos sraut perdirbimo greit, iuolaikini technikos priemoni nes. Numatoma, kad jos bus sukurti 20152020 metais. Tiksliau vertindamas informacini technologij galimybi raidos greit, H. Morovicas pastebi naujai sukuriam technini rengini parametr didjimo pagreit greitjimo tendencijas. Tai rodo, kad mogaus informacins galimybs bus pasiektos dar greiiau. Bet ar tik tai lemia mogiksias informacijos perdirbimo galimybes protavim ir kryb? Klausimas yra atviras. Manytina, kad tikrieji iltakrauj gyvn ir, ypa mogaus, informaciniai jutimo organ veiklos ir valdymo bdai dar neatskleisti. Tiriant jutimo organ kiekybines informacijos primimo ir perdavimo savybes vartojami psichofizikos dsniai.
295
6. Organizmas organizuota sistema

6.5.2. Psichofizikos dsniai Vertinant jutimo organ aplinkos savybi atspindjimo, arba informacinio kodavimo savybes, yra vartojami du pagrindiniai psichofizikos dsniai: Vberio ir Fechnerio bei Stivenso. Kaip rayta, psichofizikos dsniai padeda nustatyti pobd ir objektyvi aplinkos fizini poveiki P(t) atspindjimo subjektyviuose pojiuose S(t) kiekybinius vertinimus (6.10 pav.). Vberio ir Fechnerio dsnis Bandomaisiais tyrimais buvo pastebta, kad svorio P ir kit poji didjim bei majim P mogus subjektyviai nustato, atsivelgdamas absoliuiu laikom svor ar t poveikio P dyd. Juo didesnis P, juo didesnis maiausias pokytis P, kur mogus patikimai vertina, kad yra sunkiau ar lengviau, kad poveikis padidjo ar pamajo. Po daugybs matavim, kuri skaitiniai duomenys buvo surayti lenteles, pastebta, kad galioja labai paprastas dsningumas:

P = const. , P kuris daug kur ir iuo metu vadinamas Vberio dsniu.


Aikindamasis, kokia yra io santykinio dydio prasm, Fechneris laik, kad maiausias pokyio pajutimas vertintinas kaip subjektyviojo pojio S sivaizduojamo matavimo prietaiso rodykls smegenyse pasisukimas per vien skals padal. Tai padjo santykin Vberio dsnio lygt pakeisti lygtimi, turinia subjektyviojo pojio pokyio prasm S : , kur k, proporcingumo koeficientas, rodantis objektyviojo poveikio santykinio pokyio ryio dyd su subjektyviojo pojio pokyiu. Laikant, kad is dsningumas galioja ir labai maiems dydiams, algebrin lygt galima ireikti diferencialine lygtimi:

kurios sprendinys yra VberioFechnerio dsnio algebrin lygtis:

io sprendinio logaritmin funkcija rodo, kad esant maiems absoliutiesiems poveikiams, jautrumas pokyiams yra didesnis nei esant dideliems, pagal logaritmin
296
BIOFIZIKA

S Subjekyvusis poj tis

V BERIO-FECHNERIO D SNIS

S=

a lg

P , jeigu P P0 , P0

0, jeigu P < P0

0 0

P0 Absoliutus slenkstis

Objektyvusis poveikis

6.13 pav. Vberio ir Fechnerio dsnio grafinis vaizdas

priklausomyb (6.13 pav.). Taip pat pastebima, kad integravimo pastovioji rodo slenkstin dyd P0, t. y. tok objektyvaus poveikio dyd, kai esant poveikiui maesniam ar jam lygiam, poveikis nejuntamas. Vadinasi, Vberio ir Fechnerio dsnis matematikai ireikiamas slygine lygtimi:
a lg P , jeigu P P0 , P0

S=

0, jeigu P < P0 .

Pritaikius Vberio ir Fechnerio dsn, visus jutimo organus reikia vertinti bandym bdu pamatuojant absoliutj slenkst P0 ir koeficient a , rodant diferencin jautrum. Tikslesni matavimai parod, kad ne vis jutimo organan savybes gana gerai atspindi Vberio ir Fechnerio dsnis. Ypa jis netiko neprastiems poveikiams, pavyzdiui, pojiams elektros srovei. Tokie nenatrals poveikiai turjo auktyn usirietusi priklausomyb, kuri jokiu bdu negalima esant logaritminiam dsningumui. Todl buvo ivestas bendresnis Stivenso dsnis. Stivenso dsnis Aikindamasis santykinio dydio P/P prasm Stivensas laik, kad maiausias pokyio pajutimas vertintinas kaip subjektyviojo pojio S matavimo prietaiso rodykls santykinis pasisukim per skals vien padal reikia S/S santyk. Be to, jis vertino ir visada pasireikiant absoliutj slenkst (P P0). Tai leido santykin Vberio dsnio lygt pakeisti lygtimi, turinia subjektyviojo pojio santykin pokyt:
297
6. Organizmas organizuota sistema

( P P0 ) 1 S , = ( P P0 ) n S

kur n, proporcingumo koeficientas, rodantis objektyviojo poveikio santykinio pokyio ryio dyd su subjektyviojo santykinio pojio pokyiu. Laikant, kad is dsningumas galioja ir labai maiems dydiams, algebrin lygt galima ireikti diferencialine lygtimi:
d ( P P0 ) dS = n , S ( P P0 )

kurios sprendinys yra Stivenso dsnio algebrin lygtis:

S = ( P P0 ) n.
io sprendinio rodiklin funkcija rodo, kad subjektyviojo pojio pobd lemia koeficientas n (6.14 pav.). Jei koeficientas n < 1, subjektyviojo pojio priklausomybs pobdis beveik nesiskiria nuo Vberio ir Fechnerio logaritmins. Bet kai n > 1, subjektyviojo pojio kreiv usirieia vir, parodo matematinio modelio galimyb vertinti ir sudtingesni objektyvij poveiki atspindius subjektyviuosiuose pojiuose. Taip pat vertinus slenksio P0 netiesikum, nejautrumo maiems pojiams savyb, gaunama Stivenso dsnio slygin algebrin lygtis:
S= a ( P P0 ) n , jeigu P P0 , 0, jeigu P < P0

STIVENSO D SNIS
S Subjekyvusis poj tis

n>1

n=1 n<1

S=

a ( P P0 ) n , jeigu P P0 , 0, jeigu P < P0


Objektyvusis poveikis P

0 0

P0 Absoliutus slenkstis

6.14 pav. Grafinis Stivenso dsnio vaizdas

298
BIOFIZIKA

5.2 lentel. Stivenso psichofizikiniai poji koeficientai


Eil. nr. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Poveikiai P Garsas Garsas Rykumas (viesos) Rykumas (viesos) viesis Kvapas Kvapas Skonis Skonis Skonis Temperatra Temperatra Vibracija Vibracija Dirgiklio trukm Pasikartojim periodas Nuotolis tarp pirt Slgis deln Svoris Rieo spaudimas Elektros srov Rodiklis n 0,6 0,54 0,33 0,5 1,2 0,55 0,6 0,6 1,3 1,3 1,0 1,6 0,6 0,95 1,1 1,0 1,3 1,1 1,45 1,7 3,5 Slygos Abiausis (binaurinis) Vienausis (minaurinis) Tamsos adaptacija, 50 dirgiklio dydis Tamsos adaptacija, takinis altinis Pilko popieriaus atspindjimas Kava Heptanas Sacharinas Sacharoz Druska altis rankai iluma rankai 250 Hz pirt 60 Hz pirt Baltasis triukmas viesos, garso, prisilietim, elektros Medinio strypelio storis Statinis odos spaudimas Keliamas svoris Rankinis dinamometras 60 Hz elektros srov pirtuose

Stivenso dsnis, kaip Vberio ir Fechnerio dsnis, rodo objektyviojo poveikio atspindjim, arba kodavim rodikline funkcija, kuri yra lankstesn nei logaritmin. ios lygties koeficientas n yra pagrindinis kokybinio atspindjimo savybs rodiklis. Tam tikr poji n koeficient dydiai parodyti 5.2 lentelje. Akivaizdu, tie pojiai, kuri koeficientai maesni u vien, gali bti vertinami ir Vberio ir Fechnerio dsniu pamatuojant io dsnio koeficientus: a ir P0. Taiau tiems poveikiams, kuri koeficientai n didesni u vienet, taikytinas Stivenso dsnis. Tokias savybes daniausiai turi subjektyvieji pojiai nenatraliems dirgikliams. Bandomasis sigmoidinis dsnis Psichofizikos bandym metu labai danai nustatomos sigmoidinio pobdio priklausomybs, kurioms ireikti taikomi net keli matematiniai modeliai (6.15 pav.):
S= S MAX S 1 + ( MAX 1) exp{ P} S0

, logistinis modelis.

299
6. Organizmas organizuota sistema

S Poj tis

SIGMOIDINIS D SNIS

Smax
0,95 Smax

0,5 Smax

0,05 Smax S0 P0 Slenkstis P5 P50 P95 P Poveikis

6.15 pav. Grafinis sigmoidinio dsnio vaizdas

S=

S MAX

2
S MAX

exp

( P P0 ) 2 ( P P0 ) 2 S dP = MAX Erf , tikimybinis modelis. 2 2 2 2 2

S=

1 + arctg [ ( P P0 )] , trigonometrinis modelis. 2

S=

P P50 a S MAX , jeiguP P50 , exp 2 a S MAX P P50 1 1 exp 2 , jeiguP > P50

, difuzinis modelis.

Pateikti praktikai taikomi keturi sigmoidinio pobdio matematiniai modeliai. Jie gali bti pasirinkti atsivelgiant psichofizikos bandymo aplinkybes. Panas matematiniai modeliai taikomi ir nervini lsteli, kurios dalyvauja poji posistemio veikloje, funkcinms savybms apibdinti.

300
BIOFIZIKA

6.6. FUNKCIN NEURONO CHARAKTERISTIKA

Jau neabejojama, kad nervins lstels neuronai priima, perdirba, saugo ir siunia informacij generuodami signalus fizikocheminius lstels pokyius ir nervinius impulsus. Jie savo ataugomis aksonais atrankiai siunia impulsus kitoms lstelms ir i j sudarytiems organams. Taip lemiama t lsteli ar organ veikla. Taip pat jie grtamosiomis kolateralmis gali impulsus sisti ir sau. Kas turi lemiamos reikms neuronui vienas impulsas ar impuls danis is klausimas dar neatsakytas. Aiku, kad bendruoju atveju neuronas yra lstel, kuri, remiantis morfologiniais tyrimais, gali ateiti tkstaniai ryi (jim), ir kuri turi vien funkcin signalo siuntimo ijimo ry akson. Aksonas gali akotis ir savo galiniais ryi kontaktais per sinapses gali perduoti impuls atnet informacij kitoms lstelms ir savam neuronui taip pat. Tokia morfologin j organizacija padeda kurti tam tikrais ryiais sujungtus nervinius tinklus ir atlikti vairiausias specialias informacinio valdymo funkcijas. Visi funkciniai elementai, turintys daug jimo ryi ir vien ijim, kuris akojasi, ir gali algebrikai ar logikai sudti integruoti gali sudaryti ryi struktras pagal princip bet kuris su bet kuriuo. Todl neuronai turi unikalias galimybes formuoti didiulius neuron tinklus, kurie atlieka labai sudtingas informacijos perdirbimo procedras ir valdyti gyvno elgsen. Pastarj deimtmei neurofiziolog bandymai rodo, kad neuron reakcijas nerviniame tinkle lemia sutankjusi impuls plipsniai, paprasiausiu atveju j impuls danis. Gana rykiai tai matoma tyrinjant fizini poveiki kodavim gyvno jutimo organuose, receptori ir pirmj neuron struktrose. Pavyzdiui, 6.16 pav.

Dirginimas A

Impuls danis, s1

Dirgiklio stiprumas, g B

6.16 pav. Neurono reakcijos priklausomyb nuo poveikio stiprumo

301
6. Organizmas organizuota sistema

pateiktas slgio receptorinio neurono kodavimo reakcija tam tikro dydio slgimus. Akivaizdiai matoma, nors ir ne visai reguliari, bet gana ryki impulsin danin reakcija. Nariuotakoj ir moliusk, kuri neuronai yra daug didesni ir bandym metu maiau paeidiami, danins reakcijos yra stabilesns. Remiantis bandomj tyrim duomenimis neuronas, informacijos perdirbimo poiriu yra laikomas impuls dani sumatoriumi. Jis impuls sekas danius algebrikai sumuoja ir erdvs, ir laiko poiriu. Erdvinis sumavimas yra suprantamas kaip daugybs kit neuron ijim akson suvedimas vien neuron, o laikinis sumavimas atjusi impuls plipsni integravimas laike. Statins neurono savybs. Neuronai turi vairias morfologines formas, bet daniausiai bna vaigdiniai ir piramidiniai (6.17 pav.). Atsivelgiant nerviniuose tinkluose funkcionuojanius signalus, neuronai suprantami kaip: dviej diskreij determinuot bsen (dvinariai) funkciniai elementai; statistikai funkcionuojantys dviej bsen (dvinariai) funkciniai elementai; tolydiai kintani dydi impuls danius perkoduojantys elementai. Visais iais atvejais neuronas yra sudtuvas (sumatorius), nes j ateina daug jimo ryi, ir jis turi vien funkcin ijimo ry. Pirmuoju ir antruoju atvejais neuronas suprantamas kaip slenkstinis dviej bsen sudtuvas (sumatorius), o treiuoju tolydij dydi impuls dani sudtuvas (sumatorius), turintis tam tikr netiesini savybi. Pirmaisiais dviem atvejais neuron ijimo ir ijimo ryi signalai yra koduojami dvinarikai taip arba ne (arba 1, arba 0), o sumuojama atitinkamais teigiamaisiais (+) arba neigiamaisiais () sinapsini svori koeficientais Si . Pirmuoju atveju neuroX1 ... Xi ... Xn X1 ... Xi ... Xn

-Si +S1
N

Z1

+Sn
N

Z2

6.17 pav. vaigdinio ir piramidinio neuron schemos

302
BIOFIZIKA

nas atlieka ideali relin funkcij, turini slenkst . Grafinis ios funkcijos arba io neurono funkcins charakteristikos vaizdas parodyta 6.18 pav. Taip teorikai ireiiama fiziologin neurono savyb vadinama reakcija viskas arba nieko. Tai pats primityviausias neurono modelis, kuriuo dar ir iandien bandoma aikinti neuron tinkl, nerv sistemos funkcionavimo dsningumus kategorikja logika. Antruoju atveju neuronas yra statistinis dvinari signal sudtuvas (sumatorius), kurio slenkstin charakteristika sigmoidin tikimybin funkcija, matematikai ireikiama logistine formule (6.19 pav.). iuo atveju manoma, kad nerv posistemis yra panaus fizikin idealij duj sistem, ir pavienis jo elementas neuronas sumuoja ir siunia impulsus stochastikai. Pastaruoju metu neurofiziologai, vertindami bandomuosius neuron atsakus, link neurono reakcija laikyti nervini impuls dani kitimus. Tad neuronas yra su-

6.18 pav. Neurono slenkstinio dvinario sudtuvo (sumatoriaus) funkcin charakteristika ir grafinis jos vaizdas

6.19 pav. Neurono statistinio dvinario sudtuvo (sumatoriaus) charakteristika ir grafinis jos vaizdas

303
6. Organizmas organizuota sistema

prantamas kaip tolydij dydi impuls dani, kuri jim ir ijimo signalai yra i dani kitimai baigtini rib (0 iki Xmax , Y max) sudtuvas (sumatorius). (Daugumos iltakrauj organizm neuron Xmax , Ymax nesiekia 1000 imp. per sekund.) vaigdinio neurono sudtuvo (sumatoriaus) funkcin charakteristika yra netiesin, turi tam tikr tiesinio sumavimo dal bei diodin ir soties apribojimus, apibendrintai netiesikum N. Statin neurono tolydij dydi sudtuvo (sumatoriaus) charakteristika, matematin lygtis ir grafinis jos vaizdas parodyti 6.20 pav. Akivaizdiai matomos trys neurono funkcionavimo bsenos, kurios atspindi neurono netiesikumus: pirmoji neuronas nuslopintas, nes negali perduoti neigiamj dani, jei poveiki suma yra neigiama; tiesinio sumavimo bsena, neuronas perdirba informacij ir siunia impuls danius kitiems neuronams; neuronas persotintas ir dirba didiausiu suadinimu, daniu Ymax . Treiosios neurono persotinimo bsenos danai gali bti nepaisoma, nes patenkinus tam tikr slyg neuronas niekada nebus persotintas, t. y. nevirys virutinio suadinimo ribos Xmax. Neurono persotinimo ivengiama patenkinus slyg, kad vis neurono adinanij sinapsini svorio koeficient S+i suma neviryt vieneto, t. y.:
k i =1

S+ i 1 .

i slyga ivedama i sunkiausi neurono darbo slyg, daugiausia suadintos neurono bsenos, kai n vienas slopinanij sinapsi jimas negauna signalo, slopinantieji signalai yra nuliniai, o visos adinaniosios sinapss gauna lygius Xmax dydio signal danius. N neurono netiesikumas, rodantis labai svarbi neurono savyb perduoti ijim tik teigiamuosius neurono suminius dydius ir neperduoti neigiamj. KarY

Si X i , ... jeigu ...


i =1 n i =1 n

Si X i 0, Si X i X MAX ,

Ymax= ~1000 imp./s

Y=N
i =1

Si X i = X MAX , ........ jeigu ...


i =1 n

0, ............... jeigu ...


i =1

Si X i 0.
0

n i =1

Si X

6.20 pav. Neurono impuls dani sudtuvo (sumatoriaus) statin charakteristika ir grafinis jos vaizdas

304
BIOFIZIKA

tais i savyb vadinama diodiniu netiesikumu. Tai svarbiausias netiesikumas. Jis yra svarbus neuron tinklams, turintiems grtamuosius ryius. Sumos enklo nekintamumas svarbus dinaminiam tinklo stabilumui, nes idealiai tiesinse sistemose, turiniose grtamuosius ryius, keiiantis kintamojo dydio enklui neigiamieji grtamieji ryiai virsta teigiamaisiais ir sistema virsta nebestabilia, danai pradeda generuoti savus signalus. i diodinio netiesikumo savyb kaip tik ir apsaugo nervin tinkl nuo tokio pavojaus. Neuron pora. Taiau diodini savybi neuronai netenka galimybs perduoti informacij, jei jo jim suma neigiama. i neuron ribotum nerviniame tinkle kompensuoja kartu veikiantys oponentiniai reciprokiniai neuronai, turintys tokias paias jimo signal sinapsi struktras, sinapsini koeficient dydius, tik prieing enkl (6.21 pav.). Vienas kit pildanij reciprokini neuron poros vykdo tiesin jimo dani sumavim. I j sudarytos neuron struktros gali atlikti tiesines signal perdirbimo procedras. Tokia dviej simetrikai funkcionuojani neuron sistema gana bdinga ne tik nerv sistemai, bet ir visoms fiziologinms sistemoms. Gamtoje gan sunku suprasti, kas yra dydio enklo pasikeitimas i teigiamojo neigiamj, ir atvirkiai. Todl gyvosios gamtos fiziologins sistemos sudaromos i prieingai veikiani vyksm. Suminis abiej reciprokini vyksm poveikis sukuria teigiamuosius ir neigiamuosius veiksmus, didina ar maina ne tik neuron, bet ir irdies plakimo danius, tam tikr raumen susitraukimo dydius ir pan. Piramidiniai neuronai, kuri yra daug galvos smegen, ypa smegen ievinse struktrose, turi draudianiuosius jimus Z. piramidinius neuronus ateinantys nuo krepini neuron aksonai, turi labai didelio slopinamojo (S) dydio (svorio) sinapX1 .
. . . Xi . . . .. Xn

Y+ Xmax

N Y Y+ 0

+ si Xi
X1 . . .Xi ... Xn

- si Xi
Xmax Y Y
6.21 pav. Reciprokini neuron pora tiesinis dani sudtuvas (sumatorius)

305
6. Organizmas organizuota sistema

sinius ryius Z. Jie atlieka draudimo funkcijas, t. y. leidia ar neleidia tolesn sumin atjusi Xi signal sukelto efekto atspind aksono ijime. Tokiu bdu piramidinis neuronas gali atlikti programavimo kalb gerai inomus slyginius loginius veiksmus jeigu (IF):
n

Y=

N
i =1

S i X i , ... jeigu..Z 1 . ARBA.Z 2 = 0,

0, ....................... jeigu..Z1 . ARBA.Z 2 0,

nes vienas Z tipo draudiantysis signalas atlieka loginio neiginio veiksm, o du Z1 ir Z2 tokio tipo signalai universal login veiksm Pirso (Pears) rodykls, dar kitaip vadinam Dagero (Dagger) funkcij. Matematins logikos teorija teigia, kad turint elementus, atliekanius universali login funkcij, i j galima sudaryti tinklus (struktras), kurie atlikt visas sudtingas logines funkcijas. Tokiu bdu apibendrinant galima daryti ivadas, kad: paprastas vaigdinis neuronas nerv sistemoje atlieka analogikas programavimo kalb vartojamas aritmetinio IF, t. y. aritmetins slygos funkcijas, o piramidinis neuronas logins slygos IF funkcijas. Nesunkiai suprantama, kad turint tokius atlikties elementus galima kurti neuron tinklus, kurie vykdyt sudtingas logines ir algebrines funkcijas. Jomis galt bti valdomi informacijos srautai ir vykdantieji organai. Dinamins neurono savybs. Aptartos funkcins neurono savybs yra statins, laikant jimo ir ijimo signalus pastovi dydi, nekintanius laiko atvilgiu. Natrals neuronai pasiymi inertinmis savybmis, j atsakai, kaip ir ateinantys sinapses jimo signalai, yra laiko atvilgiu kintantys impulsavimo daniai. Todl tenka vertinti dani kitimus laiko atvilgiu dinamines neuron savybes. Dinamins neuron savybs riboja j funkcionavim, neuron reagavimo greit. Tai danai riboja neuron galimybes arba tam tikroms jungimo struktroms suteikia nauj funkci galimybi. Neurono, arba jo kiekvieno jimo reagavimo greit sinapss dinamikum perduodant ateinanius signalus veikimo potencialus, galima vertinti, kiekvien sinaps, sistem bei signal teorijos poiriu, laikant paprasiausia pirmosios eils inertine grandimi. Jos dinamines savybes apibdina pirmosios eils nehomogenin tiesin diferencialin lygtis:
T dX = s u (t ) X , dt

kur s statinis sinapsinio perdavimo koeficientas, galintis gyti visas teigiamsias ar neigiamsias reikmes, T visada teigiamj enkl turintis reakcijos inertikum apibdinantis koeficientas, vadinamas sinapss laiko pastovija (6.22 pav.).
306
BIOFIZIKA

Tarkime, neuronai gali turti vairiausi ryi, net ir grtamj per kolaterales. Tie ryiai lai bus tiesiniai. Vadis u(t) N nasi, klasikins sistem teorijos metodais X(t) T galima sintetinti ir nagrinti sudtingas funkcijas atliekanias struktras tinklus. Jei funkcin neuron charakteristika yra netiesin, dirba netiesiniu, pavyzdiui, 6.22 pav. Neurono schema ir sinapss dinamins diodinio netiesikumo reimu, tai ma- savybs vertinimas tematinis toki struktr modelis yra netiesini diferencialini lygi sisema, kurios sprendimo metodai neaiks. Tokiais atvejais teorinis j veiklos tyrimas (modeliavimas) manomas kompiuteriais, vartojant specialias programinio modeliavimo sistemas. Jei nerviniai tinklai sudaromi i binarini dviej bsen neuron, tai tokiems tinklams sintetinti ir nagrinti taikytina diskreij automat iuolaikini kompiuteri veikimo teorija. ios teorijos atsiradimo pradia biologini neuron tinkl veiklos aikinimo teorija. Jos praktinis rezultatas iuolaikiniai kompiuteriai. Apskritai, neuron reikia vertinti kaip special informacijos perdirbimo mikroprocesori, kuris atlieka slygines algebrines ir logines procedras. Jis pritaikytas darniam darbui su daugybe panai mikroprocesori kartu. Neurobiologijos tyrim duomenys apie nerv posistemio funkcin organizacij veria iekoti ar kurti atitinkamos neuron tinkl funkcionavim aikinanios teorijos. Ji turt bti pagrsta daugelio neuron, dirbani vienu metu, lygiagreiai, informacijos perdirbimu. Be to, neuronai signal ir informacijos perdirbimo funkciniai elementai, i kuri sudarytas tinklas, nra dvinariai slenkstiniai. Norint suprasti nervini tinkl veikl, reikalinga tam tikra informacijos perdirbimo neuron tinklais ir sluoksniais teorija.

6.7. NEURON TINKLAS

Neuron tinklai gali bti sudaryti i tiesiogini ir grtamj ryi. Tiesiogini ryi neuron tinklas. Bendruoju atveju paprasiausia neuron struktra, arba neuron tinklas, sudarytas i n-neuron, turintis n signalini jim U, kurie tiesioginiais isiakojaniais atitinkamais sinapsiniais ryiais veikia kiekvien neuron, be grtamj ryi, parodytas 6.23 pav. jimo signalai U gali bti arba kito neuron tinklo, arba receptori ijimai. Jie gali bti apibdinti kaip n-matis signalinis jimo vektorius matrica stulpelis. Ati307
6. Organizmas organizuota sistema

U1

U2

U3 Sij

Ui

Un

N1

N2

N3

Ni

Nn

... X1 X2 X3 Xi

.. Xn

6.23 pav. Tiesiogini ryi neuron tinklas

tinkamai kiekvieno neurono ijimo signalai, paymti, pavyzdiui, simboliu X, taip pat bus vektorius matrica stulpelis. Tarpneuroniniai ryiai, kuri daugiausia gali bti n (n 1), apibdinami sinapsiniais ryi koeficientais, kuri dydiai (svoriai) Sij , sudarys nn dydio ryi matric. ia pirmasis indeksas rodo, kur neuron ryys ateina, o antrasis i kurio neurono ateina. i ryi matrica ir bus pagrindin neuron tinklo funkcin charakteristika, nusakanti jo atliekam jimo signal perkodavim arba atspindjim io neuroninio sluoksnio erdvje. Sistem teorijos poiriu i matrica vadinama operatoriumi. Tai statinio sustabdyto vyksmo neuron tinklo apibdinimo bdas. Taiau realus neuronas yra dinaminis elementas, kurio reakcijos ijimo vietoje kintanius laiko atvilgiu jimo signalus yra taip pat kintantys laiko atvilgiu ijimo signalai. Neuronas, perdirbdamas informacij, transformuodamas signalus, reaguoja inertikai. Bendruoju atveju dinamin neuron tinkl reikia apibdinti diferencialini lygi sistema. Ji bt gana paprasta, jeigu tinklas funkcionuot tiesiniu reimu ir visi neuronai bei j sinapss turt inertikum Ti . Jei neuronai yra netiesiniai, netiesikum N turintys jimo signal sudtuvai (sumatoriai), neuron tinklo statin reakcija X, jimo signal vektori U, nustatoma pagal vektorin lygt:

X 1 = N {S11 U 1 + S12 U 2 + ... + S1i U i + ... + S1n U n } X = N {S U + S U + ... + S U + ... + S U } 21 1 22 2 2i i 2n n 2 ........................................................................... X i = N {S i1 U i + S i 2 U 2 + ... + S ii U i + ... + S in U n } ........................................................................... X n = N {S n1 U 1 + S n 2 U 2 + ... + S ni U i + ... + S nn U n } ,
308
BIOFIZIKA

arba vektorins formos:

[ X ] = N { [Sij ] [U ] }.

kur iskleistas jimo signal vektorius U ir ijimo signal vektorius X bei ryi matrica [Sij ] bt uraoma:
U1 U2 U3 [U ] = , Ui Un X1 X2 X3 [X ] = , Xi Xn S11 S 21 S12 S 22 S32 Si 2 Sn 2 S13 S 23 S33 Si 3 S1i S 2i S 3i Sii S1n S2n S3 n . Sin

[ ]

S31 Sij = Si1 S n1

S n 3 S ni

S nn

Ryi matricos pagrindinje striainje (diagonalje) nariai Sii rodo tiesiogin signalo perdavim, tarsi pagrindin signal jim, o visi kiti nariai tiesioginius oninius ryius. Vis neuron statin reakcija Xij matematikai ireikiama netiesine lygtimi, apribota netiesikumu N: . ia ryi matricos vienos eiluts sinapsiniai koeficientai yra i-j neuron konverguojani ryi visuma, o stulpelio i i-tojo jimo neuronus diverguojantys ryiai. Jeigu neuron tinkl sudaro ne netiesikum N neuronai, bet reciprokini neuron poros, tada toks neuron tinklas vykdyt tiesines algebrines signal transformacijas, matematikai uraomas tiesini algebrini lygiu sistema:
X 1 = S11 U1 + S12 U 2 + ... + S1i U i + ... + S1n U n X 2 = S 21 U1 + S 22 U 2 + ... + S 2i U i + ... + S 2 n U n ........................................................................... X i = Si1 U i + Si 2 U 2 + ... + Sii U i + ... + Sin U n ........................................................................... X n = S n1 U1 + S n 2 U 2 + ... + S ni U i + ... + S nn U n

arba vertinus dinamines neuron savybes, j reakcij inertikumus Ti , neuron tinklo matematinis modelis bt pirmosios eils tiesini diferencialini lygi sistema:
309
6. Organizmas organizuota sistema

dX 1 T1 dt = S11 U 1 + S12 U 2 + ... + S1i U i + ... + S1n U n X 1 , T dX 2 = S U + S U + ... + S U + ... + S U X , 21 1 22 2 2i i 2n n 2 2 dt ........................................................................... T dX i = S U + S U + ... + S U + ... + S U X , i1 i i2 2 ii i in n i i dt ........................................................................... dX n Tn dt = S n1 U 1 + S n 2 U 2 + ... + S ni U i + ... + S nn U n X n ,

kuri galima urayti trumpesne matematine forma:


Ti
n dX i = Sij U j X i . dt j =1

Akivaizdu, kad neuron tinklo savybes lemia ryi matrica [Sij ] ir neuron inertikumo koeficient vektorius [Ti ]. Neurobiologiniai tyrimai rodo, kad neuron struktrose, be tiesiogini ryi, yra daug grtamj ryi, kurie persmelkia vis biologini sistem funkcin organizacij. Atrodo, kad grtamieji ryiai danai turi didesn funkcin reikm nei tiesioginiai. Neuron tinklas, turintis grtamuosius ryius. Neuron tinklas gali bti sudarytas ir grtamaisiais ryiais. Tai neuron struktra i n element (neuron), kurie gauna jimo signalus [U] per sinapses, turinias ryio koeficientus [S1] (tai gali bti ir jimo signal [U] ryi matrica [S1ij ]) i receptori arba kitos neuron struktros ijim, ir ijimo atakas (kolaterales), kurios gali sudaryti sinapsinius ryius (kontaktus) su tos paios struktros neuronais. i sinapsini ryi koeficientai apibdinami matrica [S0ij ] (6.24 pav.). Pateiktoje schemoje tiesioginiai ryiai pavaizduoti paprasiausios vienetins matricos [I] pobdio, o grtamieji ryiai akson atak sinapsmis ant aplinkini neuron, bet be grtamosios atakos ant to paties savojo neurono. Teorikai apibdinant algebros metodu, tiesioginius ir grtamuosius ryius galima ireikti bendrojo pobdio matricomis. Nagrinjant pavienius atvejus gali bti vartojami tam tikri supaprastinimai. Pateikto neuron tinklo reakcija, arba ijimo signal vektorius [X ], laikant, kad neuron tinklas sudarytas i netiesini N tipo neuron matematikai bus uraytas:

[ X ] = N {[S1 ] [U ] + [S 0 ] [ X ]} ,
i kur
310
BIOFIZIKA

U1

N1

U2 N2

Nn X Ni
Ui

N3
U3

6.24 pav. Neuron tinklo, turiniojo grtamuosius ryius, schema

[X ] = N

[S1 ] [U ] . I [S 0 ]

ia [S0] grtamj ryi matrica, o [S1] tiesiogini ryi matrica, I vienetin matrica. Jeigu neuron tinklas sudarytas i reciprokini neuron por, jis vykdo tiesines signal transformacijas, kurios ireikiamos tomis paiomis matematinmis formulmis, tik be neuron netiesikum N. Vieno neurono (reciprokins neuron poros) reakcija matematikai gali bti ireikiama tiesine lygtimi:

X i = Sij U i + S0ij X j .
j =1 j =1

Jei neuronai yra netiesiniai, i lygtis bendruoju atveju netaikytina. Ji gali bti vartojama patenkinus tik tam tikras slygas ir esant tam tikriems kintamj dydiams. Taiau toks netiesinis tinklas gali gyti visikai nauj funkcikai reikming savybi. Pavyzdiui, didiausiojo signalo dydio, arba tam tikro signal dydio praleidimo tinklas (filtras), neuron tinklas, formuojantis dinaminius slenksius, arba vairiausi nerykiosios (fuzzy) logikos, pagrstos daugiau, maiau, lygu informacijos perdirbimo procedromis valdantys tinklai. Tam tikras neuron tinklo, turinio grtamuosius ryius, savybes galima suprasti nagrinjant vieno neurono, turinio grtamj ry, savybes. Neuronas, turintis grtamj ry, pavaizduotas 6.25 pav. Keiiant grtamojo ryio S0 enkl ir sinapss ryio koeficiento dyd, neuronas dl netiesikum gali gyti
311
6. Organizmas organizuota sistema

X(t)

S1 T1

Y(t) N S0

Ymax= Xmax =~1000 imp/s S0>0 S0<0


n i =1

Si X

6.25 pav. Neuronas, turintis grtamuosius ryius, i ryi taka funkcinei neurono charakteristikai

labai vairi savybi. Jas nesunku suprasti sudarius tokio neurono vieno jimo signalo X(t) perdavimo lygt, gaunam dl grtamojo ryio:
Y (t ) = N {S1 X (t ) S 0 Y (t )}, ... arba .... Y (t ) = N S1 X (t ) . 1 S0

Jei S0 < 0, grtamasis ryys yra neigiamas, atliekamas per slopinamsias sinapses, perdavimo koeficientas maja. Neurono tiesins charakteristikos dalies statumas maja, ir taip pat maja neurono jautrumas jimo signalams (6.25 pav.). Jei grtamasis ryys teigiamas, atliekamas per jaudinanisias sinapses, S0 > 0, neurono savybs keiiasi ne tik kiekybikai, bet ir kokybikai. Kol S0 < +1, neurono charakteristika, kaip ir ankstesniu atveju, keiiasi tik kiekybikai tiesin dalis statja, jautrumas didja. Bet jei S0 = +1, charakteristika bna visikai stati. Neuronas gyja idealaus rels elemento, jungtuko savybi. Jei S0 > +1, ir neuronas turi slenkst Q, atsiranda histerezs efektas didinant neurono sumin jaudinim, pasiekus slenkstin dyd Q, neuronas ikart pradeda generuoti Ymax = Xmax. Sumin sujaudinim mainant, jis uolikai grta nulinio sujaudinimo bsen, esant maesniam nei slenkstis Q poveikiui. Susidaro neigiamo statumo neurono charakteristikos tiesin dalis, atsiranda charakteristikos kilpa, vadinama histerezs kilpa. Teigiamj grtamj ry didinant dar daugiau, neurono charakteristikos neigiamas statumas pakinta tiek, kad kerta Y a. Tada neuronas virsta tam tikru atminties elementu, nes ir visikai paalinus poveik X(t) = 0, neuronas ilieka maksimaliai sujaudintas. Neuronas generuoja Xmax , tuo rodo atminties savyb atmena, kad prie tai buvo jaudinamasis poveikis. iuo atveju didiausio neurono sujaudinimo bsenai nuslopinti reikia tam tikro dydio slopinamojo poveikio. Tokiu bdu neuronai turintys grtamj ry, keiiantis grtamojo ryio koeficientui, ypa jo enklui, gali labai pakeisti viso neuron struktros ar tinklo savybes.
312
BIOFIZIKA

Panai neuron grtamj ryi taka j reakcij greiiui dinaminms savybms. Tai matoma panaiai nagrinjant ne algebrin, bet pirmos eils diferencialin neurono signal perdavimo lygt, turini grtamj ry, jo tak inertikumo koeficientui T. Nesunku sitikinti, kad neigiamieji grtamieji ryiai dinamikumo savybes gerina, inertikumo koeficient T (arba laiko pastovij) maina, nes:
T= T1 , 1 m S0

o teigiamieji dinamines savybes blogina (inertikum didina). Jei S0 = +1, neuronas virsta laiko atvilgiu kintani signal kaupikliu integratoriumiu integruojanija grandimi. Panai, tik daug sudtingesni savybi gyja neuron tinklai, turintys grtamuosius ryius. Daugiausia sunkum nagrinjimui sukelia netiesikumai ir skirtingi sinapsi inertikumai. Esant teigiamiesiems grtamiesiems ryiams ir tam tikriems inertikum koeficientams, neuronai pradeda savaime generuoti impuls danius. Tokiuos savaime impulsuojanius neuronus neurofiziologijoje danai vadina ritmo vedliais (peismekeriais). Dl neuron ir j ryi, ypa grtamj netiesikum, atsiranda sudtingi ir doms chaoso reikiniai. Tiriant gyvn nerv sistemos informacijos atspinjimo ir perdirbimo procedras, btina nagrinti neuron sluoksni funkcin organizacij. 6.8. NEURON SLUOKSNIAI Gyvnas su aplinka sveikauja kno paviriumi. Todl aplinka organizme atsispindi pavirinmis projekcijomis, o t atspind priima jutimini (sensorini) lsteli receptori sluoksniai, kurie sukuria signalin informacij apie atspindius, ir juos perduoda neuron struktroms neuron sluoksniams. Neuron sluoksniai, perdirbantys signalin atspindi informacij, bna sujungti nuosekliaisiais, lygiagreiaisiais ir grtamaisiais ryiais. Neuron sluoksnio struktra yra diskreti, sudaryta i pavieni element neuron. Neuron, kuri yra labai daug ir jie tankiai isidst sluoksniais, neuron sluoksnis gali bti vertinamas kaip vientisa struktra. Be to, neuronas yra tolydij dydi nervini impuls sekos dani algebrinis sudtuvas (sumatorius). Jei laikoma, kad neuronai sudtuvai (sumatoriai) veikia vienas kit pildaniomis (reciprokinmis) poromis, neuron sluoksnis gali bti suprastas kaip ideali tiesin vientisa sumuojanti struktra. Tokiam sluoksniui galima taikyti signal tiesini transformacij matematik. Neuron sluoksnis virsta erdvini signal filtru. Neuron sluoksniai gali bti vienmaiai, dvimaiai ir net daugelio matavim. Jie gali turti tiesioginius, grtamuosius ir mirius signalinius ryius.
313
6. Organizmas organizuota sistema

Vienmaiai neuron sluoksniai, turintys tiesioginius ryius. Tarkime, neuronai yra labai mai takiniai elementai, j labai daug ir jie yra idstyti tarsi linijine ar pavirine struktra. Tada informacin signalin neuron struktros veikl matematikai galima aprayti ne diskreiosiomis algebrini lygi sistemomis, bet integralinmis lygtimis. Pavyzdiui, organizmo paviriuje isidsts linijinis receptori sluoksnis, sudarytas i receptori Ui , atspindi aplinkos poveik U() ir perduoda tiesini (reciprokini por) neuron sluoksniui, isidsiusiam erdvje x (6.26 pav.). Receptori sluoksnis su neuron sluoksniu susij ryiais, apibdinamais matematine funkcija S(, x), kuri atspindi konvergencijos kiekvien sluoksnio neuron arba divergencijos i kiekvieno receptoriaus sluoksnio neuronus pobd. Tada tiesinio neuron sluoksnio signal perdirbim galima ireikti kaip integralin transformacij:

X ( x) = U ( ) S ( x, ) d ,

kur tokio sluoksnio signalai ijime bus jo neuron reakcija suadinimo funkcija X(x). Tai bus aplinkos atspindio receptori erdvje signalo U() atspindjimas naujoje neuron x erdvje X(x). i erdv dl ryio funkcijos S(, x) gis savit savybi, vadinasi, perdirbs jimo signal. Galima sakyti informacij perkoduos. Toks poiris ir matematinis apraas padeda suprasti daugel neurofiziologini reikini ir galina atitinkamas struktras nagrinti ir apibendrinti. Ypa tai akivaizdu, kai sluoksni sryio funkcija gana sudtinga, bet ji vis neuron yra ta pati (struktra homogenika). Jei sluoksni struktra homogenika, t. y. vis neuron ryi konvergencijos funkcijos tokios paios, integralin transformacija virsta sskos integralu:
U() U1 U2 Uj Ui Un S(,x) x

X1

X2

Xj X(x)

Xi

Xn

6.26 pav. Linijinis neuron sluoksnis, turintis tiesioginius oninius (lateraliuosius) ryius

314
BIOFIZIKA

X ( x ) = U ( ) S ( x )d ,

toks neuron sluoksnis vadinamas tiesiniu filtru. Jam nagrinti ir apibendrinti galima taikyti tiesini signal ir filtr teorij. iais atvejais patogiausia naudotis matematins signal teorijos priemonmis ir metodais, taikyti abstrakias kompleksini kintamj Furj ir/ar Laplaso matematines transformacijas, pereinant atitinkamas abstrakisias erdves. Abstrakij Furj erdv dani erdv patogiau taikyti geometrini erdvi signal transformacijai, o Laplaso laiko erdvs laiko atvilgiu kintantiems signalams analizuoti. Nustatyta, tokiais neuron tinklais galima atlikti bet kokias kompleksines transformacijas, tarp j Furj ir Laplaso. Tik matematinms kompleksinms transformacijoms atlikti reiks dviej lygiagreiai funkcionuojani sluoksni, i kuri vienos ryi funkcija bus moduliuota pagal kosinuso, o kitos pagal sinuso dsnius. Tokio teorinio matematinio poirio reikia atliekant neurobiologijos tyrimus, ypa aikinant neurofiziologiniais bandymais gaut neuron reakcij atsakus poveikius, t. y. aikinant recepcinius neuron laukus. Klasikinis pavyzdys oninis (lateralusis) slopinimas, kuris aikinamas sluoksni, turini tam tikrus ir/arba tiesioginius, ir/arba grtamuosius slopinimo ryius pasiymintis kontrasto parykinimo efektais. Vienmaiai neuron sluoksniai, turintys grtamuosius ryius. Neuron sluoksnis, turintis grtamuosius ryius, pavaizduotas 6.27 pav. Tai beveik tokios paios struktros neuron sluoksnis kaip ir turinio tiesioginius ryius. Tik oniniai ryiai yra neuron isiakojani akson ataugos, einanios i sluoksnio ijimo atgal, pasibaigianios ant sluoksnio neuron sinapsmis. Pateiktoje schemoje ryiai i receptori neuron sluoksn yra receptorius neuronas, arba ryi funkcija S1 (x, ) yra vienetin matrica. Tai atitinka signal teorijos matematin delta (x) ryi funkcij.
U() U1 U2 Uj Ui Un
S1 (x,)

x S0(,x)

X1

X2

Xj X(x)

Xi

Xn

6.27 pav. Neuron sluoksnis, turintis grtamuosius ryius

315
6. Organizmas organizuota sistema

Toks neuron sluoksnis ireikiamas netiesine integraline lygtimi:


X ( x ) = U ( ) S 1 ( x , ) d +
+ +

X ( x) S

( , x ) d .

Jei ryi struktra yra homogenika, ir visi konvergavimo neuronus ryiai turi tokias paias ryi funkcijas, integralin lygtis virsta sskine:
X ( x ) = U ( ) S 1 ( x ) d +
+ +

X ( x) S

( x ) d .

J galima suprastinti atitinkamomis kompleksinmis Furj ir/arba Laplaso transformacijomis, perversti algebrine lygtimi. Tokiu bdu ir tokiam neuron sluoksniui, kaip ir turiniam tiesioginius homogeninius ryius sluoksniui, galima taikyti tiesini signal ir sistem teorij. Tiesinio matematinio mstymo metodu nesunkiai galima suprasti daug kur neurofiziologijos bandymais stebimus oninio (lateraliojo) slopinimo reikinius, kurie rykina kontrastus. oninis (lateralusis) slopinimas Hartlaino lygtis. Neuron tinklas, turintis slopinamuosius oninius grtamuosius ryius, buvo nustatytas nariuotakojams kardauodegei Limullus, tyrinjant jos ciklopins facetins akies neuron struktr veikl. Buvo akivaizdiai parodyta, kad ie neuronai atlieka impuls dani algebin sumavim (+ arba enklu) ir sveikauja horizontaliaisiais oniniais (lateraliaisiais) slopinamaisiais ryiais. Neurofiziologas H. K. Hartlainas (H. K. Hartline), tyrinjs reikin, apra j oninio slopinimo lygtimi:

X i = k lg U i

j =1,i j

0 ij

Xj,

kuri paaikino fiziologinio ir psichofiziologinio kontrast rykinimo reikinio mechanizm. I ios lygties matoma, kad neuron struktra organizuota taip, kad pats savs neuronas neslopina, o slopinamai veikia aplinkinius neuronus. Artimiausius neuronus slopina labiausiai, tolimesnius maiau, ir taip neuron sluoksnis gyja savyb rykinti kontrastus. Remiantis signal teorija, tai erdvinis filtras, geriau perduodantis auktuosius erdvs danius ir blogiau emuosius. Dar fizikas E. Machas (Ernst Mach), teorikai tyrinjs psichofizikin kontrasto rykinimo reikin, teig, kad jutimo organai ne visikai tiksliai atspindi iorin pasaul, kad subjektyvus pojtis S (x) yra proporcingas objektyviam poveikiui U(x), atmus poveikio antros eils ivestin:

. dx 2 Verta atkreipti dmes tai, kad E. Machas, aptardamas galimus io reikinio mechanizmus teig, kad jie gali bti gyvendinti tik diskreiosiomis struktromis. Hartlaino
316
BIOFIZIKA

S ( x) = k U ( x) a

d 2U ( x)

formul kaip tik ir paaikino kontrasto rykinimo reikin diskreij struktr neuron tarpusavio slopinimo mechanizmais. Taiau nuodugnesnius ir artimesnius biologinei realybei aikinimus atspindi integralins lygtys. Dabar oninio slopinimo mechanizmai stebimi beveik visuose, ne tik neurofiziologiniuose, bet ir kituose posistemiuose. Tai yra konkurencins sveikos principas, matematikai apraomas tiesinmis ir netiesinmis lygtimis. Labai danai fiziologins, kaip ir neuron struktros, naudoja kartu ir tiesiogines, ir grtamsias ryi sveikas. Neuron sluoksnis, turintis tiesioginius ir grtamuosius ryius. Apibendrintas neuron sluoksnis, kaip ir dauguma biologini neuron sluoksni, bus sudarytas i tiesiogini ir grtamj ryi (6.28 pav.). Be to, tokie sluoksniai turi bti valdomi, t. y. turi valdomuosius poveikius, kurie sluoksnius tam tikromis aplinkybmis veiklai jungia arba ijungia. Todl neuron sluoksniai turi turti tam tikrus draudianij signal jimus, kurie per draudianisias neuron sinapses atlikt login sluoksnio valdym. Vadinasi, neuron sluoksniai gali bti apibdinti matematinmis formulmis, kaip diskreiosios struktros reakcija R, kuri yra vektorin slygin lygtis:
r S1 r v Y = U , IF ( Login funkcija) = .TAIP., I S0 R= 0, IF ( Login funkcija) = .NE. ,

arba laikant, kad neuron sluoksnis yra vientisa struktra, reakcij galima ireikti slygine integraline lygtimi:

U1

U2

Uj

Ui

Un

S1 (,x)

S1 S0 Y1 Y2 Yj Yi Yn

Login funkcija

x
S0 (x,)

6.28 pav. Neuron sluoksnis, turintis tiesioginius ir grtamuosius ryius

317
6. Organizmas organizuota sistema

+ + Y ( x) = U ( x) S1 ( x, )d + Y ( ) S 0 ( , x)d , IF ( Login funkcija) = .TAIP., R( x) = 0, IF ( Login funkcija) = .NE.

Homogenins struktros atveju, kai ryi funkcijos S 1 (x) ir S 0(x), sluoksnis apraomas paprastesne, sskine lygtimi. Neuron sluoksniai gali vykdyti vairiausias matematines kompleksines ir nekompleksines signal integralines transformacijas. Suformavus tam tikras ryi funkcijas, neuron sluoksniai virsta specializuotomis struktromis, galiniomis atlikti vairiausias kodavimo ir dekodavimo procedras. Vienas sluoksnio neuronas gali bti vertinamas kaip mikroprocesorius, o pats sluoksnis kaip filtras, signal transformatorius. Neuron sluoksnis gali bti vienmatis (neuronai isidst linijoje), dvimatis (neuronai isidst paviriais) arba trimatis, bendriausiu atveju daugiamatis. Specialios ryi struktros, pavyzdiui, dvimatis neuron sluoksnis gali vykdyti Furj, Frenelio, Volo (Walsho) ir kitas ortogonalines ar kvaziortogonalines transformacijas. Jie yra tarsi ir kvazioptiniai neuron tinklai, galintys vykdyti net ir koherentins optikos (pvz., kvaziholografines) transformacijas. Tai pasiekiama neuron sluoksniams parenkant tam tikras ryi funkcijas. neuron konverguojani ryi funkcij neurofiziologai vadina neurono recepcijos lauku. Visas neuron sluoksnio ryi funkcij rinkinys signal teorijoje vertinamas kaip filtro charakteristika, o sistem teorijos poiriu sluoksnio signal perdavimo funkcija. Neuron sluoksni sistemos. Neuron sluoksniai gali bti jungiami sistemas nuosekliaisiais, lygiagreiaisiais ir grtamaisiais ryiais. Tiesini sluoksni atvejais j jungimas apraomas tiesini grandi, sistem ir signal teorijomis. Netiesiniams neuron sluoksniams ir dar loginmis funkcijomis valdomoms neuron struktroms aikinti iuo metu isamesns teorijos nra sukurta. Neuromorfologiniai ir neurofiziologiniai tyrimai akivaizdiai rodo, kad nerv posistemis, ypa stuburini smegenys, smegen iev, yra vairiausi daugybs neuron sluoksni darinys. Aiku, tie sluoksniai turi turti ir tiesini, ir netiesini savybi. Tiesins savybs bdingos neuron sluoksniams, kuri funkcin paskirtis kuo tiksliau priimti ir perduoti auktesnio informacijos perdirbimo struktroms informacij apie aplinkos ir sistemos vidaus bkl. Draudiantieji neuron sluoksni poveikiai, sluoksni veikl valdantys per draudianiuosius ryius, sukelia netiesini reakcij pobd. Tokie reikiniai apraomi programavimo ir automat teorijos bdais. Neuron struktroms bdingos savitos prisitaikomumo (adaptyvumo) savybs. Tai susij su savybe mokytis, keisti vidaus struktr, kaupti patirt, turti atmint. i nesuprantamiausia neuronini struktr savyb apipinta daugybe hipotetini aikinim. Maiausiai ginytinas neuron struktr adaptyvum aikinantis mechanizmas yra prielaida, kad organizmo gyvenime vis laik daugja ryi, didja sinapsini kontakt skaiius, kinta sinapsini koeficient dydiai (svoriai). Remiantis bandym
318
BIOFIZIKA

duomenimis, nenaudojam neuron struktr sinapsini kontakt ir ryi tankis yra maesnis. Neurofiziologai D. Hubelis (D. Hubel) ir T. Vyzelis (T. Wiesel) tyr vos tik gimusi, dar nematani kaiuk regos analizatoriaus smegen ievs neuronus. Tyrim duomenys buvo palyginti su t pai neuron struktr subrendusi kai duomenimis. Buvo akivaizdiai parodyta, kad gyvno gyvenimo patirtis derintina su tarpneuronini ryi ir sinapsi daugjimu. Tenka pastebti, kad bendroji pamatin funkcin atitinkam analizatori organizacija yra nulemta genetikai. Taiau pavienio organizmo individualaus gyvenimo patirtis, atrodo, susijusi su daugjani tarpneuronini ir tarpsluoksnini nauj sinapsini ryi sudarymu. Todl btina aptarti mokslij ir adaptyvij neuron tinkl modelius.

6.9. MOKSLUSIS, ARBA ADAPTYVUSIS, NEURON TINKLAS

Adaptyvij ir mokslij neuron struktr modeli, danai vadinam perceptronais, bendroji schema parodyta 6.29 paveiksle. Tai sistemos, sugebanios mokytis atpainti tam tikras, receptori sluoksnyje atsispindinias panaias bsenas vaizdus. Paprasiausiu atveju tokia sistema sudaryta i trij sluoksni. Pirmasis sluoksnis yra receptori, antrasis vadinamas asociatyvij neuron, treiasis sprendianij neuron sluoksnis. Pagrindines sluoksni savybes formuoja dvi tarpneuronini ryi struktros. Tiesioginiai ryiai i receptori asociatyviuosius antrojo sluoksnio neuronus, vis neuron konvergenciniai ryiai S(, x) nulemia asociatyvij neuron savybes, sugebjim nagrinti receptori sluoksnyje atsispindjusius vaizdus U() skaidyti juos poymiais. Tai yra kodavimo procedra. Kiekvienas asociatyvusis neuronas tikrina, yra ar nra pateiktame vaizde jo poymis. Tam tikrais atvejais is neuronas gali vertinti to poymio ireiktum. Asociatyvusis neuron sluoksnis perkoduoja formalioje receptori erdvje atsispindjus vaizd, perveda j formalij poymi erv X(x). Antrajai ryi struktrai, jungianiai asociatyviuosius neuronus su sprendianiaisias, bdinga tai, kad galima juos keisti. ie ryiai vadinami hideniniais ryiais. Jais galima suformuoti kiekvienam sprendianiajam neuronui Zi toki ryi struktr, kad kiekvienas reaguot tik tam tikr atsispindjus vaizd ir nereaguot kitus. Tai reikia, kad yra neuron struktr galima imokyti atpainti vaizdus. Tokia neuron struktra yra vis funkcikai reikaling bsen koderis, pavyzdiui, atpainti skaitmenys, raids, garsai, spalvos ir pan. Mokslioji neuron struktra dirba dviem reimais mokymo ir tyrimo.
319
6. Organizmas organizuota sistema

U() U1 U2 Uj Ui Un

S(,x) X(x) x

X1

X2

Xj

Xi

Xn

MOKYTOJAS

HIDENINIAI, arba KINTAMIEJI, RYIAI

Z1

Z2

Zj

6.29 pav. Mokslioji neuron struktra

Mokymo reimo metu mokytojas ino, kok pateikt vaizd, kuris sprendiantysis neuronas turi reaguoti. Pateikdamas vaizdus ir gaudamas atsakymus, mokytojas kaitalioja sinapsini ryi koeficient enklus ir dydius (svorius) pagal tam tikras mokymo taisykles algoritmus. Pavyzdiui, jeigu neuron struktra reagavo teisingai, skatinama didinami tie teigiamieji ryiai, kurie teisingai reagavo, ir mainami sureagavo neteisingai. Gali bti mainami tie neigiamieji ryiai, kurie reagavo neteisingai. Taip pat gali bti naudojami skatinimo, baudimo bei skatinimo-baudimo mokymo algoritmai taikomos tam tikros mokymo taktikos. Neuron struktrai pradjus reaguoti pakankamai teisingai, ji toliau dirba be mokytojo tyrimo ar egzamino metu. Aiku, mokytojas gali bti naudojamas vis neuron struktros darbo laik, ir konkretaus darbo vaizd atpanimo metu. Mokytojas gali bti pats darbo vyksmas organizmo, turinio toki struktr, realus gyvenimas. Konkrei vaizd atpainimo perceptronini sistem modeliavimas parod, kad tokiu principu veikiantiems posistemiams nebdingi reikmingi funkcionavimo rodikliai. Manoma, kad tokiais modeliais galima paaikinti paprastus slygini refleks susidarymo vyksmus, galima paaikinti slyginius refleksus. Tiesa, buvo bandyta kurti daugiasluoksnius perceptronus, siekiant praplsti j galimybes. Bandyta kurti perceptronus turinius grtamuosius ryius. Taiau nebuvo
320
BIOFIZIKA

pasiekta laukiam rezultat, panai iltakrauj organizm mokymosi gebjimus. Iskirtin iltakrauj gyvn savyb atpainti jutimo organais gana transformuotai atsispindjusius vaizdus, juos atpainti kaip vienus ir tuos paius yra vienas i svarbiausi biofizikos tiriam klausim. Dar nenustatyti principai, kuriais funkcionuoja gyvn jutimo organ analizins struktros. Tai tiesiogiai susij su neaikiausiais biologijos klausimais nerv posistemio, smegen atminties ir jos mechanizm klausimais. Daug aikesnis vykdaniojo efektorinio posistemio raumen sistemos valdymas ir veikla.

6.10. RAUMEN POSISTEMIO VEIKLOS PRINCIPAI

Raumen posistemis yra pagrindin efektorin organizmo struktra. Ji rykiausiai reaguoja aplink ir priklauso organizmo vidaus posistemiui, vykdaniam veiksmus aplinkai. Raumen sistema ne tik veria chemin energij mechanin, bet yra ir pagrindinis organizmo ildytuvas. Ji yra sudtingas mechanikos posistemis, daugybs laisvs laipsni pernaos (transporto) posistemis, kurio valdymas dar sunkiai suprantamas biomechanikos ir biokibernetikos mokslams. iais klausimais fizikos mokslas domisi dar nuo Galiljaus laik. Geriausiai yra itirtas raumuo kaip mechaninins jgos sukliklis (generatorius). Maiau suprantamas raumen valdymas neuron struktromis. Raumens darbo charakteristikos. Raumuo ir supaprastinta jo valdymo schema pateikta 6.30 paveiksle. Pagrindinis dmesys skirtinas jo veiklos valdymui, kur lemia
Grtamoji informacija apie raumens ilg

Valdymo informacija i kit nervini struktr

motoneuronai Raumuo
Grtamoji informacija i Goldio lsteli apie raumens tempimo jg

Raumenin verpst

6.30 pav. Raumuo ir jo valdymo schema

321
6. Organizmas organizuota sistema

receptorins ir nerv struktros. Raumuo turi specialius receptorius raumenines verpstes, teikianias informacij apie raumens ilg L, ir sausgyslse Goldio lsteles, teikianias informacij apie sukelt jg F. Raumenis valdantys (alfa) neuronai (motoneuronai) yra tie slyginiai loginiai veiksniai, kurie reikiamu metu siunia nervinius impulsus ir aktyvina arba stabdo raumens susitraukim, t. y. valdo raumen. Visa tai priklauso nuo atjusios informacijos i auktesni nervini struktr ir informacijos i paties raumens, kurio receptoriai informuoja motoneuronus apie tikrj raumens bsen. Raumuo, kaip mechanins jgos generatorius, chemin energij, tiekiam kapiliarais per kraujotakos posistem, veria mechaniniu darbu. Tai yra, gavs valdymo informacij nervinius signalus, raumuo susitraukia ir sukelia mechanin jg, atlieka mechanikos darb. Raumens fiziologija iskiria tris raumens susitraukimo reimus: izotonin; izometrin; auksotonin. Izotoninio susitraukimo metu raumuo atlieka darb kilnodamas pastov svor P. Vertinant atliekam raumens darb naudojamasi izotoninio susitraukimo charakteristika. Ji rodo, kok aukt gali raumuo pakelti atitinkam svor arba kiek tas raumuo, apkrautas tokiu svoriu, gali susitraukti (6.30 pav.). Bandymais yra nustatyta, kad izotoninio susitraukimo metu raumens sutrumpjimas tiesikai priklauso nuo keliamo krvio ir ireikiamas tiesine lygtimi (6.31 pav.):
L = Lmax Lmax P. Pmax
L Lmax

Jei nra krvio P = 0, raumuo susitraukia maksimaliai Lmax . Esant krviui P susitraukimas 0,5 Lmax L maja, kol pasiekiama didiausioji Pmax apkrova, kuri yra lygi raumens sukeltai jgai W = L P W = L P P Pmax = F. Remiantis iais duomenimis, galima 0 vertinti raumens atlikt darb W = L P. 0,5 Pmax Pmax = F Matoma, kad raumens atliktas darbas yra W izotoninio raumens susitraukimo charakteristikos trikamp brto staiakampio plotas. Kintant raumens apkrovai, atliktas darbas kilP nojant svorius P, kis parabole, kurio pasiekia0 ma reikm bus didiausia, kai apkrovos svoris yra lygus pusei didiausiosios apkrovos 0,5Pmax. 6.31 pav. Izotoninio raumens susitraukimo charakteristikos Tai svarbi raumens darbo savyb.
322
BIOFIZIKA

Izometrinio susitraukimo charakteristika rodo, koki jg F suke- F Fmax lia raumuo keiiant jo itempimo ilg L (6.32 pav.). Kaip ir atlikto raumens darbo W izotoninio raumens susitraukimo charakteristikoje, taip pat ir izometrinio susitrauL kimo atveju, pasireikia optimalus 0 Lopt raumens itempimo ilgis Lopt . Raumeniui bnant Lopt ilgio sukeliama 6.32 pav. Izometrinio raumens susitraukimo charakteristika didiausioji jga Fmax. i savyb suprantama isiaikinus molekulinius raumens darbo mechanizmus. Optimalus raumens ilgis Lopt, kuriam esant pasiekiama didiausioji jga Fmax yra tada, kai daugiausia persidengia aktino ir miozino sukibimo globuli. Raumens ilgiui artjant prie ribini ilgi, esant maesniam ir didesniam raumens ilgiui L < Lopt < L, sukurtos jgos dydis F maja, nes raumens skaiduloms per daug susitraukus, aktyvius ryius nutraukinja ulipanios viena ant kitos aktino molekuls. Raumen perdaug isitempus, lieka vis daugiau laisv nesusijungusi su aktinu miozino globul. Jgos dyd lemia aktino ir miozino globulini kontaktini ryi kiekis. Labai svarbi raumens darbo charakteristika yra jo sukuriama galia N. Tai dydis, vertinantis svorio P klimo greit V. i raumens galios charakteristika, pavadinta Hilio vardu, yra matematin hiperbol arba Hilio funkcija. Ji rodo, kaip raumens susitraukimo greitis V maja didinant raumens apkrov P (6.33 pav.). i paprasta hiperbol sukurt raumens galingum vaizduojanti priklausomyb apibdinama trimis koeficientais a, b ir c. Jie gali bti perskaiiuoti didiausiojo greiio Vmax ir didiausio svorio Pmax reikmes. V Vmax Panaiai kaip ir izotoninio susitrau(V + a) ( P + b) = c, kimo atveju, raumens pasiekiamai c Vmax = a. galiai N, esant greiio V ir svorio P b sandaugai, grafike galia yra atitinc Pmax = b kamo brto staiakampio P V a plotas. Matoma, kad raumeniui bdinga didiausia pasiekiama galia, V P = N kai raumuo kels svor ~0,5 P max P dydio. 0 Pmax = F Auksotoninis raumens susitraukimas yra sudtinis susitraukimas. 6.33 pav. Raumens susitraukimo greiio Hilio priklauio susitraukimo metu pasireikia somybs grafinis vaizdas
323
6. Organizmas organizuota sistema

abiej susitraukimo reim savybs, nes kinta ir keliamas svoris, ir raumens ilgis. ios ribini raumens bsen charakteristikos padeda atlikti tam tikrus kokybinius ir kiekybinius vertinimus. Raumen valdymas. Akivaizdu, kad raumens darb valdo neuron struktros, esanios stuburini gyvn stuburo ir galvos smegenyse. Tai gana sudtinga valdymo sistema, kurios funkcionavim lemia dvi lygiagreiai funkcionuojanios grtamojo ryio informacinio valdymo struktros ir (6.34 pav.). Aikinama, kad struktra pagal atjusi informacij i auktesni valdymo struktr greitai bet netiksliai suteikia mechaninei sistemai reikiam padt-bsen, o antroji valdymo struktra atlieka tiksl sureguliavim. Aiku, auktesniosios nervins valdymo struktros atsiunia informacij apie organizmui reikiam to raumens bkl, nurodo valdymo tiksl, o ios vietinio valdymo struktros privalo kuo greiiau ir tiksliau suteikti sanariui reikiam padt. Grtamj informacij, reikaling vietiniam raumens veiklos valdymui, apie raumens susitraukimo metu sukeliam jg, stuburo smegen priekinius ragus siunia sausgyslse esantys receptoriai Goldio lstels (kneliai). Grtamj informacij apie raumens ilgio kitimus teikia tam tikros, raumenyse esanios jutiklins verpsts. Jos, kaip ir Goldio lstels, nervinius impulsus siunia stuburo smegen priekinius ragus. Ten vyksta pagrindinis informacijos perdirbimas, reikalingas raumeniui valdy-

Upakaliniai ragai

Priekiniai ragai

Gr tamoji informacija apie raumens ilg ir tempimo j g

Stuburo smegenys

Informacija i motoneuron

Goldi l stel

Informacija i motoneuron

S narys Intrafuzin skaidula Ekstrafuzin skaidula Sausgysl

6.34 pav. Raumens valdymo schema su snariu ir stuburo smegenimis

324
BIOFIZIKA

ti, jo tempti ar atpalaiduoti, pastatyti reikiam padt. Ten yra ir motoneuronai, kurie valdo ir reguliuoja raumens susitraukim. Tokiu bdu visa tai sudaro vis udaro kodavimo ir dekodavimo grandin, btin geram valdymui. Joje valdomasis objektas yra griaui raumenys, receptoriai koderiai yra Goldio kneliai ir verpsts, stuburo smegen priekini rag nervins struktros vykdo informacines procedras, paruoia veiklos program funkcikai prasmingai raumens veiklai ir reikiamu momentu suadina neuronus dekoderius, ir motoneuronus atlikti veiksm. Griaui padties (pozos) valdymas yra dar sudtingesnis. Kad vienas sanarys lankstytsi, reikalinga prieingai sveikaujani raumen poros sulenkiamojo ir atlenkiamojo raumen (6.35 pav.). Atlenkiamj ir sulenkiamj raumen darniai veiklai garantuoti reikalingos sruktros, kurios valdymo metu vienus neuronus ir atitinkamus raumenis jaudint, o kitus proporcingai slopint, ar maint j sujaudinimo stiprum. Tam stuburo smegen priekini rag neuron tinkle yra tarpiniai neuronai (interneuronai), kurie atlieka tam tikrus informacinius perskaiiavimus, reikalingus sulenkiamojo ir atlenkiamojo raumen motoneuron darniam darbui reguliuoti.

atlenkiamj raumen

Raumenin verpst

sulenkiamj raumen

Interneuronai

Susitraukimas

Atsipalaidavimas

6.35 pav. Snario lankstymo valdymo sistemos funkcin schema

325
6. Organizmas organizuota sistema

Tik darni porini, svertikai nervinio valdymo struktr veikla gali lemti bendr griaui funkcionavim, specialias padtis (pozas), ingsniavim, uoliavim ir kit judjimo bei ramybs bsen palaikym. Kaip gyvieji organizmai visa tai atlieka valdo konkreiai dar daug neaiku. Ypa stinga kiekybini tyrimo duomen, kurie padt patikslinti mechanini griaui ir analogik gyvn biomechanini sistem valdymo princip aikinim.

* * *
Organizm darnios organizuotos veiklos teorinis supratimas dar tik kuriamas. iuo met pagrindinis tyrintoj dmesys kol kas siejamas su tam tikr sudtini dali, organ mechanizm aikinimu. J darnios veiklos valdymo klausimai yra ypa svarbs iandien. Laukiama kiekybini tam tikr sudedamj dali mechanizm kiekybini charakteristik. Turint kiekybines pavieni dali charakteristikas bt sukurta visavert biomechanikos teorija, kompiuteriniai modeliavimo metodai tai garantuot visik organizmo veiklos supratim.

326
BIOFIZIKA

POPULIACIJ BIOFIZIKA

mons emje dauginasi geometrine progresija, o maisto itekliai didja aritmetine. TOMAS R. MALTUS, Essay on the Principle of Population, as it effects the Future Improvement of Society London, 1798

Gyvj organizm savyb daugintis gaminti save panaius nulm populiacij atsiradim, j plitim erdvje, atsirado sveikos tarp populiacij. i savyb taip pat dar didel tak biosferos kaitai. Anglikon banyios pastorius R. T. Maltusas (R. T. Malthus) dar XVIII amiaus pabaigoje pradjo kiekybiniais matematikos, net diferencialini lygi metodais nagrinti gyvybs dauginimosi vyksmus. Jis ved populiacijos (angl. population) svok. R. T. Maltus pradjo populiacijos dauginimosi kiekybin vertinim ir atliko pirmuosius teorinius populiacij dinamikos tyrimus. iandien ie metodai inomi kaip kiekybin, matematin ekologija ar ekologin biofzika. Tiesa, nenatral, gana dirbtin pirmj matematikai formuluot triui populiacijos augimo dsn dar 1202 m. yra pateiks Leonardas Pizietis, pravardiuojamas Fibonaiu (gero bdo snus). Jo pateiktas dsningumas ir metodas, nustatyti populiacijos dyd, prajus tam tikram laikui, po keli ar daugiau kart, ir iuo metu yra taikomas matematik. Tai plaiai programuotoj inoma Fibonaio skaii eil. Vliau astronomas Kepleris metod algoritmizavo kaip rekursyvij funkcij, nulmusi kompiuterini skaiiavim sukrim. Dabar yra sukurta daugyb vairiausi kiekybini metod populiacij kintamumui (dinamikai) ir j sveikoms apibdinti: Lotkos ir Volteros, Gauzs dsniai ir panas. Populiacij kaitos ir j sveik dinamika tai ta biologijos sritis, kuri geriausiai pritaik fizikinio mstymo matematinius metodus svarbioms gyvybs savybms ir ds328
BIOFIZIKA

ningumams aikinti. ie metodai lm glaust ir tiksli biologini populiacij raidos aikinim matematinio kodavimo forma. Atsirado galimyb kurti kiekybinius ekologini sistem tyrimo metodus ir emje vykstani biosferos globalikesni vyksm raidos kiekybinius modelius, kurie lemia tikslesn ateities padarini numatym. Populiacij dinamikos matematiniai modeliai, ypa j modeliavimas kompiuteriniais metodais, padeda gana tiksliai modeliuoti emje vykstani gyvosios gamtos evoliucijos vyksmus. Taip galima patikslinti ms mokslin painim apie biosferos praeit, raid ir numatyti raidos ateities galimybes.

7.1. POPULIACIJA IR JOS DIDJIMO DSNIAI

Populiacija vadinama vienos ries lsteli ar organizm visuma, gyvenanti tam tikroje apibrtoje ekologinje erdvje (nioje) ir genetikai sudaranti bendr tarpusavy sveikaujani element sistem. Natralios ekologins sistemos populiacija niekada nebna atskirta nuo kit populiacij, ji visada gyvena tarp kit ir su jomis sveikauja. Atskiros nuo kit izoliuotos populiacijos sukuriamos dirbtinai mokslinse laboratorijose arba naudojamos kaip tariamosios (tarsi) izoliuotos, kaip teoriniai izoliuoti modeliai. Izoliuotos populiacijos dinamika, j matematiniai dydi kaitos modeliai padeda suvokti sudtingesni populiacini sveik dsningumus. Teorikai taikomi keli populiacijos dydio kaitos bgant laikui (dinamikos) dsniai. Daniausiai tai bna didjimo dsniai. I tikrj populiacijos ne tik didja. Jos taip pat ir nyksta, maja. Taiau savita gyvybs savyb didti ir keistis lemia tai, kad pagrindinis dmesys skiriamas dauginimuisi ir didjimui. Majimo dinamikos danai nepaisoma suprantama, kad tai stanios ar negyvos sistemos savyb. Pagrindiniai populiacijos kiekybiniai parametrai yra individ skaiius, j biomas, individ skaiius visoje populiacijoje arba trio bei ploto vienete ir j kitimas laiko poiriu. Daniausiai ie populiacijos didjimo vyksmai ireikiami matematine funkcija N(t). Ji kinta ir priklauso nuo gimstamumo ir mirtamumo. Jeigu nagrinjamas populiacijos paplitimas erdvje, tai jos dydis ireikiamas kaip keli kintamj (laiko ir erdvs koordinai) funkcija N(t, x, y, z). Yra du pagrindiniai ir treias papildomas izoliuotos populiacijos didjimo dsniai, nusakantys populiacijos dydio arba tankio N(t ) kitimo pobd: eksponentinis, arba Maltuso, logistinis, arba Ferchiulsto ir Perlo bei Hatinsono populiacijos didjimo dsnis, vertinantis biologini vyksm vlavim. iuo metu svarbs skaitmeniniai populiacij dinamikos modeliai. J nagrinjimas pagrstas kompiuterinio modeliavimo metodais. Taikant iuos metodus irykja ne viena savita gyvj populiacij daugjimo dinamin savyb, kurios aikiai nema329
7. Populiacij biofizika

tomos nagrinjant klasikins matematikos priemonmis. Be to, klasikine matematika sunku nagrinti vyksmus, kurie ireikiami netiesinmis diferencialinmis lygtimis, o kompiuteriais skaitmeninmis netiesinmis lygtimis ar j sistemomis ireikti modeliai daugeliu atvej nagrinjami be dideli sunkum. Kompiuteriniai populiacij dinamikos tyrimo metodai parod chaoso atsiradimo galimybes ir slygas. 7.1.1. Eksponentinis, arba Maltuso populiacijos didjimo, dsnis Dar prie 200 met R. T. Maltus populiacijos daugjim apibdino ne tik odinio formulavimo (kodavimo) bdu, bet ir ireik matematikai kodavimu algebrinmis ir diferencialinmis lygtimis. odiais buvo pasakyta taip:
Populiacijos daugjimo greitis proporcingas populiacijos dydiui.

Matematikos kalba tai uraoma:


N ~N, t

arba

dN(t) ~ N. dt

Proporcingumo koeficientu populiacij daugjimo proporcingumo lygtys paveriamos algebrine pokyi arba diferencialine lygtimis:
N = N , t

arba

dN(t) = N . dt

Dauginimosi, arba populiacijos didjimo, koficientas rodo naujai atsiradusi individ skaii N per laiko interval t, arba santykin dyd individ skaiiaus pokyt (gimim ar mirim) per laiko vienet, tenkant vienam individui [N/t]/N. Taip pat laikoma, kad is dsningumas bdingas ir labai maiems dydiams. Todl i populiacijos savyb galima ireikti diferencialine lygtimi. Vertinant ne tik gimstamum koeficientu , bet ir mirtamum koeficientu , laikant, kad mirtamumas taip pat proporcingas populiacijos dydiui tik prieingo enklo, gaunamos lygtys:
N t = N N = ( ) N, arba dN ( t ) = N N = ( ) N. dt

Isprendus diferencialin lygt, gaunama algebrin eksponentin lygtis (7.1 pav.): N(t) = No exp{ ( ) t }. Taip Maltus populiacijos didjimo dsn ireik pirmosios eils tiesine homogenine diferencialine lygtimi ir dviej koeficient skirtumu (). I tikrj tai tik vienas nekintamas koeficientas, nes () vertintinas kaip vienas koeficientas, turintis
330
BIOFIZIKA

dN(t)/dt (>) (=) 0 N

(>)

N0 (<)

( = ) (<)

7.1 pav. Eksponentinio, arba Maltuso, populiacijos didjimo grafikai

gimstamumo ir mirtamumo koeficient skirtumo prasm. Jeigu gimstamumas didesnis u mirtamum ( > ), tai populiacija didja, o jeigu maesnis ( < ) populiacija maja, nyksta. Visa tai labai vaizdiai matoma ios diferencialins lygties sprendinio grafiniuose vaizduose 7.1 paveiksle. Pirmasis grafikas vaizduoja diferencialins lygties uraym, antrasis jos sprendin. ia No yra pradinis populiacijos skaiius, t. y. populiacijos skaiius pradiniu stebjimo momentu, kai t = 0. Matematikai jis gaunamas kaip integravimo pastovioji integruojant diferencialin lygt. Jei gimstamumas lygus mirtamumui ( = ), populiacijos dydis nekinta, vis laik N(t) = No = const. Jei gimstamumas didesnis u mirtamum ( > ), populiacijos dydis eksponentikai didja begalybs link. Ir didja juo greiiau, juo didesnis skirtumas ( ). Jei gimstamumas maesnis u mirtamum ( < ), populiacijos dydis eksponentikai maja artdamas prie nulio, ir nyksta juo greiiau, juo didesnis skirtumas ( ). Gana danai biologai ir ekologai Malthus populiacijos augimo dsn vadina ne eksponentiniu, bet logaritminiu. Tai susij su tyrj mgstama rezultat pateikimo logaritmins skals forma. N dyd grafiko ordinatje pateikus logaritmine skale, eksponent virsta tiese, kurios krypties koeficientas bus proporcingas ( ) dydiui. Populiarioje literatroje, ypa susiejant biologinius dsningumus su socialiniais, remiantis Maltusu teigiama, kad itekli emje daugja aritmetine progresija, o mons dauginasi geometrine progresija. Todl visada stigs itekli. Taip daromos atitinkamos socialins ivados. Aiku, grafikai itekli daugjimas tiesinje skalje pavaizduojamas kylania tiese, o populiacijos dauginimasis rodikline kylanija funkcija. I pradi, esant maai populiacijai btinj itekli yra daugiau u reikalingus populiacijai vystytis. Itekli daugjimo ties vaizduojama aukiau populiacijos. Taiau visada besirieianti auktyn populiacijos dauginimosi kreiv susikirs su itekli tiese. Aiku, tai nulems tolesn populiacijos daugjimo pobd. Pats paprasiausias mikrobiologins populiacijos daugjimas geometrine progresija vaizduotinas mikroorganizm dauginimosi schema (7.2 pav.). Viena bakterija,
331
7. Populiacij biofizika

T 20 21

T 22

T 23 2
(t/T) (t/Q)

7.2 pav. Mikrobiologins populiacijos dauginimosi geometrine progresija schema

kuri po kartos dalijimosi laikotarpio T dvigubja, ir vliau po to paties T laikotarpio ir naujai atsiradusios vl dvigubja ir t. t., tai po Q kart, arba t laiko populiacijoje bus N(t) bakterij:

N(t) = 2Q = 2(t/T).
Jeigu i pradi bus ne viena bakterija, bet No, tai: N(t) = N0 2Q = N0 2(t/T).

Naudojantis iuo paprastu populiacijos dauginimosi vyksmu galima apskaiiuoti ir vertinti biologin sprogstamj geometrine progresija reikin. Tarkime, T = 20 min. Vadinasi, per vien par i vienos bakterijos atsirast 2721021 bakterij. Po met j bt tiek, kad i bakterij kultra metr storio sluoksniu padengt vis ems rutul. Nesunku suprasti, kad populiacijos didjimo dsnis geometrine progresija, atsivelgiant Maltus, galioja tik tokiuo atveju, jeigu populiacija viena ir yra itekli perteklius. Reali populiacija gamtoje niekada nebna pavien ir negali didti iki begalybs. Jos dyd visada riboja itekliai. Todl net paviens populiacijos dauginimasis dl baigtini itekli turi rib, negali viryti tam tikro didiausio skaiiaus. Todl daniausiai yra vartojamas tikslesnis logistinis dsnis. 7.1.2. Logistinis populiacijos dauginimosi dsnis Itekli ribotumas reikalauja tikslesnio populiacijos didjimo dsnio. Devynioliktojo amiaus pabaigoje belg matematiko A. Ketls (A. Quetelet) silymu logistin populiacijos daugjimo dsnio matematin model pateik jo mokinys P. F. Ferchiulstas
332
BIOFIZIKA

(P. F. Verchulst). Dvideimtajame amiuje savarankikai tok pat populiacijos daugjimo matematin model, pateik ir amerikietis R. Prlas (R. Pearl). iek tiek pakeitus Maltuso dsnio matematin model, buvo sukurtas logistinis dsnis. Jis labai patobulino eksponentin populiacij didjimo dsn, kuris dabar yra pagrindinis populiacij dauginimosi dsnis. Tarkime, Maltuso populiacijos gimstamumas proporcingas populiacijos dydiui, t. y. koeficientas nekinta, o mirtamumo koeficientas didja proporcingai populiacijos dydiui = N. Gauname paprasiausi logistinio populiacijos didjimo dsnio diferencialin lygt:
dN ( t ) = N ( N ) N, dt

arba

dN ( t ) = N N 2. dt

Tai netiesin pirmosios eils Bernulio diferencialin lygtis, kuri yra isprendiama. Pakeitus kintamj N U = 1/N, netiesin diferencialin lygtis pavirsta pirmosios eils tiesine nehomogenine diferencialine lytimi. ios lygties sprendinio atvirktin lygtis ir yra logistins diferencialins populiacijos dauginimosi lygties sprendinys. Algebrin sprendinio lygtis:
N (t ) = 1 + [( N max / N 0 ) 1] exp{ t}
0

N max

kur Nmax = / yra didiausias galimas populiacijos dydis, o No stebjimo pradioje buvs populiacijos dydis. Nmax yra viena i svarbiausi populiacijos rodikli, vadinama populiacijos talpa toje ekologinje nioje, arba tos populiacijos aplinkos talpa. Svarbu pastebti, kad Nmax dyd rodo gimstamumo ir mirtamumo koeficient santykis. Tiesa, ia mirtamumo koeficientas turi kitoki prasm ir matmen negu Maltuso dsnio . Taiau tai yra dydis, kur galima pamatuoti bandymo bdu. Grafinis logistinio populiacijos dauginimosi dsnio vaizdas, sigmoidin arba logistin kreiv rodo (7.3 pav.), kad jei teigiamas ( > 0), tai populiacija didja artdama prie Nmax. Didiausias dauginimosi greitis pasiekiamas persilenkimo (vingio) take tv. Tada populiacijos dydis bna lygus pusei didiausio Nv = (1/2) Nmax. Atitinkamai, jei neigiamas ( < 0), populiacija maja (nyksta) sigmoidine kreive ir artja prie nulio. Vingio tako tv reikms nustatomos i lygties: tv = (1/) ln[Nmax/(Nmax No)], ir Nv = (1/2) Nmax. Labai danai ekologinje literatroje logistinio populiacijos didjimo diferencialin iraika pateikiama truput kitokia forma:

dN (t ) = N [(Nmax N )/Nmax], dt
333
7. Populiacij biofizika

N(t) Nmax = / >0

Nmax/2 =0

N0

<0 0 N N0 tv = 1 / ln max N0

7.3 pav. Logistinio populiacijos didjimo dsnio grafinis vaizdas

ir iose lygtyse koeficientas vadinamas vairiai: reprodukcijos ar net biologiniu potencialu, dauginimosi greiiu, potencine dauginimosi galia. O Nmax , kaip rayta, vadinama aplinkos talpa, daug kur ymima raide K = Nmax . Praktikai koeficientas nustatomas formule = N/(t N), keletu populiacijos dydi matavimais per maus reikmingus laiko tarpus t. Esant eksponentinio daugjimo ar majimo fazei, kai itekli kiekis yra perteklinis ir aplinkos prieinimasis beveik nulinis, = (lnN lnN0) /t. Toks suprastinimas palengvina matavim vertinimus. Pavyzdiui: 1. Mikroorganizm populiacija, kurios dydis kas 2 dienas padidja 10 kart, = 1,15 per par. 2. Aruodinio straubliuko (Calandra) = 39,6 per metus, populiacija padvigubja kas 1 savait. 3. Dirvins pels = 4,5 per metus populiacija padvigubja kas 8 savaites. 4. mogaus = 0,02 per metus populiacija dvigubja kas 35 metai. Bendresnio poirio logistiniam populiacijos dauginimosi pobdiui bdingas ribinis populiacijos dydis Nmax. J lemia du prieingai sveikaujantys vyksmai: gimstamumo ir mirtamumo greii skirtumo kaita kintant populiacijos dydiui (7.4 pav.). Didjant populiacijai, i pradi populiacija yra maa, tad gimstamumas bna rykiai didesnis u mirtamum. Tai nulemia greit populiacijos didjim. Populiacijos tankiui padidjus pasidaro ankta, pradeda stigti itekli.
334
BIOFIZIKA

dN/dt

a(N) [a(N) g(N)]max 0


Nv

N Nmax= K

(N)

7.4 pav. Apibendrinto logistinio dsnio sampratos aikinimo grafikas

Pasireikia vidurinis nuodijimasis. Jis nulemia mirtamumo didjim ir gimstamumo majim. Pasiekus tam tikr i prieingai veikiani vyksm greii dyd, abiem vyksmams susilyginus, populiacijos daugjimas sustoja. Populiacijos dydis pasiekia ribin aplinkos talpos lyg Nmax. Tokiu bdu logistinio populiacijos daugjimo dsnio formul gali bti bendresn:
dN (t ) = (N) (N), dt

kur netiesins gimstamumo (N) ir mirtamumo (N) koeficient funkcijos patenkint tam tikras slygas: pradinje populiacijos didjimo fazje turi bti (N) > (N), o pasiekus tam tikr dyd Nmax ios funkcijos turi persikirsti, ir toliau turi bti tenkinama nelygyb (N) < (N). Didiausias gimstamumo ir mirtamumo skirtumas [(N) (N)]max nurodo logistinio populiacijos didjimo persilenkimo tako padt to momento populiacijos dyd Nv ir laik tv . Sudting populiacijos didjimo vyksm atvejais net kelis kartus gali susilyginti gimstamumas (N) ir mirtamumas (N) kreivs gali persikirsti net kelis kartus. Vieni i j, kuri mirtamumas virija gimstamum, lemia pastovius populiacijos dydius. Kiti kuri gimstamumas virija mirtamum lemia nepastov populiacijos dydio virsm, lemia populiacijos dydio kait arba didesniojo, arba maesniojo pastovaus populiacijos dydio link. Taip atsiranda chaosas. Konkrei atvej pavyzdiai apie tam tikr populiacij dydio kait pateikti 7.15 pav. ir 7.19 pav.

335
7. Populiacij biofizika

7.1.3. Logistinis populiacijos dauginimosi dsnis vlinimo atveju. Hatinsono modelis Biologini populiacij dauginimuisi danai bdingi periodiki staigs padidjimai ir sumajimai plipsniai. Juos lemia svarbs biologiniai ar klimato veiksniai. Tai dsningi ir darns veiksniai, kuriuos lemia populiacijos individ amius, dauginimosi slygos ir kitos gyvenimo slygos. Pavyzdiui, ikr, kiauini, spor, skl sklaida, kai kitos kartos gali atsirasti tik po tam tikro laiko. iais atvejais populiacijas apraant matematikos metodais, taikomas logistinis dsnis, kuriam bdingas vlinimas. Jis uraomas netiesine G. E. Hatinsono (G. E. Hutchinson) diferencialine lygtimi :
N (t h) dN (t ) = 1 N (t ) . dt N max

ia yra klasikinis dauginimosi, arba Maltuso koeficientas, o h populiacijos gyvenimo amius. i matematin lygtis yra savita netiesin diferencialin lygtis. Ji sprendiama tam tikrais, daniausiai kompiuterijos metodais. Nustatyta, kad esant atitinkamiems koeficient dydiams populiacija gali pereiti periodini savaimini (auto-) svyravim bsen. ios bsenos metu populiacijos dydis arba tankis kinta periodikai plipsniais, tai virija tam tikr Nvid ir vl maja, ar sumaja maiau u lyg ir vl, po tam tikro laiko, didja iki Nmax . Tokie vyksmai bdingi daugialsi gyvn kraujo lsteli ir hormon sintezei. Hatinsono modeliai taikomi ir tam tikroms dinaminms sveikoms, konkurencijos, plrno ir aukos sveikoms aikinti. Tai yra sveikoms, kurioms svarbi populiacijos amiaus ir palikuoni atsiradimo bdo taka. i modelin sistema netiesikumu rykiai skiriasi nuo prast tradicini netiesikum, pavyzdiui, Lotkos ir Volteros. Taiau remiantis matematinio modeliavimo ivadomis, bendrieji populiacij dsningumai ilieka tie patys. Populiacij dauginimosi dsningumai ypa jautrs mirtamumo koeficiento kaitai. Praktikai mirtamumo koeficientas priklauso nuo daugelio veiksni, ir ypa nuo santykinio populiacijos amiaus. 7.1.4. Populiacijos amiaus svarba Populiacijos mirtamumas labai priklauso nuo jos individ amiaus struktros. Sulaukusi tam tikro amiaus individ skaiius ireikiamas kaip pradinio individ skaiiaus dalis, santykinis individ kiekis. Paymjus ilikusi tam tikro amiaus individ
336
BIOFIZIKA

santykin kiek (L = Nx/No), (pvz., po Ilikusi gyv 5 met ilikus pusei pradins tos paorganizm dalis % ios kartos populiacijos L5 = 0,5) loga100% ritminiu masteliu, atsivelgiant sanDROZOFILA tykin populiacijos ami, nustatomos MOGUS dvejopo pobdio priklausomybs. Jos 10% apibdina populiacijos igyvenimum HIDRA ir rodo aikiai kintant, priklausant nuo amiaus mirtamumo koeficient. 1,0% Kreiv bna igaubta tik tada, kai inAUSTR dividai mirta natralia senatvs mir0,1% timi, pvz. normaliai prastai gyvenanSantykinis organizmo amius tis iuolaikinis mogus. Jeigu vis amiaus grupi mirtingumas vienodas, 7.5 pav. Tam tikro amiaus individ igyvenimo pusiau logaritminje kreivje tai atsi- kreivs spindi kaip ties, pvz. hidra. Jei mirtingumas didelis iki brandos amiaus, kreiv bna gaubta (austrs) (7.5 pav.). Tam tikr biologini populiacij igyvenimo kreivs turi savitas priklausomybes ir vaizduoja tikimybin gyvenimo trukm. Tokios priklausomybs vaizdiai rodo savitas populiacijos savybes, jos gyvybingum ir stabilum. Santykinis organizmo amius yra nustatomas perskaiiuojant vis ri ami dalimis arba procentais, laikant, kad ilgiausias amius lygus santykiniam dydui 1 ar 100 procent. 7.1.5. Diskretusis logistinis populiacijos dauginimasis Akivaizdu, kad gyvieji organizmai dauginasi tam tikrais laiko tarpsniais, periodikai. J dauginimuisi bdinga diskreioji, laikui bgant uolikai kintanti dinamika. Toks dauginimosi vyksmas turi tam tikrus regeneracijos periodus. Juos tikslinga nagrinti skaitmeniniais metodais, diskreiosiomis skaii eilutmis, kaip dar Fibonais, arba modeliuoti kompiuteriais. Kompiuteri skaiiavimo metod esm tokio funkcionavimo metodika. Pavyzdiui, Fibonaio triui populiacijos kiekio dinamika, t. y. kiekvieno kito populiacijos periodinio ingsnio t + 1 bsimasis populiacijos dydis Nt +1 ireikiamas skaii eilute, kuri sukuriama sudedant dviej prie tai buvusi populiacij dydi Nt ir Nt1 skaiius: Nt +1 = Nt + Nt1, ia t = 0, 1, 2, 3, ...
337
7. Populiacij biofizika

Taip pat nesunkiai diskreija forma gali bti ireikta ir paprasiausios mikroorganizm, lsteli populiacijos dauginimasis, atsivelgiant Maltuso dsn: Nt +1 = Nt 2, arba bendriau Nt +1 = Nt . ia bet kuris teigiamas nelygus nuliui skaiius (3.4 pav.). Daug domesns populiacijos dauginimosi savybs atskleidiamos skaitmeniniais metodais nagrinjant logistinio populiacijos dauginimosi dinamik. Pagrindin skaitmenin logistinio populiacijos dauginimosi lygtis: Nt +1 = Nt [1 Nt / Nmax]. Lygt normalizavus, t. y. pasirinkus, kad Nmax = / = 1, didiausij santykin populiacijos dyd, prilygint norminiam dydiui 1, arba 100%, logistinio populiacijos dauginimosi dsnio skaitmenin diferencialin lygtis suprastja: Nt+1 = Nt [1 Nt] = [Nt Nt2 ] . Lygtyje lieka vienas svarbus dauginimosi koeficientas . Tai antros eils parabolinis modelis, netiesins dinamins sistemos arba populiacijos dauginimosi skaitmenin lygtis. Ji gali bti vaizdiai nagrinjamas grafiniais metodais. Labai vaizdiai visa tai rodo kompiuterijos modelis. Keiiant koeficient ir Nt galima atskleisti daug gana domi logistins populiacijos savybi. Logistinis populiacijos dauginimasis skaitmeninje normalizuotoje erdvje (Nt max ir N(t+1)max lygu 1) grafikai parodytas 7.6 paveiksle. ia, didjant dauginimosi koeficientui , parabols kalno virn didja ir pasiekia vienet, kai = 4. Populiacijos dinamika labai priklauso nuo ios parabols susikirtimo su tiese Nt +1 = Nt tako vietos.

Nt +1

Nt

7.6 pav. Logistinio normalizuotos populiacijos dauginimosi skaitmeninis modeliavimas grafikai

338
BIOFIZIKA

Jeigu i ties su parabole nesusikerta, t. y. jei maiau kaip 1 ( < 1), tai populiacija maja ir inyksta arba lieka tokio paties dydio (kai = 1). Jeigu i ties susikerta, t. y. > 1, bet ne didesnis u 3 ( < 3), populiacija didja logistikai. iais atvejais populiacija dauginasi kaip ir tolydiojo modelio atvejais majantis ar didjantis logistinis populiacijos dauginimosi vyksmas. Rykai pasikeiia populiacijos dinamika, kai parabols susikirtimo su tiese takas pereina kit parabols kalno virn, jei > 3 (7.6 pav.). iuo atveju populiacijos dinamika priklauso ne tik nuo dauginimosi koeficiento , bet ir nuo pradinio populiacijos dydio Nt . Pasiekus = 3 rib irykja savaiminiai periodiniai svyravimai (autosvyravimai), o kai > 3 dvigubja autosvyravim danis, atsiranda antroji harmonika. Dar labiau didinat , prasideda chaoso reikiniai (7.7 pav.). Tai susij su netiesini dinamini sistem bsen akojimusi bifurkacijomis. Bifurkacijomis vadinami kokybiniai netiesini dinamini sistem vyksm pokyiai, kurie atsiranda keiiantis dinamins sistemos parametrams. Atsiranda vadinamieji bifurkacijos takai. Juos irykina dinamins sistemos tikrins (charakteringosios) lygties sprendiniai ar faziniai portretai. Yra inomos stabilaus ir nestabilaus mazgo, balno, autosvyravim ir kitos bifurkacijos. Logistinio populiacijos dauginimosi dinamikos bifurkaciniai takai nurodyti 7.8 pav. ia matomi bifurkaciniai takai, atsirandantys populiacijos dauginimosi koeficietui pasiekus 1 ir virijus 3. Prasideda stabils savaiminiai svyravimai, turintys 21, 22, 23, ... kartotini dani periodus. Ypatingas dmesys skirtinas bifurkacijoms ir netiesins dinamins sistemos savybms ne tik pagal esamj populiacijos dyd Nt , bet ir pagal ankstesnes vertes Nt1 , Nt2, ..., arba vertinant tolimesni bsen Nt+2 , Nt+3 , ... vyksmus. iuos atvejus galima ireikti matematikai iteracinmis procedromis, pradedant nuo pradins N0 populiacijos 7.7 pav. Logistinio normalizuotos populiacijos dauginimosi dsnio dinaminio chaoso grafinis aikinimas bsenos F(N0):
339
7. Populiacij biofizika

N 1 = F(N 0 ), N 2 = F[F(N 0 )] = F 2 (N 0 ), N 3 = F{F[F(N 0 )]} = F 3 (N 0 ), ........ , N i = F t (N 0 ). Tada logistinio populiacijos dauginimosi vyksmo atveju: Nt+1 = F(Nt ) = [ Nt (1 Nt )], Nt+2 = F 2 (Nt ) = [ Nt (1 Nt )] [Nt (1 Nt )], Nt+3 = F 3 (Nt ) = [ Nt (1 Nt )] [Nt (1 Nt )]] [Nt (1 Nt )], .............. i iteracini procedr grafinis vaizdas pateiktas 7.9 pav. Matyti, kaip dl i prieasi netiesikumas, tiesei susikertant su vis kreivjania, dinamik apibdinania funkcija, lemia bifurkacij takus. Juo didesnis , juo daugiau vertiname ingsni, juo daugiau bifurkacini tak, juo sudtingesnis dinaminis vyksmas, juo rykesnis chaosas. ie aptarti populiacij dauginimosi vyksmai, taikomi teorikai, gana dirbtinei vienai izoliuotai, gyvenaniai neapibrtoje ekologinje nioje populiacijai. Realios populiacijos nebna izoliuotos, jos sveikauja su daugybe kit populiacij ir plinta aplinkoje. J dauginimasis yra dar sudtingesnis vyksmas.

7.8 pav. Logistinio populiacijos didjimo bifurkacijos keiiantis koeficientui

7.9 pav. Logistinio normalizuotos populiacijos dauginimosi bifurkacij skaiiaus didjimo grafinis aikinimas

340
BIOFIZIKA

7.2. DIFUZINIAI POPULIACIJ PLITIMO MODELIAI

XX amiaus pirmos puss Maltuso eksponentinis bei Ferchiulsto ir Prlo logistinis populiacijos augimo dsniai buvo iplsti ne tik vienai apibrtai erdvs vietai. Buvo vertinta ir didjanio tankio populiacijos sklaida aplinkoje. iems vyksmams buvo pritaikytos difuzijos lygtys. Logistin dsn sklaidai modifikavo ymusis biometrijos krjas R. Fieris (1937), o Maltuso eksponentin Skelamas (J. G. Skellam) (1951). Skelamo modelis taikomas populiacijos tankio sklaidai aplinkoje jai dauginantis pagal Maltuso dsn, difuzikai plintant dvimatje x, y koordinai erdvje. is vyksmas matematikai apibdinamas bangine lygtimi:
N (t ) 2 N (t ) 2 N (t ) , . = ( ) N (t ) + D + 2 t x 2 y

kur D yra klasikinis difuzijos koeficientas, susijs su populiacijos sklaidos greiiu. ios lygties sprendinys:
N (t , r ) = N0 r2 , exp t 4 D t 4 D t

N(r, t)

Y t1 t2 t3 t4 0 0 r X

r = x2 + y2

N(r, t)

t5 t4 t2 0

t7

t1 10

r = x2 + y2

7.10 pav. Populiacijos tankio didjimo ir difuzins sklaidos aplinkoje, Skelamo matematinio modelio aikinimas

341
7. Populiacij biofizika

1350.06

1347.12

7.11 pav. Maro epidemijos plitimas vidurami Europoje. Prasidjusi Pranczijos pietuose 1347 m., atsklido Lietuv per 3 metus

grafikai pavaizduotas 7.10 pav. ia r 2 = x 2 + y 2 atspindi sklaid simetrikai visomis kryptimis vienalytje (homogeninje) aplinkoje, atsivelgiant nutol nuo nagrinjamos populiacijos idinio vietos. Panaiai sklinda bakterijos, plintant epidemijai. Pavyzdiui, XIV amiuje Pranczijos pietuose, prie Viduremio jros krant, Nicoje kilusi maro epidemija per tris metus pasiek Airij, kotij, Norvegij, vedij ir Lietuv (7.11 pav.). Fierio modelis. Analogikai pritaikius populiacijos tankio difuzin plitim homogeninje dvimatje erdvje logistiniu dsniu besidauginaniai populiacijai, gaunama matematin bangin lygtis:
2 N (t ) 2 N (t ) N (t ) = [ N (t )] N (t ) + D x 2 + 2 y ., t

kurios sprendimas, jai esant netiesinei, yra sudtingesnis. Kad bt paprasiau nagrinti, vartojami bedimenciai santykiniai vienetai:
M (t ) = N (t ) , N max X = x, D Y= y, D

T = t,

kur Nmax = / , o M(t) reikia bedimenc populiacijos tank. Tada i lygtis virsta paprastesne bedimence Fierio lygtimi:
342
BIOFIZIKA

M 2M 2M , = (1 M ) M + + T X 2 Y 2

kurios pradinis santykinis populiacijos dydis arba tankis M0 = N0/Nmax . ios lygties sprendinio grafiniam vaizdui suprasti padeda bedimencs Fierio lygties:
M 2M 2M =M+ + T X 2 Y 2

sprendinio vaizdas, pateiktas 7.12 pav. Tokia lygties iraika gaunama, kai D = = 1. Todl sprendiniai yra ne eksponentinio Skelamo pobdio, bet logistinio, prasidedanio ne nuo begalinio populiacijos tankio, bet nuo baigtinio dydio, kur nusako aplinkos populiacin nios talpa. Svarbi io banginio vyksmo savyb yra populiacijos tankio bangos sklidimo greitis
v = D . Bangos sklidim N(r, t) galima suprasti nagrinjant Fierio diferencialin

N(r, t) t1 t2 t3 t4 0

r X

r=
0 N(r, t) Nmax

x2 + y2

t10 t7 t5 t4 t2 0

r = x2 + y 2
7.12 pav. Fierio populiacij didjimo ir difuzins sklaidos aplinkoje matematinio modelio sprendini grafinis vaizdas

343
7. Populiacij biofizika

lygt, atlikus klasikinius bangins lygties pakeitimus, pritaikius nauj kintamj z, kur:

N (r , t ) = U ( z ), z = r v t ,
ia v bangos sklidimo greitis. Gaunama antrosios eils netiesin diferencialin lygtis:

i kurios matyti logistinis kitimo pobdis, kai populiacijos tankio bangos frontas, jo dydis kinta nuo Umax iki nulio: U( ) = /, U(+ ) = 0. kur r = x 2 + y 2 . Tokio pobdio biologiniai vyksmai bdingi ne tik epidemij, jau aptartam maro bakterij plitimui (7.11 pav.), bet ir induoli, pavyzdiui ondatr (Ondatra zibethica) pltros dinamikai centrinje Europoje 19091927 metais (7.13 pav.). Populiacij tankio bangos sklidimas yra daug kuo panaus fizikini ir fizikochemini vyksm difuzin skaid. Todl difuziniai matematiniai modeliai gana gerai atspindi tikruosius biologini ri sklaidos vyksmus. Tai iek tiek padeda numatyti galimus pageidaujamus, ir ypa nepageidaujamus gyvybes ri tankio kitimus. Aiku, ie vyksmai natraliai atsiranda ir plinta daugelio ri sveikose. Todl btina suprasti populiacij sveik dsningumus.

Vroclavas
Teritorija

Miunchenas

Viena

7.13 pav. Ondatr populiacijos plitimas, prasidjs ekijoje 1905 m.

344
BIOFIZIKA

7.3. POPULIACIJ SVEIK DSNINGUMAI

Realios biologins populiacijos nebna paviens, atskirtos nuo kit populiacij. Populiacija visada gyvena kartu su kitomis ir sudaro bioekologines sistemas. Tarp populiacij atsiranda vairiausi vis laik kintantys santykiai. Biologija iskiria iuos tris visikai skirtingus populiacij sambvius: konkurencij, kooperacij (mutualizm) bei plrnas ir auka. Taip pat yra tarpini sambvi parazitizas, amensalizmas, komensalizmas ir protokooperacija. Tam tikru bendresniu raidos tendencij poiriu sveikaujanias populiacijas galima bt skirstyti dvi dideles grupes konkurencines ir simbiozines. Konkurencinms bdinga smulkjimo, specializacijos ir paprastinimo tendencijos, o simbiozinms prieingos didjimo, jungimosi didesnius vienetus ir vairjimo. iuo atveju simbiozins jungia dvi gana skirtingas sveikas kooperacij ir plrum. Pavyzdiui, simbioz mutualizmas, bei simbioz plrnas ir auka. Plrnui ir aukai bdinga funkcionuoti kartu. Jos negali egzistuoti vienas be kito, bet jos susijungia viena su kitu visikai kitokiais principais. Teorikai geriausiai yra ityrintos konkurencija ir plrnas ir auka sistemos. Daug maiau mutualizmas ir protokooperacija. Maesnis dmesys skiriamas tarpiniams sambviams. Visus iuos populiacij sambvius geriausia suprasti matematiniais ir kompiuteriniais metodais nagrinjant dviej sveikaujani populiacij modelius. Paprasiausios dviej vyksm, kaip ir populiacij, tiesins sveikos Puankar modeliai inagrinti treiajame, biologini vyksm kinetikos skyriuje. Biologijos ir ekologijos poiriu svarbesns netiesins sveikos. Tikslingiau yra nagrinti Volteros modelio variacijas, kuri populiacij dauginimasis ireikiamas logistiniu dsniu. ia, kaip ir kinetikos modeli, itekli A ir B srautai perstumia fazinio portreto koordinai pradi nauj koordinai centro viet N01, N02. Matematikos poiriu dinamins sistemos koordinai centro padtis nra svarbi sveik kokybei, nes kokybines populiacij dinamines savybes lemia populiacij sveik pobdiai. Sveik parametrai lemia dinamines sistem bsenas. Tarkime, N1(t) ir N2(t) yra dvi sveikaujanios populiacijos, gyvenanios toje paioje ekologinje nioje (7.14 pav.). Dviej sudtingiau sveikaujani populiacij dinamins sistemos vyksmus apibdina dviej diferencialini lygi matematinis modelis, kur lemia ei koeficientai:
dN 1 (t ) 2 dt = 1 N 1 (t ) + 1 N 1 (t ) + 1 N 1 (t ) N 2 (t ) dN 2 (t ) = N (t ) + N 2 (t ) + N (t ) N (t ), 2 2 2 2 2 1 2 dt

345
7. Populiacij biofizika

1, 2 dauginimosi potencialai ar saviveikos koeficientai; 1, 2 tarpusavio sveikos koeficientai; 1, 2 vidurinio kenkimo, nuodijimosi koeficientai.
Koeficientai 1 ir 2 bei j enklai rodo populiacij didjim ar majim, o 1, 2 populiacijoms daniausiai bna neigiamojo enklo ir lemia didiausias populiacij reikmes ar tankius. Tokiose sveikaujaniose sistemose naujai atsirandanioms kokybinms bsenoms didels reikms turi tarpusavio sveikos koeficient 1 ir 2 dydiai ir enklai. i koeficient enklai lemia sistemos vyksm pobd. Jeigu saviveikos koeficientai yra silpni, populiacijos beveik nesveikauja. Didiausi populiacij tankiai atsiranda ir plinta pagal logistin dsn, ir priklauso nuo pasisavinam i-

1 A

<N1>
1 2

N1(t)

<N2>
2

N2(t)

7.14 pav. Dviej sveikaujani populiacij sistema

s k a i i u s

I n d i v i d

a) Laikas, dienos

b) Metai

7.15 pav. Populiacij didjimas esant skirtingiems maisto itekliams ir slygoms

346
BIOFIZIKA

tekli (7.15 pav.). Jei dvi vabal populiacijos konkuruodamos gauna nevienodus itekli kiekius, j tankiai diddami logistikai bna skirtingi (7.15 pav., a). Avi populiacija Tasmanijoje daugja pagal majamai svyruojani logistin kreiv, kuri artja prie ekologins erdvs (nios) talpos (7.15 pav, b). Skirtingi koeficient enkl rinkiniai lemia tam tikras populiacij sambvio ir dauginimosi savybes: konkurencijos, kooperacijos ir plros.

7.4. POPULIACIJ KONKURENCIJA

Populiacijos konkuruoja, jeigu jos gyvena, dauginasi toje paioje nioje ir minta tais paiais baigtiniais itekliais. Dviej populiacij konkurencinis sambvis schemikai pavaizduotas 7.16 pav. Juo didesnis itekli stygius, juo rykesn konkurencija. Jeigu maisto itekliai begaliniai, konkurencija neatsiranda. Klasikinis konkurencijos matematinis modelis ireikiamas logistine diferencialini lygi sistema, kurioje pagrindinis mirtamumo veiksnys nios itekli eikvojimas (maisto suvalgymas), vertinamas funkcija F(N1, N2):
dN1 (t ) = [ 1 1 F ( N 1 , N 2 )] N 1 (t ), dt dN 2 (t ) = [ 2 2 F ( N 1 , N 2 )] N 2 (t ), dt

F ( N 1 , N 2 ) = 1 N 1 + 2 N 2 , kur 11 > 0, 2 > 0.


1 1 ITEKLIAI

<N1>

N1(t)

<N2>
2

N1(t)

7.16 pav. Klasikins dviej populiacij konkurencijos schema

347
7. Populiacij biofizika

ia 1 ir 2 kiekvienos populiacijos itekli eikvojimo koeficientai yra visada teigiami dydiai. Funkcij F(N1, N2) vertinant kaip lemiani populiacij mirtingum, j staius model diferencialini lygi sistem galima pertvarkyti:
dN1 (t ) = 1 N1 1 1 N12 1 2 N1 N 2 , dt dN 2 (t ) 2 = 2 N 2 2 2 N 2 2 1 N1 N 2 . , dt

i kur matyti, kad eikvojant bendrus ribotus iteklius, matematinio modelio konkurencija ireikiama kaip logistiniai populiacij dauginimosi vyksmai, turintys neigiamuosius tarpusavius ryius 1 = 1 2 , o 2 = 2 1. Tada konkurencijos sveikos modelin schem galima transformuoti, konkurencij vertinti kaip abipus populiacij vienos kit kenkim (7.17 pav.). Jei sistema yra stacionariosios bsenos, t. y. N1(t) = const. ir N2 (t) = const., diferencialini lygi sistema stacionariosios bsenos metu virsta algebrini lygi sistema:
0 = 1 1 1 N1 1 2 N 2 N1 , 0 = 2 2 2 N 2 2 1 N1 N 2 ,

[
[

kurios sprendiniai sistemos stacionariosios bsenos dydiai. ie dydiai ypa aikiai matomi grafiniuose vaizduose, pavaizdavus lygi sprendim kaip dviej tiesi susikirtimo tako padt (7.18 pav.). Matyti trys galimos situacijos: dvi rykios konkurencijai bdingos situacijos, tiesi susikirtimo takas stabili dinamin bsena (fazinio portreto potencialioji duob ) ir nestabili dinamin bsena (balnas). Treioji situacija

<N1>
ITEKLIAI 1 2
2

N1(t)

<N2>
2

N1(t)

7.17 pav. Konkurencija kaip neigiamieji tarpusavio ryiai

348
BIOFIZIKA

N2

a)

N2

b)

1 1 2

2 2 2

2 2 2
N2st N1st 0

1 1 2

1 1 1

2 2 1

N1

2 2 1

1 1 1

N1

7.18 pav. Dvi konkurencini sveik situacijos: nejuntama konkurencija ir ryki konkurencija

(grafikai neparodyta) tiess nesusikerta: jos lygiagreios arba nesusikerta teigiamj reikmi kvadrante. Tikslus tiesi lygiagretumas yra ribin situacija. Tikrovje jos nra. Tokia dviej skirting populiacij, turini visikai lygiaverius parametrus, situacija nemanoma. Nors iek tiek pasikeitus vienos i j koeficientams, kokybikai pakinta sistemos bsena. Jeigu tarpusavio sveikos koeficientai mai, tai jie lemia stabilij [N1s , N2s ] bsen tiesi susikirtimo take (7.18 pav., a). Tiksliau tai ireikiama nelygybmis:

1 > 2 1 2 2 2

ir

1 2 < . 1 1 2 1

Tokia sveikaujanti dinamin sistema neturs konkurencini savybi. Visos populiacijos plis, dauginsis savarankikai pagal logistin dsn (7.19 pav., a). Tokios dinamins sistemos fazinis portretas bus stabilus mazgas ar stabili spiral. I bet kokios padties bsenos, sistema rieda potencialij duob, kurios koordinats N1s , N2s . Kaip rayta, ios situacijos atsiranda, kai yra itekli perteklius, itekliai atsinaujina daug greiiau nei sunaudojami. Pavyzdiui, leming populiacij dinamika atiauriose iaurs platumose. Daug bdingesn yra ios sistemos bsena, kai nelygybi enklai prieingi:

1 < 2 , 1 2 2 2

ir

1 > 2 , 2 1 1 1

t. y. kai jauiamas itekli ribotumas, stygius ir viena populiacija apvalgo kit, kai yra akivaizdi konkurencija. iuo atveju dinamins sistemos fazinis portretas yra balnas tiesi susikirtimo take, ir stabilioji bsena yra viena i dviej kurios nors vienos aies
349
7. Populiacij biofizika

susikirtimas su viena i tiesi. Dviej populiacij dinamin sistema virsta trigeriu (7.18 pav., b ir 7.19 pav., b). Ni ukariaus populiacija, kurios koeficient santykis i /i bus didesnis. Kita populiacija turs inykti. Tas pats galioja ir tiems atvejams, kai tiess teigiamj reikmi kvadrante nesusikerta, bet jos nelygiagreios. iuo atveju taip pat liks tik viena populiacija ta, kurios koeficient i /i santykis didesnis. Reali biologini populiacij infuzorij akvariume tam tikri sugyvenimo pavyzdiai parodyti 7.19 pav. Pirmajame grafike populiacijos dauginasi savarankikai, pagal logistin dsn nekonkuruoja. Antrajame dauginasi konkuruodamos. Ir treiajame populiacijos suranda sambvio pusiausvyr gyventi kartu.
a)

P. aurelia, atskirai

P. caudatum, atskirai
a p i m t i s, ml

b)

P. aurelia kartu P. caudatum

P o p u l i a c i j os

c)

P. bursaria kartu

P. aurelia
Laikas, dienos

7.19 pav. Populiacij augimas (a) gyvenant atskirai, nesant konkurencijos ir konkurencijos slygomis, (b, c) gyvenant kartu

350
BIOFIZIKA

Gana didelis populiaciuj dauginimosi koeficient santykis, j nelygyb sistem daro nestabili, paveria trigeriu viena populiacija apvalgydama kit j sunaikina, visus iteklius sunaudoja sau. Ilieka tik viena populiacija ta, kurios dauginimasis sambvio struktroje didiausias. Tai gerai inomo ekologijos konkuruojanij populiacij Gauzs dsnio savyb. Gauzs dsnis teigia, kad ekologinje nioje negali gyventi daugiau kaip viena populiacija, kai visos maitinasi tais paiais itekliais. inoma, is dsnis, kaip ir kiti gamtos dsniai, yra idealizuotas. Jis galioja, jei stinga itekli, o populiacij dauginimasis ir itekli eikvojimas yra maesnis arba panaus, nei j atsinaujinimo greitis. Tikrovje daniausiai populiacijos, gyvenanios toje paioje ekologinje nioje, i dalies ar visikai minta kitais itekliais. Todl tarp j nusistoja tam tikra pusiausvyra. Konkurencij daugelio sveikaujani populiacij, atsivelgiant Lotkos ir Volteros netiesin (sandaugin) priklausomyb, sistemikai galima urayti netiesine diferencialini lygi sistema:
n dN i = i N i ij N i N j , dt j =1

kur i = 1, 2, 3, n konkuruojanios rys. Populiacij tankiai gali bti tik teigiamieji dydiai, Ni(t) > 0, todl is netiesikumas turi didels takos visos sistemos vyksmams. Jeigu kuri nors populiacija savo tankiu Ni nors kiek virija kitas, turi iek tiek didesn i /i koeficient santyk, ji dl konkurencini sveik pradeda slopinti kit, maiau aktyvi populiacij dauginimsi, ir jas paeiliui visai istumia i nios. io vyksmo padarinys aktyviausia populiacija dar maiau slopinama, ji dar greiiau dauginasi, ji dar daugiau slopina kitas, ne taip aktyvias populiacija. Dl tokio visuotinio tarpusavio slopinimo ar neigiamojo poveikio nioje ilieka tik aktyviausia populiacija viena. Visk nulemia ne pradinis populiacijos tankis, o pagrindini koeficient santykis. Ni ukariavusios populiacijos didiausi tank ribos santykis N max =

i , nes galioja logistinis dsnis. ii

Tokius populiacij dsningumus galima stebti akvariumuose (7.19 pav.) ir kompiuterini modeliavim metodais. Taiau gyvajai gamtai bdinga ne tik populiacij konkurencinis vienos kitoms kenkia ir egoistinis sambviai, bet ir prieingos sambvio formos kooperatyvioji simbioz mutualizmas ir protokooperacija.

351
7. Populiacij biofizika

7.5. POPULIACIJ SIMBIOZ MUTUALIZMAS IR PROTOKOOPERACIJA

Mutualizmas biologijoje yra tam tikra sambvio forma tarp populiacij ir individ, kai pavienis individas ar populiacija gyvendami atskirai inykt, bet gyvendami kartu ir vieni kitiems paddami visi klesti. Tai kooperatyvioji simbioz prieinga konkurencijai sambvio tarp populiacij forma. is sambvis atsiranda, kai visos populiacijos lengvina viena kitos bt. Savitas mutualizmo sambvis ireiktas matematikai atskirai gyvenant populiacijos t, nes turi neigiamas saviveikas. Taiau tam tikra kooperacin, teigiama tarpusavio sveika populiacijas daro aktyvias ir gyvybingas. Dviej populiacij mutualistinio sambvio, atsivelgiant Lotkos ir Volteros netiesin sveik, matematinis modelis ir jo fazinis portretas pateiktas 7.20 pav. I fazinio portreto akivaizdu, kad abi populiacijos arba va, arba klesti. Esant reikiamam populiacij tankiui, tarpusavio pagalbos dydiams ir jeigu momentins dinamins sistemos bsena yra didesnij reikmi hiperbolikai ikreipto balno skiriamosios linijos separatriss pusje, abi populiacijos pradeda eksponentikai didti. Taiau toks vyksmas yra nerealus. Visada populiacij dauginimsi riboja itekliai. Todl model reikia patikslinti traukiant logistinio ribojimo saviveik (7.21 pav.). Matematinis modelis su logistiniu apribojimu darosi dar artimesnis biologinei tikrovei. Mutualistins sveikos populiacij sistemos aktyviajai dauginimosi fazs bsenai suteikiami ribiniai dydiai N1max ir N2max. Paprastesnis kooperacijos sambvis yra protokooperacija. Tai mutualizmo bsena, kai vis populiacij ne tik tarpusavio sveikos, bet ir saviveikos koeficientai yra

N2

dN1 (t ) = 1 N1 + 1 N1 N 2 , dt dN 2 (t ) = 2 N 2 + 2 N1 N 2 . dt

1 1
2 2
N1

7.20 pav. Lotkos ir Volteros mutualizmo saviveikos matematinis modelis ir fazinis jo portretas

352
BIOFIZIKA

teigiami, ai > 0. iuo atveju abi populiacijos dauginasi proporcingai. Atsivelgiant paprastesn model, populiacij tankiai didja iki begalybs, o realesniam logistinio modelio iki tam tikr ribini reikmi. Kaip ir konkurencijos atveju, iais matematiniais modeliais galima aprayti ir daugelio, kooperacijos bdu tarpusavyje sveikaujani populiacij. Tokios dinamins sistemos matematinis modelis bt netiesini diferencialini lygi sistema:
dN i = i Ni + dt
n

ij N i N j i N i2 ,
j =1

kuri nuo analogiko konkurencijos modelio skiriasi tik prieingais tam tikr kooeficient enklais. Aiku, visos savybs, bdingos dviej populiacij kooperacijos sveik modeliui, taikytinos ir daugiapopuliacinei sistemai. Dsningumas taikytinas ir protokooperacijai, kurios ir saviveikos koeficientai yra teigiami. Protokooperacijai bdinga vis populiacij eksponentinis dauginimasis, be joki inykimo pavoj. Tokie tarpusavio pagalbos sambviai, kurie yra prieingi konkurencijos skaldomosioms populiacij tendencijoms, rodo prieingas tendencijas jungtis, agreguoti, integruotis. ios tendencijos yra ypa svarbios biologins evoliucios poiriu. Mutualizmas maiausiai itirta populiacij sambvio forma. Gamtoje i sambvio forma rykiausiai matoma kerpi pavyzdiu. Bdinga, kad kerps dumblio ir grybo simbiontas daugiausia paplits ten, kur yra sunkiausios gamtins slygos. emje yra apie 16 000 kerpi ri. Tai sudaro tik apie 10 procent vis sklini augal. Islandijoje sklini augal ri kiekio santykis su kerpi ri kiekiu lygus apie 1 (t. y. po lygiai). Taiau Antarktidoje kerpi ri yra 175 kart daugiau. Sub-

N2

N2max

dN1 (t ) = 1 N1 + 1 N1 N 2 1 N12 , dt dN 2 (t ) 2 = 2 N 2 + 2 N1 N 2 2 N 2 . dt

N1 0 N1max

7.21 pav. Logistinis mutualistinio sambvio matematinis modelis ir fazinis jo portretas

353
7. Populiacij biofizika

tropikuose, pavyzdiui Javoje, kur gyvybei, augal ir gryb pasauliui slygos labai palankios kerps sudaro tik apie 0,6 procento.

7.6. POPULIACIJ PLRA IR PARAZITIZMAS

Vieni i saviiausi populiacij sveik gamtoje, kaip mutualizmas ir protokooperacija, taip pat bdingas kitas simbiozinis sambvis plrnas ir auka sistema (7.22 pav.). Dvi neatsiejamai sveikaujanios populiacijos N1(t) ir N2(t), i kuri viena minta kita, o pirmoji maitinasi aplinkos itekliais, sudaro plrnas ir auka dinamin sistem. Teorin tokios sistemos matematin model yra sudars ir inagrinjs V. Voltera. iuo metu jo vardu vadinami klasikiniai toki sistem modeliai. Kinetikos dalyje pateiktas paprasiausias Lotkos ir Volteros netiesinis idealizuotas plrno ir aukos modelis, nevertina populiacij dauginimosi ribojani itekli veiksni. Tikrovikesniems modeliams nagrinti traukiami logistinio populiacijos dauginimsi ribojantys nariai i Ni2 :
dN 1 (t ) 2 dt = + 1 N 1 1 N 1 N 2 1 N 1 .............auka, dN 2 (t ) = N + N N N 2 .......... plrnas. 2 2 2 1 2 2 2 dt

-2
N2(t) <N2> PLRNAS

+2

<N1> ITEKLIAI N1(t) A U K A

+1

7.22 pav. Plrnas ir auka dinamins sistemos schema

354
BIOFIZIKA

Abiej lygi populiacij sandaugos nariai N1 N2 turi prieing enkl koeficientus. Tai rodo netiesin neigiamj grtamj ry, kuris ir nulemia ios dinamins sistemos savybes. Jos akivaizdiausiai matomos faziniame portrete (7.23 pav.). Udarj linij fazinis portretas rodo dinamins sistemos savaiminio svyruojanio pobdio populiacij tankio kait, o tai reikia, kad plrnas negali sunaikinti aukos. Ekobiologijos specialistai tai vadinama reguliacija. Sakoma, kad plrnas yra reguliatorius, jis neleidia per daug aukos producento populiacijai suveti nioje. Panaus dsningumas bdingas ir parazitas-eimininkas populiacij sambviui. Tik iuo atveju koeficient dydiai lemia stabilios spirals fazin portret. Jis rodo, kad populiacij tankiai svyruodami artja prie tam tikr nekintam (stacionari) reikmi. Plrnas ir auka dinamins sistemos fazinio portreto stacionariosios bsenos sprendiniai rodo, kad ji bendruoju atveju yra nestabili, ir i bet kurios bsenos pereina stabil cikl, svyruojanij bsen (3.25 pav., 7.23 pav.). Gana danai bendri teoriniai modeliai nagrinja daug auka-eksploatatorius sambvi. Matematinis j modelis bna gana bendro pobdio diferencialin lygtis:
dN i = i ( N i , N j ) N i . dt

Tai netiesini diferencialini lygi sistema, kur funkcijos i yra aukos ir plrno, inaudojamojo ir inaudotojo, eimininko ir parazito lyginamieji dauginimosi greiiai, vertintys visas populiacijas viena matematine funkcija. Matematiniais metodais yra parodyta: jeigu i funkcija atitinka daug gana sudting slyg, tai tokia dinamin sistema gali turti stacionarij svyruojamj bsen. Galima padaryti ivad, kad sudtingesni plros situacij netiesins sveikos atvejais ikyla daug teorini analizs sunkum ir neapibrtum.
N2

1/ 1

N1 0
2

7.23 pav. Plrnas ir auka dinamins sistemos fazinis portretas

355
7. Populiacij biofizika

Labai svarbus gamtoje yra plros sambvis parazitas-eimininkas. Parazitas eimininkas sambvio sistema kok nors atsitiktin poveik atsako svyruojaniuoju, danai gstaniu vyksmu. Tai rodo galim sistemos nepastovum, net eimininko t. Norint patikimai toki sistem isaugoti, reikia apriboti parazito tak atitinkamomis priemonmis, sistemos faziniame portrete suformuoti stabilj mazg arba stabilij spiral. Danai ligos atvejais tai atliekama vaistais. Plros sambviu aikinami uv populiacij kaitos reikiniai stebimi Viduremio ir kitose jrose. Kanadoje, atsivelgiant sumediot zuiki ir li kaili kiekius, vertinama atitinkamos ekologins sistemos raida. Yra itirtos realios plrnas ir auka sistemos, vertinant lyginamuosius tankius: 1. Vanagas ir virblis Europoje; fazinis portretas stabilusis mazgas. 2. Lis ir zuikis iaurs Amerikoje; fazinis portretas stabilioji spiral. 3. Vilkas ir baltauodegis elnias Ontario; fazinis portretas stabilusis mazgas. 4. Vilkas ir karibu Aliaskoje; fazinis portretas stabilusis mazgas. 5. Puma ir juodauodegis elnias JAV; fazinis portretas stabilusis mazgas. Plros pavyzdiai rodo, kad per ilg laik plrnas ir auka gyvenimo vyksmas nusistoja, pasiekiama gana stabili reguliavimosi bsena. Populiacij tankio svyravim amplitut pasidaro tokia maa, kad ji neisiskiria i matavimo paklaid dydi. Daugiakomponenio plrnavimo atvejai dar nra visikai itirti. Juos nagrinjant nustatomi sudtingi hierarchiniai visiko plrnavimo sambviai, kurie, dl netiesini j grtamj sveik, teorikai sunkiai tiriami. Taiau gamtoje visada ir visur gyvena daugyb tarpusavyle vairiausiai sveikaujani populiacij. Tokiose biologini populiacij ekologinse sistemose yra ir konkurencija, ir kooperacija, ir plra. Akivaizdu, yra daugyb ir tarpini sambvio form amensalizmas, komensalizmas, parazitizmas, kuriuos galima tirti teoriniais ir bandym metodais ne tik laboratorijose, bet ir gamtoje.

7.7. BENDRIEJI DAUGIAKOMPONENI POPULIACIJ MODELIAI

iuo met matematikos ir bandym metodais isamiau yra itirtos dviej populiacij sveikos, suformuluoti j dsningumai. iek tiek yra nagrinti trij sveikaujani populiacij dsningumai. Taiau labai maai inoma apie daugiakomponeni populiacij dinamikos dsningumus. Jei sveikos tarp populiacij yra tiesins ir matematikai apraomos tiesinmis diferencinmis lygtimis ir lygi sistemomis, dideli sunkum nra. visus klausimus galima rasti atsakymus klasikins matematikos ar kompiuterijos metodais.
356
BIOFIZIKA

Realios biologins populiacijos sveikauja netiesikai. Kyla esmini sunkum. Klasikiniai matematikos metodai tokiais atvejais bna beveik neveiksmingi. Todl taikomi modeliavimo kompiuteriais metodai. Yra sukurtos specialios, gana veiksmingos kompiuterinio modeliavimo programins sistemos, galinios skaitmeniniais metodais modeliuoti sprsti netiesini diferencialini lygi sistemas. Sudting populiacini sistem modeliavimas susideda i: konceptualaus modelio sukrimo; matematinio modelio formavimo; matematinio modelio pavertimo kompiuteriniu modeliu; galim dinamini vyksm tyrim kompiuteriniu modeliu. Modeliuojant nustatomi kintamieji dydiai, kuri kitimai priklauso nuo laiko ir erdvs. Juos galima pateikti grafikai, faziniais portretais arba j duomenis rayti skaii lenteles. Toks modeliavimas patogus, nes leidia keisti modelio parametrus konstantas, galima ibandyti daugel variant. Daugiakomponent populiacin sistema, susidedanti i n netiesikai sveikaujani populiacij, bendruoju atveju apraoma diferencialini lygi sistema:
dX i = i X i + ij Fi ( X 1 , X 2 ,... X n ), dt

kur i = 1, 2, 3, , n populiacij indeksai, o Fi (.) atitinkamos netiesini ryi tarp populiacij tarpusavs sveikos funkcijos. Viena paprasiausi klasikini daugiakomponeni netiesini populiacini sistem yra Lotkos ir Volteros tipo modelis:
n dX i = i X i + ij X i X j . dt j =1

J pobd lemia tarpusavio sveikos koeficientai ij , ypa j enklai. Jei visi koeficientai ij yra neigiami, yra visuotin konkurencija. Kai visi koeficientai ij teigiami, yra visuotin kooperacija. Jei +ij = ji arba ij = +ji , t. y. jei visi simetriki tarpusavio sveikos koeficientai skirting (prieing) enkl, yra visuotin plra. Pastaruoju atveju galimos labai vairiareikms bkls gali susidaryti katastrof ir chaoso dinamins sistemos. Modeliavimas kompiuteriais padeda vertinti ir atsitiktini poveiki tak populiacini sistem vyksmams. Kompiuteri programomis galima sukurti atsitiktines funkcijas, kuriomis galima itirti atsitiktini poveiki tak tam tikroms dinamins sistemos savybms atitinkamose sistemos vietose. i atsitiktini vyksm modeliavimo metodais atliekami sistemos raidos galimybs bei irykinami pavojai. Be to, kompiu357
7. Populiacij biofizika

7.24 pav. Ekologins daugelio populiacij sistemos maistini ir informacini ryi bendroji schema

teriniu modeliavimu galima nagrinti priemones, kuriomis bt manoma saugoti sistem nuo nepageidaujam atsitiktini populiacij kaitos vyksm. Populiacij dinaminiams vyksmams modeliuoti naudojami visi pagrindiniai biologiniuose tyrimuose taikomi atsitiktini dydi dsniai (skirstiniai): normalusis, staiakampis, Puasono, binominis ir j variacijos. Nagrinjant daugiakomponentes populiacijas reikia vertinti j vairov. Daugiakomponentinse populiacij sistemose vyksmus lemia ne tik maistiniai, bet ir signaliniai informaciniai ryiai. Toki sistem tyrimams taikytini informacijos ir valdymo teorij elementai, informacinio neapibrtumo informacins entropijos, o taip pat kodavimo ir dekodavimo algoritmai bei procedros.

7.8. INFORMACINIS POPULIACIJ VALDYMAS

Biologinms populiacijoms, be maistini ryi tarp populiacij ir individ, didel tak turi informacins procedros. Bendroji daugiakomponents ekologins sistemos, kurioje gyvena ir sveikauja didelis vairiausi lygi biologins populiacijos, schema pateikta 7.24 pav. Pirmasis biologini populiacij lygis M paprast organini mediag gamintojas. Tarp j gali nebti joki sveik. Antrojo lygio biologins popu358
BIOFIZIKA

liacijos A sveikauja bendrai naudodamos ne tik emesnio lygio organizmus, j mediagas, bet gauna ir signalus. Jos yra valdomos signal atmeta informacija. iais ir visais kitais biologiniais lygiais mediag, energijos, signalins informacijos srautai ekologinje sistemoje cirkuliuoja tiesiogiai ir grtamaisiais keliais, nuosekliai ir lygiagreiai. Aiku, tokios biologini populiacij dinamins sistemos yra rykiai netiesins, nes populiacij dauginimasis ir kiti vyksmai yra valdomi signalins informacijos. Ypa tai ryku nagrinjant vabzdi bendruomeni gyvenim. Daugeliu atvej vabzdi populiacijas galima vertinti kaip savarankikus organizmus, o pavien individ kaip daugialsio organizmo lstel. Tokiose populiacijose tarp tam tikr pavieni individ vyksta apykaita ne tik mediagomis ir energija, bet ir informacija, kuri pernea signalais. T vyksm metu, kai individai apsikeiia informacija, visada bna kodavimo ir dekodavimo procedros. Yra inoma, kad vabzdi bendruomens yra sudarytos i specializuotos paskirties individ grupi, kurios skleidia, panaiai kaip daugialsiame organizme lstels (agentai) hormonus, savitsias mediagas vilioklius (feromonus). Tam tikr viliokli (feromon) rinkiniai, j koncentracijos aplinkoje koordinuoja, valdo kit individ veikl. Pavyzdiui, bii avilio motinls skleidiami viliokliai lemia tran ir bii darbininki veiksmus jos atvilgiu. Avilyje atsiradusi kita bit motinl vis skleisdama savus feromonus, sukelia avilio skilim dalijimsi du savarankikus avilius. Ypa domi bii kodavimo sistem nustat K. Frias (K.von Frish), ityrs j okius. Jis pastebjo, kad bits okdamos ant avilio lakt perduoda kitoms bitms informacij apie nektaro iteklius, j buvimo krypt ir nuotol. Pavyzdiui, nyktukin bit okdama atuoniuk parodo, kad nektaras u 15300 metr (7.25 pav., 7.27 pav.).

7.25 pav. Bits okis kairje rodo, kad maistas arti, o deins puss okis perduoda informacij apie maisto nuotol nuo avilio ir krypt

359
7. Populiacij biofizika

Tikslesn nuotol rodo sibuodama pilvel. Juo nektaras ariau, juo pilvel judina greiiau. okio kryptis rodo orientacin nektaro itekli buvimo krypt. Jeigu nektaras visikai arti okama apskritimais. Pamatuota i bii kodavimo skiriamoji geba: nuotolis vertinamas 4 diskreiaisiais dydiais 3, 15, 60, 305 metrai, t. y. keturiais nuotoli simboliais. Atitinkamai papildomai naudojami 0; 0,9; 7; ir 4 pilvelio pakrypavimai. Vadinasi, galima teigti, kad bit perduoda apie 2 arba 4 bitus informacijos ir taip nukreipia skrydiui veiksmui kitas bites darbininkes. Taip vienos bits perduota informacija valdo kitas bites. Kit ri bits nuotol koduoja penkiomis diskreiosiomis bsenomis penkiais simboliais. Krypiai perduoti vartoja net 16 diskreij bsen, t. y. perduoda inforNyktukin bit Gigantikoji bit Indijos bit Australijos bit Italijos bit

Nuotolis nuo avilio, m

7.26 pav. Tam tikr ri bii oki kodo lentel

360
BIOFIZIKA

macij 22,5 kampinio laipsnio tikslumu arba siunia apie 4 bitus informacijos. Isamesnis bii okio kodas, naudojamas tam tikr bii ri, parodytas 7.26 pav. Bii oki kodo funkcin veikimo semantin prasm vaizdiai rodo 2.27 pav. schema. okis susideda i trij dali. Pirmja okio dalimi bit ant korio, tarsi ant emlapio, nurodo sauls azimut. Antrja okio dalimi perduoda informacij apie nektaro altinio viet, jo kamp ir krypt sauls azimuto atvilgiu. Treija okio dalimi pilvelio svyravimais perduoda informacij apie nuotol iki nektaro turini augal. Informacij apie nuotol vabzdiai perduoda ir viliokliais, j skleidiama koncentracija. Jei maistas u 2,5 m, kryptis feromonais nurodoma 45 tikslumu, t. y. 8 diskreiosiomis koncentracijomis, arba perduoda apie 3 bitus informacijos. 2,55 m nuotoliui perduoti reikia 16 diskreij koncentracij, arba 4 bit; 5 7,5 m 24 diskreij arba 4,6 bit; bei 7,5 10 m nuotoliui nurodyti 32 diskreij arba 5 bit informacijos. Specials viliokliai valdo tam tikras vabzdi elgsenos bsenas lytin, alkio, baims. Feromonais skruzds darbininks enklina koduoja keli nuo skruzdlyno

Sauls kryptis

7.27 pav. Bii oki kodo dekodavimo schema

361
7. Populiacij biofizika

iki maisto. Kitos skruzds eidamos pdsakais papildo igaruojani feromon koncentracij. Tol, kol yra maisto ir ten keliauja skruzds darbininks, tol egzistuoja feromonais enklintas kelias. Pastebta, kad nuo nuotolio keiiasi ir feromom kelio krypi skaiius.

* * *
Apibendrinant ekologini sistem ir populiacij biofizikos dsningumus reikia konstatuoti, kad ekologins sistemos yra silpnai organizuotos sistemos. Jose vyrauja maistini ryi sveikos, nors turi takos ir signaliniai informaciniai veiksniai. Signaliniai informaciniai veiksniai nra vyraujantys, todl natraliomis slygomis jie negali i esms lemti ekologins sistemos raidos. Jie gali lemti tik pavieni populiacij elgsen. Pradjus nagrinti iuos vyksmus ir juos pritaikyti mogui, prisireik ekologini sistem evoliucijos, raidos teorijos. ems ekologin sistema labai sudtinga, jai bdinga daugyb netiesini sveik, Todl ekologini sistem tyrimo nepakeiiamas rankis yra kompiuteris, matematinio kompiuterinio modeliavimo metodas. Sukrus ekosistem teorij ir galingas modeliavimo metodikas, atsiranda populiacij tausojamai valdomos raidos galimyb. Tai reikia, kad mogus gyja galimyb kurti savo gerov isaugodamas natraliai besivystanias populiacijas, j ekologines sistemas. Tai viltis, kad mokslinis gamtos painimas pads ems ekologin sistem padaryti organizuota sistema, ir jos lemiam informacinio valdymo vaidmen atliks gamt saugantis mogus Noosfera. Tam btina suprasti vis em ekosistem norint imintingai valdyti biosfer.

362
BIOFIZIKA

GYVYB ADAPTYVI, INFORMACIJ KAUPIANTI, KODAVIMO IR DEKODAVIMO SISTEMA

Darwinas buvo teisus, kalbdamas apie somatin evoliucij, bet teisus buvo ir Lamarckas, kai turimas omenyje vlesnis mogaus evoliucijos etapas. MARTYNAS YAS. Apie biologij, 1994

ems gyvyb biosfera sistem teorijos poiriu yra daugiar, vis laik kintanti ir prisitaikanti adaptyvi sistema. Gyvyb yra organizuota sistema, nes ji turi informacinio valdymo struktras, kurios jai suteikia galimyb imti i aplinkos kokybikas mediagas laisvj energij ir iuos iteklius panaudoti sistemos entropijai mainti. Toki savyb organizuot veikl gyvyb sugeba ne tik isaugoti, bet ir j didinti. Organizuot sistem teorija rodo, kad tai manoma gyvendinti tik kaupiant informacij. Informacijos kaupimas ir jos veiksmingas panaudojimas valdymui nemanomas be patikim udarojo kodavimo ir dekodavimo struktr. Todl gyvybs evoliucijos esm organizm ir populiacij bioinformacini technologij tobulumas: kuo greiiau, tiksliau, isamiau ir patikimiau gauti, perdirbti, saugoti ir sisti informacij, t. y. valdyti. Biologin evoliucija daugiausia susijusi su bioinformacini struktr raida jos lemia gyvybs adaptyvum. Gyvyb adaptyvi udarojo informacijos kodavimo ir dekodavimo bei hierarchinio valdymo organizuota sistema. Kaip atsirado organizuotos sistemos, kokie pricipai lm i sistem atsiradim ir raid tai svarbiausi teorins biologijos ir biofizikos klausimai. Atsakym iuos klausimus turi bti iekoma ir jie turi bti pildomi vis laik, kartu su nauj mokslo poiri paradigm atsiradimu. Atsirandant naujiems poiriams, ikyla ir svarbi naujovi reikm, naujai vertinti mokslo aikinimus.
364
BIOFIZIKA

Neabejojama, kad nemanoma gyvybs atsiradimo ir raidos paaikinti, nesuprantant i savybi: struktros sudtingjimo; nauj kokybini savybi atsiradimo; sudtingesns struktros ilikimo, jos atsparumo alingiems aplinkos poveikiams didinimo. Evoliucijos poiriu gyvyb emje yra bendra (holistin) sistema biosfera kuri vis laik pltojasi. Jos viduje susidar ir vis laik, daug greiiau nei visa biosfera, vystosi kitoki savit informacinio valdymo savybi turintis, protaujantis posistemis noosfera. Biosfera ir noosfera, organizuot sistem teorijos poiriu, sudaro darnaus formavimosi sistem, kurioje udarojo kodavimo ir dekodavimo bei informacinio valdymo prodedromis pasiekiamas funkcinis organizuotumas sugebjimas prisitaikyti, gyventi vis naujai susidarandaniomis slygomis adaptuotis. Negyvosios gamtos aplinkoje vyrauja mediag ir energijos virsmai. Gyvojoje gamtoje biosferoje daugiau reikiasi informacija, kodavimai, dekodavimai ir reguliavimas bei valdymas. Mediag ir energijos virsmai suprantami tik kaip technologins priemons informacinms valdymo procedroms atlikti. Ir juo sistema organizuotesn, juo i sistema geriau prisitaiko, yra adaptyvesn, juo rykesn joje informacinio valdymo veikla. Auktesnio evoliucijos lygmens organizm yra rykesni, labiau ivystyti specials informacinio valdymo organai, anatomins ir morfologins j struktros. Pavyzdiui, induoli ir ypa mogaus nerv posistemis, smegenys, smegen iev, j raida ir populiacij socialinis sugebjimas kaupti ir gaminti informacij kurti.

8.1. BENDROJI GYVYBS SUDTINGJIMO SCHEMA

Gyvybei, gyviesiems organizmams ir j populiacijoms bdingas nuolatinis vystymasis hologenez, kuri susideda i ontogenezs ir filogenezs (8.1 pav.). Ontogenez organizmo individualaus vystymosi vyksm galima vertinti kaip genetins individo gamybos technologins programos dekodavim. Filogenez pasiymi vis laik sudtingesni, vis adaptyvesni (daugiau prisitaikiusi prie esam aplinkos slyg) biologini ri atsiradimu, vertintina prieinga dekodavimui procedra kodavimu, veiksmingesni kodavimo struktr, genetini organizmo funkcin organizacij lemiani program dauginimu ir vairinimu, t. y. veiksmingesni koduot biotechnologini program formavimu. is negrtamasis vientisas biologins evoliucijos kodavimo ir dekodavimo vyksmas ir vadinamas hologeneze. Gyvybs evoliucij vertinant udarojo informacinio kodavimo ir dekodavimo procedr atsiradimo ir tolesns raidos poiriu, maiau dmesio skiriama mediag ir
365
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

FILOGENEZ KODAVIMAS IR KODUOTO ORGANIZMO MODELIO KRYBA

ONTOGENEZ DEKODAVIMAS -

8.1 pav. Hologenez organizuot sistem udarj informacinio kodavimo ir dekodavimo procedr raida (remiantis Zimmermanu)

energijos virsm mechanizmams. Svarbiausia informacinio valdymo princip raida. Mediag ir energijos virsm mechanizmai bna tik priemons, sudedamosios dalys (sandai) organels, organai informaciniams valdymo vyksmams gyvendinti. Jie, sujungti tam tikr tikslini programikai valdom pakop darni grandin, atlieka daugyb hierarchikai idstyt veiksm. Gyvybs esm funkcikai tikslingas tam tikr veiksm parengimas organizavimas. Technologins atlikties priemons gali bti vairios. Biologin evoliucija tai nuolatinis vis sudtingesni, vis daugiau prisitaikiusi kintamomis ems slygomis gyvybs ri, j populiacij atsiradimas. Aiku, is adaptacijos vyksmas, informacinio kodavimo ir dekodavimo sampratos poiriu galjo vykti tik per nuolatin atminties struktr informacinio talpio didjim ir kodavimo
366
BIOFIZIKA

bei dekodavimo procedr informacinio efektyvumo didinim. ios atminties struktros turjo susidaryti i materialij mediagini dali, atomini, molekulini, lstelini ir panai element. Tiktina, kad gyvosios organizuotos gamtos raida yra darnios bendresns negyvosios, t. y. neorganizuotos gamtos materijos mediag ir energijos vyksm raidos tsinys. Mediaginio sudtingjimo principas akivaizdus. Mokslo tyrimais apibdinant gamtos evoliucijos vyksmus, ypa kosmoso ir ems raidos pradioje, gyvybei atsirasti emje, lemtinga buvo naujos kokybs informacinio valdymo atsiradimas, kuris lm funkcin tikslingum ir funkcin organizuotum.

8.2. GYVYB CHEMINS EVOLIUCIJOS TSA

Remiantis mokslu, biologin evoliucija yra nuosekli ir logika pasaulins materijos raidos faz, prasidjusi ms emje prie ~3,54 milijardus met (8.2 pav.). Vadinasi, bsimj biologini organizacij sandaros struktra pradjo formuotis prie ~158 milijard met materijos Didiuoju Sprogimu. Padarinys pradjo formuotis ir sudtingti atomai vyko atom evoliucija. Prie ~7 milijardus met susidar ms galaktika. Prie ~6 milijardus met Saul ir tik prie ~54 milijardus met em ir Mnulis. Tuo metu vyko chemin evoliucija. I atom susidar molekuls, kurios prie ~3,53,8 milijardus met emje ir sukr pagrind biologinei organizacijai atsirasti. Neabejojama, kad prie ~4,54 milijardus met emje buvo slygos, kuriomis savaime galjo susidaryti visi molekuliniai junginiai, reikalingi gyvybei atsirasti (8.2 pav.). Prebiotin (chemin) evoliucija, imituojant to laikotarpio ems slygas laboratorinje kolboje (Milleris, 1953) parod, kad molekuls savaime sudtingja, i neorganini jungini susiformuoja organiniai junginiai, vyksta j polimerizacija (8.3 pav., 8.4 pav.). Susidaro visos keturios pagrindins organini chemini jungini rys: angliavandeniai; riebalai; nukleotidai, vyksta j polimerizacija nukleorgtys; aminorgtys, polipeptidai baltymai. Neaikiausia yra simbiozini sveik tarp nukleorgi ir baltym susidarymas. Gyvybs evoliucij vertinant net ir informacini kodavimo ir dekodavimo procedr atsiradimo ir tolesns raidos poiriu, gyvybs pamatas svarbs yra mediag ir energijos virsm mechanizmai. Inaudojant i mechanizm savybes atsiranda nauja informacin kodavimo ir dekodavimo savyb, lmusi funkcin molekulini virsm
367
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Eucyte Prie (3,54) 109 Procyte

Polycyte Homo

A
Didysis sprogimas prie (812)109 m.

Precyte

Organiniai polimerai

Atomai

Elementariosios dalels

8.2 pav. Pasaulio raida (V. vemleris)

organizuotum, valdym, valdymo princip raid. Mediag ir energijos virsm mechanizmai lieka tik priemons. Sujungti tam tikr tikslini molekulini virsm programikai valdom pakop darni grandin, atlieka gyvybines funkcijas. Gyvybs esme tampa tam tikr molekulini virsm funkcikai tiksling reakcij organizavimas. Tos reakcijos yra vairios. Organizuot sistem teorijos poiriu prie 3,84 milijard met emje susiformavo (arba atsirado) simbiozin dviej kokybiniu poiriu visikai kitonikos paskirties sveikaujani procedr struktra. Ji vieno materialaus vyksmo bsenas sugebjo atspindti kitos atminties struktros stabiliomis bsenomis. Ir atspindjo taip, kad buvo manoma ilgai isaugoti io vyksmo atspind antrosios struktros bsenomis. is atspindjimas turjo dar vien grtamj savyb: atspindio struktros bsenos atspindjimo pirmojoje mediagini virsm bei vyksm pavidalu. emje atsirado kokybikai naujas, iki tol nebuvs: udarojo informacinio kodavimo ir dekodavimo vyksmas, tiesiogiai susijs su nauja gamtos savybe atmintimi. Be to, kartu turjo susiformuoti ir kita labai svarbi biologin savyb: gaminti stabiliosios atminties struktr kopijas dublikuotis. ios pagrindins funkcins naujovs ir nulm gyvybs atsiradim bei gyvojo pasaulio raid. J simbioz lm riboto dydio atvirj termodinamini sistem erdvskyr (koacervat) atsiradim, sugebani pasiimti i aplinkos laisvj energij ir reikalingas mediagas, ir palaikyti nekintam arba net mainti sistemos entropij, t. y. didinti organizuotum. Atsirado kokybikai nauja gamtos dalis gyvoji gamta, turinti visikai naujas savybes.
368
BIOFIZIKA

Kosminis jonizuojamasis spinduliavimas Laipsniki nuostoliai Pirmin atmosfera

Meteoritai Elektros ilydiai Pirmins atmosferos dujos Abiozin sintez atmosferoje H2O garai Tam tikri tarpiniai produktai

Aminorgtys, purinai, pirimidinai, angliavandeniai, lipidai ir kt. Abiogenins organins mediagos, tirpstanios eer, jr ir kt. vandenyje H2O garai Koacervatai Vulkanai Kartieji altiniai Vulkanin dirvos iluma Divimas ir tirpimas, perkristalinimas
Filtravimas, chromatografinis atskyrimas Pirminis buljonas Reakcijos tirpale Baltymai, nukleorgtys

Idiv abiogenini organini mediag sluoksniai, i dalies su fosfatais

Ikilsteliniai agregatai

Uolien gama spinduliavimas

8.3 pav. Chemins evoliucijos emje vyksmai, lm gyvybs atsiradim prie ~3,8 milijard met (V. Kaplanas)

Gyvj organizm raida gali bti grindiama trimis atsitiktini poveiki ir sambvi tendencijomis: 1. Atranka per konkurencij (turim savybi tobulinimas). 2. Nauj kokybini galimybi sintez per simbioz kooperacij. 3. Hierarchin nauj savybi sintez per simbiozines plrnas ir auka tipo sveikas.
369
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Per vis tokios raidos vyksm pagrindins struktros buvo atrenkamos, surenkamos ir jungiamos naujas simbiozines sistemas, turinias atmint struktras. Jose yra saugoma informacija apie organizmo gaminimo technologijas ukoduotos biotechnologins organizmo programos. Tai biotechnologiniai modeliai, arba biotechnologiniai projektai, t. y. genetins informacijos struktros. iuo poiriu biologins evoliucijos vyksmas yra informacins procedros. Kokybinius pokyius lemia pakitusi biotechnologin programa, biotechnologinis organizmo modelis programa, mediagikai urayta keturi simboli kodavimo kalba. ias procedras atlieka neikliai (signalai) nukleorgtys. Biotechnologini projekt mediaginis gyvendinimas yra dekodavimo procedra, pasireikiantis kaip biocheminis gamybos vyksmas. Jai atlikti gaminamos tam tikros gamybos priemons, specializuot molekulini stakli rinkiniai fermentai. Nauj biologini kokybi atsiradimas grindiamas atminties struktr informacinio talpio didinimu ir atminties struktr kombinacij vairinimu, t. y. gen jungimais, genotipo pokyiais. Organizmo fenotipo pokytis pirmini genetini program pokyi padarinys. Todl inomi dviej tip biologiniai pakyiai: mutacijos, kaip genetini program pakitimai, ir modifikacijos dekodavimo procedr sukelti pokyiai. Kaip inoma, modifikaciniai pokyiai atsiranda tik tam tikram individui jo gyvenimo tarpsniu. Mutaciniai pokyiai, nesukeliantys organizmo ties ar nesudarkantys normalaus organizmo reprodukavimosi, yra perduodami palikuonims, nepakit ilgam ilieka populiacijoje. iais atvejais gali susidaryti, ir tikriausiai susidaro, naujos kodins struktros, suteikianios organizmui naujos informacijos, naujas organizmo ir i jo atsiradusi populiacij funkcines galimybes. Tokie vyksmai buvo chemins evoliucijos molekulini virsm raidos tsinys. Todl molekuliniai mediag ir energijos virsmai buvo pagrindiniai biologins organizacijos technologini procedr elementai. Vienos molekulins struktros fermentai specializavosi materialiosiomis mediag ir energijos perdirbimo funkcijoms: specializavosi bti vairiausios paskirties gamybos priemonmis, staklmis, o nukleorgtys materialiosiomis priemonmis, atliekaniomis nematerialisias informacijos atminties, reikalingos valdyti, funkcijas. Tam tikri baltymai atlikti ir informacijos perdavimo signalines procedras. Chemins evoliucijos vyksmo metu susiformavus bioinformacinio valdymo nukleorki ir signalini molekuli struktroms, turjo susidaryti organizuota sistema, t. y. sistema, kurios entropija gali ilikti nekintama arba entropija mat. Informacins valdymo struktros galino didinti savj organizuotum naudodamos aplinkos iteklius. Atsiradusi nauja savaiminio organizavimosi sistema didino savj organizuotum naudodama aplinkos laivj energij ir kokybikas mediagas. Tokia sistema termodinamikos poiriu gali bti tik atviroji sistema. Be to, toki savyb gali turti tik tam tikro baigtinio dydio erdvskyra. Ji turi sugebti i aplinkos imti kokybikas
370
BIOFIZIKA

mediagas ir laisvj energij, ir jas perdirbus panaudoti sistemos vidaus irimo vyksmams panaikinti. Tokia pradin erdvskyra koacervatas, susidars per pirmin chemins raidos tarpsn pirminiame buljone, nuo aplinkos buvo atribotas dvigubu lipid sluoksniu. Jis specializavosi kryptingai atlikti mediag ir energijos virsmus. Jame esanios nukleorgtys ir tam tikri signaliniai baltymai specializavosi naujai kokybei informacijai saugoti, urayti, nuskaityti, sisti ir visiems kitiems organizuojantiems veiksniams valdymui atlikti. Aiku, tokie gyvybiniai vyksmai, kol jie tenkina organizuotos sistemos reikalavimus, vyksta nuolatos. Prieingai antrajam fizikins termodinamikos entropijos didjimo dsniui, vyksta irstani erdvskyros dali atkrimas ir nauj dali sintez gamyba. Todl gyvyb reikia vertinti kaip natraliai susidarius biotechnologin vyksm, kuriam didiausi tak daro informacins kodavimo ir dekodavimo procedros. Jos atliekamos specialiomis matricins sintezs procedromis. Todl gyvybs esm bioinformacins technologijos, natraliai susidariusios per chemins ir biologins evoliucijos vyksm. Mokslui lieka maai abejoni dl organini jungini, organini chemini molekuli, kurios lemia gyvybs struktros savaimin atsiradim emje. Manoma, kad prie 815 milijard met dl kosminio sprogimo atsirado ms Galaktika ir prasidjo atom evoliucija, kuri tebevyksta ms Saulje, atsiradusioje tik prie 5 milijardmeius. Ms ems atsiradimas prie 4,5 milijardus met siejamas su chemine, molekuli evoliucijos pradia. Mokslo laboratorijose udarose kolbose imituojami ikibioziniai ems vyksmai. Bandymais rodyta, kad atmosferoje i neorganini jungini NH3, CH4 , H2O, ir kit dujins bsenos molekuli, veikiant kosmoso ir ultravioletinei spinduliuotei, krintant meteoritams, formuojantis ems plutai, kunkuliuojant vulkanams, majant temperatrai ir pan., susidaro aminorgtys, purinai, pirimidinai, angliavandeniai, lipidai ir kitos molekuls. ie organiniai cheminiai junginiai, itirp vandenyje, sudaro abiogenines organines mediagas, kurios polimerizuojasi ir taip sudaro pirmin gyvybs buljon, turint baltym ir nukleorgi (8.3 pav., 8.4 pav.). Akivaizdu dl fizikochemini sveik elektrolitinje aplinkoje i lipid ir kit molekuli susidaro erdvskyros, koacervatai. Taiau kaip koacervat viduje susidaro organizuotum lemianios bioinformacins valdymo struktros, nulmusios gyvybs atsiradimo esm, iandien dar nesuprantama. Gyvybei, kaip organizuotai sistemai, reika, kad ribotoje erdvje erdvskyroje, koacervate bt patikim informacijos atminties ir atitinkam informacijos raymo ir nuskaitymo funkcini struktr, t. y. bioinformacin kodavim ir dekodavim vykdani molekuli agregat, organeli ar organ. Mokslui inoma, kad visose lstelse svarbiausi informacini procedr vykdytojai yra materials informacijos neikliai, specialios molekuls vadinamos signalinmis. Signalais vadintinos nukleorgtys ir tam tikri baltymai, nes ios molekuls saugo, perdirba ir pernea informacij vykdymo
371
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Elektrodai aibams Vakuuminis siurblys

Atmosferos slyg imitacija

aldymas Papildomas tiekimas CH4, NH3, H2 Kaitinamas vanduo Pirmasis buljonas i organini molekuli

8.4 pav. Milerio aparatas chemins evoliucijos vyksmams modeliuoti

priemonms, savitoms molekulms fermentams. Jie atlieka funkcikai kryptingus, tikslingus virsmus tam tikras biochemines reakcijas. Daugialsiuose organizmuose informacinio valdymo procedras atlieka hormon ir nervins struktros, kurios valdo visus kitus vykdomuosius organus griaui ir raumen, kraujotakos, virkinamojo kanalo veikl ir pan. Galima teigti, kad informacines procedras atliekantys signalai ir j funkcionavimo struktros lemia gyvybs esm. Gyvybs atsiradimas yra tiesiogiai susijs su iomis savybmis: 1. Polimerini nukleorgi molekuli kaip informacins atminties atsiradimu ir j ilgjimu. Tai lm atminties struktr informacinio talpio didjim. Todl valdant vyksmus atsirado galimyb iskirti tam tikr vien bsen i N galim. Jei n yra nukleorgties azotini bazi grandins ilgis, N = 4n, tai tokia atminties struktra turi informacin talp Q = log2 N = 2n bit. 2. Galimybe suformuoti tam tikr, turini funkcin prasm simbolini element i 4 azotini bazi A, G, C, T (arba U) idstymo tvark atminties struktrose. (Suformuoti diskreij simboli sek, kuri atspindt krypting funkcini veiksm program, projekt, t. y. turti sugebjim koduota forma urayti biotechnologins veiklos projekt). 3. Galimybe nukleorgi atmintyje koduot veiksm program (projekt) iifruoti dekoduoti, t. y. pagal azotini bazi sekas nulemti speciali gamybini element ferment rinkini, atliekanius kryptingus mediag ir energijos virsmus, gamyb.
372
BIOFIZIKA

4. Galimybe patikimai sintetinti nukleorgi azotini bazi sek atminties molekulse kopijas. ios simbiozikai susijusios procedros turjo atsirasti vienu metu, neatsiejamai nuo gyvybs, kartu. Informacini struktr btinum mainose, sugebaniose gaminti save panaias mainas (kopijuotis) ir net tobulintis, teorikai parod kompiuteri krjas matematikas Donas fon Noimanas (von Neumann) 19521953 m. Apie informacin nukleorgi paskirt biologinse sistemose tuo metu dar nebuvo raoma. Informacijos teorijos taikym funkcinei nukleorgi veiklai aikinti po met ar kit pirmieji pradjo D. Gamovas (G. Gamov), M. Yas ir H. Kastleris (H. Quastler). Pastarasis pradjo vertinti mikrorganizm informacijos talpio kiekyb. Tarkime, prokariotins lstels (bakterijos) DNR grandin (genom) sudaro 107 azotini bazi por, informacijos talpis yra Q = log2 410 000 000 = 2107 bit. Vadinasi, konkreti bakterijos veiklos genetin programa veiklos projektas, bt uraytas nukleorgtyje kaip vienas uraas i N = 410 000 000 =220 000 000 ~106 000 000 galim variacij. H. Kastleris teigia, kad tai didesnis informacijos kiekis, nei jo reikia bakterijai normaliai funkcionuoti. Jo manymu, tam pakakt apie 1000 bit informacijos. mogaus genomo, kuris turi apie ~3,2109 azotini bazi por, informacijos talpis yra apie 800 megabait (~ vienas CD). Vadinasi, skirting moni, kurie skiriasi nors viena azotine baze skaiius, daug kart virija atom skaii ms galaktikoje. Tikimybi teorijos poiriu, savaiminis atsitiktinis (stochastinis) susiformavimas turt bti nemanomas vykis. Tokie apytikriai kiekybiniai skaiiavimai, nors ir labai netiksls, rodo, kad gyvybs raidos vyksmo metu veikia specials organizacijos principai, mechanizmai, didinantys labai ma tikimybini vyki realias galimybes. Tai manoma tik dl speciali ir veiksming informacinio valdymo procedr.

8.3. BIOLOGINS RAIDOS VEIKSNIAI

Biologins raidos nemanoma suprasti nenustaius tikrj, gyvybei bding, vyksm ir veiksm: augimo; dauginimosi; kitimo; konkurencijos; kooperacijos; plros.
373
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Visi nurodyti veiksniai veikia kartu, tik tam tikromis evoliucijos stadijomis skirtingu stiprumu, kuris savo ruotu vis laik kinta. Organizmas organizuota sistema auga, kad susidaryt tam tikros molekulins struktros, organels ir organai, galintys visaveriai atlikti jiems skirtas funkcijas. Tik darniai veikiant organelms ir organams sistema gali pasiekti patikim savarankiko gyvenimo bsen, kai sistemos entropija ilieka nekintama, stacionari ar maja. Taiau organizmas, kaip ir visos realios mainos, visada susidvi. Veikia antrasis termodinamikos dsnis sistemos entropija neivengiamai didja ir organizmas turi suirti, mirti. Kad tokios ries organizmai ilikt, jie turi sugebti gaminti savo kopijas daugintis. Sudtingos mainos organizmo ideali tapai kopij gamyba nesuprantama be jos pagaminimo technologinio projekto genetins programos. Tokia programa gali bti urayta stabiliosios bsenos diskreiojoje atminties struktroje, semantikai abstrahuota kodine forma. Tik tikslia glausta forma ireikta organizmo programa (projektas) gali bti tiksliai kopijuojama. Tad organizmo dauginimuisi, pirmiausia btina tiksli ir stabili jo gamybos programa, ir taip pat reikalingi programos (projekto) informacinio kopijavimo mechanizmai, atliekantys tam tikras procedras mitoz, mejoz, spor ir skl gamyb. Toks biotechnologins programos (projekto) gyvendinimas dekodavimas ir yra organizmo augimo ir dauginimosi vyksmas. Norint suprasti biologin evoliucij, btina paaikinti vis didjant organizm sudtingjim, kuris lemia prisitaikomum adaptyvum. i savyb gyvendinama, jeigu organizmas daugindamasis gamina ne tik tiksl biotechnologins programos struktr kopijavim, bet atsiranda ir nauj variacij galimyb. Tam tikro organizmo variacija (modifikacija) nra biologikai svarbi, nes modifikuotam organizmui mirus ar uvus, va ir pakyiai. Projekto genetins programos pokyiai suteikia organizmui galimyb tvirtinti variacijas, dauginimosi vyksmu jas padauginti ir iplatinti aplinkoje. inoma, dauginimasis turi bti galingas dauginimasis geometrine progresija. Tik toks dauginimasis sukuria didjani populiacij ir gali garantuoti atitinkamos organizmo genetins programos sitvirtinim aplinkoje. Atsitiktiniai genetini program pokyiai mutacijos, sukelia tam tikras organizm vairovs galimybes. Taiau daug veiksmingesns specialios variacij sukrimo priemons lytinio dauginimosi mechanizmai. Lytinis dauginimasis specialiai vairina genetines programas, gen derinius pagal tam tikrus genetikos dsnius. Kartu per dauginimsi geometrine progresija, per tam tikras populiacij sveikas susidaro atrankioji adaptacija sudtingjimas, specializacija ir nauj funkcij atsiradimas. Remiantis nagrintu H. Puankar dviej sveikaujani populiacij dinamikos modeliu, kokybinmis j matricomis, galima pateikti galim raidos krypi schem kintant keturiems koeficientams (8.5 pav.). Tarkime, evoliucinuojanti sistema prasideda nepriklausomybs bsena, kai abi populiacijos nesveikauja, j nepriklausomos veiklos saviveikos (dauginimosi) koeficien374
BIOFIZIKA

KONKURENCIJOS

MUTUALIZMAS + + 0 + + + + + 0 + + 0 0 + + +

KOOPERACIJOS

KONKURENCIJA

+ +

PROTOKOOPERACIJA ++ ++

AMENSALIZMAS +0 + + 0+

NEPRIKLAUSOMYB

+0 0+

KOMENSALIZMAS + 0 ++ ++ 0+

+ + 0

+ 0 +

PARAZITIZMAS + ++ ++ + PLRNAS + + AUKA

AUKA + + PLRNAS

PLRA

8.5 pav. Bioekologin populiacini sveik schema, parodanti galimas sistemos raidos kryptis

tai 1, 2 yra teigiami, o j tarpusavio sveikos koeficientai yra lygs nuliui, t. y. 1= 2 = 0. Teigiamos tarpusavio sveikos lemia populiacij gyvybingumo didjim. Galima tiktis, kad viena i j pereis komensalizm ar kooperacij, t. y. 1 arba 2 bus teigiamas arba prads kenkti kitai (1 arba 2 bus neigiamas) ir susidarys amensalizmas ar net konkurencija (kai 1 arba/ir 2 bus neigiami). Komensalizmo sistemos gali evoliucionuoti dviem kryptimis: gali susiformuoti protokooperacija, kai populiacijos pasidaro labai gyvybingos (1 ir 2 yra teigiami), arba parazitavimas (1 arba 2 yra neigiamas). Protokooperacija, jei nepriklausomos saviveikos koeficientai 1 arba/ir 2 bna lygs nuliui arba net neigiami, evoliucionuoja mutualizmo link (1 ir 2 bna neigiami). Tolesn populiacij parazitavimo evoliucija gali paskatinti vien i populiacij sav saviveikos veikl mainti (koeficientai 1 arba 2 bus lygus nuliui), o toliau keiiantis iems koeficientams gali atsirasti plrnoaukos sistemin sveika. Kiekviena i ribini sveik forma suteikia evoliucijai savitas kokybines tendencijas ir galimybes.

375
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

8.4. SVEIK RAIDOS TENDENCIJOS (KOMPIUTERINIO MODELIAVIMO IVADOS)

Evoliucines tendencijas irykina tam tikri kompiuterinio modeliavimo rezultatai. Ypa verti dmesio loim teorija pagrsti modeliai, imituojantys atsitiktines (stochastines) sveikas ir parodantys evoliucijos padarinius. vairiai sveikaujanias dvi populiacijas ar du kokybikai skirtingus dinaminius vyksmus galima tyrinti kompiuterijos metodais, programikai. Populiacij raida modeliuojama kompiuterijos metodais, sukrus imitacines programas. Klasikinis loim teorijos, Kalinio dilemos udavinio sprendimas kompiuterinio modeliavimo metodu, pritaikomas populiacij sveikoms tirti. Tikimybinmis programomis sukuriamas klasikinis stochastinis loimas tarp dviej populiacij. Po tam tikros loimo trukms raundo kompiuteris rodo kiekvieno lojo laimjim rezultatus iloimo matric. Kalinio dilemos udavinys du nusikaltliai, laukiantys teismo, renkasi savo elgsenos taktik: ar vienas kit skandins kenks (konkurencija), ar vienas kitam pads (kooperacija), ar vienas kitam pads, o tas anam kenks (auka ir kenkjas sveika). Galimos ir vairesns situacijos, kai vienas kitam nei padeda, nei kenkia, t. y. nulins tarpusavio sveikos. Atlikus toki sveik modeliavim iloimo matricos rodo populiacij sveik tendencijas. Tokia apibendrinta rezultat matrica, atspindinti bendrsias situacijas, parodyta 8.6 pav., o konkretizuota balais 8.7 pav.

0
PLRA

PLRA

K S T I W I I P W T I I I S K R R K

KOOPERACIJA K

D
KENKIMAS

PLRA
PLRA

8.6 pav. Konkurencijos, kooperacijos ir plros sveik stochastinio modeliavimo tam tikr situacij pavadinimai

376
BIOFIZIKA

0
PLRA
PLRA

K 0 5 1 2 2 1 1 2 5 2 3 2 2 3 0 3 2 3 3 3 2

KOOPERACIJA K

D
KENKIMAS KONKURENCIJA

PLRA

PLRA

8.7 pav. Konkurencijos, kooperacijos ir plros sveik vairi kombinacij stochastinio modeliavimo Kalinio dilemos metodu rezultatai

Vienas atskiras kvadratlis imituoja abiej tarpusavio sveikos situacijas. KK abu kooperuojasi, vienas kitam padeda. DD abu vienas kit skandina, abu kenkia, konkuruoja. DK plrnas ir auka situacija, vienas kitam padeda, o antrasis pirmajam prieingai kenkia. Vidurinis kvadratlis 00 atspindi visik nepriklausomyb. Dar galimos 4 papildomos situacijos, kai tik viena i j visikai nedaro takos kitai. Tai atitikt bioekologinius komensalizmo, amensalizmo ir parazitizmo sambvius. Vis pateikt situacij kiekvienos populiacijos ar individo elgsena gali bti vardyta arba jai suteiktas tam tikras prasminis kodinis elgsenos pavadinimas ir vertintas jo iloiamumas balais (8.6 pav.): T pagunda laimti kenkiant, kai kitas bendradarbiauja, kooperuoja plros situacijose; R kooperacijos atlygis, kur gauna populiacijos, jei abi bendradarbiauja, kooperuojasi: K komensalo atlygis u pagalb, jei kitas bendradarbiauja, kooperuoja; W amensalo laimjimas, kai kitas kenkia; I atlygis u nesikiim; P bausm, kai abi populiacijos kenkia viena kitai; S nauda kvailelio, kuris bendradarbiauja kooperuoja, kai anas jam kenkia. Konkrei aplinkybi atvejais danai galioja i gaut bal nelygybin seka: T > R K > W I > P > S.
377
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Konkretaus modelio iloimo matrica parodyta 8.7 pav. Akivaizdu, kad sistema geriausi rezultat pasiekia bendradarbiaudama, kooperuodamasi, viena kitai padedama, vertinama (R + R) = 3 + 3 = 6 balais. Blogiausias sambvis abipus konkurencija, visi vienas kitam kenkia, vertinama tik (P + P) = 1 + 1 = 2 balais. Nepriklausomybs sistema pasiekia tarpini rezultat, vertinama (I + I) = 2 + 2 = 4 balais. Vadinasi, remiantis i situacij modeliavimo duomenimis, tenkinama nelygybin seka R > I > P. Taiau plros situacijomis, kai vienas kenkia, o kitas kooperuoja, sistemos nauda yra (T + S) = 5 + 0 = 5. Apibendrinant i savyb galima ireikti nelygybmis: (T + S) < 2R, kur T >> S ir T > R. Modeliavimas kompiuteriu rodo, kad: pati veiksmingiausia visai sistemai sambvio forma yra kooperacija; pati veiksmingiausia tam tikrai populiacijai (individui) sambvio forma yra pra, jai bnant plrnu; pati neveiksmingiausia sambvio forma visai sistemai yra konkurencija; pati neveiksmingiausia sambvio forma tam tikrai populiacijai (individui) yra pra, jai bnant auka. ios savybs lemia gyvybs evoliucijos tendencijas. Aiku, labai sunkiomis bties slygomis visos populiacijos gali ilikti ir didti tik kooperuodamosi. Tai rodo mutualizmo dinamini vyksm fazinis portretas. Mutualizmas susikooperavusi pavieniai nykstani populiacij forma, lemia arba abiej populiacij visos dinamins sistemos inykim, jei tarpusavio j pagalba per maa, arba vis ilikim ir klestjim esant pakankamo dydio abipusei pagalbai. Antruoju atveju populiacijoms pasidarius gyvybingoms, j saviveikos koeficientams tapus teigiamais, sistemai perjus i mutualizmo protokoopracijos bsenas, natraliai prasideda parazitavimas. Kai kurios i i kooperacijos bdu sveikaujani populiacij pradeda mainti tarpusavio kitoms populiacijoms pagalb arba net pradeda kenkti. Tai naudinga kenkianiajai parazituojaniai populiacijai. (Kenkianioji pradeda gauti 5 balus vietoje 3). Atsiranda plra dinamin plrnas ir auka sistema. Kenkianioji plrno populiacija suklesti inaudodama padedanij populiacij, maindama jos veiksmingum. Visos sistemos veiksmingumas maja. inoma, vienai i j parazituojant ar plrnaujant sukelia aukos eksploatuojamosios populiacijos reakcij, pagalba kitai populiacija keiiasi pagalbos mainimo ar kenkimo tendencij kryptimi. Pradeda veikti kitas sambvio principas kaip tu man, taip a tau. Dinamin plros sambvio sistema virsta konkuruojania, neveiksmingiausia visos sistemos poiriu. Bendresniu disipatyvij sistem teorijos
378
BIOFIZIKA

poiriu konkuruojani populiacij sistema rieda galimos potencialins duobs dugno link, o kooperuojani sunkiai laikosi galimo potencialiojo kalno virnje. Sveikaujani dinamini sistem galimos raidos analiz rodo, kad: pati veiksmingiausia kooperacijos sambvio forma yra nestabiliausia; stabiliausia, bet neveiksmingiausia visuotins konkurencijos sambvio forma; plros sambvis naudingiausias tam tikrai populiacijai plrnui. iais kompiuterinio modeliavimo bdais irykinti dinamini sistem dsningumai taikytini nesudting biologini populiacij, chemini ir biochemini reakcij, susidedani i dviej sudedamj dali, vyksmams aikinti. Daugiakomponeni ir netiesini dinamini sistem atvejais, jei sveik ir saviveik koeficientai keiiasi, susidaro visikai naujos kokybins dinamini sistem savybs. Atsiranda sistemos, turinios katastrof ir chaoso savybi. Sakoma, sistemos evoliucionuoja sudtingdamos. Daugiakomponeni sveikaujani sistem kompiuterinio modeliavimo rezultatai rodo, kad vyraujant konkurencinms sveikoms, dauginantis struktroms bdinga smulkjimo skaidymosi (diferencijavimosi) tendencijos, o vyraujant kooperacinms dinamins sistemos struktra didja, paviens dalys jungiasi, integruojasi. Aptartos populiacij sambvio savybs apibdintos remiantis tiesiniais matematiniais modeliais. Netiesiniai Lotkos ir Volteros modeliai rodo kokybikai panaius dsningumus, taiau jie tiksliau atitinka tikrov. Netiesini dinamini sistem tam tikras galimas raidos tendencijas galima velgti nagrinjant klasikinius modelius, fazinius j portretus. Tiesa, netiesini dinamini sveikaujani populiacini sistem fazini portret sudarymas bendruoju atveju gana sudtingas udavinys. Be to, tai ypa sunku, jei saveikaujani populiacij yra daugiau kaip dvi. Dar sudtingiau, kai bandoma vertinti tarp populiacij signalinius ryius ir j tak bendriems ir tam tikriems kiekvienos populiacijos vyksmams, kai populiacijas veikia informacinis valdymas. iuo metu tinkam tokioms sveikoms tyrinti veiksming metod dar nra sukurta. Tokioms sistemoms tirti vartotinos specialios kompiuterinio modeliavimo programos. Paprasti klasikiniai tiesiniai ir netiesiniai modeliai, tradicins matematikos ir kompiuteriniai metodai padeda pastebti vis trij ribini sambvio form evoliucini padarini bsimsias tendencijas. Galima numatyti, ko tiktis i konkurencijos, ko i kooperacijos ir ko i plros.

379
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

8.5. KONKURENCIJA TIK STABILIZUOJA IR TOBULINA

Daugiausia itirtas ir rykiausiai matomas dinamini vyksm ir sistem sambvis konkurencija geriausiai atspindimas faziniais portretais (8.8 pav.). Kaip jau apibrta tai dviej ar daugiau aktyvi dinamini vyksm, kurie dauginasi sveika, kai vienas kitam kenkia. Kenkia tuo, kad gyvendami visi kartu toje paioje erdvje (nioje), naudojasi tais paiais baigtiniais itekliais savo aktyvumu vienas kitam sunkina bt. Jie vienas kito tiesiogiai nenaikina (nevalgo), bet netiesiogiai, per itekli stygi, tarp i vyksm natraliai vyksta vadinamoji konkurencin kova. Vyksmas, kuris greiiau ir daugiau sunaudoja itekli, ir bna vyraujantis toje erdvje (nioje), stengiasi visus kitus i ios nios istumti. Tai teigia inomas Gauzs dsnis. i savyb bdinga biologinms, ekonominms ir kitoms sistemoms. Balno tipo fazinis portretas ir jo orientacija koordinai ai atvilgiu rodo vyksm galimyb ir Gauzs dsningumo realum. Konkurencikai sveikaujantys X(t) ir Y(t) vyksmai pltosis pagal i fazini portret pavaizduotas tendencijas. Tai priklauso nuo tam tikr slyg stipri tarpusavio konkurencijos koeficient ir i kokios pradins bsenos sistema pradeda raid. Reals vyksmai kiekybikai vertinami tik teigiamaisiais dydiais ir j kiekiai negali bti neigiami, todl fazinio portreto balno orientacija koordinai sistemoje bus tokia, kad vyksmo raida visada bus nukreipta kuri nors vien a, t. y. vieno konkretaus vyksmo didjim. Vadinasi, vieno vyksmo, kurio a atsirm ar labai prie jo priartjo, yra labai daug, o kito visai nra arba yra labai maai. Taip atsiranda dinamia) b)
Y

YS

Y0 Y0

X0

XS

X0

8.8 pav. Konkurencinio sambvio dinamini sistem faziniai portretai balnai tiesini (a) ir netiesini (b) sveik atvejais

380
BIOFIZIKA

ns sistemos trigerinis reikinys, kuris ir rodo Gauzs dsn. is dsningumas galioja ir daugiakomponentei sistemai. I daugelio populiacij, kurios konkuruoja, taip pat iliks tik viena, kuri veiksmingiausiai naudos iteklius, bus geriausiai prisitaikiusi gyventi tomis slygomis. Vadinasi, atsivelgiant itekli naudojim, ji toje nioje yra adaptyviausia. Esant labai silpniems konkurenciniams ryiams arba itekli pertekliui, trigerinis balno efektas negalioja, dinamins sistemos fazinis portretas bna stabiliosios bsenos mazgas, raida vyksta disipacins duobs link. Visi vyksmai atsiranda pagal savus dsningumus nepriklausomai balno centro vietoje susidaro stabilusis mazgas. Vertinant konkurencins sistemos raid sudtingumo poiriu, sistema paprastja, irykina vienos populiacijos, jos savybi svarb ir menkina kit reikm. Tokiai dinaminei sistemai bdinga monopolizacija, nioje pradeda vyrauti tik viena populiacija, viena savyb. Sistema virsta vienre. Taiau ios populiacijos savybs geriausiai atitinka to laikotarpio ni, populiacija yra tobuliausia tomis slygomis. Aiku, didels sudtingos dinamins sistemos galimybi vairov priklauso nuo jos sudedamj dali, populiacij vairovs. Gali bti populiacij labai daug, bet jeigu j savybs vienodos ar beveik vienodos, galima sudaryti didiul sistem. Toki sistem galimybi vairov labai ribota. Jos geriausiai prisitaikiusios tik prie tos nios, bet bna labai paeidiamos pakitus aplinkai, aplinkos slygoms. Konkurencins sistemos yra paprastos, stabilios, konservatyvios ir gana tobulos atlikdamos joms tinkanias funkcijas. Evoliucijos metu konkurencija atlieka kokybs filtro funkcijas palieka tik paprastus, veiksmingus, bendruosius, konservatyvius vyksmus ir sistemas. Ir nepakenia (netoleruoja) i t pai itekli gyvenanios vairovs. Tai yra silpniausia biologini konkurencini sistem savyb, nes gamta vis laik keiiasi ir gyvybei ilikti reikia kitokias savybes turini populiacij. Tokiais atvejais gelbsti kooperacija.

8.6. KOOPERACIJA LEMIA NAUJAS KOKYBES

Kooperaciniam populiacij sambviui bdingos prieingos konkurencijai savybs. Kooperacija simbioziniai sambviai simbioz (mutualizmas), simbioz (protokooperacija) net simbioz (amensalizmas). Tai tokios dinamins sistemos, kai visos sistemos dalys, populiacijos vienos kitoms padeda, tarpusavio sveikos koeficientai teigiami arba vienas i j gali bti labai maas, net nulinis. Fazinis kooperacins sistemos portretas, kaip ir konkurencijos atveju, yra toks pats balnas, tik koordinai ayse kitaip orientuotas (8.9 pav.). Tai visikai keiia funkcin sistemos raid. Protokooperacijos sambvio metu, kai visi ryi tarp sudedamj dali, populiacij koeficientai teigia381
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

a) a
Y [XY] YS

b) b
Y

[XY]

Y0 Y0

X0

XS

X0

8.9 pav. Kooperacijos mutualizmo dinamins sistemos sambvio tiesins (a) ir netiesins (b) faziniai portretai

mi, visos populiacijos vystosi didjant. Tiesa, mutualizmo atvejais, t. y. toki sambvi, jei yra neigiamas populiacij aktyvumas, neigiami saviveikos koeficientai, populiacijos silpnai kooperuojasi ar net nesikooperuoja, jos nesugeba i aplinkos pasiimti didesni itekli, visa kooperacin sistema nyksta. Vis sistemos sudedamj dali, populiacij tankis proporcingai artja nulio link. Patenkinus ilikimo slygas, kai dinamins sistemos bsena perkopia per skiriamj fazinio portreto rib skiriamj potencialj kalnagbr, visa sistema didja audringai, nestabiliai, proporcingai didja abi sudedamosios dalys, abi populiacijos. Toks pat dsningumas galioja ir daugiakomponentms dinaminms sistemoms. Ni upildo populiacij vairov. Padarinys didja tikimyb susidaryti sudtingesnms organizacijoms, susidarant vairiausiems agregatams i skirtingas savybes turini sudedamj dali. is vyksmas lemia nauj darini, turini naujas kokybines savybes atsiradim. Kooperacija lemia biologin simbiogenez, kuri nemanoma konkurencinse susiskaldaniose sistemose. I kibernetikos inoma kooperacinio sambvio nelygyb, dar vadinama H. Fiorsterio (H. von Frster) btina kooperacinio sambvio ilikimo slyga ar nelygybe. Btinas reikalavimas, lemiantis stabil koperacijos ilikim, yra ireikiamas nelygybe: (X & Y ) > (X ) + (Y ). ia X(t) ir Y(t) tam tikr vyksm, dinamins sistemos sudedamj dali, populiacij kintami dydiai. J kooperuota sistem (X &Y ). Kiekvieno j sugebjimai pavieniai atlikti funkcij, pavyzdiui, daugintis, yra (X), (Y ). Kooperacijos nelygyb teigia, kad kooperacinis sambvis iliks patvarus, jeigu kooperuotos sistemos
382
BIOFIZIKA

sugebjimo siekio funkcijos (X & Y ) galimyb bus didesn nei pavieni sudedamj dali, populiacij galimybi suma. Ir juo i nelygyb didesn, juo kooperacin sjunga stipresn. i nelygyb taikytina ir daugiakomponentms sistemoms:
&X i > { ( X i )} , i i

kur Xi yra kooperacin sistem sitraukusios tam tikros sudedamosios dalys, populiacijos, atliekanios skirtingas funkcijas, bet siekianios to paties bendro tikslo funkcijos . i kooperacijos samprata atskleidia ir skirting sudedamj dali, populiacij funkcin specializacij. Aikinantis gamtos, ypa gyvosios, sudtingjimo savyb per evoliucijos vyksmus, kooperacija yra viena i svarbiausi. Taiau jos nepakankama visiems rekiniams suprasti. Savita simbiozin savyb bdinga plrnas ir auka sambvio sistemai. Ji daug kuo papildo funkcin simbiogenezs evoliucij.

8.7. INFORMACIJA IR VALDYMAS, PAGRSTA PLRNO IR AUKOS SVEIKA

Plrnas ir auka dinaminio sambvio sistema yra taip pat simbiozin sistema, nes abi sudedamosios dalys, populiacijos negali viena be kitos egzistuoti, pildydamos vienos kitas, labai rykiai pasiskirsto atlikti skirtingas funkcijas. J btis kartu bna abiem populiacijoms funkcikai reikalingos (8.10 pav.). Biologijoje i sambvio forma atlieka reguliavimo funkcijas. Plrnas, maitindamasis auka-producentu, yra geometrine progresija besidauginanios aukos-producento reguliatorius, ribojantis jo tank erdvje (nioje). Toki sistem matematiniai modeliai yra kaupianiosios (integruojanios) grandys, turinios netiesinius neigiamuosius grtamuosius ryius. Ryiai, j koeficientai, lemiantys udarj fazin portret, rodo reguliacines dinamins sistemos savybes. Nes nei viena, nei kita sudedamoji dalis, populiacija nei inyksta, nei nerealiai didja iki begalybs. Juo udaroji fazin sistemos trojektorija statesn, siauresn ir prisiplojusi apie reguliuojamo vyksmo siekiamo dydio tikslo X0, juo geresns reguliavimo savybs. Idealus atvejis, jei pasiekiamas fazinis portretas stabilusis mazgas take X0. Tokios dinamins sistemos plrno grandis bna tarsi tam tikras sistemos bsenos valdytojas jungiklis: producento-aukos kiek X didina, jei X(t) < X0, ir maina, jei X(t) > X0. Grtamieji ryiai suformuoja dinamin slenkst X0, kuris atspindi dvi dinamins sistemos bse383
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

nas: X(t) didinti, X(t) mainti. Grtamojo ryio kanalas yra informacinio valY(t) dymo, arba kitaip vadintinas kodavimo ir dekodavimo kanalu. Toks paprastas dviej bsen, arba apie vien bit perAUKA duodantis informacijos kanalas, apkaX(t) bindamas valdomj objekt auk, j ITEKLIAI valdo reguliuoja. iuo atveju plrnas Y(t) atlieka informacijos neiklio Y signalo funkcijas, nes jo kiekis visada Y0 bna daug maesnis nei aukos. Tokios plrnas ir auka dinamins X 0 sistemos, turinios netiesinius neigiamoX0 jo pobdio (sveik enklai +, ) grtamuosius ryius, gali evoliucionuoti sudtingas informacinio valdymo siste8.10 pav. Plrnas-auka sambvio schema ir fazinis mas. J grtamojo ryio kanale susiforjos portretas muoja receptorins kodavimo struktros, plrno grandis virsta informacijos perdirbimo grandimi, turinia atmint, o jos ijimo struktros, kaitaliojanios aukos grandies bsenas, virsta dekoderiais. Taip simbiozins plrnas ir auka dinamins sistemos gali gyti visikai naujos kokybs informacines valdymo, kodavimo ir dekodavimo savybes, kuriomis sistema gali atlikti funkcikai tikslingus veiksmus. Daugiakomponents tokio sambvio sistemos gali formuoti hierarchines kodavimo ir dekodavimo struktras. Atsirads toks dinamins sistemos kodavimo ir dekodavimo sambvis kartu lm sudtingas valdymo procedras, atitinkamas organizm valdanias struktras. Plrnas ir auka simbioz, tai tokios naujos kokybs atsiradimo itakos, kurios suteikia galimyb atsirasti organizuotai sistemai ir gyvybei. Aptarti sveik principai turjo lemti organizuotos sistemos gyvybs atsiradimo, biomolekulins simbiogenezes ir net daugialsi organizm raidos prielaidas.
PLRNAS

8.8. BIOMOLEKULIN SIMBIOGENEZ

Chemogenezs vyksmas modeliuojant biologins raidos pradi, organini chemini jungini atsiradim, akivaizdiai rodo tikras struktr sudtingjimo galimybes. Visi sudtingi bioorganiniai junginiai, nukleorgtys ir baltymai yra neorganizuotos sistemos. Joms visikai taikytina antrojo termodinamikos dsnio formuluot, kad j entro384
BIOFIZIKA

PIRMINS LSTELS SIMBIOGENEZ KOOPERACIJOS PRINCIPAIS AGREGUOJANT MEDIAG ir ENERGIJOS VIRSMUS, TURINIUS INFORMACINI KODAVIMO IR DEKODAVIMO PROCEDR EOBIONTAS

PIRM. LSTEL

DNR

PROTOBIONTAS

r-RNR

KOACERVATAS

m-RNR t-RNR RNR DNR

ORG. MOLEKULS

C H E

M O G E N E Z

8.11 pav. Hipotetin teorins lstels genezs schema (V. vemleris)

pija didja, laikui bgant molekuls irsta, skyla. Taiau tam tikromis slygomis, atsitiktini vyki situacijomis, galimi ir sudtingjimo atvejai. Gyvyb rodo reali galimyb i organini jungini ems slygomis sukurti organizuot sistem lstel, kuri sugebt ne tik entropij palaikyti nekintam, bet dar j ir mainti, t. y. augti ir daugintis. Tokios teorins hipotetins lstels susiformavim mokslas sivaizduoja kaip nuosekl sudtingjimo vyksm, prasidjus nuo koacervat susidarymo (8.11 pav.). Koacervat susidarymas i riebalini rgi, baltym ir kit organini jungini jros vandenyje elektrolitins terps pirminiame buljone, dideli neaikum nesukelia. Pagrindinis klausimas kaip koacervat struktras siterpia informacines procedras atliekanios nukleorgtys. Biomolekulinio koacervato evoliucija iki pirmins lstels matoma per tris pakopas. Jas nulemia tai, kurios nukleorgtys susirenka: 1. Protobiontu vadinamas koacervatas, kai j siterpia informacin m-RNR ir pernaos t-RNR. 2. Eobiontu vadinama struktra, kurioje papildomai probionto struktroje atsiranda ribosomins r-RNR, ribosominis kompleksas.
385
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

3. Pirmin lstel susiformuoja tada, kai eobionto struktroje atsiranda deoksiribonukleorgtis DNR. Toks lstels formavimosi vyksmas, atsirads susikooperavus trims bioorganinio sudtingjimo vyksmams, rodo informacini procedr, kurias atlieka ribonukleorgtys ir deoksiribonukleorgtys, svarb. Molekulin nukleorgi evoliucija M. Eigeno (M. Eigen) ir P. usterio (P. Shuster) nuomone prasidedama nuo RNR. Remiantis pateikta pirmine lstels formavimosi hipotetine schema, pirmoji informacin procedra, lmusi gyvos lstels raid, yra RNR ir baltym vienalaik polimerizacija. Ji dar kitaip vadinama vienalaike polipeptid polimerizacija ant nukleotid.
NT-NT-NT-NT-NT-NT-NTX AR-AR-AR-AR-AR-AR-ARAR AR aminorgtys NT NT nukleotidai

Atsiradusios tokios dvi polimerins linijins struktros, kuri sekoje gali kaitaliotis kitokie elementai, jau gali bti panaudotos tam tikra tvarka sudliot simboli rinkini, sek informacijai saugoti, t. y. atminties funkcijoms. Be to, manoma, kad tokiu bdu susiformavusi pirmin RNR buvo replikacijos savybs pradinink. Vadinasi, kartu RNR galjo atlikti tam tikr sek atmintyje esani informacij kopijuoti ir dauginti. Tokia savaimin paprasta RNR replikacija parodyta 8.12 pav. Ji rodo struktr, sek kopijavimo mechanizm atsiradim. Tokia savaimin paprasta replikacija yra matricins sintezs prototipas. Jis vyksta komplementins sintezs principu, t. y. naujoje sekoje atsirandant element lemia jo struktr papildantis: urocilas U adenin A, citozinas C guanin G ir atitinkamai atvirkiai. Bendruoju informacinio kodavimo poiriu itokia RNR struktra labai svarbi, nes linijinje grandinje gali bti kaitaliojami daugiau kaip 2 skirtingi elementai. Tokiose struktrose jau galima informacij fiksuoti, kaupti apie paios sistemos ar atspindti apie kit sistem bsenas. Vadinasi, joje jau slypi kodavimo ir dekodavimo galimybs. Be to, replikacins savybs suteikia dar vien funkcin privalum atminties kodini kombinacij informacijos dauginimo galimyb. Gaminant informacines kopijas, jos iplatinamos aplinkoje. Savaimin replikacija vyksta gana ltai. Tad per evoliucin sudtingjimo vyksm turjo atsirasti replikacijos greitinimo mechanizmai. RNR ir polipeptid polimerizacija gali vykti sinchronikai, vieniems su kitais sveikaujant. Galima sivaizduoti ir paprast transliacijos procedros schem (8.13 pav.).
386
BIOFIZIKA

AGCUAGCU AGCUAGCU UCGAUCGA UCGAUCGA

+ +
AGCUAGCU UCGAUCGA

+i

RNR

8.12 pav. Paprasta RNR replikacija ir tam tikros jos schemos

ioje schemoje jau yra visas sintetinimo priemoni ferment rinkinys, pagreitinantis ir didinantis funkcin speciali molekulini struktr priemonmis: replikazmis, kodazmis, sintetazmis. Visos ios priemons darniai kartu vykdo primityvi RNR transliacij. Kooperacinio saudtingjimo simbiogenzs principu tokios transliacins struktros taip pat evoliucionuoja ir sudaro didesnius funkcinius agregatus hiperciklus.

REPLIKAZ FERMENTAI KODAZ

RNR

SINTETAZ

8.13 pav. Paprastoji RNR transliacija

8.9. HIPERCIKLAI

Hiperciklai tai udara informacini procedr grandin, aikinanti darni nukleorgi ir ferment veikl. Paprastasis hiperciklas, sudarytas i dviej sveikaujani transliacijos struktr, turini mutacij galimybes, parodytas 8.14 pav. Tokia, nors gana ir paprasta, dinamin sistema, gyja daug daugiau galim bsen, gali bti atminties struktra. Be to, esant mutacijoms, galimi svarbs evoliucijai, RNR sek pokyiai. Jie lemia tolesn hipercikl raid susidaro vientisos pakitusios udarosios grandins. ie vyksmai sukuria didiules, programikai prasmingai sujungtas dinamines sistemas, atliekanias daugyb vairiausi krypting biomolekulini sintezi, galini tenkinti organizuotos sistemos reikalavimus.
387
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

REPLIKAZ 1

REPLIKAZ 2

+ +
FERMENTAI KODAZ SINTETAZ 1

+ +

RNR

MUTACIJOS

RNR

FERMENTAI

KODAZ SINTETAZ 2

8.14 pav. Paprastasis hiperciklas

E1

+i I1 + i En i

i + i I2 In Ii +i i i E2

Ei

8.15 pav. Hiperciklin nukleorgi ir ferment informaci ryi sistema

Kaip rayta, ferment ir nukleorgi simbiozs galimo atsiradimo model, vadinam hiperciklais, yra pateik M. Eigenas ir P. usteris. Sudtingesnio hiperciklo apibendrinta schema pateikta 8.15 pav. Laikoma, kad tam tikroje erdvs vietoje erdvskyroje vyksta daugyb savarankik komplementari nukleorgi (+Ii , <=> Ii ), ciklikai pasikartojani RNR sintezi replikacij. Aiku, jas veiksmingai greitai turi vykdyti specials fermentai RNRpolimerazs. Prie kiekvienos RNR vyksta transkripcija. Po jos, naudojant speciali ferment RNR priklausom RNRpolimeraz, informacija per388
BIOFIZIKA

raoma informacins m-RNR struktr, o i ribosomose, kaip transliacijos padarinys, perkoduojama ferment Ei struktras. ie fermentai Ei yra kito ciklinio proceso RNR polimerazs katalizatoriai, t. y. atlieka kito komplementaraus polinukleotidinio ciklo Ii +1 sintez, kuris savo ruotu yra dar kito Ii +2 ciklo RNRpolimerazs sintezs pradininkas, ir t. t. kol usidaro visa udaroji grandin. Hiperciklams bdingos ios savybs: 1. Stabilumas vis dalyvaujani ciklinio vyksmo molekulini struktr ilikimas. 2. Vis molekulini struktr proporcingas daugjimas. 3. Konkurenciniu santykiu su kitais, nedalyvaujaniais iame hipercikle, replikacijos ciklais. 4. Hiperciklas gali didti arba mati. Tai priklauso nuo atrankos sukeliamo poveikio. 5. Hiperciklai gali sudaryti auktesnio lygio tinklus. 6. Hiperciklai konkuruoja tarpusavyje. Hipercikl atsiradimas kelia daug neaikum. ios hipotezs autoriai M. Eigenas ir P. usteris teigia, kad pirmoji save gaminanti replikuojanti molekulin struktra buvo pernaos t-RNR, sudaryta madaug i 100 nukleotid. Hiperciklas, atsirads ar susiformavs koacervate, tokiai struktrai jau suteikia protobionto savybi (8.16 pav.).

+i I + i E i

i + i I In Ii +i i i E

8.16 pav. Paprastoji prolstel protobiontas

389
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Hiperciklin dinamin struktra, terpta membranos atribot erdvskyr, jau vykdo replikacijos, transliacijos ir operon veiklos procedras. Toki struktr jau galima vertinti kaip organizuotos sistemos prototip paprast prolslel protobiont. Joje vykstantys fermentini reakcij vyksmai yra funkcikai kryptingi, tikslingi ir koordinuojami. ioje sistemoje yra pagrindiniai molekuliniai agregatai, reikalingi organizuotai sistemai funkcionuoti. Kad bt galima suformuoti vis biologins lstels model, dar reikalingos bent dvi evoliucins pakopos genetinis kodas ir atminties didjimo galimybs.

8.10. GENETINIO KODO SUSIDARYMAS

Genetinis kodas yra btinas, kad bsimj molekulini virsm funkcikai tikslingo tinklo programinis projektas bt atsispindtas tam tikros atminties struktroje. Genetinio kodavimo susiformavimas susijs su ribosom mechanizm susidarymu. Molekulins evoliucijos teoretik nuomone, pirmiausia turjo susidaryti paprasiausias vienos padties simpletinis kodas. J lDvivij RNR spiral m pernaos t-RNR (8.17 pav.). Manoma, kad pirminiame buljone, vykstant RNR ir baltym simbiozinei NAKTIS DIENA polimerizacijai, susidaro dvivijs RNR spirals. Nakties metu, kai atvsta, vyrauja dvivijs RNR spiralins struktros, o m-RNR dien, kai karta jos isiskiria. Ant j, kaip m-RNR matric, gali vykti baltyt-RNR m polimerizacija, naudojant pernaos AR t-RNR. Tokia procedra sukuria paprasSimpletinis kodas iausi vienos padties simpletin kod ir virsta transliacijos pirmtaku. is vyksmas lemia keturi aminorgi grupi 8.17 pav. Hipotetins protobionto RNR simpletinio kodo susidarymo schema susidarym (8.1 lentel).
8.1. lentel. Hipotetinio pirminio simpletinio kodo lentel
xUx Phe; Ile; Leu; Val; Ser; Thr; xCx Pro; Ala; Glu; xAx Asp; Lys;? xGx Arg; Gly; ?

390
BIOFIZIKA

ias keturias pirminio kodo grupes nulemia fizikochemins aminorgi savybs: pirmj grup hidrofobikumas; antrj grup poliarikumas; treij grup rgtins savybs; ketvirtj grup bazins savybs. Sudtingjimo vyksmo metu simpletinis kodas virsta dubletiniu kodu. iuo atveju dvi pirmosios kodono padtys lemia atitinkam aminorgt. Aiku, dubletinio kodavimo atveju yra tik 42 = 16 skirting simbolini rinkini. J yra per maai visoms aminorgtims koduoti. Dvivij RNR ar DNR spiral Dubletinio kodavimo procedros bdingos eobionto struktrai. Joje jau NAKTIS DIENA yra susidariusios ribosomos transliacijos procedras atlieka ribosomins r-RNR su r-RNR kartu su baltymais (8.18 pav.). baltymais Dubletinis kodas yra gana atrankus m-RNR (selektyvus) ir savitas. Jis pateiktas lent-RNR telje i 16 kodon (8.2 lentel). Eigeno ir usterio nuomone, treioji AR kodono padtis yra laisvesn. Joje gali bti: Dubletinis kodas arba tripletinis kodas x => purinai ar pirimidinai; y => pirimidinai; 8.18 pav. Eolstels ribosominis kompleksas z => purinai. Tripletinis kodavimas susidaro, kai pagrindin RNR pakeiiama patvaresne (stabilesne) DNR struktra. Tripletikumas prasideda treiuoju sudtingjimo simbiozi8.2 lentel. Hipotetin dubletinio kodo lentel
UUy: => Phe; UUz: => Leu; UCx: => Ser; UAy: => Tyr; UAz: => Stop; UGy: => Cys; UGA: => Stop; UGG: => Trp; CGx: => Arg; AGy: => Ser; AGx: => Arg; GGx: => Gly;

CUx: => ? AUy: => Ile; AUA: => Ile; AUG: => Met; GUx: => Val;

CCx: => Pro;

ACx: => Thr; GCx: => Ala;

CAy: => His; CAz: => Gln; AAy: => Asn; AAz: => Lys; GAy: => Asp; GAz: => Glu;

391
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

niu ingsniu, eobionto struktrai susikooperavus su savarankikai susidarania bioorganine DNR. Pirmins lstels eobionto ribosomins struktros, kooperuotos su DNR, panai kaip ir su RNR schema pateikta 8.18 pav. Susidaro pirmins lstels struktra: dvivij RNR spiral pasikeiia patvaresne, galinia sudaryti daug ilgesn ir stabilesn linijin DNR struktr. Ji per transkripcijos procedras perduoda kodin sek, nea informacij ir j perduoda ribosomas transliacijai perkoduoti kitu, aminorgi kodu. Molekulin DNR struktra, pakeitusi RNR, virsta pagrindine gyvj organizm genetins informacijos atminties struktra.

8.11. NUKLEORGI ILGJIMAS GENETINS ATMINTIES DIDJIMAS

Viena pirmj slyg, kurios turi bti patenkintos aikinant biologin prisitaikomum adaptyvij raid, turi bti atminties talpos didjimas. Jeigu laikoma, kad pagrindin organizmo lstels atmintis yra genomas, genetin atmintis slypi nukleorktyse, vadinasi, jos didjim turi lemti nukleorgi polimero ilgjimas. H. Kastlerio (H. Quastler) nuomone, tai gali vykti komplamentariosios polimerizacijos bdu (8.19 pav.). Vienasilio polinukleotido polimerizacija P turjo vykti labai ltai, o hidroliz greitai. Tai negaljo nukleorktims NR suteikti struktros patvarumo ir stabilumo. Taiau dvisilio polinukleotido struktra yra labai stabili. Ji gali susidaryti daug didesniu greiiu komplamentariosios KP matricins sintezs bdu P + KP. Taip pat atsiranda reali galimyb susidaryti stabiliai trisilei ar net ketursilei NR struktrai. Dvisils NR gali disocijuoti 2 vienasiles, arba net atvirkiai du, beveik panaios komplamentarioji struktros vienasils, gali susisukti dvisil.
T C G A T A G C T A T C G A T A G C T A A G C T A T C G A T

B
A G C T A A G C T A T C G A T

KP B KP P

KP B P

P KB KP

8.19 pav. Nukleorgties komplomentariojo ilgjimo schema

392
BIOFIZIKA

Taip gali susidaryti ir disocijuoti DNR ir RNR komplamentariosios struktra. I j susidaro daug komplamentari struktrini darini: 1. Asociacijos vienasils NR sudaro dvisiles. 2. Disociacijos dvisils NR suskyla vienasiles. 3. Dvisils NR susidaro i komplamentari vienasili ir papildom nukleotid. 4. Nukleotidai susidar irstant vienasilms NR. Galimas ir daug sudtingesnis NR ilgjimas, sujungiantis dvi NR siles trij nukleotid tilteliais. Taip gali susidaryti iedo formos NR. Be to, struktrin NR organizacija lemia NR galimyb susisukti spiral ir taip pat isisukti. Tokios savybs susisukusios bsenos suteikia NR stabilumo, ir taip pat galimyb vairiausioms matricinms sintezms isisukus. Taip pirminiame bulijone kartu galjo atsirasti ir susidaryti ir RNR, ir DNR informacins struktros. Molekulins biologijos teoretikai NR kinetik aikindami asociacij ir disociacij vyksmais, vyksm pusiausvyra, nustat tam tikr NR DNR, RNR sveik eigos dsningumus. is metodas virto genetins atminties informacini vyksm mechanizm ir tam tikr informacijos molekulini neikli signal evoliucins raidos pagrindiniu aikinimo bdu. Molekulins biologijos teoretik nuomone, tokiu bdu biosferoje atsirado lstels informacijos gavimo, saugojimo, perdirbimo (perkodavimo) ir siuntimo mechanizmai. Sisteminiu poiriu, tai tik paviens funkcins sudtingos organizuotos sistemos dalys. Norint organizm suprasti sistemikai, reikia nustatyti pagrindini informacijos sraut kelius.

8.12. PAGRINDINIAI ORGANIZMO LSTELS INFORMACIJOS SRAUTAI

Nukleorgtys RNR ir DNR turi unikali molekuli savyb gaminti savo komplamentarisias kopijas. Jos gyviesiems organizmams suteikia vien svarbiausi savybi daugintis, gaminti save panaius ir dauginti save gaminanias programas, projekt kopijas. Sugebjimas isaugoti NR struktros element azotini bazi sekos tvark veikiant aplinkai, t. y. bti atminties struktra, ir nulm nukleorgi informacini procedr atlikimo funkcij. Ilga polimerin DNR struktra, palyginti su RNR, yra daug patvaresn ir stabilesn fiziniams poveikiams, ypa jai esant kompaktikos dvivijs spirals bsenos. Todl DNR yra pagrindin genetins informacijos saugotoja. Simbiogenetinio sudtingjimo vyksmo metu RNR ir DNR pasidalijo funkcijomis,
393
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

AGCTAGCT AGCTAGCT TCGATCGA AGCTAGCT TCGATCGA

+i

i TCGATCGA

8.20 pav. DNR komplamentariojo kopijavimosi ciklinis vyksmas

taiau jos visos susijusios su informacini procedr veikla. J veikla taip pat susijusi ir su DNR kitais matricins sintezs reikiniais, be kuri replikacija nemanoma suprasti daug biologini vyksm. Kaip ir RNR, DNR taip pat turi komplaDNR mentariojo dauginimosi kopijavimosi savybi (8.20 pav.). Dl tam tikr fizini (pvz., temReversin peratros) arba speciali ferment poveikio dviTranskripcija transkripcija vij DNR skeliama iilgai, nutraukiami vandeniliniai ryiai, atsiranda dvi komplamentarioRNR sios vienasils DNR. Kartu ir tuo paiu metu fermentai DNR polimerazs, prie i viensiRNR replikacija li, kaip ant matric prijungia komplamentarisias azotines bazes. io vyksmo padarinys Transliacija gaunamos jau dvi tapaios DNR. Vyksmas gali vl kartotis, ir taip geometrine progresija vyksta Baltymai dvigubinimosi procedros. Realiose lstelse darni RNR ir DNR simbioz, naudojant speciali ferment rinkinius, atlieka pagrindines 8.21 pav. Pagrindini lstelje vykstani informacijos sraut schema informacines procedras, kurios vadinamos: DNR replikacija, RNR replikacija, transkripcija, reversine transkripcija ir transliacija. Visos jos sudaro tam tikr informacini sraut tinkl, kurio vienas svarbij veiklos rezultat transliacija, t. y. baltym sintez (8.21 pav.). Baltymai yra ne tik universali tam tikr organizmo mediag, yra j sudedamosios struktros dalys. Jie taip pat yra ir organizm darbo stakls vykdo metabolinius virsmus, mediag ir energijos perdirbimus ir taip pat bna signalais, kurie pernea informacij, dalyvauja valdant. Baltymai atlieka tam tikras bioinformacines procedras jie valdo, t. y. vykdo, dekodavim.
394
BIOFIZIKA

8.13. BALTYMAI FERMENTAI DEKODERIAI

Molekulin biotechnologija gana aikiai rodo baltym (ferment) atliekani tam tikras savitas reakcijas mediag virsmus svarb ir j tak gyvybs funkcionavimui. Didels baltymins molekuls ne tik greitina biochemines reakcijas, bet atlieka svarbias funkcijas atrenka ir vykdo tik tam tikrus, tik jiems pritaikytus molekulinius virsmus. Tai baltym molekulms suteikia informacinio valdymo savybi. Aiku, jeigu erdvskyroje bus tam tikras reikiam ri ferment rinkinys, bus vykdyta visa biotechnologinio vyksmo grandin. inoma, esant pirminiams substratams gamybos itekliams. Tie patys substratai, esant kitokiam ferment rinkiniui, gali bti naudojami kitokiems biotechnologiniams vyksmams atlikti. Keiiantis baltym rinkiniui erdvskyroje, keiiasi ir biotechnologinis vyksmas, keiiasi ir organizmo veiklos pobdis. Fermentai nepatvarios baltymins molekuls. Jos keiia savo ketvirtin ir tretin struktras, susidvi, trkinja, nyksta ir nebegali atlikti savo funkcij. Funkcionuojant organizuotai biologinei sistemai, juos reikia nuolat atgaminti (regeneruoti), t. y. sintetinti. Todl sintezei reikalinga speciali, stabili ir patikima informacija, saugoma atitinkamose atminties struktrose, kuri garantuot patikim tiksli atgaminam ferment struktr. Tarp atminties NR struktr ir vykdanij ferment E turi susidaryti simbioziniai ryiai. ie ryiai yra kodavimo ir dekodavimo procedr esm. Dalis dekodavimo vyksm organizmuose jau yra suprantama. Operono veiklos schema rodo svarbiausius prokariot dekodavimo kelius, padeda aikinantis eukariotini lsteli dekodavimo procedras. Galima suprasti hormoninio dekodavimo principus remiantis agent veiklos sistemose teorija. Taip pat atskleisti ir nervini struktr dekodavimo principai per sinapsinius j ryius vykdaniuosius neuronus ir lsteles. Kaip atsirado nukleorgi NR ir ferment E simbiozinis ryis, kaip susidar kodavimas kodai, kodonai, kodavimai ne tik lstelse, bet ir daugialsiuose organizmuose, kaip susiformavo genetins, hormon, nerv informacins dar yra daug neaikum. Kibernetikos adaptyvij valdymo sistem teorija, nagrinjanti prisitaikani sistem ir struktr veiklos principus, nurodo, kad tokie vyksmai manomi tik per grtamuosius ryius. Tokie grtamieji ryiai pirmiausia turi keisti paios organizuotos sistemos funkcin struktr informacinio valdymo programas, informacij atmintyje. J pakeitimas per dekodavimo procedras jau lemia veiksm keitimus, organizuotos adaptyviosios sistemos prisitaikomum. Grtamieji poveikiai keiia funkcionavimo algoritmus. Gyvj organizm kodavimo ir dekodavimo procedros daugiausia atliekamos specialiomis organizuot chemini ir biochemini virsm priemonmis, nes ir sudtingiausio daugialsio organizmo visa biotechnologin informacija projektas ge395
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

netin programa yra jo lstelse. Vadinasi, vien lsteli molekulini struktr rinkiniai ir j bkls yra atspindimos kitokiose molekulinse struktrose: vien vis laik kintani molekulini kompleks rinkiniai buvo atspindimi speciali, turini stabili organizcija molekuli (NR) struktroje taip, kad pastaroji savo bsena lemia kaip tik t molekulin rinkinio struktr. Taip vien molekulins organizacijos bsen atspindjimas specialiose atminties molekulinse struktrose vadinamas kodavimu, o ios atminties molekulins (NR) bsenos atspindjimas visos sistemos molekulinje struktroje dekodavimu. ioje schemoje parodyta, kad paprastesns molekulins organizacijos dinamin struktra erdvskyroje (lstelje), kurios bsenos apibdinamos kaip molekuli P1, P2,... Pi, ... Pn koncentracij rinkinys, yra nulemta auktesnio organizacinio lygio NR molekuli bsen, apsprendusi atitinkam ferment komplekto E1, E2, ... Ei, ... En sintez. is ferment komplektas gamina lstelei reikalingas mediagas, kurios savu ruotu gritamaisiais poveikiais daro tak stabilij atminties NR molekulinei struktrai ir taip pat lemia paprastesns organizacijos lygmens kitoki P1, P2, ... Pj, ... Pn molekulin sudt erdvskyroje. Toks tarpusavio sveikos vyksmas sukelia informacinio valdymo reikinius, kurie vadinami kodavimu ir dekodavimu. ia paprastesns organizacijos erdvskyros struktras galima vadinti realiu mediag ir energijos virsm posistemiu, o NR molekulin struktr formaliuoju informacijos posistemiu. Pastarojoje koduota forma atspindimos realios sistemos savybs funkcinis jos modelis. NR atlieka organizuotos sistemos atminties ir informacijos perdirbimo, sprendim primimo, valdymo funkcijas. Tokia dinamin sveikaujanti sistema, turinti gr-

Patvari stabilij bsen struktra NR molekul

8.22 pav. Hipotetin molekulinio kodavimo ir dekodavimo formavimosi schema

396
BIOFIZIKA

tamuosius ryius, jau gali palaikyti stabili erdvskyros organizacij ir pasiimti i aplinkos ar vidaus reikiamus substratus S, kurie dekoderi ferment E1, E2, ... Ei, ... En komplekto yra perdirbami funkcikai prasmingus mediag ir energijos virsmus. Taip formuojasi molekulin kodavimo semantika. iuo principu funkcionuojanios kodavimo ir dekodavimo sistemos atsiradimas jau galjo nulemti informacijos, reguliavimo, modeliavimo vyksmus ir net prognozuojant (anticipatorin) valdym, toki savybi atsiradim. Taip organizuota sistema jau gali garantuoti organizuotumo patvarum, bet dar neturi gyviesiems organizmams bdingos dauginimosi savybs. Sudtingos organizuotos sistemos, galinios daugintis, gaminti save panaius ir net tobulintis, pirmj teorin model pateik kibernetikos teoretikas Donas fon Noimanas (von Neumann).
8.14. NOIMANO AUTOMATAS, KURIS DAUGINASI Kaip rayta, 19521953 m. D. Noimanas pateik teorin model tokios sistemos automato (mainos) kuri sugeba gaminti save panaius ir net tobulinti. i sistema turi svarbiausias gyvj organizm savybes. Autoriaus nuomone, tokia maina turi bti sudaryta i trij pagrindini dali: A materialij gaminimo, vykdymo dali, ranki, stakli perdirbani mediagas, gaminani reikiamus elementus (detales) ir pernaos priemoni; I nuorod informacijos kuri lemia A dali valdym. A dalis tikslingai darniai, atsivelgdama informacines instrukcijas i I, atlieka reikalingas operacijas; B renginio nuorodoms informacijai kopijuoti ir perduoti kopijas kitoms kartoms. 8.22 pav. pateikta hipotetin molekulin dekodavimo sistema ir yra sudaryta i A ir I dali. Norint, kad ji dar ir gamint savo kopijas, reikia j papildyti treija nuorodas (informacij) kopijuojania B dalimi. Tokiu bdu kibernetin D. Noimano teorin maina tarsi gyvoji organizuota sistema GOS bus: GOS = < A + I + B >. Organizm atveju bt: A lstels arba organizmo knas, turintis atitinkamas materialisias funkcines struktras: fermentus, virkinimo, kvpavimo, judjimo organeles bei kitus organus; I informacija. Genomas genetins programos, uraytos DNR molekulse keturi simboli (A-adenino, G-guanino, C-citozino ir T-timino) kodavimo principu; hormon, nerv ir kitoki informacijos funkcionavimo princip sistemos.
397
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Tokia sistema galt gaminti tik savo kopijas, turinias labai maai pokyi. Ji negalt evoliucionuoti iekoti adaptyvesns aplinkai funkcins organizacijos ir veiklos princip. Kad i maina evoliucionuot, informacijos (nuorod I) dalis turi susidti i stabilios, nekintamos dalies Is , ir kintam nuorod F. Tada: GOS = <A + B + (Is + F)>. Atsitiktiniams ar kitokiems poveikiams pakeitus F nuorodas, kintam nuorod dalis F nulemt nauj tokias paias, panaias save ir taip pat gaminanias mainas, tik jau turinias kit ypatybi. Vadinasi, maina galt mutuoti ir evoliucionuoti, kad palikuonys bt kitokie negu j tvai. Remiantis biologiniais tyrimais, gyvajam pasauliui bdinga ne tik atsitiktiniai programiniai pokyiai mutacijos, bet ir specialios biologins priemons kintamumui didinti. Viena rykiausi lytinis dauginimasis, kuris yra akivaizdus dviej tos paios ries individ genetinje atmintyje saugojam program vairinimas, atsitiktinai derinant tam tikras j dalis informacines paprogrames. Visos ios informacinio pobdio naujovs turi sukurti funkcines naujoves, t. y. turi atsirasti naujos vykdanios struktros fermentai bei j ir kit molekuli, organoid, organ komplektai funkcijas atliekantys mechanizmai. Daniausiai funkcij atlikimo mechanizm veikla yra pagrsta baltym savybmis. Todl baltymai organizuot sistem teorijos poiriu yra pagrindiniai dekodavimo elementai. Tiesa, vienas baltymas organizme atlieka ma funkcij. Pavyzdiui, jeigu tretin arba ketvirtin baltymo struktra yra tam tikros komformacins bsenos, tai jis perdirba tik tam tikros ries molekul, permeta i vienos membranos puss kit proton, jon ir panaiai. Taiau tam tikras operacijas atliekani toki element rinkinys gali atlikti akivaizdi sudting fiziologin funkcij. Pavyzdiui, aktino ir miozino slinkim vienas kito atvilgiu. Tai jau akivaizdus funkcinis veiksmas raumens susitraukimas. is vyksmas ir bus isamesnis dekodavimas. Visas dekodavimas organizme bus darns daugybs raumen susitraukimai ir atsipalaidavimai, nulemiantys gyvno jim ar kitus motorinius veiksmus. Galutinis dekodavimo rezultatas funkcikai tikslingi darns veiksmai. iuo poiriu akivaizdiausias biologinis dekodavimo reikinys yra embriogenez. Pavyzdiui, tik k apvaisinto vitos kiauinio struktroje sunku irti pakyius. Ten, jo genetins atminties akimi nematomoje struktroje, slypi viiuko pagaminimo biotechnologin programa, taiau labai gerai matoma daug iteklini mediag baltymo ir trynio homogenikos struktros. Po 3 savaii kiauiniui bnant tam tikros temperatros aplinkoje, i homogenik iteklini struktr, nematomai bioinformacinei genomo programai valdant, sudedama nehomogenika dinamin maina viiukas.

398
BIOFIZIKA

8.15. KINETINIS GEN ATRANKOS MODELIS

Biofizikai teoretikai N. M. ernavskaja (. . ) ir D. S. ernavskis (. . ) pltodami M. Eigeno biologins organizacijos atsiradimo ir raidos teorij, pateik kinetin model. Jie, naudodamiesi faziniais portretais, parod netiesins konkurencijos susiformavimo galimyb. Tarkime, visos sintetinamos, dl mutacij turinios kitokias molekulins struktras, mediagos tarpusavyje konkuruoja. Jos, dl t pai naudojam itekli viena kitai kenkia, bet be grtamojo poveikio. Tada kinetin vyksm galima apibdinti diferencialini lygi sistema:

dX i = ki X i X i dt

n j =1 ji

a ij X j ,

ia Xi konkuruojanios struktros, j kiekiai ar koncentracijos, pvz., hiperciklai, ki savo sintezs koeficientai ir aij konkuravimo koeficientai. Paprasiausiu atveju, kai n = 2, sistema virsta dviej netiesini diferencialini lygi sistema, panai Lotkos ir Volteros konkurencines sveikas:
dX 1 = X 1 (1 X 2 ), dt dX 2 k 2 k = X 2 (1 1 X 1 ) . dt k1 k2

Suprastintame matematiniame modelyje akivaizdiai matomas fazinis balno portretas (8.23 pav.). Tai trigerinis vyksmas. Jis rodo, kad molekulins sintezs raidos metu lieka vyraujantis tik vienos ries, tam tikr gen nulemtas molekuli rinkinys. Daugiakomponeni sistem atveju tokia konkurencija atlieka didiausiosios atrankos filtro funkcijas. Vadinasi, dl konkurencins raidos, kaip ir Gauzs dsnio atveju, toje nioje ilieka tik vienos struktros molekulins organizacijos populiacija. Tai

X2

X2

8.23 pav. Dviej antagonistini konkuruojani hipercikl kinetins sveikos matematinio modelio fazinis portretas

399
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

paaikina tam tikras specializuotos atrankos tendencijas, rodo sistemos raid tam tikra evoliucijos kryptimi. Manoma, kad dl atsitiktini pokyi ir tokios konkurencins atrankos galjo susidaryti molekulini sambvi rinkiniai, kuri sugebjimai daugintis, perdirbti aplinkos iteklius toje realioje aplinkoje savus genetins informacijos rinkinius, yra didiausi. Taip per genetinius vyksmus pasireikia molekuli ir organizm adaptyvumas. Reali aplinka niekada neilieka stabili. Ypa greitai kinta jos aplinkos struktra esant biologinms organizacijoms. Biologins populiacijos, kurios dauginasi, per gana trump laik visikai keiia aplink. Veikiant grtamiesiems ryiams, populiacijoms mutuojant, ypa dauginantis lytikai, dl konkurencini veiksni pasikeiia ir vyraujani nioje populiacij struktra. Taip pasireikia genetin atranka ir organizm adaptyvumas. Daug rykiau kinta molekulins ir biologins organizacijos, j rys dl simbiozini kooperacini sambvi.

8.16. UNIVERSALIOS SAVE GAMINANIOS SISTEMOS (SAIZERIAI) IR ORGANIZM SIMBIOGENEZ

Biologini sistem raida negalima, jei nra kooperacini simbiogenezs vyksm. Biologija organizm sudtingjim kooperuojantis simbiogenez (endosimbioz) ilg

DNR

Transkripcijos lokusas

Transliacijos lokusas

Replikacijos lokusas

m-RNR

BALTYMAI

E1

Ei

En

8.24 pav. Simbiozin, save gaminanios sistemos saizerio schema

400
BIOFIZIKA

laik vadino tik hipoteze. Taiau vargu ar kitaip galima paaikinti toki didiul gyvybs form vairov. Remiantis gyvybs kodavimo ir dekodavimo funkcins organizacijos samprata, organizmo sudtingjimas pirmiausia turt prasidti nuo informacini struktr kooperavimosi. Eigeno hiperciklins struktros yra tipikos simbiozins dinamins struktros, turinios atmint. Jos turi neuniversalias replikacijos procedras, kurioms btini specials fermentai. Daug universalesni yra V. A. Ratnerio (. . ) ir V. V. amino (. . ) saizeriai (syser system of self-reproduction) ir D. H. Uaito (D. H. White) autogenai (8.24 pav.). Saizeris universalus modelis aikinantis baltym dalyvavim replikacijos, transkripcijos ir transliacijos procesuose. Tai tam tikra simbiozin atminties savybi turinti molekuli sistema, kuri valdo dinaminius molekuli virsm vyksmus. Atrodo, kad remiantis saizeri samprata galima paaikinti molekulini struktr sudtingjim, adaptyvesni saizerini rinkini dauginimsi ir konkurencij. i samprata taip pat aikina sudting tarpsaizerini struktr, vientiso j tinklo ar tinkl susiformavimo galimyb. Tai neprietarauja bandym duomenims. Tokiais principais gali bti grindiama prokariotini lsteli simbiogenez, kurios padarinys eukariotai. Hipotetin eukariotini lsteli saizerins simbiogenezs tinklas yra bioinformacini lstels vyksm technologij sisteminis modelis (8.25 pav.). Dar XX imtmeio pradioje K. S. Merekovskio (. . ) pasakyta, o po pus amiaus L. Margulis (L. Margulis) ipltota simbiogenezes hipotez aikina, kaip i amebini organizm (moner) atsirado branduoliai ir daug organeli, t. y. galjo susiformuoti eukariotiniai organizmai. Amebinio prokariotinio organizmo plrnikas bandymas fagocituoti fototropines spirochetas ir anaerobines bakterijas, plrnas ir auka sambvio raidos metu susiformavo simbiozinis organizmas. Tam tikri fagocituoti prokariotiniai organizmai nepasidav suvirkinimui ir specializavosi atlikti sav funkcin veikl. Spirocheta virto mechaninio judjimo varikliu iueliu, aerobin bakterija mitochondrija, o anaerobin bakterija lstels branduolio prototipu. Jame susitelk visos DNR. Fagocituotai aerobinei bakterijai susikooperavus su pagrindiniu organizmu ir virtus mitochondrija, labai patobuljo organizmo energinis veiksmingumas. Tokiu paiu bdu fagocitavus melsvadumblius, susiformavo emesnij eukariotini augal lstels. Panaiai turjo susiformuoti pirmins gryb ir gyvn eukariotins lstels. Informaciniu kodavimo ir dekodavimo poiriu tokios simbiogenezs vyksmai akivaizdiai rodo auktesns gyvybs organizacijos sudtingjim isaugant savarankikas valdymosi struktras. Daugumos eukariotini organizm organoiduose yra savos nukleorgtys. Jeigu vadovausims poiriu, kad nukleorktys yra informacinio valdymo struktros, tai j buvimas mitochondrijose, plastidse ir kitose organelse rodo j
401
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

APIBENDRINTOS

LSTELS GYVNO

Phanerozoic

AUGALO

GRYBO

Archaeozoic

Protists

Euflagellate eucyte

Pre-euflagellate

Monera
MELSVADUMBLIAI (Chloroplastai)

SPIROCHETOS (iueliai)

ANAEROBINS AEROBINS BAKTERIJOS (Branduoliai) (Mitochondrijos)

8.25 pav. Hipotetin eukariotini organizm simbiogenz (L. Margulis)

savarankikum ir savivald. Jas taip pat koordinuoja ir braduolio struktros genetin informacija. Organizmuose, pradedant nuo eukariot, vyrauja decentristinis valdymas ir centro koordinacija. Kyla daug klausim, ar visos organels turi savsias nukleorgtis. Pavyzdiui, ar turi nukleorgtis iueliai. Dalis autori (tyrj) j ten nenustato, o kai kurie randa. Kyla neaikum dl fotoreceptorini lsteli kilms. inomos dvi elektromagnetini bang viesos energijos pamimo biochemins sistemos organizmuose: chlorofilin ir rodopsinin. Pirmj chlorofilin turi dauguma augal. Ji yra pagrindinis ems gyvojo pasaulio laisvosios Gibso energijos organini chemini jungi pirminis gamintojas. Augal plastidse esanti chlorofili402
BIOFIZIKA

n sistema elektromagnetinius Sauls fotonus paveria chemini ryi energija, kuri yra pagrindiniai beveik visos gyvybs energijos itekliai. inoma, chloroplastai turi savas nukleorgtis. Laikoma, kad jie augaluose atsirado simbiogenezs keliu. Antroji vies pasiimanti rodopsinin sistema, yra gyvn regjimo fotoreceptoriai. Fotoreceptorins lstels turi savit organizacij. Kai kurie autoriai jas laiko neatskiriama nerv sistemos dalimi, nors j savybs nuo neuron daug kuo skiriasi. Taip pat inoma, kad yra rodopsinins bakterijos, kurios pasiima sauls energij rodopsinini sistem bdu. Jos, kaip ir fotoreceptoriai, pagal viesos intensyvum sukuria lstels protonin membran gradient ir atitinkamai potencial skirtum. Kyla klausimas, ar gyvn fotoreceptoriai negali bti taip pat simbiogenetins veiklos padarinys? Taiau fotoreceptoriai turi vis chromosom rinkin.
F A N E R O Z O J U S P R O S T E R O Z O J U S

MONEROS

AUGALAI

GYVNAI GRYBAI

PIRMUONYS

A R C H E J U S

8.26 pav. Gyvojo pasaulio raidos simbiogenezs schema (L. Margulis)

403
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

Tokie neatsakyti klausimai kelia tam tikr abejoni dl simbiogenetins hipotezs universalumo. Manoma, kad simbiogenezs vyksmo metu kai kuri fagocituot bakterij nukleorgtys buvo terptos branduolin nukleorgi rinkin. Padarinys homologin organel valdo i simbiontinio organizmo centro-branduolio ateinanti informacija. Realu, kad daug paprastesni organizm, pavyzdiui, rodopsinini bakterij, per simbiogenetin sudtingjimo vyksm, savsios informacinio valdymo struktras nukleorgtis sutelk bendrame branduolyje. Tolesn daugialsi organizm simbiogenetins raidos i eukariotini lsteli schema pateikta 8.26 pav. Aiku, biologinis skirstymas prokariotinius (chromonemins organizacijos) ir eukariotinius (chromosomins organizacijos) organizmus, atsivelgiant genetins informacijos struktros matom morfologij rodo, kad simbiogenetins raidos metu gyvybs, kaip organizuotos sistemos, valdymo principai visikai pasikeit. Stinga bandym duomen atskleisti informacinius valdymo principus lstelse ir organizmuose. Manoma, kad eukariotinse lstelse atsirado tam tikra valdymo hierarchija, auktenio ir emesnio valdymo struktros. Daugialsiuose organizmuose tarplstelini sveik konkurencins, kooperacins ir plros metu taip pat vyko lsteli specializacija (funkcin diferenciacija) ir kooperavimasis. Padarinys susidar specializuoti organai.Tiktina, kad valdymo struktr hormonins ir nervins sistem ryiai su kitais organais formavosi per plrnikj simbiogenez, o kitus daugiau lm kooperacijos privalumai. Aiku, konkurencins sveikos lm savit specializacij. Per visus iuos sudtingjimo vyksmus pirmiausia turjo keistis atitinkamos informacins struktros genetins programos. Turjo vis laik didti informacin atminties struktr talpa, tobulti kodavimo ir dekodavimo procedr veiksmingumas, formuotis hierarchinis valdymas. J veiklos padarinai aikinami tiriant gyvn elges.

8.17. ADAPTYVIOJI GYVN ELGESIO EVOLIUCIJA

Sugebjimai kaupti individuali organizmo gyvenimo patirt rodo gyvn elgsenos tyrimai. i tyrim kol kas yra per maai, kad bt galima atlikti isamesnius teorinius tyrimus. Dauguma j yra tik kokybiniai, taiau svarbs tam tikri apibendrinimai (8.27 pav.). Etologiniai tyrimai padeda iskirti penkis gyvn adaptyvaus elgesio bdus: Taksius ir tropizmus. Neslyginius refleksus. Instinktus. Slyginius refleksus. valg (insait), mstym, kryb.
404
BIOFIZIKA

MSTYMAS, ESMS SUVOKIMAS, VALGA (INSAITAS)

SLYGINIAI REFLEKSAI

INSTINKTAI

405
BESTUBURIAI

NESLYGINIAI REFLEKSAI

TAKSIAI

Pirmuonys Paprastieji Sliekai Vabzdiai uvys Paukiai daugialsiai Amfibijos Ropliai

emesnieji emesnieji mogus induoliai primatai


STUBURINIAI

8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

8.27 pav. Adaptyvios elgsenos ri evoliucija kintant valdymo posistemi funkcionavimo principams

Visi ie elgesio bdai turi skirting reikm gyvnams, kuri filogenetinis isivystymas yra nevienodas. inoma, j elgesys atspindi informacinio valdymo struktr funkcins organizacijos savybes. Taksiai ir tropizmai lemia vis vienalsi organizm elges. Tokias elgesio apraikas galima matyti nagrinjant daugialsi organizm, net stuburini elges. Tiesa, taksi taka filogenetins raidos skalje yra majanti. Primityvij daugialsi organizm elgesiui bdingi ryks neslyginiai refleksai kartu su taksiais. Tai paprasiausi technikos automat veikla, kai paprastas poveikis visada sukelia tipik reakcij. Pavyzdiui, moliuskus, atsivelgiant j elges, etologai vadina, refleks respublikomis. Sliek ir ypa vabzdi elges daugiausia lemia instinktai. Etologai vabzdius vadina instinkt respublikomis. Valdymo teorijos poiriu toks elgesys panaus programinio valdymo sistem veikim. i gyvn elgesiui bdingi ir taksiai, ir neslyginiai refleksai. Taksiai, neslyginiai refleksai ir instinktai yra gimtos, genetikai perduodamos adaptyviojo elgesio programos. Jos keiiamos tik filogenetikai, atsirandant naujoms rims, pakitus genetinms programoms. Tam tikri individai, turintys tik iuos informacinius valdymo mechanizmus, keisti savo elgesio negali. Jie yra instinkt, neslygini refleks, taksi vergai. Kai kurie daugialsiai, pavyzdiui sliekai, sugeba mokytis, gyvenant keisti savo elges. Jie kaupia asmenins patirties informacij. iems daugialsiams bdingi slyginiai refleksai. Jie panas paprast technini mokymosi sistem, kurias kibernetika vadina perceptronais, veikim. Juo organizm filogenetinio isivystymo lygis auktesnis, juo gyvno elges daugiau pradeda lemti asmenin patirtis. Instinkt, neslygini refleks, taksi taka elgesiui pasireikia, bet j reikm silpnja organizmams filogenetikai sudtingjant. iltakraujams organizmams, ypa induoliams, bdingi visikai kitokie adaptyvaus elgesio principai. Etologai iltakraujo gyvno, turinio naujj smegen iev, elgesio pagrindu laiko mstym, kuris reikiasi tam tikra savybe valga (insaitu), kryba. valga suprantama kaip organizmo smegen savyb, jutimo organuose atsispindtus aplinkos signalus vertinti funkcikai prasminga informacija apie aplink, t. y. atspindti aplink prasmingai (semantikai), atsivelgiant individo motyvacijas, tikslus. Tai suvokim ir mstymo savybs, kurioms bdinga sudtinga informacin veikla. ias savybes gyvnui suteikia ypatingos, dideli galimybi atminties struktros ir veiksmingos kodavimo ir dekodavimo procedros. Neabejotina, kad tiek slyginius refleksus, tiek suvokimo, mstymo, valgos savybes lemia atitinkamos nerv sistemos struktros, kurios per vis evoliucin raid atsirasdamos ir suteik atitinkamas funkcines savybes. Msty406
BIOFIZIKA

mo sugebjimai tiesiogiai susij su iltakrauj organizm, ypa induoli, naujosios smegen ievs (neocortex) isivystymu. iuo metu vis i struktr funkcin veikla ir organizacija yra viena i didiausi neatskleist biologijos mokslo paslapi.

* * *
vertinus pastarj deimtmei mokslo ir technologij laimjimus ir j tak moni sampratai apie gyvyb, gyvj gamt, galima apibendrinti biologijos ir biofizikos moksl raidos tendencijas: Gyvyb yra organizuota sistema, kurios esm lemia kibernetins informacinio valdymo procedros. Mediag ir energijos virsmai yra tik priemons informacinms procedroms atlikti. Todl gyvybini vyksm esm yra ne chemijos bei fizikos mediag ir energijos virsmai ir j mechanizmai. Gyvybines savybes, j esm lemia informacinio valdymo, kodavimo ir dekodavimo procedros. Informacinis valdymas tampa svarbiausia gyvyb aikinania teorija. Organizmas yra hierarchinio informacinio valdymo, kodavimo ir dekodavimo sistema: pirminis lygis yra genetinis, auktesnis hormoninis, ir aukiausias nervinis. Gyvybs atsiradimas emje neatsiejamas nuo informacijos bei informacinio kodavimo ir dekodavimo procedr atsiradimo. Pirmins kodavimo ir dekodavimo procedros atsiradim suformavo nukleorgi ir baltym simbioziniai ryiai. Filogenez yra gyvojo pasaulio vis vairesni ri koduot biotechnologini program formavimo procedra (informacini projekt krimas), didinant informacin atminties talp ir taip iekant adaptyvesni genetini projekt. Ontogenez yra dekodavimo procedra biotechnologinis vyksmas, genetikai ukoduotos individo programos gyvendinimas iskleidimas. Gyvyb emje yra bioinformacini technologij raidos vyksmas, kur pradeda siterpti mogus, valdantis gen ir kitas bioininerijos technologijas. Biofizika plaija prasme mokslas, gyvybs vyksmus, organizm ir populiacij funkcin organizacij aikinantis sisteminiu poiriu, kibernetikos ir informacijos teorijomis per cheminius ir fizikinius mechanizmus. Ji tampa iuolaikini biologijos moksl teoriniu pagrindu.

407
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema

ALTINIAI IR REKOMENDUOJAMA LITERATRA

Pagrindin literatra
1. Giunter E., Kempf L., Libertas E., Miuleris H.J., Penclinas H. Biologijos pagrindai. Vilnius: Mokslas, 1987. 2. Mildaien V., Jarmalait S., Daugelaviius R. Lstels biologija. Kaunas: VDU leidykla, 2004. 3. Murray J. D. Mathematical Biology. I. An Introduction. New York, Berlin, Heidelberg, London, Paris, Singapore, Tokyo, Springer, 2002. 4. Sybesma C. Biophysics. An introduction. Dordrecht/Boston/London, Kluwer Academic Publishers, 1977. 5. Venslauskas M. S. Biofizika (vadas). Kaunas: KMA leidykla, 1996. 6. A. . . . 1. . : , 1999. 7. A. . . . 2. . : , 2000. 8. M. . . : , 1988. 9. . ., . ., . ., . . : , 1988. 10. Keener J., Sneyd J. Mathematical Physiology. New York, Berlin, Heidelberg, London, Paris, Singapore, Tokyo, Springer, 2001.

Papildoma lieratra
11. Bareikis G. Fraktalai. Paskait konspektas. Vilniaus Universitetas, Matematikos fakultetas. 1998.09.01. www.mif.vu.lt/ttsk/bylos/Archyvas/bg/pas/fr1.pdf. 12. Filosofija Vilniaus universitete. Vilnius: Mintis,1979. 13. Yas M. Apie biologij. Kaunas: Candela, 1994. 14. Kaneko K. Life: An Introduction to Complex Systems Biology. Springer, 2006. 15. Kirvelis D. Biologijos paradigmos. Kilm ir raida. Kn. Mokslas gamtos moksl fakultete. Vilnius: VU leidykla, 2006. http://video.google.com/videoplay?docid=-8216857834944707942&hl=en 16. Kuhn T. S. Mokslo revoliucij struktra. Vilnius: Pradai, 2003. 17. Pyragas K.. Netiesins dinamikos pagrindai. Vilnius: UAB Ciklonas, 2003. 18. Pyragas K. Netiesins dinamikos pagrindai, http://pyragas.pfi.lt/pdffiles/teaching/nds1.pdf 19. Popper K. R. Rinktin. Vilnius: Pradai, 2001.

409
8. Gyvyb adaptyvi, informacij Literatra kodavimo ir dekodavimo sistema kaupianti,

20. vgda O. Taikomoji informacijos teorija. Vilnius: Mokslas, 1980. 21. Alberts B., Bray D. et all. Molecular biology of the Cell, 4th ed. Garland Pubshing Inc. New York, London, 2002. http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.TOC&depth=2 22. Botany on line: Cybernetics. http://www.biologie.uni-hamburg.de/b-online/e15/15.htm 23. Casti J. L. Alternate realities: Mathematical Models of Nature and Man. New York, Toronto, Singapore: John Wiley&Sons,1988. 24. Dawkins R. The Selfish Gene. Oxford, New York: Oxford University Press, 1989. 25. Hannon B., Ruth M. Modeling Dynamics Biological Systems. New York, Berlin, Heidelberg: Springer, 1997. 26. Heinrich D., Hergt M. Ekologijos atlasas. Vilnius: Alma littera, 2000. 27. Klipp E., Herwig R., Kowald A., at all. Systems Biology in Practice. Concepts, Implementation and Application. KgaA, Weinheim, Wiley-VCH GmbH Co., 2005. 28. Palsson B. . Systems Biology. Properties of reconstructed networks. Cambridge University Press, 2006. 29. Prigogine I., Stengers I. Order out of Chaos. Heinemann, London, 1984. ( ., . . : , 1986.) 30. Principia Cybernetica. http://pespmc1.vub.ac.be/ 31. Rosen R. Anticipatory Systems. Pergamon Press, 1985. 32. Rosen R. Life Itself. Columbia University Press, 1995. 33. Schwemmbler W. Symbiogenesis a Macromechanism of Evolution. Progres towards a unifield of evolution. Berlin, NewYork: Walter de Gruyter, 1989. 34. Shigesada N., Kawasaki K. Biological Invasions: Theory and Practice. Oxford University Press, 1997. 35. Smith J. M. Mathematical Ideas in Biology. Cambridge at the University Press, 1968. ( . . . : , 1970.) 36. Smith J. M. Models in Ecology. Cambridge at the University Press, 1974. ( . . . : , 1976.) 37. Yamaguchi M. An introduction to chaos. 1996. http://brain.cc.kogakuin.ac.jp/~kanamaru/Chaos/e/ 38. . . . : , 1985. 39. . ., . . . . : , 1999. 40. . . : , 1983. 41. . . : , 1977. 42. ., . . . M: , 1987.

410
BIOFIZIKA

DALYKIN RODYKL

A abstraktus 25 agentas 286, 288 aib nekategorika 204 Zad (Zadeh) 204 aksonas 264 elektriniai potencialai 264 ALIFE (artifical life) 218 alometrin funkcija 74 alometrijos koeficientas 74 altruizmas 128, 130 amensalizmas 128, 132 aminorgtis 235, 367 anafaz 227, 253 angliavandeniai 75, 367 aparatra (hardware) 25 aplinka 31, 59 aplinkos talpa 333 apoptoz 229, 271 apvaisinimas 229 archaeus 34 Arenijaus lygtis 110 Aristotelis 12, 33, 36, 48, 54 asimiliacija 67 atmintis 25, 31, 175, 208, 368 genetin 392 nervin 294 ATP 225 atraktorius 151 Lorenso 151, 152 atsinaujinimo pusperiodis 100 atsinaujinimo puslaikis 100 atspindjimas 25, 190 atspindys impulsinis 192

Atvateris (Atwater) 39, 75 audinys 279 auka 128, 165, 383 auksinai 285 autoinhibicija 148 autokataliz 148 autogenas 401 automatas dauginimosi 397 komandinis 208 loginis 207 nerykiosios logikos 208 Noimano 224, 397 Zad (Zadeh) 210 autosvyravimai 339 B baitas (BYTE) 177 balnas 123, 124, 127, 382, 399 baltymas 395 bandymas 19 kontrolinis 21, 22 planas 21, 22 Ballis (Ball) 75 baltasis triukmas 193 Baueris () 42 bazs azotins 230 funkcijos 196 Bekonas (Bacon) 36 Belousovas () 145 bendroji lygtis 106, 126 kompleksins aknys 107 menamosios aknys 107 realios aknys 107 aknys 107, 126

411
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl

Bekeis (Bekesy) 50, 51 Benetas (Bennett) 174 Bernaras (Bernard) 48, 49 Bertalanfis (Bertalanffy) 44 Bras (Baer, ) 55 bii okis 359, 360 bifurkacija 339, 340 biochemija 16 bioelektra 37, 258 bioelektrinis potencialas 258, 260 sklidimas 263 ramybs 260 veikimo 260 biofizika 13, 14, 15, 17, 18 molekulin 14, 15 sistem 14, 15, 44 fiziologin 14, 15, 44 siaurja prasme 17 plaija prasme 17 biofizikai 14 fizikai 14 biologai 14 matematikai 14 kibernetikai 14 ininieriai 14 medikai 14 bioinformacins technologijos 371 bioinformatika 16, 23 biokibernetika 16 biologija 37 biologin raida 373, 375 biomedicinos mokslai 15 biosfera 25, 362, 365 biosistema 19 biotechnologija 369 bioinformacin 28 dekodavimas 240 bitas (BIT) 176 blastula 278 Bogdanovas-Malinovskis (-) 45 Bolcmanas (Boltzman) 81, 96, 173 konstanta 81 lygtis 81 termodinamin tikimyb 81 Bolcmano ir enono formul 161 Borelis 34, 35

branduolys lstels 224 integravimo 196 briuseliatorius 143 buljonas gyvybs 371, 385,393 Burdelis (Burdelle) 35 C calandra 334 Castis (Casti) 24 ciklinai 226, 253 ciklin reakcija 108, 109 citokininai 285 chaosas 150, 339, 357 chemija 17 chemogenez 385 ernavskaja () 398 ernavskis () 280, 398 ievskis () 43 D darbas 60 cheminis 60 elektrinis 60 ekstensyvusis 60 intensyvusis 60 mechaninis 72 paviriaus tempties 60 pltimosi 60 susitraukimo 60 Darvinas (Darwin) 36, 39, 364 da Vinis (da Vinci) 45 danis Naikvisto 202, 203 dedukcija 21 Dekartas (Descartes) 24, 35, 36, 49, 54 dekodavimas 24, 25, 26, 157, 173, 187, 197, 202, 234, 242, 361, 396 bii okiai 361 medis 175 valdymas 175 dekoderis 395 Demonas 217 deoksiribonukleorgtis (DNR) 27, 234

412
BIOFIZIKA

desimiliacija 67 dsnis 21 bandomasis 299 Chatchisono 329 eksponentinis 330 Ferhiulsto ir Perlo 329 Gauzs 131, 351 Maltuso 330 psichofizikos 296 sigmoidinis 299 Stivenso 297 Vberio 296 Vberio ir Fechnerio 296 determinantas 126 dinamin sistema 120, diferencialin lygtis 95 difuzija 258 palengvinta 259 dinaminis modelis 95 disipacija 81,86 funkcija 86, 90, 91 disipacin struktra 147 diskretizavimas 202 diskriminantas 127 ditas (DIT) 177 DNR (deoksiribonukleorgtis) 27, 224 Donano pusiausvyra 256 Dryas 24, 48, 54, 55 Dufingo chaosas 150 dualizmas 33 dublikacija 368 duomenys 21 dvasia 35 dvejopai (dualistikai) 25, 32, 33 drugelio efektas 149 Daulis (Joule) 39 E Edingtonas (Eddington) 86 efektorius 31, Eigenas (Eigen) 53, 386 ektoderma 279 elgesys 404 adaptyvusis 405 gyvn 404 elektrochemija 37 elektrofiziologija 37

elektroforez 268 elektrokinetiniai potencialai 267 elektroosmosas 268 endoderma 278 endosimbioz 400 energija 12, 28, 58, 59 aktyvacijos 110 apykaita 69, 70, 74 chemin 60 ekvivalentas 72 elektros 59 elektromagnetin 60 Gibso 61, 64, 67, 68, 72,78 Helmholco 62, 64, 68, 78 kinetin 59 laisvoji 61, 78 nelaisvoji 78, 80 potencin 59 pusiausvyros lygtis 62 sistemos vidin 61, 64 sklaidos 81 suritoji 78 ilumin 59 viesos 60 tverms dsnis 75 mogaus 75, 76, 77 energin bsena 120, energinis pavirius 120 entalpija 62, 64, 72 laisvoji 98 entelehija 12, 32, 48 entropija 61, 64, 79, 80, 82 fizikin 61, 64, 79, 80, 177 informacin 82, 175, 179 santykin 180 vietin 86, 89 eobiontas 385 eolstel 391 erdvskyra 237 fosfolipidin 238 etologija 404 evoliucija 366 biologin 366 chemin 367, 369 bis (Ashby) 47, 217

413
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl Rodykl

F faktas 19, faktorius 110 sterinis 110 falsifikavimas 20, 22 fantazija 21 fazs (lstels) anafaz 226 citokinezs 226 G0 227, 229 G1 227, 229 G2 227, 229 M 227 metafaz 227 mejoz 228 mitoz 227 postmitozin 229 profaz 227 S 226, 229 telofaz 227 fazinis kampas 107 fazinis energinis pavirius 120 fazinis portretas 120, 122, 123 fazin erdv 120 fazin ploktuma 120 fazin trojektorija 120 Fechneris (Fechner) 51, 52 fenotipas 25, 40 Ferchiulstas (Verhulst) 329, 332 fermentas (E) 27, 29, 395 feromonas 27, 287, 359 Fibonais (Leonardas Pizietis) 34, 328, 337 filogenez 365 Fiorsteris (Foerster) 50, 380 nelygyb 382 Fieris (Fisher) 40, 173, 341 fitohormonai 285 fizika 18 Aristotelio 12, 33 Galiljaus 12 socialin 38 fiziologija 13, 36 fenomenologija termodinaminiai koeficientai 88 termodinamikos lygtys 88 formul Bolcmano 157

Debajaus 268 Goldmano 261 Hiukelio 268 Hodkino 261 Katzo 261 Smoluchovskio 268 enono 179 vant Hofo 257, 259 fotosintez 63, 225 fraktalas 153 medis 154 Serpinskio (trikampis) 154 Frias (Frish) 359 funkcija branduolio 196 Dagero (Dagger) 306 dekodavimo 196 jeigu (IF) 306 Hilo 323 delta 200 Dirako 192 Eulerio 199 informacijos 178 kodavimo 196 Kronekerio 197 kvaziortogonalin 197 logins slygos (IF) 306 neapibrtumo 178 ortogonalioji 197 Pirso rodykl 306 singuliarioji 193 slenkstin192 svorio 197 uolio 200 Volo (Walsh) 200, 202 vienetin 192 ypatingoji 193 G Gaboras (Gabor) 174 Galtonas (Galton) 13, 39 Galvanis (Galvani) 37 elementas 37 Gamovas (Gamov) 42, 375 gastrul 278 Gausas (Gauss) 38 Gauz () 41 dsnis 351

414
BIOFIZIKA

genas atranka 398 ekspresija 228 raika 228, 251 genomas 233 informacinis talpis 234 mogaus 373 genotipas 25, 40 Gibso lygtis 61 Gibso pusiausvyra 254 grafinis metodas 338 grandis 191 aktyvioji 192 pasyvioji192 valdomoji 193 grtamasisi ryys 146, 243 Goldio lstel 322, 324 Gosetas (Gosset) 40 Gudvinas (Goodwin) 245, 250, 281 gyvno schema 277 gyvyb 32, 85 gyvybin jga 49, 55 gyvybs buljonas 371 H Hakslis (Huxley) 41 Haleris (Haller) 36 hardware 241 Hartlainas (Hartline) 50, 51, 316 Hartejus (Hartley) 173 Harvjus (Harvey) 36 harmonika 339 Hatinsonas (Hutchinson) 329, 336 Hekelis (Heckel) 276 Helmholcas (Helmholtz) 39 Helmontas 34, 54 Heso dsnis 71 heterotrofas 292 hideniniai ryiai 320 Hilis (Hill) 41, 327 hiperciklas 387 hipotez 20, Hodkinas (Hodgkin) 41 Holstas (Holst) 49 hologenez 366 homeostatas bio 217

homeostaz 49, 285 hormonai 284 aktyvikliai 285 slopikliai 285 Hubelis (Hubel) 319 I IF 194 aritmetinis 194 loginis 194 indukcija 21 informacija 13, 28, 155, 173 abstrakioji 186 entropija 178 Fierio 40 fizikin 159, 161 fiziologin 186 istorija 173 kibernetin 159,161 kiekis 177 parametrin 186 perteklius 180 santykin 157, 161, 174 semantin 186 srautas 395 struktrin 157, 161, 174 talpis 175 teorija155 topologin 186 valdanioji 31 vienetai 177 inios 186 informacinis valdymas 159, 170 inhibicija (r. slopinimas) 115 insaitas (r. valga) 404 instinktas 404 integralas kodavimo 196 sskos 192 intervalas Naikvisto 202 itekliai 31 valga 405 J jakobiano matrica 128 jga

415
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl Rodykl

apibendrinta 87 fizikin 60 organizuojanti 154 organin 154 valdanti 32 jutimo organai 292 informacija 293 Johansenas (Johannsen) 40 K kabelio teorija 263 Kajalas (Cajal) 49 kalinio dilema 376 kalorimetravimas 73 Kaplanas (Kaplan) 369 kardauodeg (limullus) 50 Karsonas (Carson) 174 Kastleris (Quastler) 53, 373, 392 katastrofa 149, 356 Ketl (Quetelet) 32, 338 Kenonas (Cannon) 49 Kepleris (Kepler) 328 kibernetika 15, 16 kibervitalizmas 22 kinetika 97 atvirosios sistemos 105 chemin 97 izoliuotos sistemos 97105 netiesin 141 tiesin 99108 Kiuvj (Cuvier) 39 klost 149 kodas 157, 161, 199, 390 bii oki 360 dubletinis 391 genetinis 232, 235, 390 simpletinis 390 tripletinis 391 koacervatas (erdvskyra) 369, 385 kodo elementai 161, 235 simboliai 161, 175 padtys (pozicijos) 161, 175 kodavimas ir dekodavimas 24, 155, 159, 180,195, 203, 230 atviras 158, 180 bii okio 361

genetinis 231, 234 diskretusis 196 netiesinis 204 tiesinis 203 udaras 24, 156, 368 kodinis medis 176 kodonas 232 Start 232, 236 Stop 232, 236 koeficientas asimiliacijos 269 disimiliacijos 269 disipacijos 269 disociacijos 86, 259 jon laidumo 261 Onzagerio 88 tarpusavio ryi 88 komensalizmas 130 kompiuterija 25 komplamentarus kopijavimas 392 asociacijos 393 disociacijos 393 konkurencija 128, 132, 380 konkurencinis slopinimas 115 konstanta Faradjaus 256 disociacijos 259 Donano 256 idealij duj 256 pernaos 259 konstruktyvizmas 20 Kolcovas () 42 kooperacija 128, 381 koordinacija 156 Kotelnikovas () 174 teorema 174 Kramerio metodas 106 Krikas (Crick) 21, 43 krymin kataliz 148 Knas (Kuhn) 20 Kupfmuleris (Kupfmuller) 174 kryba 404 L Lac operonas 249 Lainuiverio ir Berko lygtis 114, 116 laikmena 225

416
BIOFIZIKA

lstel 224 augimo dsniai 269 ciklas 225, 254 ciklo valdymas 252 eksponentinis augimas 269 eukariot 224 fazs 226 fizikocheminis modelis 256 Goldi 321 kodavimo ir dekodavimo sistema 230 pirmin 385 prokariot 224 proporcingasis augimas 269 schema 234, 240 taikinys 287 Laplasas (Laplace) 38 Lamarkas (Lamarck) 13, 364 La atelj (Chateljer) principas 90, 91 lateralinis slopinimas 316 Lefevras (Lefever) 143 Limullus 316 Linjus (Linn-Linnaeus) 39 linija atminties 181 ryio 181 logika kategorikoji 303 nerykioji (fuzzy) 311 logistinis dsnis 332 logistin lygtis 333 Lorente de Noas (Lorente de No) 49 Lorensas (Lorenz) 151 Lorenso lygtys 151 Lotka 41, 45, 141, 328, 379 lygtis 141 lyginimas 21 lygtis bangin 264 bendroji 126 Dufingo lygtis 150 Fiko 258 Goldmano 261 Hartlaino (Hartline) 316 Hilo (Hill) 323 Hodkino 263 homogenin 126 Huhenheimo 256 Katzo 261 Nernsto 256, 260

M Machas (Mach) 51, 52, 316 Macho formul 316 Majeris (Mayer) 39, 75 Maksvelas (Maxwell) 217 Maksvelo Demonas 217 Maltus (Malthus) 38, 328, 330 Margulis (Margulis) 401, 403 mstymas 404 maina 67 baltym 241 chemin 67 gen 241 membran 241 Noimano 222, 387 ilumin 62, 63 matrica 125, 128, 136 Adamaro (Hadamard) 201 grtamj ryi 311 koeficient 125 kokybin 128 Jakobio 128 Jakobio enkl 128 sveik 137 vienetin 199 tiesiogini ryi 311 enkl 128 mazgas 123 nestabilus 120 stabilus 120 McCullochas (McCulloch) 50 mediaga 13, 28, 62 apykaita 66, 70 kaloringumas 72 membrana 238 banginis ilgis 265 ekvivalentin schema 262 elektrin talpa 265 N-tipo netiesikumas 266 laiko pastovioji 265 vara 265 Merekovskis () 401 metafaz 227, 253 mezoderma 278 Michaelis ir Menten (Michaelis&Menten) 40, 41 konstanta 113 lygtis 112 matematinis modelis 113, 117

417
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl Rodykl

mintis 49 Miteltadtas (Mittelstaedt) 49 Mileris (Miller) 55, 369, 372 modelis 21, 156, 159, 356 Belousovo ir abotinskio 143 difuzinis 298 Fierio 342 Hatinsono 336 Hodkino ir Hakslio 262 Huhenheimo 256 gen atrankos 399 Gudvino 245, 281 konceptualus 357 lstels 222, 254 lsteli diferenciacijos 280 Lotkos ir Voltera 140 matematinis 357 membranos 238, 262 operono 245 Skelamo 341 tikimybinis 300 trigonometrinis 300 modeliavimas (modeling relations) 24 modifikacija 372 mokslo revoliucija 20, 22 Mono (Monod) 43, 242, 245, 249, 250, 258 metodas Puankar atvaizd 153 Puankar pjvi 153 Morovico (Morowetz) schema 295 morul 278 motoneuronas 321 mutacija 370 mutualizmas 124 N Naikvistas (Nyquist) 174 Naikvisto danis 202, 203 Naikvisto intervalas 202 natai (NAT) 177, 203 naudingumas energinis koeficientas 77, 78 neapibrtumas 182 nekonkurencinis slopinimas 115 nekroz 271 neopozityvizmas 20 nervinis tinklas 288

neuroinformatika 49 neuronas 279 dinamins savybs 306 interneuronas 325 funkcin charakteristika 301 impuls dani sudtuvas 304 inertikumas 306, 313 grtamasis ryys 311 krepelinis 302 N netiesikumas 304, 309 piramidinis 302, 305 reciprokinis 305 slygin charakteristika 306 slenkstin charakteristika 303 statistinis sudtuvas 303 statins savybs 302 vaigdinis 302 neuron sluoksnis 313 grtamieji ryiai 310, 315, 317 linijinis 314 sistemos 318 tiesioginiai ryiai 314, 317 vienmaiai 314 neuron tinklas 279, 307 adaptyvus 319 mokslusis 319 tiesiogini ryi 307 neuron pora 305 reciprokin 305 neurul 279 neutralizmas 137 Nikolis (Nicolis) 143 Niutonas (Newton) 38, Noimanas (Neumann) 47, 174, 373, 397 Noiesas (Noyes) 145 noosfera 25, 362, 365 NR (nukleorgtis) 27, 29, 225, 367 nukleorgtis (NR) 27, 225, 367 O Oileris 35 formul 125 ontogenez 366 Onzageris (Onsager) koeficientai 87 matrica 88 principas 90

418
BIOFIZIKA

operacija aritmetin 196 login 196 slygin 196 operatorius Laplaso 170 operonas 242 fazinis portretas 248 modelis 245 sveikos 250 oregonatorius 143 organas 279 jutimo 292 organinis 17, 367 organizmas 16, 275 daugialstis 278 hierarchin sistema 277 organizuota sistema 277 organizuotas 17, 44, 47 osmosas 259 P padarinys 30 padtis (pozicija) 178 Paracelsas 34, 54 paradigma 20 parazitizmas 128 Paskalio trikampis 154 perceptronas 216 Rozenblato 216 pernaa 258 aktyvioji 258, 260 bendroji 260 mediag 258 pasyvioji 258 prienaa 260 snaa 260 viennaa 260 pikselis 198 Prlas (Pearl) 329, 333 Pirso (Pears) rodykl 306 Pirsonas (Pearson) 12, 13, 20, 39, 55 Pitsas (Pitts) 50, Platonas 33, 54 plra 133, hierarchin 139 visika 139, 140

plrnas ir auka 128, 165, 168, 383 pojtis 293 klausa 293 lytjimas 293 rega 293 skausmo 293 skonis 293 subjektyvusis 297 alio 294 ilumos 294 uosl 293 polipeptidai 367 Poperis (Popper) 20 populiacija 328, 356 populiacijos amius 336 populiacijos didjimas 328 diskretusis eksponentinis 331, 337 diskretusis logistinis 337 Hatinsono dsnis 336 eksponentinis dsnis 330 Ferhiulsto ir Perlo dsnis 329, 332 logistinis 332 Maltuso dsnis 330 populiacijos plitimas 341 bangos sklidimo greitis 343 difuzinis 341 Fierio 342 ondatr (Ondatra zibethitca) 344 Skelamo 341 populiacij sveikos 345, 375 amensalizmas 345 bioekologins 375 daugiakomponentis 356 komensalizmas 345 konkurencija 347 kooperacija 345 mutualizmas 352 parazitizmas 354 plra 356 plrnas ir auka 354 protokooperacija 352 simbioz 352 posistemis 27 dinaminis 27 informacinis 27 metabolinis 27 nerv 289 valdantysis 31 valdomasis 31

419
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl Rodykl

poveikis 292, 296 potencialas bioelektrinis 260 dzeta 267 elektokinetinis 267 standartinis 60 sedimentacijos 267 tekjimo 267 termodinaminis 62 poveikis 30 pozityvizmas 19 profaz 229, 255 programin ranga (software) 25 programa (projektas) 27 genetin 27 protokooperacija 128, protobiontas 385, 389 prieastis 30 Prigoinas (Prigogine) 42, 143 lygtis 84 principas 89, 171 procedra citokinez 228 dekodavimas 196 mitoz 228 kodavimas 196 psichofizika 49 psichin jga 49 Puankar (Poincare) 119, 374 Puankar modelis 119 pusiausvyra 83 Gibso ir Donano 254 konstanta 98 pastovioji 98 termodinamin 83 R raida 368, 373 ragai (stuburo smegen) 324 priekiniai 324 upakaliniai 324 Ranvj ssmauka 265 Raevskis (Rashevsky) 41, 42 Ratneris () 401 raukl 149 raumens susitraukimas 321 auksotoninis 322

izometrinis 323 izotoninis 322 raumuo 321 atlenkiamasis 325 darbas 321 sulenkiamasis 325 valdymas 321, 324 verpst 321 reakcija 30, 68 atspindio 194 biochemin 110 ciklin 108, 109 chemin 67, 97, 110, 111 darbas 67 egzergonin 67, 72 endergonin 67, 72 fermentin 111 impulsin 192 grandinin 104 greiio konstanta 99 greitis 97 grtamoji 100 laiko pastovioji 99 stechiometrin 97 akotoji 102 termobranduolin 62 refleksas (reflection) 36, neslyginis 404 slyginis 404 reguliatorius 157, 167, 170, 209 astatinis 169 disipatyvioji sistema 171 kibernetinis155 statinis 168 optimalusis 211 organizuota sistema 172 reguliavimas 46, 168 optimalus 211 replikacija 226 paprasta RNR 387 represija 243 Rias (Rich) 42 riebalai 367 Rosenas (Rosen) 24, 42 Rozenblatas (Rosenblatt) 217 Rubneris (Rubner) 39, 75

420
BIOFIZIKA

ryiai hideniniai 320 kintamieji 320 ryio linija 181 S saizeris 400 sambvis 133 sska 192, 195 integralin transformcija 195 kodavimas ir dekodavimas 195 sveik matrica 134, 135 sveik raida 376 smon 25 sanarys 324 valdymas 325 sauls viesos spektras 65 semantika 157, 204 separatris 120, 352 signalas 25, 29, 156, 190 atspindtas 192 jos 193 ijos 193 harmoninis 193 poveikio 192 valdymo 193 siela 25, 48 simbiogenez 382403 biomolekulin 384 saizeris 400 simbioz 124, 352, 400 mutualizmas 127, 352 protokooperacija 127, 352, 385 plra 131, 352, 385 parazitizmas 352, 385 singuliarinis signalas 190 sistema 25, 58, 59 adaptyvioji 215 anticipacin 214 atviroji 61 autopoetin (autopoietics) 2 9, 207 chaoso (chaotics) 207 daugiakomponent 135 dinamin 136 disipatyvioji 92, 171 ekologin 358 gyvoji 85

gaminimosi (self-production) 207 kibernetin 165 konkurentin 136 kooperacin 136 natrali 25 neuron sluoksni 318 formali 25 termodinamin 81, 87 udaroji 60 adiabatin 61 izoliuotoji 60 organizuota 30, 155, 163, 172, 205, 230 plrnas ir auka (plros) 131, 136 prognozuojanti 214 save referuojanti (self-refering) 207 savitvark (self-organizing) 207, 217 sekimo 209 servosistema 209 sudtinga (complex) 30, 207, 220 valdanti 206 valdoma 163 skaidula 324 ekstrafuzin 324 intrafuzin 324 Skelamas (Skellam) 341 skilimo pusperiodis 100 skilimo puslaikis 100 slopinimas 115 alosterinis 117 konkurencinis 115, 116 nekonkurencinis 115, 116 sinaptinis 304, 316 slopinimo konstanta 115 smegenys 281 iev (neocortex) 406 Sniadeckis 37, 38, 45, 54, 55 software 240 spinduliuot 65, 66 regimoji 65 ultravioletin 65 infraraudonoji 65 sudtingjimas 365 stabilizavimas 168, 209 stacionarioji bsena 84,106, termodinamin 84, 85

421
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl Rodykl

standartinis slygos 69 Start 233 Stivensas (Stevens) 51, 52 Stivenso dsnis 297 Stjudento t-kriterijus 40 koeficientas 40 Stop 233 Stubuleviius 37 svyravimai 124, 126 savaiminiai 126 sukeltieji Szilardas (Szilard) 173 aknys 126, kompleksins 126 menamos 126 realios 126, aminas () 401 enonas (Shannon) 13, 46, 54, 55, 158, 173 teorema 185, 202 enono informacijos teorija 156, 180, 291 enono kodavimo ir dekodavimo kanalas 159, 180 ardenas (Shardin) 49, 52, 54, 55 iluma 61 ilumin maina 63 ilumin sklaida 74 ilumin talpa 62, 68 malhauzenas () 232 malhauzeno ir Bordzilovskio formul 232 oninis (lateralinis)slopinimas 316 rdingeris (Schrodinger) 46, 58 talis (Stahl) 54 usteris (Shuster) 386 vemleris (Shwemmler) 368, 385 T talpa (populiacijos aplinkoje) 332 talpis (informacijos) 175 taksiai 404 tara 31 technologija 26 bioinformacin 371

tektologija 45 telafaz 255 temperatra 78, 110 Kelvino 79 teorema Kotelnikovo 202 enono 185, 202 teorija 21 bendroji sistem 44 informacijos 180 kabelio 263 Noimano 222 signal 190 Zad 204 terminatoriai 233 termodinamika 58 pirmasis dsnis 61, 63 antrasis dsnis 82, 83, 84 negrtamj vyksm 86 fenomenologins lygtys 87 termodinaminiai potencialai 64 Teiloro ir Makloreno eilut 87 tikslas 32 veiklos 163 tikslingas funkcionavimas 156 Thompsonas (Thompson) 41, 45 Tomas (Thom) 149, 151 transkripcija 243 transliacija 243 paprastoji RNR 387 transformacija Adamaro (Hadamard) atvirktin 201 integralin 194 Ermito (Hermite) 200 Frenelio (Freshnel) 200, 316 Furj 193, 198, 318 Hevisaido 200 Lagero 200 Laplaso 198 ortogonalins 316 Volo (Walsh) 200, 316 Treviranus (Treviranus) 54, 55 tropizmai 404 Turingas (Turing) 47, 143, 144, 174

422
BIOFIZIKA

U Uaitas (White) 401 Uatas (Watt) 217 Ukskulis (Uexkull) 46 Umvelt 46 udarasis kodavimas ir dekodavimas 368 V valdymas 28, 173, 205, 358 informacija 155, 187, 358 instrukcinis 187 hormonais 284 komandinis 187 lstels ciklo 225, 252 populiacij 358 valdymo bdai 205 grtamja informacija 206 kombinuotai 206 miria informacija 206 nerviniais tinklais 289, 290 tiesiogiai 206 valdymo sistemos 207 adaptyvioji 207 antisipacin 207 grtamojo 188, 207 informacinis 365 kibernetin 207 kombinuota 189 lstels ciklo 253 miri 189 optimalaus 207 prognozinio 207 programin 207, 210, 243 savimok 188 sekimo (servosistema) 207, 209 tiesioginio 187, 206 vant Hofo koeficientas 110 Vberis (Weber) 51 Vberio ir Fechnerio dsnis 296 veikianij masi dsnis 97 vektorius 88, 309 verifikavimas 22 Violeris (Wohler) 55 virsmai 30 energijos 31 mediag 31

Virchovas 220, 230 virtualus 22, 25, 26, virusas 229 viskas arba nieko 303 Vis Vitalis 49, 55 vitalizmas 32, kibernetinis 32 Volta 37 stulpas 37 Volteras (Volterra) 41, 142, 328, 379 lygtys 142 modelis 142 Votsonas (Watson) 21, 43 vyksmas 27, 108 bioinformacinis 228 biotechnologinis 27, 228 energijos 59 mediagos 95 mejoz 228 mitoz 228 nestabilieji 108 nesusij 121 sveikaujantys 119 stabilieji 108 susij 123 tikslingas 32 Vyneris (Wiener), 13, 32, 46, 54, 55, 174,178 Vyzelis (Wiesel) 319 Y Yas 42, 44, 364, 373 Z Zad (Zadeh) 204 zigota 278 zoonomija 37 abotinskis () 145 akobas (Jacob) 43, 238, 249 akobo ir Mono schema 44, 242, 245 akobo ir Mono trigerin schema 280 idinys 126,127 inios 173, 186

423
8. Gyvyb adaptyvi, informacij kaupianti, kodavimo ir dekodavimo sistema Dalykin rodykl Rodykl