P. 1
GUÍA%20BIO%202011[1]

GUÍA%20BIO%202011[1]

|Views: 1.327|Likes:
Publicado porAny Mafra Ramirez

More info:

Published by: Any Mafra Ramirez on May 06, 2012
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

10/27/2014

pdf

text

original

GUÍA METODOLÓGICA DE BIOLOGÍA

BENEMÉRITA UNIVERSIDAD AUTÓNOMA DE PUEBLA

Benemérita Universidad Autónoma de Puebla
VICERRECTORÍA DE DOCENCIA
DIRECCIÓN GENERAL DE EDUCACIÓN MEDIA SUPERIOR

GUÍA METODOLÓGICA DE BIOLOGÍA
PLAN 06

AUTORES

PASCUAL VICENTE MUÑOZ MA. DOLORES RAMOS VERA JORGE ANTONIO VIDAL ARGÜELLO MIRIAM ROMERO TORRES

AGOSTO 2011

GUÍA METODOLÓGICA DE BIOLOGÍA

GUÍA METODOLÓGICA DE BIOLOGÍA, PLAN 06

Dr. Roberto Enrique Agüera Ibañez
RECTOR

Dr. José Ramón Eguibar Cuenca
SECRETARIO GENERAL

Ma. Esther Gámez Rodríguez
ABOGADA GENERAL

Mtro. José Jaime Vázquez López
VICERRECTOR DE DOCENCIA

Lic. Jorge Luis Lima Villegas
DIRECTOR GENERAL DE EDUCACIÓN MEDIA SUPERIOR

Lilián Ruiz Córdoba
SECRETARIA ACADÉMICA DE LA DGEMS

Esta guía metodológica se elaboró en la Dirección General de Educación Media Superior de la Benemérita Universidad Autónoma de Puebla

D.R. © BENEMÉRITA UNIVERSIDAD AUTÓNOMA DE PUEBLA CALLE 4 SUR 104, COL CENTRO C.P. 72000. PUEBLA, PUE. MÉXICO AGOSTO DE 2011

2

GUÍA METODOLÓGICA DE BIOLOGÍA

PRESENTACIÓN
El trabajo que a continuación se presenta es producto de la conjunción entre los objetivos trabajados en ciclos anteriores con el modelo constructivista del conocimiento dentro del Modelo Universitario Minerva de la Benemérita Universidad Autónoma de Puebla y el enfoque en el desarrollo de competencias de acuerdo a la Reforma Integral de la Educación Media Superior (RIEMS), integrando la Asignatura de Biología al Marco Curricular Común (MCC) que permitirá dar en un futuro la flexibilidad y el enriquecimiento del currículo del bachillerato. Los bloques que se presentan son los siguientes: BLOQUE 1. LA BIOLOGÍA COMO CIENCIA BLOQUE 2. CÉLULA, ESTRUCTURA Y FUNCIÓN BLOQUE 3. HERENCIA Y VARIACIÓN BLOQUE 4. LA EVOLUCIÓN DE LOS SERES VIVOS BLOQUE 5. BIODIVERSIDAD Y MEDIO AMBIENTE BLOQUE 6. INTRODUCCIÓN A LA ANATOMÍA Y FISIOLOGÍA HUMANA En cada bloque se especifican las competencias genéricas y sus atributos, posteriormente se presentan las tablas de objetivos específicos; conocimientos previos, declarativos, procedimentales y actitudinales/valorales, así como los contenidos específicos, mapas conceptuales, los criterios de evaluación de acuerdo al Programa de Estudios de la Asignatura, orientaciones didáctico-pedagógicas y la bibliografía, vínculos a sitios web de interés (TIC’s y TAC’s) y material audiovisual para desarrollar las actividades. Bloque 1. La Biología como Ciencia. Analiza a la Biología como una ciencia construida desde lo social y fundamentada en paradigmas, para reconocerse como un ser biológico y social, contrastando el carácter intra e interdisciplinario de esta ciencia con otras.

3

GUÍA METODOLÓGICA DE BIOLOGÍA

Bloque 2. Célula, Estructura y Función. Relaciona la composición química con la estructura y fisiología celular, para valorar la importancia de la célula como unidad estructural y funcional de los seres vivos a través del análisis de los procesos celulares. Bloque 3. Herencia y Variación. Investiga los fundamentos que permiten delinear las bases genéticas de la herencia para argumentar su desarrollo histórico, así como su impacto en la vida actual, valorando la trascendencia del proyecto genoma humano y su alcance en las aplicaciones de la biotecnología a través de la resolución de problemas, elaboración de cariotipos y la realización de un ensayo. Bloque 4. Evolución de los Seres Vivos. Investiga las principales teorías sobre el origen y evolución de los seres vivos para explicar la diversidad, a través de la comparación de los cambios genéticos, que han manifestado a través del tiempo. Bloque 5. Biodiversidad y Medio Ambiente. Interrelaciona el medio ambiente y su biodiversidad con el flujo de materia y energía de cada ecosistema para ubicarlos y valorar el equilibrio de la biosfera a través de una visita guiada a áreas naturales y la elaboración de un mapa mental integrador. Bloque 6. Introducción a la Anatomía y Fisiología Humana. Identifica la organización del cuerpo humano y la función que desempeñan los sistemas en el mantenimiento de la homeostasis del mismo, para tomar decisiones en el cuidado de su cuerpo a través del uso de modelos anatómicos.

4

GUÍA METODOLÓGICA DE BIOLOGÍA

JUSTIFICACIÓN

El nivel educativo medio superior en México emprende una transformación de fondo a través de la Reforma Integral de la Educación Media Superior (RIEMS) acordada en 2008 entre la Asociación Nacional de Universidades e Instituciones de Educación Superior (ANUIES) y la Secretaría de Educación Media Superior de la Secretaría de Educación Pública (SEP – SSEMS), en dicha reforma, la vertiente más relevante lo es la orientación pedagógica educativa basada en el desarrollo de competencias; enfoque cuyas intenciones es demasiado pertinente en un país como México, en donde se requiere de la formación de personas capaces de dirigir una nación hacia la búsqueda de verdaderos cambios que se reflejen primeramente en el individuo y posteriormente en la sociedad de la que forma parte. Por consiguiente, se requiere de la formación integral, partiendo necesariamente desde la convivencia con prácticas o actividades de aprendizaje implementadas en primer lugar para el crecimiento en el factor desarrollo humano, en este caso específico del estudiante, a quien se le prepara a ser una persona diferente, con actitud propositiva, en la mirada de mejorar su realidad, en diversos casos, de los cuales pueden mencionarse: el contribuir al desarrollo sustentable, a propiciar una sociedad democrática, utilizar de forma responsable la tecnología, y conformar un proyecto de vida que implique dar respuesta a los retos que le corresponde vivir. Ante este compromiso, la asignatura de Biología que se imparte en el segundo año del Plan de estudios 06 del nivel medio superior de la Benemérita Universidad Autónoma de Puebla (BUAP), busca al igual que las otras asignaturas del plan curricular de contribuir en la preparación de ciudadanos que necesita la sociedad, la cual es cada vez más compleja y demandante. En este tenor, la asignatura se ubica dentro de tres marcos que son:
5

GUÍA METODOLÓGICA DE BIOLOGÍA

• Marco mundial, en donde el fenómeno de la globalización permea el ambiente educativo a través de la incorporación de una cultura científica nacional, que rescata como eje de apoyo los mejores conocimientos elaborados en el mundo, encaminando su aplicación a formar personas críticas, creativas, competentes, capaces de incidir en aquellos ámbitos en los que se desenvuelve para mejorar su entorno nacional. • Marco nacional, que se caracteriza por la RIEMS que establece Competencias a desarrollar en el estudiante y docente; constituyendo así el marco curricular común del Sistema Nacional de Bachillerato. Esta educación en competencias enfatiza el acento en el “Saber Hacer”, es decir, visualizar la movilización práctica y no ociosa de los conocimientos, habilidades, aptitudes y actitudes que el estudiante aprende a través de su formación escolar, en donde éste sea capaz de aplicarlos en la solución de problemas y/o retos que se le presentan en la vida académica, cotidiana y más allá de su trayectoria escolar. • Marco institucional, constituyéndose en el Modelo Universitario Minerva (MUM), cuyo sustento base lo es el enfoque metodológico constructivista sociocultural, orientación que el nivel medio superior universitario manifiesta en el desglose de su mapa curricular, a la vez derivándose en un equilibrio entre las aéreas de Ciencias Naturales y Exactas, Ciencias Sociales, Lenguaje y Humanidades. Asimismo se establece un tronco común, que incluye la readecuación y adaptación de los programas de diversas asignaturas con la finalidad de brindar a los estudiantes una educación que les permita una vez que egrese del nivel medio superior, acceder de forma crítica y ética al nivel superior y/o incorporarse al campo laboral. Bajo este contexto, la asignatura de Biología ofrece junto con las demás asignaturas en su relación interdisciplinar, transdisciplinar y transversalidad saberes que contribuyen al crecimiento cognitivo y cognoscitivo del estudiante

6

habilidades. de carácter ético. actitudes y valores integrados que permiten la realización de diversos desempeños o tareas. además tienen un enfoque práctico en distintos contextos. 7 . y social. resolución de problemas cotidianos y la comprensión racional de su entorno. Específicamente la Biología pertenece al área de las ciencias experimentales. implica el dominio de las principales metodologías y enfoques propios de distintas áreas de conocimiento. Dicho de otra manera. contribuir y desarrollar la formación por competencias es tarea compleja. sin omitir el rigor de las disciplinas y favorece acciones responsables hacia el medio ambiente y a sí mismo. no puede ser concebida sin la aplicación de actividades experimentales de sus contenidos. a fin de propiciar la formación integral del estudiante. Y las Disciplinares que capacitan al estudiante para procesar. Por lo que implica generar ambientes de aprendizaje en donde se pretende desarrollar un conjunto de competencias que integran conocimientos. útiles a lo largo de la vida. Por su carácter experimental. académico. a través de una serie de actividades que le permitan el desarrollo y adquisición de competencias indispensables para la vida. La idea principal es avanzar hacia la preparación de individuos con cualidades individuales. pero no imposible. como son las de tipo: Genérico que describen fundamentalmente conocimientos. la ciencia y la tecnología. aplicar y transformar en contextos específicos. habilidades y actitudes.GUÍA METODOLÓGICA DE BIOLOGÍA hacia su aprendizaje y autoaprendizaje y a la generación de conocimientos que va a favorecer al avance de la cultura. el conocimiento organizado en las disciplinas. que están orientadas hacia la aplicación de métodos y procedimientos de las ciencias.

Psicología y Desarrollo Humano ASIGNATURAS CONSECUENTES: Física. “Psicología y Desarrollo Humano” en primer año. Educación Ambiental y Salud. Temas Selectos de Biología y Bioquímica. “Física” y materias propedéuticas como “Educación Ambiental y para la Salud”. y una relación horizontal con “Matemáticas”.GUÍA METODOLÓGICA DE BIOLOGÍA PROGRAMA EDUCATIVO (PE): NIVEL MEDIO SUPERIOR ASIGNATURA: BIOLOGÍA CÓDIGO: PROG 0015 NIVEL: MEDIO SUPERIOR CRÉDITOS: 10 UNIDAD ACADÉMICA: PROGRAMA EDUCATIVO: MODALIDAD EDUCATIVA: NIVEL EDUCATIVO: CÓDIGO: NOMBRE DE LA ASIGNATURA: UBICACIÓN EN EL MAPA CURRICULAR: NIVEL MEDIO SUPERIOR PLAN 06 ESCOLARIZADA BACHILLERATO 0015 BIOLOGÍA SEGUNDO AÑO CORRELACIÓN: La relación vertical que tiene este programa con respecto a su ubicación en el mapa curricular es con “Química”. “Temas Selectos de Biología” y “Bioquímica” en tercer año. “Cultura Física” e “Informática” en segundo año ASIGNATURAS PRECEDENTES: Química. CARGA HORARIA DEL ESTUDIANTE TEORÍA HORAS CRÉDITOS PRÁCTICA HORAS CRÉDITOS ESTUDIO INDEPENDIENTE HORAS CRÉDITOS TOTAL HORAS CRÉDITOS 4 2 6 10 8 .

6 ¿Cuál es la relación tejido-órgano-sistema? 40 45 48 50 80 86 88 BLOQUE 3 .4 ¿Qué diferencia hay entre los patrones hereditarios mendelianos y los no mendelianos? 3.HERENCIA Y VARIACIÓN 3.2 ¿Qué diferencia hay entre célula procarionte y eucarionte? 2. ESTRUCTURA Y FUNCIÓN 2.3 ¿Cuál es el objeto de estudio de la Biología? 1.6 ¿Cuáles son las aplicaciones más importantes de la Genética? 9 92 97 100 101 102 113 119 .4 ¿Cómo se reproducen las células? 2.2 ¿Cuáles son los paradigmas en los que se basa de la Biología? 1.4 ¿Cuál es la importancia de la Biología en la solución de problemas del entorno social? 1.3 ¿En qué consisten las leyes establecidas por Mendel sobre la herencia? 3.GUÍA METODOLÓGICA DE BIOLOGÍA ÍNDICE Presentación Justificación Índice Propósitos BLOQUE 1 – LA BIOLOGÍA COMO CIENCIA 1.5 ¿Qué es una mutación? 3.1 ¿Cuáles hechos históricos condujeron al desarrollo de la Genética? 3.3 ¿Cómo está estructurada y cómo funciona una célula? 2.1 ¿Qué relación tiene la Biología con el desarrollo social 1.2 ¿Qué diferencias y similitudes encontramos en los conceptos de Genética? 3.5 ¿Cuáles son las características de los niveles de organización de la materia? 3 5 9 11 12 16 17 25 30 35 BLOQUE 2 – CÉLULA.1 ¿Cuáles hechos históricos condujeron al planteamiento de la Teoría Celular? 2.5 ¿Cómo se pasa de una célula a la pluricelularidad? 2.

4 ¿Cómo funciona el sistema digestivo? 6.3 ¿Cómo funciona el sistema óseo? 6.1 ¿Cómo funciona el sistema tegumentario? 6.1 ¿Cómo se clasifican a los seres vivos? 5.7 ¿Cómo funciona el sistema linfático? 6.5 ¿Cuáles son las evidencias de la evolución? 135 139 139 144 148 156 BLOQUE 5 – BIODIVERSIDAD Y MEDIO AMBIENTE 5.2 ¿Cómo se originó la vida? 4.11 ¿Cómo funciona el sistema reproductor? 281 286 288 291 294 298 300 304 305 307 315 320 10 .5 ¿Cuál es la dinámica de los ecosistemas? 5.9 ¿Cómo funciona el sistema nervioso? 6.7 ¿Cuáles son las grandes divisiones de la biósfera? 180 185 191 195 232 248 257 265 BLOQUE 6 – INTRODUCCIÓN A LA NATOMÍA Y FISIOLOGÍA HUMANA 6.10 ¿Cómo funciona el sistema endócrino? 6.3 ¿Cómo se originaron las células eucariontes? 4.6 ¿Cómo se equilibran los ciclos biogeoquímicos? 5.3 ¿Cuál es el sistema actual de clasificación de los seres vivos? 5.4 ¿Cómo se relaciona la biodiversidad con el medio ambiente? 5.1 ¿Qué es la evolución biológica? 4.8 ¿Cómo funciona el sistema excretor? 6.4 ¿Cómo explica la evolución la diversidad de los seres vivos? 4.6 ¿Cómo funciona el sistema circulatorio? 6.2 Los virus ¿vivo o no vivo? 5.5 ¿Cómo funciona el sistema respiratorio? 6.2 ¿Cómo funciona el sistema muscular? 6.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 4 – EVOLUCIÓN DE LOS SERES VIVOS 4.

11. considerando otros puntos de vista de manera crítica y reflexiva. Obtiene. Disciplinares Básicas 1. asumiendo consideraciones éticas. Elige y practica estilos de vida saludables. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo. 9. coherente y sintética. física y ecológica de los sistemas vivos. Atributos: 3. 5.2 Toma decisiones a partir de la valoración de las consecuencias de distintos hábitos de consumo y conductas de riesgo. Competencias a desarrollar en la Asignatura: Genéricas 3. biológica. 12. 13. 5. Sustenta una postura personal sobre temas de interés y relevancia general. consultando fuentes relevantes y realizando experimentos pertinentes. Diseña modelos o prototipos para resolver problemas. 6. Emite juicios de valor sobre la contribución y alcances de la ciencia como proceso colaborativo e interdisciplinario en la construcción social del conocimiento. definiendo un curso de acción con pasos específicos. reflexiva y creativa aplicándolas en la resolución de problemas en diversos contextos. instrumentos y equipo en la realización de actividades de su vida cotidiana. actitudes y valores.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. Desarrolla innovaciones y propone soluciones a problemas a partir de métodos establecidos. Fundamenta opiniones sobre los impactos de la ciencia y la tecnología en su vida cotidiana. a través de la movilización de conocimientos. 5. Relaciona los niveles de organización química.5 Sintetiza evidencias obtenidas mediante la experimentación para producir conclusiones y formular nuevas preguntas. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. 7. 6. habilidades.2 Evalúa argumentos y opiniones e identifica prejuicios y falacias. 14. 2. Atributos: 8. 8. Atributos: 6. Identifica problemas.GUÍA METODOLÓGICA DE BIOLOGÍA PROPÓSITOS DE LA ASIGNATURA: Analizar los conceptos y procesos biológicos sustentados en el respeto hacia la vida y su entorno.1 Propone maneras de solucionar un problema o desarrollar un proyecto en equipo. registra y sistematiza la información para responder a la pregunta de carácter científico. 4.4 Estructura ideas y argumentos de manera clara. satisfacer necesidades o demostrar principios científicos. jerarquías y relaciones. Analiza las leyes generales que rigen el funcionamiento del medio físico y valora las acciones humanas de impacto ambiental.2 Ordena información de acuerdo a categorías. Participa y colabora de manera efectiva en equipos diversos.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. formula preguntas de carácter científico y plantea las hipótesis necesarias para responderlas. Atributos: 5. 5.3 Asume una actitud constructiva. 6. 8. sus procesos vitales y el entorno al que pertenece. Rectifica preconcepciones personales o comunes sobre diversos fenómenos naturales a partir de evidencias científicas. Aplica normas de seguridad en el manejo de sustancias. para generar mejores explicaciones de los fenómenos que se llevan a cabo en los seres vivos de manera crítica. 11 .

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 1 La Biología como ciencia 12 .

GUÍA METODOLÓGICA DE BIOLOGÍA 13 .

8. familiar y personal. sus ramas y ciencias auxiliares a través de la elaboración de un mapa mental. definiendo un curso de acción con pasos específicos.2 Ordena información de acuerdo a categorías. Argumenta la relación que existe entre la Biología con la Tecnología y la Sociedad. Analiza los cuatro paradigmas que dan el carácter de cientificidad a la Biología. para reconocerse como un ser biológico y social. Obtiene. 1. Reflexiona de manera informada y crítica sobre las implicaciones de la investigación científica en los diferentes ámbitos social. Jerarquiza los niveles de organización de la materia viva Explica las características distintivas de los seres vivos y las ejemplifica. Fundamenta el campo de acción de la Biología y sus principales ramas. Fomenta la tolerancia y disponibilidad en el trabajo colaborativo durante la realización de proyectos. Construye un mapa mental de la interrelación de la Biología. SABERES Procedimentales Investiga las aportaciones y aplicaciones de la Biología y sus ramas por medio de un glosario. Contrasta los paradigmas de la Biología a través de un debate en plenaria Emplea el método científico para desarrollar un proyecto de investigación. contrastando el carácter intra e interdisciplinario de esta ciencia con otras.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE 1: LA BIOLOGÍA COMO CIENCIA TIEMPO: 18 horas UNIDAD DE COMPETENCIA: Analiza a la Biología como una ciencia construida desde lo social y fundamentada en paradigmas. COMPETENCIAS Genéricas/Atributos Disciplinares 5. registra y sistematiza la información para responder a la pregunta de carácter científico. 14 . CRITERIOS DE DESEMPEÑO Contrasta los paradigmas de la Biología a través de un debate en plenaria Emplea el método científico para desarrollar un proyecto de investigación. consultando fuentes relevantes y realizando experimentos pertinentes. Actitudinales/ Valorales Valora el impacto de los avances de la Biología en la sociedad actual. Interrelaciona la Biología. sus ramas y ciencias auxiliares. Declarativos Conceptúa a la Biología como una ciencia.1 Propone maneras de solucionar un problema o desarrollar un proyecto en equipo. • • • 5. Emite juicios de valor sobre la contribución y alcances de la ciencia como proceso colaborativo e interdisciplinario en la construcción social del conocimiento. Identifica problemas. formula preguntas de carácter científico y plantea las hipótesis necesarias para responderlas.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. 5. 4. jerarquías y relaciones.

GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • Clase Magistral • Base orientadora de la ESTRATEGIAS DE APRENDIZAJE • Glosario • Mapa mental • Debate RECURSOS DIDÁCTICOS • Guía metodológica • Internet EVIDENCIAS Y/O PRODUCTOS • Actividades de la guía metodológica del alumno. • Mapa mental acción (BOA) • Libros y Revistas • Asesoría metodológica y • Proyecto de electrónicas. ¿Qué estudia la Biología? _______________________________________________________________________ 2. Escribe el nombre de tres científicos que hayan contribuido al estudio de la Biología _______________________________________________________________________ 3. ¿Con qué ciencias se relaciona la Biología? _______________________________________________________________________ 4. • Artículos de divulgación • Debate • Proyecto de investigación temática • Curso extracurricular investigación en revistas científicas • Pintarrón sobre metodología de la investigación EXPLORANDO TUS CONOCIMIENTOS 1. Escribe una aplicación de algún conocimiento o descubrimiento biológico que conozcas _______________________________________________________________________ _______________________________________________________________________ 5. Escribe cuáles son los pasos del método científico _______________________________________________________________________ _______________________________________________________________________ 15 .

con ramas muy variadas que se dividen a su vez en otras disciplinas. Las ciencias que auxilian a la Biología para lograr investigaciones completas se denominan ciencias auxiliares. la evolución. la agricultura y la cría y mejora de animales. entre otras. Geografía. se ha transformado en una ciencia que busca comprender las funciones y las estructuras de los seres vivos. Además. donde el conocimiento biológico es fundamental. Historia. ha establecido conceptos. 16 . la herencia. se apoya en otras disciplinas científicas. LA BIOLOGÍA DENTRO DEL CONTEXTO DE OTRAS CIENCIAS La Biología es una ciencia tan compleja que para alcanzar sus objeticos. Física. La Biología en la actualidad ha conformado una gran trama conceptual y metodológica que ha logrado comprender y explicar la enorme complejidad de los seres vivos. Las principales se enuncian a continuación: Química. sus conocimientos tienen importantes consecuencias en la sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el uso de los recursos naturales. Este campo de conocimiento que inició como la descripción y la clasificación del mundo viviente. Tiene también una amplia gama de aplicaciones prácticas y ha contribuido al desarrollo de una gran cantidad de campos aplicados. la interacción con el medio y con otros organismos. Matemáticas.1 ¿QUÉ RELACIÓN TIENE LA BIOLOGÍA CON EL DESARROLLO SOCIAL? La Biología es la ciencia que estudia a los seres vivos. la biotecnología.GUÍA METODOLÓGICA DE BIOLOGÍA 1. integra temas fundamentales en el estudio de los organismos. como son: el desarrollo. teorías y principios y varios enfoques metodológicos para abordar el estudio de la vida. Surge de manera formal en el siglo XIX y ha definido su objeto de estudio a lo largo de la historia. como la medicina. Ya vimos que la Biología es una ciencia muy extensa. la ingeniería genética.

sin embargo las que se retoman por su gran contribución al campo de estudio de la Biología ya que se definieron nuevos conceptos. Relaciones evolutivas entre los seres vivos Funciones orgánicas de los seres vivos Herencia de los caracteres biológicos Estructura y funciones de los tejidos Estructura de los seres vivos. grandes programas de investigación que se encuentran en el origen de la Biología moderna son los siguientes: 17 . Desarrollo de los óvulos fecundados Comportamiento animal Variación de las especies a lo largo del tiempo.GUÍA METODOLÓGICA DE BIOLOGÍA RAMA Anatomía Bacteriología Bioquímica Botánica Citología Ecología Embriología Etología Evolución Filogenia Fisiología Genética Histología Morfología Paleontología Taxonomía Virología Zoología OBJETO DE ESTUDIO Estructura de los organismos Bacterias Composición química de la materia viva Plantas Estructura y funciones de las células Ecosistemas. es decir. métodos y objetos de estudio.2 ¿CUÁLES SON LOS PARADIGMAS EN LOS QUE SE BASA LA BIOLOGÍA? Han existido una gran cantidad de investigaciones en los diferentes campos de estudio de la Biología. Vida en el pasado Clasificación y nomenclatura de los seres vivos Virus Animales 1.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Haz una investigación documental de otras ramas de la Biología que no estén en el cuadro anterior y llénalo en la siguiente tabla Rama Objeto de estudio 18 .

GUÍA METODOLÓGICA DE BIOLOGÍA Responde las siguientes preguntas 1. ¿Cómo puede contribuir la Genética a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 19 . ¿Cómo puede contribuir la bioquímica a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 3. ¿Cómo puede contribuir la entomología a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 2.

El tercer paradigma es la teoría de la homeostasis. que abordan problemas de carácter general y que por ello se denominan como paradigmas globales de la Biología. coautor quien llegó a las mismas conclusiones de manera independiente a Darwin.3) El segundo paradigma es la teoría de la evolución formulada por Charles Darwin en su obra El origen de las especies (1859). enunciado por Claude Bernard y contenido en la 20 . quienes escriben la versión definitiva de su enunciado en 1839 (fig. A esta teoría hay que añadir a Alfred Rusell Wallace. los conceptos y las teorías. 3. esto es. El paradigma incluye los problemas relevantes a resolver. esto es. las formas reconocidas como válidas para solucionarlos. como modelo de problemas y soluciones de una sociedad científica determinada. de la regulación del medio interno de los organismos. los datos empíricos. lo que se considera científico —o más en particular. lo objetivo— queda determinado por las convenciones de los miembros de la comunidad y así resulta imposible decidir la superioridad científica de un paradigma sobre otro. De esta manera. etc. La Biología se constituyó como ciencia hasta el siglo XIX en un proceso que inició en 1838 con la formulación de la teoría celular y que culminó en 1900 con el descubrimiento de las leyes de la herencia. aunque es rechazada por ciertos sectores.GUÍA METODOLÓGICA DE BIOLOGÍA • • • • Teoría Celular Teoría de la evolución Teoría del gen Teoría de la homeostasis El paradigma constituye un cuerpo de conocimientos teóricos y metodológicos que son reconocidos durante cierto tiempo. En este orden de ideas. los criterios y juicios de valor compartidos por la comunidad. los procedimientos experimentales. genera una polémica que ya se da en el seno de una comunidad científica constituida. la cual. siendo en este periodo cuando por vez primera contamos con conceptos unificadores de orden general y con una posible aceptación universal. el primer paradigma global es la teoría celular formulada por Teodoro Schwann y Matias J Schleiden. Es en esta etapa cuando se formulan paradigmas de orden superior.

Investiga y añade 10 prefijos y sufijos distintos a los mostrados. opuesto por si mismo vida célula verde dos verdadero vegetal luz sangre relativo a plantas diferente agua 21 . ACTIVIDAD Completa la siguiente tabla con la información que se te solicita. bi eu fito foto hemo herb hetero hidro sin contra. publicado en 1878.GUÍA METODOLÓGICA DE BIOLOGÍA obra Lecciones sobre los Fenómenos de la Vida Comunes a los Animales y los Vegetales. Erich Tschermak y Hugo De Vries. Dicha información debe estar relacionada con la asignatura de Biología. pero que carece de impacto científico hasta su redescubrimiento en 1900 al haber llegado a esas mismas conclusiones Carl Correns. en el texto Experimentos sobre Hibridación de las Plantas. Prefijo significado ejemplo significado a anti auto bio cito cloro di. El cuarto paradigma son las leyes de la herencia formuladas por el monje agustino Gregorio Mendel en 1865.

GUÍA METODOLÓGICA DE BIOLOGÍA hiper hipo por encima de por debajo de homeo igual homo iso macro micro poli proto igual igual grande pequeño muchos primero pseudo "falso vita zoo vida animal Sufijo dermis piel fago fase significado ejemplo significado comida estado 22 .

23 . producción inflamación rompimiento estudio de medición condición.GUÍA METODOLÓGICA DE BIOLOGÍA filo gen itis lisis logía metro osis podo trofos que lo atrae. Escribe en cada inciso la relación existente entre los dos paradigmas interrelacionados según indican las flechas. enfermedad pie alimento ACTIVIDAD En cada espacio escribe el nombre de cada uno de los paradigmas de la biología. su autor(es) y el año de su creación. afín a origen.

GUÍA METODOLÓGICA DE BIOLOGÍA a) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ b) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ c) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ d) ___________________________________________________________________________________ 24 .

en tanto que una piedra o el agua de lluvia no lo son. Los seres vivos tienen una estructura organizada. pues ésta permite 25 . Su unidad primordial es la célula. la organización se hace más compleja. un rosal o una gallina son seres vivos. A pesar de su enorme diversidad. a partir de ella. Éstas son las siguientes: Organización.GUÍA METODOLÓGICA DE BIOLOGÍA ___________________________________________________________________________________ ________________________________________________________________________________ e) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ f) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ Finalmente. qué puedes concluir al término de está actividad con respecto a los paradigmas de la Biología ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ 1.3 ¿CUÁL ES EL OBJETO DE ESTUDIO DE LA BIOLOGÍA? Cualquier persona puede reconocer que una hormiga. los seres vivos de nuestro planeta comparten una lista de características que los distinguen como tales.

A pesar de que algunos objetos no vivos pueden tener una o más de estas características (algunos cristales de roca pueden crecer. participan en reacciones químicas. únicamente los seres vivos las reúnen todas. Movimiento.GUÍA METODOLÓGICA DE BIOLOGÍA generar tejidos. Por ejemplo. El conjunto de reacciones químicas ocurridas en un ser vivo se lama metabolismo. órganos y sistemas. lo que los hace crecer. las cuales obtienes mediante la alimentación y la respiración. Metabolismo. Tu cuerpo está formado por sustancias en constante transformación. los osos polares tienen una gruesa capa de grasa bajo la piel que los ayuda a sobrevivir en temperaturas por debajo de los cero grados centígrados. Por ejemplo. protegerse para huir de algún depredador.1) 26 . Los seres vivos producen descendencia similar a ellos. 1. es decir. Multiplican su número de células a partir de una sola. como las plantas. que orientan sus hojas hacia la luz. Es la facultad de desplazar el cuerpo de un punto a otro. Esto hace suponer que todos los seres vivos tienen un mismo origen: una especie que evolucionó de maneras distintas para dar lugar a la enorme cantidad de especies. tu crecimiento se detendrá. Responden a estímulos del medio ambiente. Generalmente el movimiento ocurre para conseguir alimento. A esa primera especie se le llama ancestro común y una prueba irrefutable de su existencia es que todos los seres vivos del planeta usan la misma sustancia química para heredar sus características: el ácido desoxirribonucleico (ADN) (fig. o al menos una parte de él. Reproducción. ¿Has observado cachorros de algunas mascotas? Crecimiento. Irritabilidad. Adaptación. Tú crecerás varios centímetros más y al llegar a cierta edad. las plantas crecen en dirección a la luz y las personas nos rascamos cuando nos pica un mosquito. Los seres vivos tienen capacidad para adaptarse y sobrevivir en un ambiente determinado. Tu cuerpo está formado por células que a su vez constituyen tejidos (como la piel) órganos como el corazón). En tu interior éstas se combinan y se descomponen.

2. 1 planta. 1 lombriz de tierra. ACTIVIDAD ESPECÍFICA .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD 1. Organizados en equipos.PROYECTO EN MI CONTEXTO Por equipo. En el siguiente cuadro comparativo de los tres objetos de estudio marquen el recuadro que señale la característica correspondiente que posea. a) ¿La roca posee alguna característica por la que pudiera ser considerada ser vivo?. puede tener una sola de las características analizadas o debe tenerlas todas? Explícalo. escojan un tema sobre Biología que les guste para trabajar un proyecto que desarrollarán durante esta unidad. __________________________________________________________________________ __________________________________________________________________________ c) ¿Cuál es la unidad fundamental de la que estamos constituidos todos los seres vivos? ____________ . ¿por qué? __________________________________________________________________________ __________________________________________________________________________ b) Para que se considere que un ser está vivo. Considera los siguientes aspectos para desarrollarlo 27 .. observen con una lupa las características de 1 roca.

Fuentes de información Las fuentes de información son muy pocas o ninguna. la investigación. BIEN (2) La pregunta o problema es relevante. 28 . éstas no son confiables ni contribuyen al tema. es relevante y actualizada. La información recopilada tiene relación con el tema pero algunas no están al día o no son relevantes. Establece el Establece el propósito de la propósito de la investigación. motiva la investigación y contribuye de manera satisfactoria al conocimiento. La utilizada es metodología utilizada adecuada para es adecuada para resolver el problema. Las fuentes son confiables y contribuyen al desarrollo del tema. Si utiliza fuentes. seleccionando la No establece los metodología para criterios o éstos no resolver el problema. Las fuentes son confiables (aceptadas dentro de la especialidad) y contribuyen al desarrollo del tema. Las fuentes de información son variadas y múltiples. DEFICIENTE (1) La pregunta o problema tiene muy poca o ninguna relevancia y posibilidad de solución. La información recopilada es actualizada pero incluye algunos datos que no son relevantes o no tienen relación con el tema. la establece. Tiene adecuada para dificultad resolver el problema. Metodología de investigación Las fuentes de información son variadas y múltiples. La información tiene poca o ninguna relación con el tema principal. resolver el problema. El propósito de la investigación no es Establece el propósito claro o no se de la investigación. pero metodología y tiene dificultad para criterios a ser establecer los utilizados.GUÍA METODOLÓGICA DE BIOLOGÍA RÚBRICA PARA EVALUAR UN PROYECTO DE INVESTIGACIÓN Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Asignatura: PONDERACIÓN CRITERIOS EXCELENTE (4) MUY BIEN (3) La pregunta o problema es relevante y aunque motiva la investigación. No metodología. pero su solución es predecible y su contribución al conocimiento es limitado. TOTAL El Problema o la pregunta La pregunta y el problema son relevantes. Las fuentes de información son limitadas o poco variadas. son apropiados para el problema. La criterios a ser metodología utilizados. La información recopilada tiene relación con el tema. pero establece la tiene dificultad para metodología a establecer los utilizar o ésta no es criterios. su contribución al conocimiento es limitado. No motiva la investigación. la metodología. Algunas fuentes no son confiables por lo que no contribuyen al desarrollo del tema.

Tiene dificultad documentando las fuentes de información o no las documenta. Tiene dificultad sustentando la conclusión con los datos. No corrobora los datos y tampoco mantiene la integridad de los mismos. Tiene dificultad haciendo inferencias de los datos y relacionándolo con el conocimiento previo. Responde parcialmente a los objetivos o no responde. Responde a los objetivos. No sustenta la conclusión con los datos. Se sustenta con los datos.. Mantiene poca o ninguna objetividad en el análisis de los datos. Responde a los objetivos. Incluye fuentes de información que no están citadas en la investigación. Las fuentes de información presentan algunos errores. Constructivismo: Estrategias para aprender a aprender. No utiliza los formatos establecidos. Recopila y organiza los datos de acuerdo al área de estudio. Mantiene objetividad al expresar las ideas. Tiene dificultad utilizando los formatos del área de estudio en la citación de las fuentes.GUÍA METODOLÓGICA DE BIOLOGÍA Recopila y organiza los datos de acuerdo al área de estudio. Éstos tienen poca o ninguna credibilidad. Mantiene muy poca o ninguna objetividad al expresar las ideas. Establece relaciones entre los datos (diferencias y similitudes). Corrobora los datos. Mantiene objetividad en el análisis de los datos. Las fuentes de información están documentadas. Mantiene objetividad al expresar las ideas. Recopila y organiza los datos de acuerdo al área de estudio. Total: Documentación Mantiene objetividad en el análisis de los datos.. Comentarios: REFERENCIAS: (Pimienta. Tiene dificultad corroborando los datos y manteniendo la integridad en la recopilación de los mismos. no los altera para su beneficio. Conclusión Las fuentes de información están documentadas y propiamente citadas. Mantiene integridad en la recopilación de los datos. Tiene dificultad estableciendo relaciones entre los datos (diferencias y similitudes). Corrobora los datos. Los relaciona con el conocimiento previo. Metodología Constructivista. No puede hacer inferencias o relacionar los datos con el conocimiento previo. Tiene dificultad manteniendo la integridad en la recopilación de los datos.Tiene dificultad estableciendo relaciones entre los datos (diferencias y similitudes) y haciendo inferencias. Establece relaciones entre los datos (diferencias y similitudes). También tiene dificultad relacionando los datos con el conocimiento previo Recopila muy pocos datos o ninguno. Puede hacer inferencias de los datos. 2005) Referencias 29 . Mantiene objetividad en el análisis de los datos. Análisis Responde a los objetivos. Tiene dificultad manteniendo objetividad al expresar las ideas y sustentando la conclusión con los datos. Guía para la planeación docente. 2005) (Pimienta.

hasta nuestros días. La Biología en la actualidad ha conformado una gran trama conceptual y metodológica que ha logrado comprender y explicar la enorme complejidad de los seres vivos. sus conocimientos tienen importantes consecuencias en la sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el uso de los recursos naturales. Para ello las comunidades de científicos han establecido normas y criterios que hacen que sus explicaciones tengan un considerable grado de certeza. sociales e históricos. han cambiado en diferentes épocas. al igual que las otras ciencias. TECNOLOGÍA Y SOCIEDAD La Biología es la ciencia que se encarga del estudio de los seres vivos y de los fenómenos y procesos que ocurren en los seres vivos. Las primeras explicaciones sobre el mundo natural recurrieron a la intervención de factores sobrenaturales. Aunque el término se utilizó por primera vez hasta el siglo XIX. 30 . tratado o estudio. en función de factores científicos. la búsqueda de explicaciones sobre la naturaleza transitó por diferentes rutas hasta llegar a nuestra época en que la ciencia en general (y la biología en particular) se ha convertido en una actividad social fundamental. A lo largo de la historia la búsqueda de conocimiento sobre la naturaleza ha sido abordada de muy diferentes formas y ha perseguido fines diversos. Al iniciar el camino de la racionalidad.GUÍA METODOLÓGICA DE BIOLOGÍA 1. Sin embargo. la ciencia se convirtió en una actividad fundamental ya que planteó una alternativa a las posturas metafísicas para comprender el mundo que nos rodea.C. la disciplina se ejercía desde muchos años atrás con otros nombres. En la actualidad la ciencia ha eliminado estos elementos metafísicos y basa sus explicaciones en causas naturales. Además. de la comparación de hechos y de la aceptación o rechazo de argumentos para aceptar una idea como válida.5 ¿CUÁL ES LA IMPORTANCIA DE LA BIOLOGÍA EN LA SOLUCIÓN DE PROBLEMAS DEL ENTORNO SOCIAL? BIOLOGÍA. por seguir un método que surge de la observación. Su definición deriva etimológicamente del griego bios. donde el conocimiento biológico es fundamental. Desde el año 580 a. La Biología se cuestiona exclusivamente sobre el mundo natural y se caracteriza. estos criterios no han sido siempre los mismos. y de logos. vida. filosóficos.

las ciencias que utilizaban el experimento comenzaron a destacar y a ofrecer resultados aceptables. La ciencia es el resultado del esfuerzo de generaciones anteriores y la cooperación de las contemporáneas y éstas son fundamentales para su desarrollo futuro. El método experimental cobró gran importancia y. pretende formular teorías que expliquen las relaciones que existen entre diferentes clases de fenómenos y procura explicar por qué los hechos ocurren de cierta manera y bajo ciertas condiciones. se otorgaron grandes presupuestos para impulsarlas. El positivismo afirma que: • Las teorías se construyen a través del método experimental. La ciencia no es sólo un conjunto de diferentes formas de conocimiento. cuando se define con precisión su objeto de estudio y se establecen referentes teóricos y metodológicos que unifican el estudio de los seres vivos. pero una de sus intenciones es generar conocimiento nuevo acerca del universo. La Biología además ha promovido el desarrollo del quehacer humano con la generación de fármacos y vacunas para evitar enfermedades. Pero. Debido a esta situación se construyeron enfoques filosóficos que se propusieron explicar la actividad de los científicos. su naturaleza es claramente social. sino que es también el producto de una actividad humana que tiene una naturaleza específica. que trascendió hasta nuestros días. • La ciencia está formada por conocimientos verdaderos.GUÍA METODOLÓGICA DE BIOLOGÍA La Biología como ciencia surge de manera formal en el siglo XIX. la química y la biología servían para desarrollar la industria y. y en algunos aspectos es una concepción que se mantiene en la enseñanza de la ciencia. • La actividad científica es socialmente neutra. • Existe un único método para estudiar la realidad. Puede reelaborar problemas antiguos. la revolución industrial y la burguesía impulsaron de manera importante el desarrollo de las ciencias naturales. ¿por qué se dice que la biología es una ciencia? ¿Qué es lo que caracteriza al conocimiento científico que lo hace distinto a otro tipo de conocimiento? ¿Cómo se construyen las teorías científicas? En el siglo XIX. a través de los años. por lo tanto. La ciencia busca la organización sistemática del conocimiento acerca del mundo. uno de ellos fue el positivismo de Augusto Comte (1798-1857). con la creación y 31 . La física. se convirtió en el método de demostración que establecía la diferencia entre la metafísica y la ciencia.

que tienen la capacidad de transformar el nitrógeno disuelto en el suelo en compuestos que las plantas pueden aprovechar (sales de amonio) y con ellos fabricar ácidos nucléicos (ADN y ARM) y proteínas (fijación del nitrógeno). un mapa físico de las posiciones reales. En el verano del año 2000 se publicó el genoma "en bruto". El primer cromosoma completo (el cromosoma humano 22) se publicó en diciembre de 1999. Se ha calculado que más de 70 millones de toneladas de nitrógeno se incorporan anualmente a la biosfera mediante este proceso. donde el desarrollo de Terapia Génica o estudiando el genoma humano por completo ha abierto las posibilidades de evitar patologías asociadas a factores genéticos. en febrero de 1996 establecieron varios acuerdos los participantes (más de 2000 científicos de más de 20 institutos en 6 países). y la determinación de la secuencia de bases del ADN Novedades en la ciencia El Proyecto Genoma Humano se propuso en 1990 como un estudio a 15 años. se encuentran bacterias del genero Rhizobium.GUÍA METODOLÓGICA DE BIOLOGÍA mejoramiento de nuevas cepas de organismos vivos de uso agrícola. para abril de 2003 se terminó la secuencia completa y se publicó en agosto de 2004. Aunque en un principio se pensó que las aplicaciones y los beneficios serían inmediatos. fácilmente se dieron cuenta de que hay mucho trabajo por delante. ganadero y forestal o incluso en campos como la Genómica. como el fríjol. Sin embargo. en el que se secuenciaría el genoma humano completo. Este tipo particular de bacterias que "infectan" al fríjol son de la especie Rhizobium etli. En el caso de las leguminosas. de más de 3. Mediante una asociación simbiótica entre la bacteria y la raíz se forma una protuberancia. ya que la información genética se considera como la "verdadera herencia" humana. El más importante acuerdo fue que se proveería de una serie de datos para toda la comunidad científica. Desde entonces se abrieron varios caminos a seguir. para cumplir los objetivos planteados inicialmente: crear un mapa genético de los lugares relativos de los genes. En un principio no quedaba claro si toda la información que se obtuviera sería del dominio público o solo propiedad de empresas privadas. donde habita la bacteria y pasa sales de amonio a la raíz. El Proyecto Genoma Humano ha generado la participación de países de todo el mundo que colaboran de manera coordinada. 32 .000 millones de pares de bases.

hasta cierto punto. En América Latina. como Brucella. que provoca una infección grave llamada brucelosis. Por ejemplo. En el Centro de Ciencias Genómicas (CCG) de la UNAM. aunque no son bacterias iguales. Así nos damos cuenta de que la ciencia es sistemática. y en bacterias patógenas del ser humano. podrían utilizar formas comunes para interactuar con diferentes tipos de células. objetiva. como Agrobacterium que provoca tumores. LAS CARACTERÍSTICAS DE LA CIENCIA: EL MÉTODO CIENTÍFICO La ciencia (del latín scientia. hace falta la participación de la sociedad civil y del Estado para aumentar la inversión en estos rubros y para forjar una cultura científica más sólida. se buscan las causas y las consecuencias del fenómeno y se trata de explicarlo sin que en ningún momento las creencias religiosas o de cualquier otra índole afecten el estudio. conocimiento) es un proceso dinámico de adquisición.GUÍA METODOLÓGICA DE BIOLOGÍA Esta asociación y formación del nódulo está determinada por un "dialogo" molecular entre ambas partes. En países como Japón o China se ha comprendido que el desarrollo científico es la base del crecimiento. por lo que resulta muy importante identificar los "sucesos" moleculares que intervienen en este proceso. La ciencia se basa exclusivamente en los hechos del mundo natural y no en las creencias. Otro descubrimiento aun más interesante es que este plásmido tiene genes que se parecen a otros presentes en bacterias patógenas (dañinas) de plantas. analítica y comunicable porque sigue un método para sus estudios y los analiza antes de tomar cualquier resolución. Además. siempre trata que los otros especialistas estén enterados de los resultados 33 . Morelos. por lo que invierten gran parte de su producto interno bruto en la generación de nuevas patentes de las tecnologías creadas por sus científicos. Esto sugiere que. De manera que se ha encontrado que una sección llamada "plásmido simbiótico" en las moléculas de ADN que porta la mayor parte de los genes involucrados en la capacidad de nodular al fríjol y fijar nitrógeno. lo cual permite que sea. el desarrollo de la innovación científico/tecnológica se ha estancado. en Cuernavaca. en un estudio científico de los sismos que ocurren frecuentemente en México. organización y acervo de conocimientos que son el resultado de aplicar el método científico. un grupo de investigadores mexicanos se ha dedicado a analizar la secuencia completa del genoma de Rhizobium etli. colocándonos en desventaja con los demás países del llamado "primer mundo". Aunque en México se cuenta con un buen nivel de desarrollo científico y con la capacidad de vincularlo a la generación de nuevas tecnologías.

El método científico plantea los siguientes pasos: planteamiento del problema. Siguiendo en el ejemplo de los sismos. A mediados del siglo XIX. experimentación confirmación o rechazo de la hipótesis. Así. a muchos microorganismos. La ciencia es explicativa por su naturaleza clara e informativa. hipótesis (verde). De esta forma se pueden evitar algunas catástrofes. Pasteur se dedicó a estudiar una enfermedad llamada cólera de las gallinas. composición del marco teórico. si no es que todas. como en el caso de los modelos preventivos para el desalojo de edificios durante un sismo. con la finalidad de encontrar y obtener microorganismos. Es lo que se va a explicar científicamente en algún grado. suponía que algunas enfermedades. inyectó algunos de estos microorganismos en gallinas sanas: todas enfermaron de cólera y murieron. se informa a la población para que tome las medidas pertinentes y se minimicen los daños. experimentación (rojo). donde se mantenían vivos por varias semanas Posteriormente. 34 . El planteamiento del problema. La composición del marco teórico implica: la revisión de la literatura sobre el tema. Pasteur se dedicó a estudiar diferentes tejidos de las gallinas enfermas. obtuvo algunos que él consideró podían ser los causantes de la enfermedad. que causaba gran mortandad entre las aves. Por fin. y los cultivó en caldos especiales. La formulación de la hipótesis consiste en simples afirmaciones sujetas a comprobación que lleguen a explicar los fenómenos. bien podían ser causadas por ellos. pero sobre todo es verificable porque los resultados pueden reproducirse para confirmar los conocimientos. consiste en hacer una pregunta que guíe todo el proceso de la investigación. formulación de hipótesis. Pasteur había observado a través de microscopios. es predictiva porque genera modelos que se adelantan a los hechos. resultados y conclusión (azul).GUÍA METODOLÓGICA DE BIOLOGÍA para escuchar sugerencias y críticas. ACTIVIDAD Identifica y subraya de distinto color cada uno de los pasos del método experimental que siguió Louis Pasteur: observación y planteamiento del problema (amarillo). la selección de planteamientos de diversas ideas y hasta contrapuestas corrientes teóricas y la elaboración propia del texto.

que es un gas incoloro. La célula es la unidad fundamental por la cual están constituidos todos los seres vivos y en general se acepta que. neutrones y electrones. Si no es así. ¿A qué se llama materia? Todo lo que podemos ver y tocar es materia. obtenemos agua. combinamos el H2 con oxígeno. si. Finalmente. Si combinamos átomos de hidrógeno entre sí obtenemos hidrógeno molecular (H2). carbono) que están formados por átomos. una molécula. esta formada principalmente por carbono. Pero también son materia algunas cosas que no podemos ver. se alcanza una conclusión que recopila los resultados y la comprobación o no de la hipótesis. las interacciones entre las distintas moléculas que ocurren a nivel microscópico. forman biomoléculas que interactúan entre si dentro de la forma viva mas simple que es la célula. estableciendo con el tiempo una teoría o ley. La materia ocupa una cierta porción de espacio que se denomina volumen. 1. la materia viva ocupa los cuatro últimos lugares. hidrógeno. calcio. pueden producir a nivel macroscópico una célula viva. entonces hay que replantear la hipótesis original para volver a comenzar. La materia viva llamada también materia orgánica. al combinarse. En el caso específico del aire esto no es tan evidente. Estos elementos. ¿Qué es la materia viva? Dentro de los niveles de organización. en cambio. ningún organismo es un ser vivo si no consta al menos de una célula LOS NIVELES DE ORGANIZACIÓN DE LA MATERIA La materia en el universo está organizada. oxigeno y nitrógeno. como el aire. Los seres vivos están formados por materia que a su vez está formada por elementos químicos (como el nitrógeno. por ejemplo. Los físicos han descubierto un variado número de partículas subatómicas como protones. 35 .GUÍA METODOLÓGICA DE BIOLOGÍA A través de la experimentación la hipótesis puede ser comprobada una y otra vez. otro gas.5 ¿CUÁLES SON LAS CARACTERÍSTICAS DE LOS NIVELES DE ORGANIZACIÓN DE LA MATERIA? Por sorprendente que parezca.

nervioso. Estas poblaciones interactúan de distinta manera con otras poblaciones del lugar constituyendo una comunidad. como proteínas y ácidos nucleícos. Los organismos pluricelulares están formados por sistemas que actúan en forma coordinada y precisa. Los tejidos están ordenados en estructuras funcionales. 36 . que es una de las miles de millones de galaxias que conforman el Universo. la Vía Láctea. las células se organizan de acuerdo a sus características y funciones conformando tejidos como el conectivo. Cuando se reúnen a todos los individuos de una misma especie que viven en un mismo lugar. formamos grandes y complejas moléculas: las macromoléculas. muscular. que es una asociación coordinada de tejidos y órganos. Por ejemplo. Esta comunidad comparte el mismo lugar físico que presenta características particulares y cuando se relacionan con el medio físico constituye a un ecosistema. que es la capa de la Tierra donde existe vida. denominadas órganos como el corazón y los pulmones en los animales. y el conjunto de ecosistemas forman un bioma caracterizado por las condiciones climáticas que determinan un gran biosistema regional. entre otros). surgen otros niveles superiores de organización que estudian los astrónomos como que nuestro planeta Tierra es parte de un Sistema Solar que a su vez pertenece a una galaxia. Si combinamos moléculas entre sí. y que comparten el mismo hábitat forman una población. En el nivel subcelular múltiples moléculas se ensamblan y dan lugar a estructuras especializadas como los organelos celulares (mitocondrias. es decir. Un individuo es un solo organismo de una especie determinada. Se puede decir que la vida aparece como propiedad definitoria en el nivel celular. o las hojas y las raíces en las plantas. Desde aquí.GUÍA METODOLÓGICA DE BIOLOGÍA La vida surgió a partir de átomos y moléculas. El conjunto de todos los biomas integran a la biosfera. epitelial. no nos referimos a la selva amazónica o a la africana sino a todas las selvas del orbe. por ejemplo la población de elefantes de la sabana africana. la célula es la porción más sencilla de la materia viva que es capaz de realizar todas las funciones vitales. Estas constituyen la materia prima que forman los virus y las células. cuando se habla de la selva. por ejemplo el hombre. cloroplastos. En la mayor parte de los individuos pluricelulares. Las funciones biológicas básicas se llevan a cabo por un sistema o aparato. en el mismo tiempo.

Célula procarionte y eucarionte Organismos unicelulares: bacterias. estómago Sistema circulatorio. el profesor o algún alumno voluntario hará lo mismo tratando de incluir todas las ciencias investigadas por todos los alumnos. banco de atunes Bosque Ecosistemas y biomas terrestres y acuáticos: Bosque tropical. nervioso Corazón. animales y vegetales superiores Parvada de aves. levaduras. Polisacáridos. Primero delimita el campo de acción de la Biología. aminoácidos. los niveles de organización de la materia de forma descendente. cloroplastos. muscular. estrellas. 37 . proteínas. galaxias y universo ACTIVIDAD Escribe en una hoja de tu libreta y en forma de lista. lípidos complejos. ribosomas. protozoarios Tejidos conectivo. algas. neutrones y electrones Carbono. digestivo. epitelial. ácidos nucléicos. ubica cada ciencia utilizando llaves o corchetes de acuerdo al nivel o los niveles correspondientes a su campo de estudio. arrecifes de coral Todos los biomas del planeta Planetas. En forma grupal. nucleótidos. Oxígeno Monosacáridos. Con el trabajo documental de las ramas de la Biología investigadas. Hidrógeno. virus Organelos celulares: mitocondrias. pulmones.GUÍA METODOLÓGICA DE BIOLOGÍA NIVELES DE ORGANIZACIÓN DE LA MATERIA Subatómico Atómico Molecular Macromolecular Subcelular Celular Tisular Órganos Sistémico Organismos Poblacional Comunitario Ecosistema Biosfera Cosmológico Protones. respiratorio Organismos pluricelulares.

L. P. Núm. Biología I. pp 1242 González. J.A. M. (1994). (2007). reflexiva y propositiva Ponderación Logros: Puntos 30 Puntos 60 Puntos 80 Puntos Aspectos a mejorar : 100 Puntos 100 EVALUACIÓN DIAGNÓSTICA Aplicación de un examen diagnóstico y la retroalimentación por medio de una lluvia de ideas. Publicaciones Cultural. C.R. pp 1226 Cervantes. M. México. México.GUÍA METODOLÓGICA DE BIOLOGÍA MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios Emplea el método científico para desarrollar un proyecto de investigación Pre-formal Realiza un proyecto de investigación sin aplicar los pasos del método científico Receptivo Realiza un proyecto de investigación aplicando los pasos del método científico con orientación del docente Resolutivo Realiza un proyecto de investigación aplicando los pasos del método científico de forma clara y precisa Autónomo Realiza un proyecto de investigación aplicando los pasos del método científico de forma crítica y reflexiva.D. (1998) Genómica en México. México. 1. M. Pérez Granados. Vector. p 26. Vázquez. ¿Como ves? Año I. (2004) Biología General. Nueva Imagen UNAM. pp 48 38 . y Hernández. (2006). ACTIVIDADES DE APRENDIZAJE: • Glosario • Mapa mental • Debate ACTIVIDAD ESPECÍFICA: • Proyecto de investigación FORMATIVA SUMATIVA Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad 30% 20% 20% 30% BIBLIOGRAFÍA BÁSICA Bernal. y Molina Cerón. México. Publicaciones Cultural. La Ciencia en la Historia. Estratégico Realiza un proyecto de investigación aplicando los pasos del método científico de forma crítica. Biología Ed. Primera edición México. Santillana.

Temas para un Futuro Biólogo.pdf VIDEOS RECOMENDADOS Cosmos de Carl Sagan Paradigmas de Joe Baker TIC Proyecto Biósfera.F.geociencias. H. Kapicka y Lundgren. La Vuelta al Mundo del Doctor Balmis o los Desconocidos Niños Héroes en Genética para el Futuro. (1986). Biología. Tomo LVI. la Dinámica de la Vida. México. http://www. serie Flash. (1996) El Origen de la Vida. México.es/biosfera/ 39 . 960 pp. 91 pp.cl/files/articulos/El_Origen_de_la_Vida_en_la_Ti erra_v3.) El Origen de la Vida desde un Punto de Vista Geológico. México. Universit`a degli studi di Genova. Mc Graw Hill. Historia de la Biología. A. 56-86. 569 pp. Acento editorial. CECSA. (1999). (1975). (1984). mayo junio. España. pp.lunanueva.GUÍA METODOLÓGICA DE BIOLOGÍA BIBLIOGRAFÍA COMPLEMENTARIA Biggs. D. Quinta reimpresión. http://recursos. México. Italia. Rojas Peña.mec. Colección Esto es Química ¿y qué? Facultad de Química.pdf Lazcano Araujo. pp. Trillas. Biología. I. México. J. 1. Llera Domínguez. (1997). Rodríguez. (1996). UNAM. UNAM. México. pp. CONACYT. A. I.. Un Universo en Expansión.unam. 7077. Fondo de Cultura Económica. http://www. (2003. México 111 pp.mx/~alaniz/SGM/200356Gomez. 107 pp. Segunda Edición. y Pantoja Alor. Segunda edición. L. Boletín de la Sociedad Geológica Mexicana. García. Núm.cnice. en Ciencia y Desarrollo. 60-74 Gómez Caballero. (1993). Ledesma M. (2004) El Origen de la Vida sobre la Tierra. Consejo Nacional para la Enseñanza de las Biología. México.. J. Buican. Biología: "Ciencia o Naturalismo”. 737 pp. 36 pp.

estructura y función 40 .GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 2 Célula.

COMPETENCIAS Genéricas/Atributos Disciplinares 5. la tecnología. Establece la interrelación entre la ciencia. Relaciona los niveles de organización química. Desarrolla modelos experimentales que demuestren los procesos celulares. 1. 5. 6. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo. Aplica normas de seguridad en el manejo de sustancias. sus procesos vitales y el entorno al que pertenece. 4. Declarativos Explica la teoría celular Actitudinales/Valorales Valora la importancia del trabajo colaborativo. para valorar la importancia de la célula como unidad estructural y funcional de los seres vivos a través del análisis de los procesos celulares. el desarrollo de la teoría celular hasta la época actual Construye un cuadro de doble entrada de los componentes celulares. 12.2 Ordena información de acuerdo a categorías. instrumentos y equipo en la realización de actividades de su vida cotidiana.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE: LA CÉLULA: ESTRUCTURA Y FUNCIÓN TIEMPO: 45 horas UNIDAD DE COMPETENCIA: Relaciona la composición química con la estructura y fisiología celular. Valora la importancia de los procesos celulares para la conservación de la vida.5 Sintetiza evidencias obtenidas mediante la experimentación para producir conclusiones y formular nuevas preguntas. 13. la sociedad y el ambiente en contextos históricos y sociales específicos. SABERES Procedimentales Elabora una línea del tiempo del descubrimiento de la célula. Usa responsablemente el material de laboratorio en el trabajo experimental Relaciona la composición química con la estructura y función celular Identifica los procesos celulares 41 . registra y sistematiza la información para responder a preguntas de carácter científico. física y ecológica de los sistemas vivos. Obtiene. 14. biológica.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. consultando fuentes relevantes y realizando experimentos pertinentes. jerarquías y relaciones. Utiliza el microscopio como instrumento para el estudio de la célula Desarrolla un mapa conceptual integrador de la estructura y los procesos celulares.

el desarrollo de la teoría celular hasta la época actual a través de una línea del tiempo. • Conocimiento educativo • Cuadro de divulgación • Mapa • Actividades • Reporte • Resolución prácticas tape reactivos de • Materiales y laboratorio • Bata blanca 42 .GUÍA METODOLÓGICA DE BIOLOGÍA CRITERIOS DE DESEMPEÑO Explica el descubrimiento de la célula. Relaciona la composición química. • • • • ESTRATEGIAS DE ENSEÑANZA • Aplicación de preguntas generadoras • Dinámicas ESTRATEGIAS DE APRENDIZAJE • Elaboración de una línea del tiempo • Elaboración RECURSOS DIDÁCTICOS • Aula • Microscopio • Laboratorio virtual • Videos • Software • Revistas • Pizarrón • Plumones • Cañón • DVD • Guía metodológica • Manual de • Masking EVIDENCIAS Y/O PRODUCTOS • Línea del tiempo • Reporte grupales • Presentaciones de un cuadro de doble entrada y manejo del microscopio conceptual integrador de laboratorio a través de una V de Gowin de actividades de la guía metodológica de la práctica V de Gowin conceptual integrador de doble entrada • Mapa de power point sobre los niveles de organización celular experimentales. Describe los tipos de célula mediante el uso del microscopio compuesto y reporta los resultados en una V de Gowin. la estructura y función celular a través de un cuadro de doble entrada. Analiza la estructura y los procesos celulares mediante un mapa conceptual integrador.

GUÍA METODOLÓGICA DE BIOLOGÍA 43 .

¿Cuál consideras que es el instrumento más importante para el estudio de la célula? _________________________________________________________________ 4. ¿Quién descubrió la primera célula? _________________________________________________________________ 5. En el siguiente recuadro dibuja una célula 3. Escribe las funciones que realiza una célula ______________________________________________________________________ ____________________________________________________________ 44 .GUÍA METODOLÓGICA DE BIOLOGÍA EXPLORANDO TUS CONOCIMIENTOS 1. Existen organismos macroscópicos y microscópicos ¿Menciona algunos ejemplos de los últimos? ______________________________________________________________________ __________________________________________________________________ 2.

2). identificó una serie de estructuras parecidas a un panal de abejas. Algunas moléculas reguladoras hacen las veces de capataces.GUÍA METODOLÓGICA DE BIOLOGÍA La célula es la unidad estructural y funcional de todos los seres vivos. Realiza una investigación documental a cerca de la Teoría Celular 2. a pesar de que es a Hooke a quien se le da el crédito de descubrir las células. El primero en observar bacterias. ACTIVIDAD 1. Por lo tanto. 45 . tejidos y algunos presentan sistemas. Pero también existen organismos pluricelulares como los hongos. Anota en ella el año. A estos espacios los llamó celdillas debido a que se parecían mucho a las celdas que ocupaban los monjes en el monasterio.2. Toda célula está delimitada por una membrana celular lo cual le permite funcionar como una fábrica porque en ellas se requiere de materia prima para la producción de sustancias útiles. en donde los obreros son las enzimas. no fue el primero en observarlas. 3. la cual se localiza en el núcleo o centro de control.1 ¿CUÁLES HECHOS HISTÓRICOS CONDUJERON AL PLANTEAMIENTO DE LA TEORÍA CELULAR? Descubrimiento de la célula En 1665 el científico inglés Robert Hooke (fig.1) al observar un corte fino de corcho. Acuérdate de llevar una secuencia cronológica de los acontecimientos. los personajes y sus postulados. Sin embargo. en el ambiente se localizan organismos unicelulares. 2. nombre del científico y una breve oración de la aportación que hizo. plantas y animales los cuales se diferencian de los unicelulares por que están formados por órganos. protozoarios y espermatozoides fue el holandés llamado Anton van Leeuwenhoek. ya que vigilan que las actividades se realicen de acuerdo con las indicaciones contenidas en la molécula de ADN. en el siglo XVII (fig. glóbulos rojos. de ahí derivó el término de célula. como las bacterias y los protozoarios entre los que se encuentran las amibas y el Paramecium. Posteriormente en plenaria expondrán la línea del tiempo 2. Con esa información elabora una línea del tiempo donde se pueda evidenciar los antecedentes de la teoría celular.

2 A. La célula es la unidad estructural de la vida. Leeuwenhoek A partir del descubrimiento de Hooke.1 Robert Hooke Fig. Con ello se formulan los dos primeros principios de la teoría celular: 1.3). quienes en 1838 y 1839 descubrieron que todos los animales y vegetales están formados de células (fig. Fig. el desarrollo tecnológico. particularmente la invención del microscopio. 46 . 3.GUÍA METODOLÓGICA DE BIOLOGÍA En el siglo XVII. 2. zoólogo y botánico.2.3) concluyó que las células proceden de otras células semejantes. Un ejemplo de ello lo constituye el planteamiento de la teoría celular. no fue suficiente con tener instrumentos o técnicas que permitieran observar las estructuras o fenómenos vivos para poder entenderlos y explicarlos. Sin embargo. una serie de naturalistas y científicos iniciaron la búsqueda de células en tejidos animales y vegetales. esto abrió un sinfín de posibilidades y formas de aproximación al estudio del mundo microscópico. respectivamente. Todos los seres vivos están compuestos de una o más células. 2. Las células sólo pueden originarse por división de una célula preexistente. permitió la exploración de un mundo que antes era inaccesible para el ojo humano. fue necesario también contar con marcos conceptuales que permitieran interpretarlos. su hipótesis dio lugar al tercer postulado de la teoría celular: 3. entre ellos se encuentran los alemanes Friedrich Theodor Schwann y Matthias Jakob Schleiden. Fue en 1855 que el patólogo alemán Rudolf Virchow (fig. 2.

si no efectuaran estas funciones. ¿Con cuál de los postulados de la teoría celular se relaciona el hecho de que las células de tu piel se mantengan vivas? ¿Por qué? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 47 . Virchow De aquí se concluye que la célula es la unidad: • Anatómica. Las células de tu piel respiran.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.3 M. excretan. • De origen. morirían. Los seres vivos están formados por una o más células. 2. Schwann y R. Cada célula lleva a cabo todas las funciones vitales. se nutren. La célula se origina a partir de células preexistentes. Schleiden. • Fisiológica. ACTIVIDAD Contesta las preguntas siguientes con respecto a la Teoría Celular 1. T.

antes y Karion. el ejemplo característico son las bacterias. se forma una “costra” con sangre coagulada y los restos muertos de células. Las células procariontes (pro. huesos. etc. están constituidas por células. músculos. ¿Con cuál de los postulados de la teoría celular se relaciona? ¿Por qué? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 2. 48 .2 ¿QUÉ DIFERENCIAS HAY ENTRE CÉLULAS PROCARIONTES Y EUCARIONTES? Existen dos tipos celulares básicos clasificados con base en su organización y complejidad estructural: procarionte y eucarionte.GUÍA METODOLÓGICA DE BIOLOGÍA 2.4). Tu cuerpo está formado por piel. a su vez. núcleo) no tienen núcleo verdadero. y bajo la costra tu piel se regenera ¿Con cuál de los postulados de la teoría celular se relaciona la regeneración de tu piel? ¿Por qué? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 3. Estas partes. el ADN se encuentra disperso en el citoplasma constituyendo un solo cromosoma o unido a la membrana citoplásmica (fig.2. Después de haber tenido un “raspón”. Este hecho.

donde el material genético (ADN) duplicado se condensa en estructuras llamadas cromosomas y se divide en dos células hijas. las células procariontes sólo están presentes en los reinos Arqueobacteria y Eubacteria. sin embargo. El ADN se localiza dentro de una doble membrana llamada envoltura nuclear que lo separa del resto del citoplasma y conforma un núcleo verdadero. En algunas bacterias se ha observado in vitro (en laboratorio) que bajo ciertas circunstancias realizan un proceso llamado conjugación. las células eucariontes se dividen por mitosis. Por otro lado. una nueva generación de bacterias puede aparecer cada 20 o 40 minutos. a partir de la cual se producen células hijas con la mitad del número de cromosomas de la célula madre. cada componente tiene una función especializada (fig. por ejemplo. La división celular de las células procariontes se da por división binaria o bipartición. 2. De ellas derivaron las células eucariontes actuales presentes en los cuatro reinos restantes: Protista. protegiéndola de las agresiones del medio externo y da forma a la célula. siendo la base de la reproducción sexual.5). Presentan una pared celular que rodea completamente a la membrana celular. peroxisomas y citoesqueleto. Los dos tipos celulares poseen ribosomas encargados de la síntesis de proteínas. La complejidad de las células eucariontes se basa en el desarrollo de compartimentos internos que originan diversas estructuras subcelulares denominadas componentes celulares como: mitocondrias. presentan una diferencia sustancial en cuanto al tipo de ARN ribosomal que lo forman. Plantae y Animalia. Por lo general. por esta razón la reproducción es más rápida que en las eucariontes. De aquí que los ribosomas procariontes se denominen 70s y los eucariontes 80s por su coeficiente de sedimentación. lisosomas. complejo de Golgi. el ADN se duplica y las dos copias se separan y se forman dos células hijas idénticas. núcleo) son mucho más complejas.GUÍA METODOLÓGICA DE BIOLOGÍA Las células procariontes son de menor tamaño que las eucariontes. retículo endoplásmico. ribosomas. las células eucariontes (eu. De acuerdo con la clasificación de seis reinos. Las células germinales sufren meiosis. centriolos. en el que un fragmento de ADN denominado plásmido puede pasar de una bacteria a otra. Las células procariontes son microorganismos asexuados (sin sexo). vacuolas. tanto estructural como funcionalmente. cloroplastos. 49 . verdadero y Karion. Fungi.

como el movimiento. ¿CÓMO ESTÁ ESTRUCTURADA Y CÓMO FUNCIONA UNA CÉLULA? Entre las propiedades que comparten las células y que a la vez pueden considerarse como características de los seres vivos. Todos los seres vivos se alimentan. Morfología de una célula procarionte Fig. el intercambio de materia y energía con el medio. la cual pertenece al grupo bioquímico de los nucleótidos. La complejidad de la vida va desde las partículas subatómicas y los átomos. esto se refiere a que las células incorporan nutrientes para transformarlos a partir de una serie de reacciones químicas que realizan y con ello obtienen la energía útil a la célula para realizar todas sus actividades. Las células son entidades complejas y organizadas en términos de orden y regularidad. Esta energía se encuentra almacenada en una molécula altamente energética denominada ATP (adenosíntrifosfato). así como la especialización celular y la capacidad de responder a estímulos. Los autótrofos transforman la energía solar en 50 . Las células intercambian materia y energía con el medio. el mantenimiento de su medio interno. el crecimiento y el desarrollo. la reproducción. toman del medio las sustancias necesarias para obtener energía. la organización de estos átomos en moléculas de pequeño y gran tamaño como agua. el crecimiento. Morfología de una célula eucarionte 2.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.5. Esta estructura está basada en moléculas orgánicas e inorgánicas. proteínas y ácidos nucleicos a su vez se organizan en estructuras subcelulares que constituyen a las células. la capacidad de autorregularse.3. esto es. 2. etc. 2. el que tienen ADN necesario para la reproducción. se encuentra su complejidad.4.

ACTIVIDAD Realiza una investigación documental para completar el siguiente cuadro comparativo entre célula procarionte y eucarionte. escribiendo las características que las hacen distintas. los heterótrofos tienen que transformar los alimentos en otros más sencillos y a partir de éstos sus células se encargan de sintetizar otros compuestos más complejos que utilizan para reparar tejidos y llevar a cabo todas sus actividades. 51 . en cambio. Éste consta de dos fases: una fase de degradación donde moléculas grandes se transforman en moléculas pequeñas llamada catabolismo y una fase de síntesis donde se forman moléculas grandes a partir de moléculas pequeñas llamada anabolismo.GUÍA METODOLÓGICA DE BIOLOGÍA energía química a través de la fotosíntesis. Toda esta serie de reacciones que se llevan a cabo en el interior de la célula gracias a la presencia de las enzimas o biocatalizadores en conjunto se llama metabolismo.

A esta capacidad de respuesta celular se le denomina irritabilidad. forman órganos. Algunas mutaciones son tan severas que causan la muerte del organismo. modificar su actividad metabólica. las sustancias químicas. la luz. dan origen a los tejidos y estos. proteínas carbohidratos. como la reproducción. la síntesis de proteínas. la cantidad de electrólitos. la cantidad de agua. Cilios Complejo de Golgi y flagelos) Lisosomas Microfilamentos Filamentos intermedios 52 Ribosomas ORGANELOS Mitocondria Cloroplasto Núcleo Vacuolas Microcuerpos Vesículas . iniciar la división celular. molécula que identifica a cada ser vivo y que contiene las instrucciones para todo el funcionamiento celular: la reproducción. y el conjunto de órganos forman sistemas. Esto permite a las células sobrevivir. se presentará una mutación. Cuando las células con una función específica se unen entre sí. propiedad importante para el funcionamiento celular. Las células responden a los estímulos del medio como el alimento. a su vez. las hormonas. por tanto. moverse. ya que si falla se presentan alteraciones que pueden ser determinantes y causar la muerte celular. posee mecanismos reguladores de todo su funcionamiento. de la misma manera las biomoléculas como: aminoácidos. las mutaciones no letales y no dañinas producen la variabilidad genética que permite que los seres vivos evolucionen. Los mecanismos reguladores de la célula son tan importantes que un cambio en la secuencia del ADN debe ser identificado y corregido por la célula. etc. el desarrollo.GUÍA METODOLÓGICA DE BIOLOGÍA Las células mantienen constante su medio interno a través de un proceso de equilibrio fisiológico denominado homeóstasis. de no ser así. Las células tienen ADN. Todas las células responden de manera específica para cada sustancia o agente externo o interno. la presión o la cantidad de agua. Sin embargo. los factores de crecimiento. etcétera. dichas información se encuentra contenida en la secuencia de nucleótidos del ADN. lípidos y ácidos nucléicos constituyen los componentes de la célula. Dichos componentes de acuerdo a su composición química y la función que desempeñan se clasifican en: SISTEMAS MEMBRANOSOS SISTEMAS NO MEMBRANOSO Citosol o hialoplasma Membrana celular Inclusiones citoplasmáticas Retículo endoplásmico: liso y Citoesqueleto rugoso Microtúbulos (Centriolos. La célula. crecimiento y funcionamiento de la célula.

su composición química es lipoproteíca. carbohidratos y colesterol. está constituida por una doble capa de fosfolípidos. si se trata de una célula animal. proteínas periféricas e integrales. 53 . MEMBRANA CELULAR La membrana celular es la que limita y da forma a la célula.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD A través de un diagrama de Venn establece las diferencias y similitudes entre una célula animal y una vegetal. pero si es de origen vegetal presenta ergosterol. es decir.

2. 4. Fig. La palabra carbohidrato literalmente significa carbón con agua (carbón hidratado) o hidrato de carbono.GUÍA METODOLÓGICA DE BIOLOGÍA Las proteínas: son compuestos orgánicos formados por aminoácidos (fig. éstos dos últimos en la misma proporción que en el agua (2:1). Fórmula general de un aminoácido ACTIVIDAD 1. Un alcohol polivalente es una molécula orgánica que tiene más de un radical alcohólico (C — OH).6. clasificación y función. Los carbohidratos: son miembros de una familia de compuestos orgánicos que se caracterizan por tener varios grupos hidroxilos y por lo menos potencialmente un grupo aldehídico o cetónico. por ejemplo el glicerol.6). en la fórmula empírica se observa que eso no es cierto. expongan su cuadro sinóptico para hacer una retroalimentación. CnH2nOn 54 . 2. En plenaria. hidrógeno y oxígeno. 3. 2. estructura y función. los cuales se caracterizan por tener un grupo amino. forma. Realiza una investigación documental a cerca de las proteínas. Posteriormente integra equipos de tres compañeros y compartan su información obtenida a través de sus respectivas investigaciones. A continuación elaboren un cuadro sinóptico donde se pueda evidenciar la clasificación de las proteínas por su: composición química. y se les conoce así por tener carbón. un carboxilo y un radical como se puede observar en la siguiente fórmula general. en la que se enfatice su definición. sin embargo.

y el segundo se transforma en vitamina D debido a la radiación ultravioleta En la década de 1950 se observaron por primera vez al microscopio electrónico las membranas celulares. Los fosfolípidos son ejemplos de lípidos compuestos formados por la unión de ácidos graso. la carga eléctrica de los iones determina en un momento dado qué tipo de moléculas la atraviesan. 55 . Químicamente están constituidas por una doble capa de lípidos.L. Para explicar su estructura. ACTIVIDAD 1. 2. clasificación y función.7). clasificación y función de los carbohidratos y los lípidos. 2. Las moléculas cuyo tamaño coincida con el tamaño del poro o sean más pequeñas que éste podrán atravesar la membrana fácilmente. Singer y G. 3. Integra equipos de tres compañeros y compartan su información obtenida a través de sus respectivas investigaciones. expongan su mapa conceptual para hacer una recapitulación y retroalimentación. 4. un alcohol denominado glicerol y ácido fosfórico. elaboraron un modelo llamado mosaico fluido (fig. en la que se enfatice su definición. A continuación en plenaria. en 1972. desempeñan funciones estructurales y de reserva.GUÍA METODOLÓGICA DE BIOLOGÍA También se les conoce como sacáridos (sacar en latín significa azúcar). Realiza una investigación documental sobre los carbohidratos y lípidos. Algunas moléculas como los gases pueden atravesar la membrana debido a que son solubles en los lípidos de ésta y finalmente. los biólogos S. Existen varios mecanismos por medio de los cuales la membrana es selectivamente permeable: a) el tamaño del poro. desempeñan su principal función biológica como energéticos. Lo importante de este modelo es que denota la calidad dinámica de la membrana celular. carbohidratos y proteínas. o sea. Un gramo de carbohidratos proporciona 4 calorías.J. Además. Nicholson. el primero participa en la fluidez y estabilidad de las membranas biológicas. glúcidos (glucos en griego significa dulce) o azúcares. Posteriormente consensada la información elaboren un mapa conceptual integrador donde se pueda evidenciar la función. que de ellos se obtiene energía para procesos vitales. b) la solubilidad en lípidos y c) el potencial eléctrico de la membrana. El colesterol y el ergosterol son esteroles.

las cadenas hidrofóbicas del fosfolípido se encuentran orientadas hacia el interior de la bicapa. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ Argumenta cuál es la relación que existe entre el colesterol y el estrógeno ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ _______________________________________________________________________________ Los lípidos más abundantes en la membrana son los fosfolípidos. Esta bicapa de lípidos tiene consecuencias en la estructura y funcionamiento de las células. Explica la importancia del colesterol en tu organismo y argumenta los daños que puede ocasionar el exceso. En ciertas membranas también existe colesterol. Las membranas de la mayor parte de los vegetales y de las bacterias no contienen colesterol. Debido a la cohesión y formación 56 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. sustancia que en ciertas células animales puede constituir hasta 50%. Los grupos polares de cada capa de fosfolípidos se orientan hacia el exterior de la bicapa y pueden interactuar con las moléculas de agua que los rodean.

que se localizan por completo fuera de la bicapa de lípidos. que penetran en la bicapa de lípidos. Otro tipo de proteínas son las periféricas. 2. la mayoría atraviesan completamente la bicapa y tienen regiones que sobresalen en ambos lados de la membrana hacia el espacio extracelular y el citoplásmico. Modelo de mosaico fluido de la membrana celular Las proteínas de la membrana varían desde una docena hasta 50 tipos diferentes. las membranas son deformables y pueden cambiar toda su forma como ocurre durante la locomoción o la división celular.7. 57 . La composición de carbohidratos de la membrana depende del tipo de célula. y la cantidad de éstos varía entre 2 y 10% del peso total. Fig. Se encuentran unidos a los lípidos y las proteínas en forma de glucolípidos y glucoproteínas. Pueden ser proteínas integrales.GUÍA METODOLÓGICA DE BIOLOGÍA espontánea de las bicapas nunca se observan membranas con bordes libres. siempre son estructuras íntegras continuas. pero ancladas por grupos de ácidos grasos o por otras proteínas a la superficie extracelular o citoplásmica. Cada una se encuentra localizada y dirigida en una posición particular de la bicapa lipídica. respectivamente. Gracias a la flexibilidad de la bicapa de lípidos.

CITOPLASMA El citoplasma es la masa coloidal química y morfológicamente compleja. por ejemplo. RETÍCULO ENDOPLÁSMICO El retículo endoplásmico es un sistema membranoso que se distribuye a través del citoplasma.8). el citoplasma presenta un estado fluido (sol) y otro viscoso (gel). el rugoso (RER) y el liso (REL) (fig. movimiento celular. Es una barrera selectivamente permeable. d. La parte del citoplasma que está atravesado por una red de fibras y filamentos denominada citoesqueleto. pero al mismo tiempo proporcionan el medio para comunicar un espacio con otro. en el que están suspendidos los organelos y las microestructuras celulares. ya que impide el libre intercambio de materiales de un lado a otro.GUÍA METODOLÓGICA DE BIOLOGÍA La membrana celular cumple varias funciones: a. que se diferencian entre sí por los siguientes aspectos: 58 . liberación de calcio de las reservas internas. Se observan dos tipos de retículos endoplásmicos. inhibiendo o estimulando actividades internas como el inicio de la división celular. comprendida entre la membrana celular y la membrana nuclear. a toda la porción citoplasmática que carece de esta estructura se le da el nombre de citosol o hialoplasma (parte líquida del citoplasma). c. b. Poseen receptores químicos que se combinan con moléculas específicas que permiten a la membrana recibir señales y responder de manera específica. Delimita y protege la célula. 2. lo cual permite que se encuentre en movimiento continuo (ciclosis) favoreciendo el intercambio de sustancias con el medio exterior. la elaboración de más glucógeno. etc. por tanto. Permite el paso o transporte de solutos y de agua de un lado a otro de la célula. pues regula el intercambio de sustancias entre el interior y el exterior de la célula siguiendo un gradiente de concentración. Es un líquido viscoso de consisten cia gelatinosa y su estructura corresponde a la de un coloide (sistema constituido por agua y diferentes moléculas de elevado peso molecular). recibe el nombre de morfoplasma (parte coloidal). desde la membrana nuclear hasta la membrana plasmática.

2.GUÍA METODOLÓGICA DE BIOLOGÍA a. c. d. b. Mientras que en el retículo endoplásmico rugoso se realiza la síntesis proteica y la maduración de las proteínas de exportación y las que se transportan a otros componentes celulares. las células que secretan gran cantidad de proteínas tienen una gran actividad de RER. según sus actividades. El RER presenta ribosomas adheridos a sus membranas y el REL recibe este nombre porque no las tiene. hormonas esteroides y ácidos grasos. A medida que el RER se aleja de la membrana nuclear externa y se distribuye en el citoplasma. El RER es un conjunto de canales con forma de cisternas en cuyas paredes membranosas se realiza la síntesis de proteínas con la intervención de los ribosomas (ARNr). Fig. Por ejemplo. 59 . Como consecuencia desarrollan funciones diferentes. Retículo endoplásmico rugoso Las células tienen cantidades distintas de REL o RER.8. el ARN mensajero y el ARN de transferencia. En el retículo endoplásmico liso se sintetizan algunos fosfolípidos. hay una zona de transición donde cambia de forma (canales y cisterna) y se observan los retículos con tubos anastomosados entre sí y cuyas paredes membranosas carecen de ribosomas.

por ejemplo. 2. los fragmentos de páncreas se transfieren a un medio que contiene el mismo aminoácido pero sin marcar (no radiactivo). 60 . la distribución de proteínas y lípidos que reciben del retículo endoplásmico. 2. algunas de estas proteínas son enzimas que se envían a los lisosomas. discordes con rebordes amplios relacionados con vesículas emergentes. Transforma las proteínas y los residuos de carbohidratos para formar glucoproteínas presentes en la superficie externa de la membrana celular. Relación entre RER y complejo de Golgi ACTIVIDAD Para determinar el lugar de síntesis y el camino que siguen las proteínas segregadas por las células del páncreas antes de salir de la célula.GUÍA METODOLÓGICA DE BIOLOGÍA COMPLEJO DE GOLGI El complejo de Golgi. Estos fragmentos se mantienen en un medio fisiológico que contiene un aminoácido marcado.10. Se toman muestras a lo largo del tiempo después de aplicar el marcador radiactivo.9 y 2. Fig. Realiza funciones específicas.10). ensambla glucolípidos y glucoesfingolípidos. Después de un tiempo (de tres a cinco minutos). Almacena las glucoproteínas en vesículas para ser enviadas a otras partes de la célula. leucina tritiada. se realiza la siguiente experiencia: se toma el páncreas de una rata y se corta en fragmentos.9. asimismo. tales como: Formar vesículas como los lisosomas. consiste en cisternas aplanadas. 2. Complejo de Golgi Fig. (fig.

las muestras son fijadas y preparadas para su examen histoautoradiográfico. c) Muestra C: cuando se examina una muestra tomada 20 minutos después del marcado. b) Muestra B: 15 minutos después del marcado con leucina tritiada. se observan proteínas radiactivas en los dictiosomas 61 .GUÍA METODOLÓGICA DE BIOLOGÍA Inmediatamente después de tomarlas. se constata que la radiactividad está localizada en la región del retículo endoplásmico rugoso situada en la proximidad de los dictiosomas del Complejo de Golgi. a) Muestra A: se constata que tras 5 minutos se puede observar radiactividad en la región basal de la célula. a nivel del retículo endoplásmico rugoso.

explica dónde se sintetizan las proteínas segregadas por las células pancreáticas y cuál es el camino que siguen hasta que salen de la célula. 2. Analizando esta experiencia. Cuando las células enferman. ingieren restos celulares viejos para digerirlos.GUÍA METODOLÓGICA DE BIOLOGÍA d) Muestra D: en las muestras tomadas 60 minutos después de la experiencia. por tanto son llamados autofagosomas o vacuolas autofágicas o digestivas (fig.11). e) Muestra E: 4 horas después. Contienen gran cantidad de enzimas hidrolíticas (digestivas) que degradan todas las moléculas inservibles para la célula. la radiactividad sólo se detecta en el exterior de la célula. los lisosomas rompen su membrana y las enzimas encerradas en su interior destruyen toda la célula en un proceso denominado autolisis. Funcionan como estómagos de la célula y además de digerir cualquier sustancia que ingrese del exterior (lisosomas secundarios o vacuolas digestivas). sólo se observa radiactividad en las vesículas que rodean las cisternas del complejo de Golgi. en la cara de maduración de los dictiosomas. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ¿Qué relación hay entre el retículo endoplásmico y el complejo de Golgi? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ LISOSOMAS Los lisosomas son vesículas con una estructura muy sencilla y están rodeados solamente por una membrana. 62 .

Las enzimas hidrolíticas de los lisosomas se forman a partir del retículo endoplásmico rugoso y posteriormente son empaquetadas por el complejo de Golgi. Fig.GUÍA METODOLÓGICA DE BIOLOGÍA Actualmente se conocen unas 40 enzimas lisosómicas. Formación de lisosomas a partir del complejo de Golgi VACUOLAS Son sacos rodeados también por una sola membrana. por ejemplo: insulina. otras de almacenamiento de agua. como las enzimas digestivas y las hormonas proteicas. glucosidasas y sulfatasas. originándose así los lisosomas. 63 . aislados en grupos llamados polirribosomas o en la parte externa del retículo endoplásmico rugoso. Éstos realizan la síntesis de proteínas de membrana y de proteínas que algunas células secretoras exportan hacia sus alrededores. se mueven por los extremos cercanos al complejo de Golgi. RIBOSOMAS Los ribosomas se encuentran libres en el citoplasma. fosfatasas. 2. Las proteínas que son transportadas dentro de los canales. Hay diferentes tipos de vacuolas. desechos metabólicos o alimentos y otras ayudan a la célula a eliminar el exceso de agua del interior. lipasas. todas ellas son hidrolasas ácidas del tipo de las proteasas. nucleasas. fosfolipasas. Algunas de soporte.11. unas son temporales y otras permanentes.

están en el citoplasma. La subunidad pequeña se ajusta a la más grande como un engrane solamente si hay ARNm que deba ser traducido. uno para secuencia corta de tres nucleótidos del ARNm. La superficie del ribosoma tiene cuatro sitios de unión. Los microtúbulos están formados por una glucoproteína que se conoce con el nombre de tubulina (figuras. La subunidad más pequeña contiene más o menos 30 proteínas diferentes y las más grandes de 45 a 50. que son estructuras en forma de pelos microscópicos. 64 . todas estrechamente unidas con los ARN ribosomales (fig. los microtúbulos participan en el transporte de las proteínas y otros compuestos. ARNt y ARNr. Entre estas estructuras se encuentran las siguientes: Microtúbulos Estas estructuras.13 y 2. 2. forman el huso acromático durante la mitosis. 2. En los axones nerviosos de las neuronas.15). permiten el desplazamiento de los cromosomas a través del huso mitótico o acromático y participan activamente en transportar organelos o nutrientes dentro de la célula. Los cilios y flagelos de algunos organismos unicelulares están formados por microtúbulos y participan en la locomoción y desplazamiento de estos. Dan soporte a las células. como las hormonas de la hipófisis y del hipotálamo. otro para el ARNt que ha descargado el aminoácido y un sitio donde la enzima peptidil transferasa trabaja formando enlaces peptídicos entre los aminoácidos adyacentes.GUÍA METODOLÓGICA DE BIOLOGÍA Los ribosomas completos están formados por dos subunidades de diferente tamaño.14). CITOESQUELETO La gran variedad de filamentos proteínicos del interior de las células le confieren cierta consistencia a éstas. 2. que en conjunto se llaman citoesqueleto. Los cilios. otro para el ARNt nuevo que lleva el aminoácido específico para que se ensamble a la cadena polipéptidica nueva. son cilindros huecos de 25 nm de grosor. Durante la síntesis de proteínas se establece un contacto entre los ARNm.12). existen en cantidad abundante alrededor de la célula para que al agitarse les permitan desplazarse en el medio que generalmente es líquido (fig.

ensanchadas en el ecuador. es decir. tales como la miosina o participan en la formación de las uniones intercelulares. Durante su trayectoria organizan poco a poco entre ellos el huso acromático. Cuando inicia la división celular. están formados por una gran variedad de proteínas y participan directamente en mantener la forma de la célula y darle fuerza ténsil a ésta (figs. como ya se mencionó anteriormente.13. Los pares de cilindros se separan lentamente. Los centriolos son estructuras cilíndricas de las células animales y de las células de algunos vegetales inferiores (fig. se replica y da lugar a dos estructuras iguales.16). Se pueden asociar con otras proteínas.13). Los centriolos vistos al microscopio electrónico se aprecian como cilindros huecos formados por nueve tripletes de microtúbulos (fig.14. 2. 2. De cada centriolo se proyecta un racimo de filamentos de proteína contráctil formando figuras llamadas áster. ya que su grosor es de 6 a 8 nm (fig. 65 .GUÍA METODOLÓGICA DE BIOLOGÍA Filamentos de actina o microfilamentos Existen otras estructuras que forman el citoesqueleto compuestas de proteínas contráctiles y presentes en gran cantidad en las células de músculo esquelético.16). estrechas en los extremos y a la que llamamos huso acromático. 2. 2. 2. Filamentos intermedios Los filamentos intermedios tienen un diámetro de 10 nm. Al inicio de la división celular.15). los centriolos emigran a polos opuestos. y 2. A estos filamentos se les denomina de actina porque están formados por la proteína o microfilamentos. CENTRÍOLO Y HUSO Cerca del núcleo hay una pequeña estructura que se llama centriolo o centro organizador de microtúbulos. Cuando los filamentos han llegado a polos opuestos se obtiene una figura semejante a dos conos unidos por su base. emigrando cada par a los polos opuestos de la célula.

Fibras del Citoesqueleto Fig.14. 2.16.12. Disposición del citoesqueleto en la célula Fig. Estructura de un cilio 66 .GUÍA METODOLÓGICA DE BIOLOGÍA Figura 2. Estructura de un centriolo Fig. 2.13. 2. Estructura de un ribosoma Fig. 2.15.

presentes únicamente en las células vegetales y en protistas fotosintéticos. sólo una pequeña fracción de ésta es interceptada por los organismos fotosintéticos.GUÍA METODOLÓGICA DE BIOLOGÍA CLOROPLASTOS Los cloroplastos son organelos de doble membrana. En el interior de las células vegetales se encuentran los cloroplastos. los cuales almacenan el pigmento verde llamado clorofila que capta la luz solar. Este pigmento absorbe la energía de la luz solar y la cede para la elaboración (síntesis) de carbohidratos como la glucosa. a partir de dos compuestos disponibles en el medio ambiente: el agua y el dióxido de carbono del aire. En los organismos eucariontes. 2. 2. que forman la membrana interna.17). usando como fuente de energía la luz solar que transforma en energía de enlaces químicos. que contienen un pigmento de color verde llamado clorofila. La fotosíntesis se resume en la siguiente ecuación química: 67 . El oxígeno que se libera en la atmósfera sirve para efectuar el proceso respiratorio. La luz solar contiene energía que ingresa a la atmósfera terrestre. Fig. Esquema general de la fotosíntesis La fotosíntesis es un proceso que utilizan las plantas.18. éstos se apilan formando estructuras llamadas granas (fig. la fotosíntesis se lleva a cabo en los cloroplastos. Los cloroplastos están constituidos de una membrana externa que delimita al organelo del citoplasma y rodea al estroma dentro del cual se encuentran sacos membranosos llamados tilacoides. algas y algunas bacterias para sintetizar su alimento.

Fueron descritas por primera vez por Altman en 1884.000 años. que no requiere la luz. 68 .17. lento que todo el O2 en unos 2. Fue Benda. Por el contrario. 2. Se le conoce como oscura porque no importa que la luz del Sol esté o no presente irradiando luz. MITOCONDRIA Con el microscopio óptico las mitocondrias aparecen como bastones o raquetas.18) tiene dos etapas: la fase luminosa que incluye una serie de reacciones que dependen de la luz. Cada año la fotosíntesis de todos los vegetales del planeta fija unos 100 millones de toneladas de carbono.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. 2. se efectúa de cualquier forma. y la fase oscura. cuantos meses. Estructura de un cloroplasto La fotosíntesis (fig. chondrios = gránulo). en 1897. quien las denominó mitocondrias (mito = hilo. desde el CO2 hasta los compuestos orgánicos. Se ha calculado que si el CO2 consumido en la fotosíntesis no fuera repuesto por los procesos de respiración celular.

El interior de la mitocondria está constituido por un contenido más o menos líquido denominado matriz mitocondrial (fig. Se distribuyen dentro de la célula en relación con los lugares donde la aplicación de esa fuente de energía es más intensa. 69 . La membrana interna presenta invaginaciones hacia el interior. Estos organelos presentan una doble membrana (externa e interna). En el hígado se calcula que hay unas 1000 mitocondrias por célula. 2.GUÍA METODOLÓGICA DE BIOLOGÍA Su tamaño. Cada una de unos 7 μm de espesor y entre ambas membranas hay un espacio de unos 8 μm (espacio perimitocondrial o intermembranal).19). por lo que la compartimentación que introducen es abierta. sin embargo. número y forma son muy variables. Nuestros glóbulos rojos y las amibas carecen de mitocondrias.5 μm hasta 5 o 7 μm de longitud. Tridimensionalmente. 2. todas las células de los organismos eucariontes tienen mitocondrias. y en un estadio del ciclo de vida del microorganismo protista denominado Tripanosoma brucei sus mitocondrias prácticamente desaparecen.19. Las dimensiones de la mitocondria pueden ser desde 0. Estructura de una mitocondria Por regla general. Éstas no llegan de un lado a otro de la mitocondria. Fig. que constituyen tabiques denominados crestas. los túbulos distales del riñón y otras células que necesitan una gran fuente de energía son mucho más abundantes. pero hay excepciones. en las células del corazón. la forma de la mitocondria podría compararse muy bien a la de un cacahuate.

¿qué pasa dentro de éstas? Es aquí donde comienza la respiración celular. Durante este proceso. se incorpora a una molécula de ATP (adenosín trifosfato). Ahí son utilizadas en las funciones celulares de los órganos y también ayudan para todas las actividades diarias del cuerpo (fig. 2. proceso que en las células eucariontes se lleva a cabo en un organelo especializado que es la mitocondria. 2. Fig. con ayuda del oxígeno. parte de la energía desprendida de la glucosa. No es continua. pero. Está rodeado por un par de membranas concéntricas denominadas en conjunto envoltura nuclear o membrana nuclear. las moléculas de ATP salen de las mitocondrias y viajan a todas las células del cuerpo. NÚCLEO Es el organelo más prominente de la célula y se localiza en cualquier sitio del citoplasma.20).GUÍA METODOLÓGICA DE BIOLOGÍA El oxígeno del aire que respiramos llega a cada una de nuestras células a través de los glóbulos rojos que lo acarrean.20 Esquema general de la respiración celular La ecuación general de la respiración celular es: Una vez sintetizadas. sino que posee 70 .

sintetizadas del núcleo al citoplasma para que realicen su función.GUÍA METODOLÓGICA DE BIOLOGÍA poros que permiten el paso de las cadenas de ARNm. 71 . ACTIVIDAD Realiza un esquema global ilustrado que muestre la interrelación entre los reactivos y productos de las reacciones de la fotosíntesis y de la respiración celular. El nucleoplasma es un medio acuoso de solución coloidal en estado semigel. rica en proteínas y es donde están suspendidos los cromosomas. El poro es un complejo proteínico que controla el paso de sustancias a través de la envoltura nuclear. Además de que esta envoltura separa el contenido nuclear o nucleoplasma del citoplasma.

2. o sea. por lo tanto tienen carga positiva (fig.GUÍA METODOLÓGICA DE BIOLOGÍA Se considera que esta membrana y el núcleo tienen la misma relación que la membrana plasmática y el citoplasma. que regulan de la misma manera los materiales que pasan hacia dentro y fuera del núcleo.22). Dentro del núcleo se encuentra uno o más nucléolos que son pequeños cuerpos amorfos. Fig. tales como la lisina y la arginina.21). pues son ricas en aminoácidos. los cuales a menudo cambian de forma y tamaño. éstos contienen un grupo amino libre capaz de adquirir un protón por poseer un par de electrones no compartido. La cromatina se encuentra formada por una nucleoproteína. se utiliza el término cromatina. Cuando se encuentran en este estado. 2. 2. Las histonas son proteínas básicas. Cuando una célula inicia su división éstos desaparecen y cuando termina la división celular aparecen nuevamente (fig. Las nucleoproteínas son estructuras complejas formadas por ácidos nucleicos y proteínas del tipo de las histonas que en conjunto se denominan nucleosomas. Estructura del núcleo Los cromosomas son estructuras que se forman de ADN altamente compactado.21. 72 .

sustancias importantes para la estructura y funcionamiento de las células. los ácidos nucléicos. En general se les considera como macromoléculas naturales. La continuidad celular: Es necesario para la reproducción y regeneración de las partes perdidas. de la conservación de la información y herencia genética.22. para la elaboración de proteínas. y del control de las funciones celulares.GUÍA METODOLÓGICA DE BIOLOGÍA El ADN lleva carga negativa debido a la presencia de numerosos grupos fosfatos. sobre todo en los aspectos de la reproducción celular. polímeros de nucleótidos de una cadena (ARN) o dos cadenas (ADN). 2. La célula inicia la división y la cromatina se organiza en los cromosomas. información que se centra en el Dogma Central de la Biología. esenciales en el avance del conocimiento del desarrollo de la estructura y función los seres vivos. Estructura de la cromatina Para poder comprender la función del núcleo tenemos que adentrarnos al estudio de otras biomoléculas. término que quiere decir cuerpos coloreados. El núcleo es el centro de regulación de la célula. 2. En general. Contiene los factores hereditarios de la célula. es el centro de control. cuya función principal es la de contener y permitir la transcripción y traducción de la información genética (código genético). permitiendo así que sus características pasen a sus descendientes. cuyas principales funciones son: 1. por lo cual las histonas se enlazan fuertemente con el ADN. 73 .

etc. para que a partir de la información colectada se elabore un diagrama de Venn de diferencias y similitudes de los ácidos nucléicos ADN ARN ACTIVIDAD Realiza una investigación documental y completa el siguiente cuadro de los tipos de ARN 74 . estructura tridimensional.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los ácidos nucléicos: unidades que los conforman (niucleótidos). tipos. funciones..

ADN → ¿? → Proteínas Un posible candidato para intermediario era el ARN. que estaba dentro del núcleo. ya que el ARN tiene ribosa en vez de desoxirribosa). dirigir la síntesis de proteínas fuera del mismo? A Crick se le ocurrió la idea de que debía existir un intermediario. 75 . Para mitad de los 50’s se sabía que la secuencia de nucleótidos en el ADN daba origen a una secuencia de polipéptidos. El ARN tenía varias características que lo hacían un firme candidato: • Un esqueleto de azúcares y fosfatos (a pesar de que tiene un azúcar distinto. Es decir. ¿Cómo podía el ADN. faltaba dilucidar una pieza del rompecabezas ya que se sabía que las proteínas se sintetizaban fuera del núcleo. entonces. ADN → Proteínas Pero si esto era cierto. Razonaron. que si el ADN era la molécula que transmitía la información genética a las células hijas. que se encuentra en el citoplasma. la molécula de ADN debía dirigir la síntesis de proteínas. sería más fácil entender su función. esta debía funcionar como un código.GUÍA METODOLÓGICA DE BIOLOGÍA tipo de ARN forma localización función ¿EL DOGMA CENTRAL DE LA BIOLOGÍA ES UNIVERSAL? Watson y Crick sospecharon que una vez esclarecida la estructura del ADN.

• El uracilo se puede unir a la adenina como lo hace la timina. pero el ARN tiene uracilo en vez de timina. durante algún tiempo esta idea adquirió cierta dimensión de verdad absoluta en la mayoría de los libros de texto. En 1971 se descubrió que algunos virus. Actualmente el dogma ha sufrido cierta fisura. Además. entre otras situaciones o elementos. salvo notables excepciones. Crick sintetizó esta idea a lo que llamó el Dogma Central de la Biología. Si bien Crick usó el término dogma en un sentido figurado y quizá con humor. llevan su información en forma de ARN. como el VIH. No obstante. ya que la información pasa del ARN al ADN. una vez que la información llega a las proteínas. y que esta puede pasar al ADN de sus huéspedes. las proteínas no pueden influir en los genes. ya que las ideas científicas sólo son aceptadas hasta que aparezca evidencia experimental que las desmienta. que especifica que el ADN se traduce en ARN y este. Es decir. estas no pueden ser cambiadas o. a los priones. Según este postulado. lo que es lo mismo. Ese proceso ocurre en sentido contrario al esquema de Crick. que no se asienta en dogmas. ribozimas y la enzima transcriptasa inversa. a su vez. • El ARN es una cadena sencilla. Estas excepciones atañen.GUÍA METODOLÓGICA DE BIOLOGÍA • Tanto el ADN como el ARN usan las mismas bases nitrogenadas. dirige la producción de proteínas. actualmente se sabe que tanto el ARN como las proteínas pueden influir en la expresión del código genético. la ciencia es un ente dinámico. 76 . pues han surgido una serie de elementos que implican la ampliación de este dogma tan categórico. la información fluye de manera unidireccional: no puede moverse de las proteínas al ADN.

la palabra GTG en ácidos nucléicos en proteína se traduce por Histidina.GUÍA METODOLÓGICA DE BIOLOGÍA Podemos resumir el Dogma Central de la Biología como sigue (fig. La información contenida en el ARNm es "leída" por estructuras llamadas ribosomas. Así. Dogma Central de la Biología 77 . 2.23. Este proceso se denomina traducción.24). 2. es por lo tanto: ADN → ARN → Proteínas Fig. y así sucesivamente. La información contenida en el ADN se transcribe a una molécula de ARN (proceso llamado transcripción) que recibe el nombre de ARN mensajero o ARNm. 2.21): 1. La relación que hay entre ambos lenguajes recibe el nombre de Código Genético (fig. El flujo de información para la expresión de los genes. 2. traduciendo el lenguaje nucléico al lenguaje proteíco. TTT por Lisina.

estaríamos ante la reproducción clónica (fig. Por equipo. este individuo es genéticamente distinto de ambos: así es como la reproducción sexual genera variabilidad. En el modelo que construiste ¿qué sería la polimerasa? 6. ¿Qué pasos del modelo representan la traducción? 9. 1.GUÍA METODOLÓGICA DE BIOLOGÍA Pero la otra función del ADN es la de transmitirse a su descendencia. ¿Cómo es la secuencia de las moléculas hijas de ADN con respecto a la original? 2. ¿Qué sucede para separar las dos hebras de ADN? 5. ACTIVIDAD Haz una investigación documental acerca de los procesos involucrados en el Dogma Central (duplicación. 2. como copia exacta del ADN parental. ¿En qué momento del ciclo celular ocurre la replicación del ADN? 3.23). transcripción y traducción). ¿Cuál es la finalidad de construir una secuencia de bases de ADN? 7. el nuevo individuo recibe la mitad del ADN de cada uno de sus padres. Así. idea y construye un modelo para representar cada proceso. Si el ADN se transmitiera a la célula o al individuo hijo sin variación. Esto lo hace el ADN duplicándose a sí mismo en el proceso conocido como replicación. ¿Qué paso de este modelo representa la transcripción? 8. ¿Qué pasaría si el ADN no se duplicara antes de la división celular? 4. ¿Cómo está relacionada la secuencia de bases en los ácidos nucléicos con la secuencia de aminoácidos en las proteínas? 78 . Ahora bien: en la reproducción sexual. Considerando tu modelo responde las siguientes preguntas.

¿Cuál sería el ARNm y el polipéptido resultantes de la siguiente secuencia de ADN? CCGCGGCATATTTATGGCAAAAGC ARNm → Polipéptido → ¿Cuántos codones posee el ARNm? ¿De cuántos aminoácidos formarían el polipéptido? __________________ __________________ 79 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Utilizando el código genético deduce.

Por ejemplo. La reproducción tiene una íntima relación con la transmisión de caracteres hereditarios y la evolución de las especies. el núcleo sería el ingeniero porque es quién “ordena y dirige” la construcción del edificio (proteína) Nucléolo Aquí se sintetizan los tipos de moléculas de ARNr que se usan en la formación de los ribosomas.4 ¿CÓMO SE REPRODUCEN LAS CELULAS? CICLO CELULAR La reproducción es una función básica de los seres vivos. 2. es un proceso que les permite a las especies la continuidad de la vida tanto en el tiempo porque las perpetua. 80 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Si hiciéramos la analogía de la síntesis proteica con la construcción de un edificio. como en el espacio porque sustituye a los organismos que mueren y se mantiene el número de individuos. Los nucléolos son esenciales para la síntesis de proteínas y de ácidos ribonucleicos. ¿cuáles serían los protagonistas de dicha obra y por qué? Escribe la letra dentro del paréntesis que corresponda Explica en cada caso el porqué asignaron esa respuesta.

la célula ha tenido que duplicar previamente su material genético. después del periodo S. constituyendo lo que se denomina el ciclo celular. en el periodo G2 los cromosomas ya aparecerán formados por dos cromátidas unidas por el centrómero. Ciclo celular La mayoría de las células del organismo se divide periódicamente. por lo que en el periodo G1. lo cual ocurre durante el periodo S o fase de síntesis (de ADN). Para dividirse. se dice que la célula está en el periodo de interfase. Al final del periodo G2 ocurren las fases de la mitosis. las cuales se suceden en un tiempo de una a dos horas. mientras que. cada cromosoma estará constituido por una simple cromátida.GUÍA METODOLÓGICA DE BIOLOGÍA El proceso de división celular por el cual una célula da origen a dos células idénticas con igual dotación de cromosomas. Para lograr esta división. ocurren transformaciones y fenómenos que se suceden de manera cíclica.24. Cuando no se manifiestan los fenómenos de la división. se denomina mitosis. 2. 81 . siendo notables excepciones las neuronas y los miocitos. en el cual el ADN no está compactado y forma una fina red dentro del núcleo. En el caso de las células somáticas humanas cada célula que se divide da lugar a dos células hijas con 46 cromosomas. previo a la fase S.

La mitosis asegura la distribución exacta y equitativa de los cromosomas en cada una de las células hijas. sino que además. En la telofase se forman dos núcleos hijos (cariocinesis) y el citoplasma también completa su división (citocinesis) mediante un plegamiento de la membrana que comienza desde la periferia en la parte media y progresa hacia el centro de la célula. los cromosomas se colocan en el plano ecuatorial de la célula y aparecen unidos por el centrómero con el huso acromático. En la metafase. de tal manera que finalmente se obtienen dos células hijas con igual dotación de cromosomas y citoplasma (división ecuatorial). Esto garantiza que la información genética (juego de cromosomas) se distribuya exactamente en cada uno de los núcleos hijos. migre hacia el polo respectivo de la célula. restituye las células muertas. los centríolos son los sitios donde se ensambla la tubulina.24). migrando uno de ellos por la periferia del núcleo hacia el otro polo de la célula. sana 82 . 2. se acortan y aparecen como bastones compactos. de modo que cada célula tenga exactamente el mismo número y tipo de cromosomas que las demás células de la misma especie. los cromosomas que ya se habían duplicado en el periodo de síntesis de la interfase. unida por su centrómero al huso acromático. La membrana nuclear deja de hacerse visible y se observan los centríolos. que forma el huso mitótico. que también se han duplicado.GUÍA METODOLÓGICA DE BIOLOGÍA DIVISIÓN CELULAR Mitosis Es un proceso continuo con fases consecutivas que se definen según las características morfológicas que presentan los cromosomas (fig. En la profase. En los organismos pluricelulares. En la anafase ocurre la división longitudinal del centrómero. lo que permite que cada cromátida se separe y. en donde cada célula tendrá toda la información genética para la totalidad de las características del organismo. la cual es la subunidad proteica de los microtúbulos. la división mitótica no solamente puede dar origen a nuevos individuos por reproducción vegetativa en plantas o por fragmentación en animales.

25. por lo que se denomina reproducción asexual. una ventaja en condiciones ambientales estables y una desventaja cuando estas condiciones cambian. Los organismos unicelulares se reproducen habitualmente mediante mitosis. así que las células hijas son exactamente iguales a la progenitora. como muchas plantas. Fases de la mitosis 83 . en los que es un medio auxiliar de reproducción. Con una rama de un árbol se puede obtener un árbol entero idéntico genéticamente al original. la mitosis es una forma de producir mucha progenie idéntica. Otros tipos de reproducción asexual ocurren también en organismos unicelulares e incluso pueden darse en organismo superiores. regenera tejidos dañados o perdidos del cuerpo. formando. por su capacidad de adaptabilidad. 2. En organismos unicelulares. Esto conlleva una variabilidad mínima.GUÍA METODOLÓGICA DE BIOLOGÍA heridas y en algunos casos. En este mecanismo de reproducción no interviene el sexo.

directamente o indirectamente después de una serie de divisiones mitóticas.26). sólo una de ellas.GUÍA METODOLÓGICA DE BIOLOGÍA Meiosis Un mecanismo más complejo y perfecto de reproducción es la reproducción sexual que acontece en los organismos con diferenciación sexual y está mediada por células gaméticas haploides que se fusionan para formar un cigoto diploide. 2. denominadas primera y segunda divisiones meióticas. la primera. 84 .26. que tiene notable importancia en la evolución y variación genética de las especies que se reproducen sexualmente. Fases de la meiosis La meiosis permite la reducción del número de cromosomas por medio de dos sucesivas divisiones celulares. Como compensación. lleven a cabo un tipo de división especial denominado meiosis (fig. Los cromosomas homólogos se aparean en la primera división de la meiosis y realizan un proceso de intercambio de material genético. 2. denominado entrecruzamiento (crossingover). es precedida de la duplicación de los cromosomas. este mecanismo exige que células diploides que originan gametos.

GUÍA METODOLÓGICA DE BIOLOGÍA En la profase I. la cual es seguida por la meiosis II. Durante la anafase I. cada una de ellas con un número simple o haploide de cromosomas en condiciones normales. los cromosomas se colocan en el plano ecuatorial de la célula y en la anafase II ocurre la división longitudinal del centrómero. después de haber llevado a cabo el entrecruzamiento. el cual se manifiesta citológicamente por los llamados quiasmas. ACTIVIDAD Completa la siguiente tabla de diferencias entre mitosis y meiosis escribiendo en el espacio el enunciado correspondiente a la descripción 85 . En la telofase I se completa la primera división de meiosis. se colocan en el plano ecuatorial de la célula. los cromosomas bivalentes. los cromosomas homólogos se aparean o sinapsan en toda su longitud. orientando sus centrómeros hacia cada uno de los polos. Por consiguiente. completándose la migración hacia los polos en la telofase II. En la metafase II. cada una de las dos células obtenidas en la meiosis I originará a su vez otras dos. cuatro en total. En la metafase I. o sea. los dos cromosomas de cada par se separan. dirigiéndose cada uno al polo celular correspondiente. Esta separación de los homólogos constituye la base física de la segregación de los alelos. formando los llamados cromosomas bivalentes y luego intercambian porciones de su material en lo que constituye el punto de entrecruzamiento.

por tanto las células procariontes miden entre 1-5 µm y las eucariontes de 10 a 30 µm en animales y hasta 100 µm en vegetales. los eritrocitos se convierten en sacos de forma discoidal llenos de hemoglobina. pues su función reproductora así lo requiere. Las células presentan formas diversas que en general se relacionan con su función. es decir. ya que todas las actividades celulares que realizan. las células del cartílago se rodean de una matriz característica que contiene polisacáridos y la proteína colágeno. ACTIVIDAD Elabora en tu libreta un cuadro de doble entrada con las siguientes características SISTEMAS MEMBRANOSOS LOCALIZACIÓN COMPOSICIÓN QUÍMICA MORFOLOGÍA FISIOLOGÍA SISTEMAS NO MEMBRANOSOS ORGANELOS 86 . que transporta oxígeno. Por ejemplo. como responder ante estímulos del ambiente. Las células se miden en micras (µm).5 ¿CÓMO SE PASA DE UNA CÉLULA A LA PLURICELULARIDAD? Tamaño. excretar el exceso de líquido y evadir a los depredadores. las células del músculo esquelético contienen una red de filamentos alineados con precisión y compuestos de proteínas contráctiles.GUÍA METODOLÓGICA DE BIOLOGÍA 2. Se considera a los protozoarios como los paramecios y las amibas organismos unicelulares complejos. los espermatozoides poseen un flagelo que les da una gran movilidad. forma y función de las células Casi todas las células son microscópicas. la milésima parte de un milímetro. las lleva a cabo cada célula. procurarse alimento. que juntos suministran apoyo mecánico.

compáralas entre sí de acuerdo a su función y explica porqué tienen esa estructura. 87 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga y dibuja tres o mas tipos diferentes de células humanas.

liso y cardiaco. Los órganos están compuestos de tejidos los cuales se componen de células. muscular y nervioso.GUÍA METODOLÓGICA DE BIOLOGÍA 2. ACTIVIDAD ESPECÍFICA Por equipo. Debido a la complejidad del mismo. RUBRICA PARA EVALUAR UN MAPA CONCEPTUAL Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Asignatura: 88 . Los tejidos animales incluyen el tejido epitelial.6. • El tejido epitelial forma membranas que cubren las superficies corporales interna y externa y también origina las glándulas • El tejido conectivo generalmente contiene una cantidad considerable de material extracelular e incluye a la dermis. cartílago tendones. elabora un mapa conceptual de una célula eucarionte hipotética donde interrelaciones a todos los componentes celulares con sus funciones. • El tejido nervioso está especializado en la generación y conducción de señales eléctricas. Este mapa conceptual se expondrá al grupo para su evaluación. la actina y la miosina. Existen tres tipos de tejido muscular: el esquelético. ligamentos. el tejido adiposo y la sangre • El tejido muscular está especializado en el movimiento y utiliza filamentos proteicos que se deslizan. ¿CUÁL ES LA RELACIÓN TEJIDO-ÓRGANO-SISTEMA? El cuerpo animal está compuesto de sistemas los cuales a su vez están formados por dos o más órganos. conectivo. especializada para una tarea específica. hueso. se recomienda que se construya en varios pliegos de papel bond para poder extenderse. Un tejido es un grupo de células y de material extracelular que forman una unidad estructural y funcional.

no tienen sentido por sí mismo. TOTAL: COMENTARIOS: REFERENCIAS:(Garza. tienen sentido por sí mismo. 2002) (Pimienta. Muestra cada concepto una sola vez. y sobre la línea escribe frases o palabras claves que indican la relación existente entre dichos conceptos. aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja y no muestra relaciones entre conceptos de manera clara y correcta Utiliza líneas para unir los conceptos. MUY BIEN (3) Identifica los conceptos y tiene algunas ramas que se derivan del concepto principal Ordena los conceptos del más general al más específico. pero no muestra ramas que se derivan del concepto principal No ordena los conceptos del más general al más específico. Muestra cada concepto una sola vez. y no escribe sobre la líneas frases o palabras claves que indiquen la relación existente entre dichos conceptos. 2005) 89 . tienen poco sentido por sí mismo. aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja. y sobre Especificación la línea escribe frases de conectores y o palabras claves que nexos entre los indican la relación conceptos.. no tienen sentido por sí mismo. Y al leer los conceptos con sus relaciones. 2000) (Núñez Chan. Metodología Constructivista. Guía para la planeación docente. pero no lo hace en todas las líneas BIEN (2) Identifica los conceptos y solo muestra dos ramas que se derivan del concepto principal Ordena los conceptos del más general al más específico. pero no se pueden apreciar relaciones entre conceptos de manera clara y correcta DEFICIENTE (1) Identifica solo los conceptos. pero sólo se pueden apreciar algunas relaciones entre conceptos de manera clara y correcta Utiliza líneas para unir los conceptos. aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja. pero no escribe frases o palabras claves que indiquen la relación existente entre dichos conceptos. Y al leer los conceptos con sus relaciones.GUÍA METODOLÓGICA DE BIOLOGÍA PONDERACIÓN CRITERIOS EXCELENTE (4) Identifica los Identificación de conceptos y tiene conceptos del varias ramas que se tema derivan del concepto principal Ordena los conceptos del más general al más específico. Solo utiliza algunas líneas para unir los conceptos. Y al leer los conceptos con sus relaciones. aunque haya los conceptos relaciones que tengan relacionándolos que marcarse de un vertical y extremo a otro de la horizontalmente hoja y se pueden según el grado apreciar varias de inclusividad relaciones entre conceptos de manera clara y correcta Muestra cada concepto varias veces. PUNTAJE Jerarquización de los conceptos de mayor a menor inclusividad Muestra cada concepto una sola Organización de vez. Y al leer los conceptos con sus relaciones. haciéndolo en todas las líneas Utiliza líneas para unir los conceptos. existente entre dichos conceptos.

(2005) Biología General. 53 y 62-64. Madrid España pp. y Hernández M. Ediciones Cultural. Harvey (2005). Biología Celular y Molecular. 126-141 Lodish. Puntos 80 Aspectos a mejorar : Autónomo Argumenta diferencias y semejanzas de los procesos celulares mediante un mapa conceptual integrador. Pre-formal Investiga la estructura y los procesos celulares mediante un mapa conceptual Receptivo Identifica la estructura y los procesos celulares mediante un mapa conceptual integrador. Los Mecanismos de la Vida.GUÍA METODOLÓGICA DE BIOLOGÍA MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios Analiza la estructura y los procesos celulares mediante un mapa conceptual integrador. Publicaciones Cultural 2ª reimpresión. 52. Puntos 100 Estratégico Fundamenta los procesos celulares a través de un mapa conceptual integrador. ACTIVIDADES DE APRENDIZAJE: • Línea del tiempo • Cuadro de doble entrada • Reporte de laboratorio en V-Gowin ACTIVIDAD ESPECÍFICA: • Mapa conceptual integrador Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad FORMATIVA SUMATIVA 30% 20% 20% 30% BIBLIOGRAFÍA BÁSICA Atlas de Biología. Ponderación Logros: Puntos 30 Puntos 60 Puntos 100 EVALUACIÓN DIAGNÓSTICA Aplicación de un examen diagnóstico y la retroalimentación por medio de una lluvia de ideas. Resolutivo Establece diferencias y semejanzas entre la estructura y los procesos celulares mediante un mapa conceptual integrador. Editorial Médica Panamericana 5ª edición. México pp. Cervantes M. 90 .50.

pp.es/biosfera/ 91 .bioxeo. Limusa México. La Vida y sus Procesos. Granillo y P. Ed. Colección Espejo de Urania. (2004). (2006) Biología. (2001) Biología.S. Bachillerato General Publicaciones Cultural Primera Edición. 75-95 Valdivia. La Vida Celular.mec.cellsalive. Publicaciones Cultural. 70-100 Vázquez C. México. Luis (2000). Villarreal. La Célula.com/plabioca. Biología. SEP/Santillana.htm Cells alive http://www. La Ciencia desde México 18. Ed Mc Graw-Hill 3ª edición. B.com Proyecto Biósfera. 72-125 BIBLIOGRAFÍA COMPLEMENTARIA Bojorquez Castro. pp. Las Membranas de las Células. Programa Nacional de Formación de Profesores. M. Ed. México. R. http://recursos. pp. (2003). 611páginas. Consejo Nacional de Ciencia y Tecnología Tapia. Biología. Fondo de Cultura Económica. Consejo Nacional de Ciencia y Tecnología VIDEOS RECOMENDADOS • Gran Planeta Celular • Cosmos de Carl Sagan TIC’s Bioxeo – Recursos Biología http://www. México Peña. Ricardo.GUÍA METODOLÓGICA DE BIOLOGÍA Overmire. La Ciencia desde México 30.cnice. Asociación Nacional de Universidades e Institutos de Enseñanza Superior George Dreyfus (2002). (1987) Las Células de la Mente. Antonio (1986). Salomón B Martín. Fondo de Cultura Económica.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 3 Herencia y variación MI FAMILIA 92 .

GUÍA METODOLÓGICA DE BIOLOGÍA 93 .

Ejemplifica las aplicaciones más importantes de la Genética. por medio de la construcción y el diagnóstico de un cariotipo. elaboración de cariotipos y la realización de un ensayo. Desarrolla un ensayo sobre el impacto de las aplicaciones de la Genética sobre algunas actividades humanas. • • • • 94 . SABERES Procedimentales Realiza una línea del tiempo del desarrollo histórico del campo de la Genética Aplica los conceptos de la genética en las leyes de la herencia para la resolución de problemas de genética. Analiza las aplicaciones actuales de la genética mediante la investigación y elaboración de un ensayo. Aplica las Leyes de Mendel a través de la práctica de su método experimental y los diferencia de patrones hereditarios no mendelianos Categoriza e identifica a las mutaciones como mecanismos generadores de enfermedades hereditarias. 4. Explica los patrones hereditarios mendelianos y no mendelianos Describe las mutaciones como mecanismos de variabilidad genética. CRITERIOS DE DESEMPEÑO Investiga los hechos históricos premendelianos mediante una línea del tiempo. consultando fuentes relevantes y realizando experimentos pertinentes. Realiza una práctica de rasgos hereditarios para identificar el fenotipo de sus compañeros y predecir su posible genotipo. COMPETENCIAS Genéricas/Atributos Disciplinares 6. registra y sistematiza la información para responder a preguntas de carácter científico. Declarativos Analiza los hechos históricos que condujeron al estudio de la Genética Analiza las leyes de la genética mendeliana para comprender el mecanismo de la herencia. Obtiene. asumiendo consideraciones éticas. valorando la trascendencia del proyecto genoma humano y su alcance en las aplicaciones de la biotecnología a través de la resolución de problemas. Valora el respeto a la decisión de los padres a tener o no un hijo con alguna enfermedad hereditaria. Actitudinales/Valorales Fomenta el respeto y tolerancia hacia personas con enfermedades hereditarias y/o con rasgos físicos diferentes. Fundamenta opiniones sobre los impactos de la ciencia y la tecnología en su vida cotidiana.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. Critica de forma informada las aplicaciones actuales de la Genética que permita la toma de decisiones apegadas a la Bioética.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE: HERENCIA Y VARIACIÓN TIEMPO: 29 horas UNIDAD DE COMPETENCIA: Investiga los fundamentos que permiten delinear las bases genéticas de la herencia para argumentar su desarrollo histórico. Categoriza las mutaciones como mecanismos que producen enfermedades hereditarias y las detecta mediante la elaboración de cariotipos. 2. así como su impacto en la vida actual.

• Ensayo. • Cañón. • Problemario. • Revista electrónicas. • Manual de prácticas.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • Aplicación de ESTRATEGIAS DE APRENDIZAJE • Elaboración de un collage • Elaboración de un cuadro • RECURSOS DIDÁCTICOS Guía metodológica. • Artículos de EVIDENCIAS Y/O PRODUCTOS • Línea del tiempo • Reporte de la práctica V preguntas generadoras • Dinámicas grupales • Presentaciones de comparativo • Elaboración de un cuadro de Gowin • Entrega de un • Ensayo • Árbol genealógico • Problemario resuelto cariotipo sinóptico • Resolución de problemas • Construcción de árbol power point sobre mutaciones y enfermedades hereditarias. • Resolución de experimentales. problemario. • Reporte de actividades animaciones sobre temas de genética • Software educativo. ¿De qué están compuestos los genes? ______________________________________________________________________ 3. • Laboratorio virtual. EXPLORANDO TUS CONOCIMIENTOS 1. • Computadora. • Actividades genealógico • Investigación • Cuestionarios. • DVD experimentales a través de una V de Gowin. • Resolución de divulgación científica. ¿Por qué te pareces a tus padres?__________________________________________________________________ 2. Escribe 2 enfermedades hereditarias ______________________________________________________________________ 95 . • Pizarrón. Escribe 5 rasgos que se hereden ______________________________________________________________________ 4. • Plumones. • Videos • Ilustraciones y actividades de la guía.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD: GLOSARIO Para analizar mejor este bloque es importante y necesario que antes te familiarices con la terminología de genética. Elabora un glosario con un mínimo de 20 términos. 96 .

de los que estos hombres derivaban su gran fuerza. y posteriormente la información de ambos padres se mezclaba como un fluido.1) y afirmaban que la hembra sólo proveía el ambiente para el desarrollo de la futura generación. Durante el siglo XVIII. es decir. 97 . el holandés Anton van Leeuwenhoek descubre "animáculos" en el esperma humano y de otros animales. dentro de cada espermatozoide (Fig. 3. enriqueciendo así el linaje nacional.LAS IDEAS PREMENDELIANAS Muchas veces hemos oído expresiones como “este niño es idéntico a su papá” o bien “tiene los ojos de la abuela”. Muchas leyendas se basaron en extravagantes posibilidades de apareamiento entre individuos de diferentes especies. como los espermistas. mientras que otros ni siquiera consideraban que este tipo de mezclas eran necesarias. Se procreaba y se observaban ciertos rasgos físicos semejantes entre padres e hijos.C. se apareó con un toro y produjo el Minotauro.GUÍA METODOLÓGICA DE BIOLOGÍA 3.C.) enunció la teoría de la pangénesis. Algunos otros. imaginaron ver a un "pequeño hombrecito" al que llamaron homúnculo. Los héroes folclóricos de Rusia y Escandinavia.) pensaba que el semen masculino y el flujo menstrual se mezclaban en la concepción. y que el esperma solo lo estimulaba. según la mitología griega. según los primeros naturalistas. La esposa de Minos. Los filósofos griegos sostenían varias ideas: Hipócrates (460-377 a. moscas.) nacían por generación espontánea. a un animal tan poco probable como la jirafa. etc. Aristóteles (384-322 a. Así. pero los mecanismos no eran conocidos. la escuela ovista pensaba que el futuro ser se encontraba dentro del óvulo. sabemos que algunas características de los individuos han sido heredadas de sus progenitores ¿Cómo sucede esto? A lo largo de la historia de la humanidad se desconocían los detalles científicos de cómo funcionaba la herencia.1 ¿CUÁLES HECHOS HISTÓRICOS CONDUJERON AL ESTUDIO DE LA GENÉTICA? . que eran incapaces de explicar de otro modo. Por el contrario. el folklore reflejó las nociones tempranas e imperfectas acerca de la naturaleza de las relaciones hereditarias. las formas "simples" (gusanos. eran tradicionalmente los hijos de mujeres que habían sido capturadas por osos. El camello y el leopardo también se apareaban de vez en cuando. según la cual cada parte del organismo enviaba su información hereditaria a los órganos reproductores.

¿Por qué Mendel llamó a la 1ª. pues el material hereditario blanco y negro. la teoría de la mezcla explicaba que la unión de óvulos y espermatozoides producía una descendencia que era una "mezcla" de los rasgos de los padres.GUÍA METODOLÓGICA DE BIOLOGÍA En el siglo XIX. ¿Por qué utilizó Mendel en sus experimentos chícharos y no otra planta? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 3. ACTIVIDAD: Realiza una investigación documental y en tu libreta contesta las siguientes preguntas: 1. ¿Sabía Mendel qué era un gen? ¿Por qué? _____________________________________________________________________________________ _____________________________________________________________________________________ 2. ¿Por qué le llamó Ley de la Segregación a su segunda Ley? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 98 . nunca podría separarse de nuevo. Ley de la Uniformidad? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 4. A base de esta hipótesis podría predecirse que la progenie de un animal negro y de uno blanco sería gris y que su progenie también lo sería. una vez mezclado.

1. llamadas genes. Los siete rasgos del chícharo que estudió Mendel 99 . 3.1) Tabla 3. Mendel cimentó las bases de la Genética actual explicando que los rasgos heredables son contenidos en unidades discretas. específicamente en relación con la teoría de la evolución de Darwin.GUÍA METODOLÓGICA DE BIOLOGÍA EL EXPERIMENTO DE MENDEL Se podría decir que el nacimiento de la Genética ocurrió cuando el fraile agustino Gregor Mendel (1822-1884) realizó experimentos acerca de la herencia en chícharos (Fig. posición y color de la flor. No fue hasta 1930 cuando se comprendió completamente el alcance de su obra. Mendel seleccionó para su investigación siete rasgos del chícharo: textura y color de la semilla.2) y en 1865 presentó su investigación a la Sociedad de Historia Natural de Brünn (actual República Checa). con el título Experimentos en Hibridaciones de Plantas. forma y color de la vaina y longitud del tallo (tabla 3. que se heredan por separado en cada generación.

Por ejemplo. altura.2 ¿QUÉ DIFERENCIAS Y SIMILITUDES ENCONTRAMOS EN LOS CONCEPTOS DE LA GENÉTICA? La genética actual. Empleó un par de letras que representan los genes que intervienen en cada rasgo estudiado. posición de las flores. Por otro lado. 3. que es un rasgo dominante. mientras que la letra “a” minúscula refiere al gen para el tallo bajo que corresponde a un rasgo recesivo. Por ejemplo. color de piel.2 Gregor Mendel ACTIVIDAD Retomando la línea del tiempo de célula.1 El homúnculo Fig. forma de la hoja. 3. el color de cabello. agrégale los hechos más relevantes que marcaron el curso de la genética. a partir del trabajo de Mendel. todo lo que podemos observar como resultado de la expresión de la información genética.GUÍA METODOLÓGICA DE BIOLOGÍA Mendel ideó un mecanismo para simbolizar y comprender la transmisión de los rasgos hereditarios. Fig. etc. el genotipo es la constitución genética de un organismo que determina 100 . la letra “A” mayúscula representa al gen para tallo alto. expone varios conceptos básicos para la comprensión de los mecanismos de la herencia: El fenotipo es la apariencia de un organismo. color de ojos. en el tamaño de la planta. 3.

genéticamente iguales para ese carácter y cuyo fenotipo es producto del carácter dominante. se llama primera generación filial.3). Cuando el individuo porta alelos distintos (Aa). 3. dominante y recesivo. se dice que el genotipo es homocigoto (raza pura). Los cromosomas homólogos tienen los mismos genes. Para facilitar la notación. en un lugar físico específico. el primero tiene sólo alelos dominantes (AA) y el segundo lleva sólo alelos recesivos (aa). los genes “A” y “a” son alelos porque ambos codifican para la misma característica (tamaño de la planta). Segunda ley . Las generaciones sucesivas a partir de este cruzamiento se denominan F2 y así sucesivamente. ubicados en los mismos loci (plural de locus). aunque con expresiones distintas: alta y baja. conocido como locus. 3. ya fuese para la forma de las semillas o para las plantas. En el ejemplo anterior. el cruzamiento inicial entre dos variedades se llama generación paterna. aunque se puede inferir al analizar las proporciones fenotípicas. SOBRE LA HERENCIA? Primera ley . y su descendencia.GUÍA METODOLÓGICA DE BIOLOGÍA al fenotipo y que no es observable directamente. Cuando un organismo tiene alelos iguales.Ley de la uniformidad de la primera generación Al cruzar entre sí individuos de razas puras distintas para un determinado carácter. o F1. 101 . lo que permite su segregación en distintos gametos durante la meiosis. respectivamente. se obtiene una generación de individuos híbridos. o P1. Además.3 ¿EN QUÉ CONSISTEN LAS LEYES. su genotipo es heterocigoto (híbrido).Ley de la segregación de los caracteres Los alelos de un carácter en los híbridos de la primera generación se segregan durante la formación de los gametos sin mezclarse y se reúnen de nuevo de todas las formas posibles en la fecundación para originar a los individuos de la segunda generación (fig. cada gen se ubica en un cromosoma del par homólogo. ESTABLECIDAS POR MENDEL. Cada gen se ubica en uno de los cromosomas homólogos. Los genes alelos son determinados segmentos de ADN que determinan un rasgo hereditario.

7). acondroplasia. polidactilia y aniridia. Por ejemplo. Por otro lado. alelos múltiples. Si una persona tiene un alelo dominante defectuoso desarrollará la enfermedad. 102 . enfermedad de Huntington. herencia intermedia.Ley de la herencia independiente de los caracteres Cada uno de los caracteres hereditarios se transmite a los descendientes con absoluta independencia de los demás (fig. herencia autosómica dominante y recesiva.4 ¿QUÉ DIFERENCIA HAY ENTRE LOS PATRONES HEREDITARIOS MENDELIANOS Y LOS NO MENDELIANOS? Los principios establecidos por Mendel se agrupan en un modelo genético denominado herencia mendeliana.5).4) Cruzamiento de prueba Al cruzar un fenotipo con el padre homocigoto recesivo se puede determinar el genotipo desconocido. 3. Por ejemplo. Si se producen dos fenotipos distintos quiere decir que el progenitor desconocido era heterocigoto para ese carácter. aquellos rasgos que no cumplen dichas leyes quedan incluidos en la herencia no mendeliana. HERENCIA MENDELIANA Herencia autosómica dominante En este tipo de herencia sólo se necesita uno de los genes para que se exprese una característica o una mutación (Fig. tanto rasgos normales como alteraciones hereditarias. Se conoce como autosómica porque el gen se encuentra en un cromosoma somático o autosoma. herencia ligada al sexo. Si por el contrario aparece un solo fenotipo entonces es homocigoto (fig. La característica o anomalía será más extrema o severa en los individuos homocigotos que en los heterocigotos. 3. genes ligados. 3. poligenia y herencia multifactorial. determinación del sexo. Se heredan de esta forma: braquidactilia. 3. Esto implica que los patrones hereditarios. codominancia. se rigen por las leyes de Mendel.GUÍA METODOLÓGICA DE BIOLOGÍA Tercera ley .

Determinación del sexo Existen dos tipos de cromosomas: autosomas que contienen genes que determinan las características somáticas. En el humano.GUÍA METODOLÓGICA DE BIOLOGÍA Herencia autosómica recesiva Se expresa únicamente cuando en el genotipo de un individuo están los dos alelos recesivos que pueden ser normales o mutados (Fig. cuya dotación cromosómica es de 46. y cromosomas sexuales o gonosomas. Se heredan de forma autosómica recesiva la anemia drepanocítica (o falciforme). fenilcetonuria y fibrosis quística.7 Herencia autosómica dominante Fig. se heredan de esta forma.8). que definen los caracteres sexuales. 3. puesto que llevan un alelo normal y otro alterado. 3. Fig. proceso que mantiene el equilibrio génico en ambos sexos al igualar el contenido de ADN cromosómico activo. pero que pueden transmitir su alelo defectuoso a sus hijos. albinismo. 103 .8 Herencia autosómica recesiva En la mujer ocurre la inactivación de uno de los cromosomas X (que resulta en la formación del corpúsculo de Barr observado en los núcleos interfásicos). Casi todas las enfermedades causadas por la falta de una enzima esencial. Los portadores son heterocigotos para el gen. 3. cada célula somática contiene 22 pares de autosomas más un par sexual XX si se trata de una mujer (homogaméticas) y 22 pares de autosomas y un par XY si se trata de un varón (heterogaméticos). entre otras. Son personas fenotípicamente normales.

6). 3. 3.3 Primera y segunda leyes de Mendel Fig. por lo que en el 50% de los casos se formarán mujeres y en el otro 50% se formarán hombres (fig.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.5 Cruzamiento de prueba Fig. 104 .4 Tercera ley de Mendel Fig. un óvulo puede ser fecundado por cualquiera de los dos tipos de espermatozoides que se han producido.6 Determinación del sexo La determinación del sexo ocurre en la fecundación y depende de los gametos. 3. Al ser aleatoria. 3. 3.

105 . Un árbol genealógico o genograma es un gráfico que muestra las relaciones de parentesco y la transferencia de los rasgos hereditarios a través de varias generaciones en una familia. así como cualquier patología o enfermedad presente en tus familiares y elabora tu árbol genealógico. y la herencia ligada al sexo así como pueden observarse las relaciones de consanguinidad y la unión entre personas estrechamente relacionadas. Analiza en tres generaciones de tu familia dos características normales que se presenten por herencia autosómica dominante y/o recesiva. la transmisión de caracteres hereditarios (genotipo).GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . con base en las leyes de Mendel y. Los consejeros genéticos emplean la genealogía para determinar en las parejas si serán capaces de producir hijos sanos.¿A QUIÉN ME PAREZCO MÁS Y POR QUÉ? Construye tu árbol genealógico. El análisis genealógico puede detectar la herencia autosómica dominante y recesiva. Expón tu árbol genealógico explicando el fenotipo entre los familiares presentados y el origen posible de las características y enfermedades. específicamente. Se elabora con el fin de detectar algunas anomalías genéticas y para establecer las probabilidades que tiene un padre de procrear un hijo con un rasgo determinado.

106 . Se cruzan dos plantas de chícharos. 4. Esto ocurre porque uno de los alelos para la textura del cabello ejerce una dominancia incompleta sobre el otro alelo. Otros rasgos con herencia intermedia son la braquidactilia y anemia falciforme. muestra el genotipo y fenotipo que obtuvo en la F1 y F2. con otra amarilla y normal y se obtienen: 30 plantas rojas normales. cruzó dos plantas de chícharo de líneas puras. Resuelve el siguiente problemario en tu libreta. 2. Si una persona con cabello rizado tiene un hijo con una persona de cabello lacio. 1. Si dos personas con cabello ondulado se casan (F2). El color rojo de la pulpa del tomate depende de la presencia de un factor R dominante sobre su alelo r para el amarillo. Comprobar el resultado realizando un cuadro de Punnett. con lo que se obtiene una proporción fenotípica de 1:2:1 (Fig. en humanos la textura del cabello está influida por un gen con dos alelos dominantes incompletos. se obtiene en la primera generación individuos con un rasgo intermedio al de los dos progenitores puros. 3. ¿Cuáles son los genotipos de las plantas que se cruzan?. una de vainas verdes y flores axilares (VVAA) con otra de vainas amarillas y flores terminales (vvaa). 9 rojas enanas y 10 amarillas enanas. Obtén genotipos y fenotipos de F1 y F2. 3. una de tallo largo y otra de tallo corto. en uno de sus experimentos. Se cruzan tomates rojos híbridos y de tamaño normal homocigotos con la variedad amarilla enana. Se cruza una planta de pulpa roja y tamaño normal. que llamaremos C1 (cabello rizado) y C2 (cabello lacio). utiliza el cuadro de Punnett. HERENCIA NO MENDELIANA Herencia intermedia o Dominancia incompleta Al cruzar distintas líneas puras entre sí (dominantes y recesivas). con las siguientes probabilidades: 25% cabello rizado (C1C1). ¿Qué proporción de tomates rojos que salen en la F1 serán enanos? (Los alelos dominantes son el tamaño normal y el color rojo). tendrán hijos con cualquiera de los tres tipos de cabello. 50% cabello ondulado (C1C2) y 25% cabello lacio (C2C2). Por ejemplo. todos sus hijos saldrán con cabello ondulado (F1). El tamaño normal de la planta se debe a un gen N dominante sobre el tamaño enano n.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . Utilizando la cuadricula de Punnett. Mendel. 31 amarillas normales.9).PROBLEMARIO DE HERENCIA MENDELIANA Con base en las Leyes de Mendel. Los heterocigotos con el genotipo C1C2 tienen cabello ondulado.

sino que tienen 75% de plantas de polen largo y flor púrpura y 25% de polen redondo y flor roja. en el chícharo dulce (Fig. 3.10 Genes ligados Por ejemplo. los genes para el color de la flor y la forma del polen están en el mismo cromosoma de tal manera que los genes se distribuyen juntos durante la meiosis y se heredan juntos. el color de flor púrpura (P) domina sobre el rojo (p). 3. Un ejemplo de ligamiento lo constituyen los genes del grupo sanguíneo Rh y los genes HLA (complejo de histocompatibilidad) Fig. sin embargo. Así los fenotipos de la F2 no se presentan como 9:3:3:1.10). Sin embargo. 3.GUÍA METODOLÓGICA DE BIOLOGÍA Genes ligados Los genes se separan independientemente durante la meiosis. Cuando un chícharo homocigoto de polen largo y de flor púrpura se cruza con uno de polen redondo y de flor roja.9 Herencia intermedia Fig. y la forma larga de polen (L) domina sobre la redonda (l). toda la F1 tiene flores púrpuras y polen largo. 107 . existen grupos de genes en un mismo cromosoma.

muchos de los cuales desempeñan un papel en la masculinidad. 3. la mayoría de este tipo de herencia los genes anómalos se encuentran en el cromosoma X y son recesivos. la coagulación de la sangre y ciertas proteínas estructurales de los músculos.11 Herencia ligada al cromosoma X: daltonismo Fig. el cromosoma Y contiene unas cuantas docenas de genes. Fig. Por esta razón.12 Experimento de Morgan Así se tiene que. 3. el cromosoma X contiene más de 1000 genes. codificando rasgos que son importantes en ambos sexos como la visión del color. cambian respecto a los genes que se encuentran en los cromosomas somáticos.GUÍA METODOLÓGICA DE BIOLOGÍA Herencia ligada al sexo Existen rasgos determinados por genes que se encuentran en cualquiera de los dos cromosomas sexuales: X o Y. pocos de los cuales tienen un papel específico en la reproducción de rasgos femeninos y la mayoría no tienen su equivalente en el cromosoma Y. así como los mecanismos por los cuales se heredan. En los humanos. por lo que se debe tener el gen dañado en dosis doble (homocigosis) para que se produzca la enfermedad en la mujer 108 . las proporciones que se obtienen en la descendencia. En cambio.

o llevar uno normal y uno dañado (heterocigota o portadora). Morgan cruzó machos de ojos blancos con hembras de ojos rojos. Esta mosca posee características externas claramente observables. Si una mujer portadora se une a un hombre sano. En sus trabajos. A través de sus investigaciones logró determinar qué ese rasgo estaba ligado al cromosoma X. Morgan estudió esta característica y observó que algunas moscas tenían ojos de color blanco. Una de ellas es el color de ojos. Las moscas de ojos blancos tienen alelos puros para ese rasgo. ya que originan solo progenie con ojos blancos. Las mujeres con fenotipo normal pueden no llevar el gen (homocigotas dominantes). El color natural o silvestre es rojo. Morgan en la mosca de la fruta. todos los individuos de ambos sexos tenían ojos rojos Cuando las moscas de la F1 se cruzaron entre sí. ya que la descendencia obtenida de ellas presenta las dos características. y en la actualidad puede resumirse en los siguientes postulados: • Los genes que determinan los factores hereditarios del fenotipo se localizan en los cromosomas. Si se analiza el sexo y color de ojos de los individuos de la F2. 3. la cual ha tenido aportaciones posteriores. En la F1. sólo la mitad es de ojos de color rojo y la otra mitad. 109 . 25% de hijos sanos (su cromosoma X lleva el gen dominante) y 25% de hijos enfermos (su cromosoma X lleva el alelo dañado).GUÍA METODOLÓGICA DE BIOLOGÍA y en el varón solo se necesita uno (Fig. las moscas hembras de ojos rojos pueden tener genes para ojos de color rojo o blanco. Drosophila melanogaster (Fig. de color blanco. Con base en lo anterior. 25% de hijas portadoras (heterocigotas).12). El descubrimiento de los genes ligados al sexo fue hecho en 1910 por Thomas H. en tanto que los machos. Estos resultados permiten inferir que el rasgo de color de ojos está controlado por dos alelos. pero hay una serie de variantes en este rasgo hereditario. 3. surge la teoría cromosómica de la herencia.11). en donde el gen que determina el color rojo es dominante sobre el gen para el color blanco. En cambio. el 25% de los descendientes de la F2 presentaron ojos blancos y el 75% restante ojos rojos. se puede comprobar que todas las hembras son de ojos rojos. en cada fecundación tendrá una probabilidad del 25% de hijas sanas (que no lleven el gen).

B. es decir. 3.2 y Fig. los alelos IA e IB son codominantes sobre iO que es recesivo. • Los genes alelos se encuentran en el mismo locus de la pareja de cromosomas homólogos. Codominancia y alelos múltiples Los alelos múltiples son una condición en la que hay más de dos alelos alternativos probables que definen ciertos rasgos. Este gen codifica una glucoproteína específica que se localiza en la superficie de los glóbulos rojos o eritrocitos. son consecuencia de tres distintos alelos de un sólo gen (IA. 3. Un ejemplo clásico son los alelos del sistema de grupos sanguíneos ABO (Tabla 3.13 Codominancia y alelos múltiples 110 . Los 4 grupos sanguíneos. ambos son fenotípicamente detectables en heterocigosis. IB e iO) presente en el cromosoma 9. por lo que tienen sangre tipo AB. Los alelos múltiples se originan por diferentes mutaciones en un mismo gen. A. AB u O.2 Grupos sanguíneos Fig.GUÍA METODOLÓGICA DE BIOLOGÍA • Cada gen ocupa un lugar específico o locus (en plural es loci) dentro de un cromosoma concreto.13) y los del complejo de histocompatibilidad (HLA). • Los genes se encuentran dispuestos linealmente a lo largo de cada cromosoma. A su vez. Tabla 3. por lo que en los organismos diploides cada carácter está regido por una par de genes alelos.

111 . un ejemplo de ello es la reina Victoria de Inglaterra. A la suma de los factores herencia-ambiente se le conoce como herencia multifactorial. el ambiente influye sobre muchos rasgos poligénicos. ya que era tradicional y beneficioso casarse entre los miembros de la realeza. etc y muchos padecimientos sistémicos: lupus eritromatoso. Además. hipertensión arterial.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . defectos del tubo neural. portadoras y enfermo/a.¿CÓMO SE TRANSMITE LA HEMOFILIA? En las familias reales puede observarse en sus genogramas un alto grado de consanguinidad. ACTIVIDAD En tu libreta elabora un cuadro comparativo sobre los tipos de herencia mendeliana y no mendeliana. estenosis pilórica. Especificando por qué se presentan personas sanas. esquizofrenia. cardiopatías. luxación congénita de cadera. Analiza el siguiente genograma y determina cuál es el patrón genético que sigue la hemofilia apoyándote en la teoría cromosómica. Entre los padecimientos que se heredan en forma multifactorial se encuentran la mayoría de los defectos del nacimiento: labio y paladar hendido. epilepsia. diabetes mellitus. psicosis maniacodepresiva.

1. ¿Qué proporción genotípica y fenotípica cabe esperar en un matrimonio entre un hombre daltónico y una mujer portadora? 6. 4. e) Determina qué posibilidad tiene la pareja de que su siguiente hijo tenga visión normal. En la especie vacuna. Un toro sin cuernos se cruza con tres vacas: a) Con la vaca A que tiene cuernos se obtiene un ternero sin cuernos. se casó con una mujer que sufría jaqueca. c) El hijo. Determina el genotipo de: a) La madre. Un varón de ojos azules se casa con una mujer de ojos pardos. ¿Cuál de los ratones A y B será homocigoto y cuál heterocigoto? Razona la respuesta. Un hombre que padecía de aniridia y cuya madre no. La madre de la mujer era de ojos azules. d) Explica cómo se pudo presentar este suceso. es dominante sobre la presencia f. En la especie humana la Miopía es un rasgo dominante (M). b) El padre. Un ratón A de pelo blanco se cruza con uno de pelo negro y toda la descendencia obtenida es de pelo blanco. Elabora un árbol genealógico para explicarlo. 2. La jaqueca es debida a otro gen también dominante (J). ¿Cuáles son los genotipos del toro y de las tres vacas? 3. b) Con la vaca B también con cuernos se produce un ternero con cuernos. sabiendo que el color pardo domina sobre el color azul. Léelos con detenimiento y razona el patrón hereditario. Al unirse una mujer de visión normal a un hombre con miopía. pero cuyo padre no la sufría. 5. Del matrimonio nació un hijo con ojos pardos. el padre de ojos pardos y tenía un hermano de ojos azules. la falta de cuernos F. y que probabilidad de que su siguiente hijo sea miope.GUÍA METODOLÓGICA DE BIOLOGÍA PROBLEMARIO DE HERENCIA NO MENDELIANA Resuelve en tu libreta los siguientes problemas de genética. La aniridia (dificultades en la visión) en el hombre se debe a un factor dominante (A). ¿Qué proporción de sus hijos sufrirán ambos males? 112 . tienen un hijo con visión normal. c) Con la vaca C que no tiene cuernos se produce un ternero con cuernos. Otro ratón B también de pelo blanco se cruza también con uno de pelo negro y se obtiene una descendencia formada por 5 ratones de pelo blanco y 5 de pelo negro. Razonar cómo será el genotipo de todos ellos.

Si ambos padres tiene sangre tipo A ¿Qué posibilidades hay de que tengan un hijo con tipo sanguíneo O? Fundamenta tu respuesta. En un cuadro de Punnett representa la posible descendencia del cruce de dos plantas.5 ¿QUÉ ES UNA MUTACIÓN? El botánico Hugo de Vries en el año de 1901. lo que contribuye a su adaptación al medio ambiente y. Las mutaciones junto con la recombinación genética aumentan la variabilidad genética de las especies. 3. 9. 8. Investiga en tus familiares. donde determinó que estas variantes surgían como resultado de cambios súbitos en los genes y que la variante producida por un gen cambiado se transmitía luego a la progenie. el cruce entre plantas que producen rábanos redondos (RRRR) y las que producen rábanos alargados (RARA) producen rábanos ovalados (RRRA). Si una mujer albina se une a un hombre de color normal cuyo padre es albino. y mutantesa los organismos que exhibían estos cambios. si tienen 8 hijos ¿Cómo serán fenotípicamente sus hijos? 10. como lo hace cualquier otra característica hereditaria. En los rábanos. El Defecto de Albinismo es una característica recesiva. Con base a la información obtenida realiza un árbol genealógico expresando el genotipo de cada integrante. A partir de lo ocurrido de Vries planteo una hipótesis. aunque la mayoría de sus ejemplos no eran muy válidos. encontró que la herencia en la mayoría de las especies generalmente era ordenada y predecible. una de rábanos redondos con una de rábanos ovalados. Los conceptos propuestos por de Vries no resultaron tan erróneos. pudo observar que cada cierto tiempo aparecía alguna variante que no estaba presente ni en los progenitores ni en ningún antecesor de estas mismas plantas. De Vries denominó mutaciones a estos cambios hereditarios repentinos. en 113 . el fenotipo de plegar su lengua en U. el concepto de mutación como fuente de la variación genética demostró ser de suma importancia.GUÍA METODOLÓGICA DE BIOLOGÍA 7. La capacidad de plegar la lengua exprésala como uncaracterística dominante y la incapacidad de plegar la lengua como una característica recesiva. en sus estudios sobre herencia mendeliana en plantas. Sin embargo.

pueden transmitirse como rasgos hereditarios diferenciadores a los descendientes del organismo en los que tuvo lugar la mutación. puede provocar alteraciones en el organismo en el que se presente. provocando alteraciones que generalmente son corregidas a través de diferentes mecanismos de reparación. Se originan por: 114 . químicos (agentes alquilantes.GUÍA METODOLÓGICA DE BIOLOGÍA definitiva. En la naturaleza las mutaciones ocurren al azar y espontáneamente. oxidantes) y biológicos (virus y transposones). como así también un efecto negativo provocando la extinción de una especie. De acuerdo al dogma central de la biología. que inducen varias clases de cambios heredables perjudiciales o benéficos y pueden ser: físicos (rayos ultravioleta. también lo hará la secuencia de aminoácidos en las proteínas formadas. sin embargo al cambiar dicha información. cromosómico y genómico MUTACIONES GÉNICAS O PUNTUALES Las mutaciones a nivel molecular son llamadas génicas o puntuales y afectan la constitución química de los genes cambiando la secuencia de nucleótidos (Tabla 3. En un ambiente heterogéneo o cambiante. una variación determinada puede darle a un individuo o a su progenie una ligera ventaja. pero desaparece en el momento en que muere el individuo en que se originó. Una mutación en una célula somática.3). los mutágenos. Podemos establecer dos grandes grupos de mutaciones en relación con el tipo de células en las que se producen: somáticas y germinales. no obstante. a la evolución de las mismas. Sin embargo. el ADN es una molécula estable que contiene la información genética. gamma). TIPOS DE MUTACIONES Las mutaciones pueden darse en tres niveles diferentes: molecular (génicas o puntuales). X. óvulos y espermatozoides. las mutaciones en las células germinales. pero se conocen varios agentes externos. Para resumir entonces:"Una mutación es un cambio heredable en el material genético de una célula". Si no existieran las mutaciones no existiría la gran biodiversidad planetaria. pueden generarse cambios en la secuencia de bases.

la porción que porta el centrómero une sus extremos rotos y forma un cromosoma anular(Fig. Ocurre un traslape de pares de nucleótidos complementarios de una zona del ADN a otra Deleción. que puede ser terminal o intercalar (Fig. Ocurre cuando se añade o agrega uno o más nucleótidos. Por ejemplo. Estas mutaciones pueden ocurrir por: Deleción.3 Mutaciones puntuales o génicas MUTACIONES CROMOSÓMICAS El cambio afecta a un segmento de cromosoma (mayor de un gen).GUÍA METODOLÓGICA DE BIOLOGÍA Sustitución. Tabla 3. por tanto a su estructura. Translocación. Es la pérdida de un segmento cromosómico. 3. Inserción. 3.14). 115 . Cuando ocurre en los dos extremos. Inversión. Donde debería haber un nucleótido se inserta otro.15). en lugar de la citosina (C) se instala una timina (T). Mediante dos giros de 180° dos segmentos de nucleótidos de hebras complementarias se invierten y se intercambian. Se pierde o elimina uno o más nucleótidos produciendo un error de lectura durante la traducción que conlleva a la formación de proteínas no funcionales.

Como consecuencia. 116 .16). Intercambio de segmentos entre cromosomas no homólogos. que puede ser o no recíproca (Fig. por lo que al fecundarse con el gameto contrario.GUÍA METODOLÓGICA DE BIOLOGÍA Inversión. Algunos tipos de translocaciones producen abortos tempranos.17).18). por lo que se altera el orden de los genes en el cromosoma (Fig. el producto resultante tendrá tres cromosomas 21. 3. los gametos de esa persona llevarán el cromosoma translocado más uno normal. al translocarse todo el cromosoma 21 a otro cromosoma como el 14 (14/21).15 Cromosoma anular Fig.17 Translocación Translocación. 3.16 Inversión Fig. 3. También se pueden formar portadores de trisomías como la del 21 (síndrome de Down). 3. 3. 3. Fig. Cuando un segmento cromosómico rota 180° sobre sí mismo y se coloca en forma invertida. 3. cuando la división del centrómero se produce según el plano transversal en vez de vertical. uno de los brazos del cromosoma original se pierde y los brazos del isocromosoma resultante son genéticamente idénticos entre sí pero en sentido inverso (Fig. Isocromosomas: Se origina durante la meiosis o mitosis.14 Deleción Fig.

café. Se pueden clasificar por el número de cromosomas que se tengan en: monoploidía o haploidía: si las células presentan un solo juego de cromosomas. manzana. 117 . Pueden ser: Euploidía Se da cuando la mutación afecta al número de juegos completos de cromosomas. lila y crisantemo. por ejemplo en alfalfa.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. afecta a todo el genoma. fruto o flor es económicamente importante. 3. no separándose ninguno de estos. Este tipo de mutaciones también recibe el nombre de aberraciones o variaciones cromosómicas. 3. Esto ha sido empleado en numerosas plantas cultivadas donde el tamaño de hojas. semilla. Aneuploidía Afecta al número de cromosomas individualmente y se debe al fenómeno de no disyunción ocurrido durante la meiosis cuando los cromosomas homólogos no se separan y ambos se incorporan a un mismo gameto (Fig. plátano. Los organismos poliploides generalmente son más grandes y vigorosos presentando habitualmente gigantismo.19). Son causadas por errores en la separación (disyunción) de los pares de cromosomas homólogos durante la meiosis. y poliploidía: si presentan más de dos juegos cromosómicos. tabaco. es decir.18 Isocromosomas MUTACIONES GENÓMICAS Son alteraciones en el número de los cromosomas propios de la especie. pera.

Asimismo. Monosomías La falta de un cromosoma produce una monosomía. de igual forma también habrá gametos que tendrán un cromosoma menos (Fig.GUÍA METODOLÓGICA DE BIOLOGÍA Si este gameto fecunda a otro se originará un cromosoma triplicado (trisomía). Otros síndromes son el triequis o metahembras (47. cuando fecunden a otro normal. pues el único cromosoma X que tienen está activado. donde sus células tienen un número anormal de cuerpos de Barr. 3.20 Trisomías y monosomías en cromosomas sexuales Fi Trisomías En el humano. XX + 21 ó 47. se presenta el síndrome de Turner (45. los cromosomas sexuales (gonosomas) pueden afectarse. XY + 21). XXY). En el humano. X). por ello.19 La no disyunción produce monosomías y trisomías g. 3. XXX) y la polisomía XYY (47. No presentan cuerpo de Barr como las mujeres normales. 118 .20) y. el individuo tendrá un cromosoma menos (monosomía). XYY). 3. Fig. como la trisomía del cromosoma 21 que produce el síndrome de Down (47. se pueden presentar a nivel de cromosomas somáticos (autosomas). como el caso delsíndrome de Klinefelter (47.

se detallan las características de algunas mutaciones que se pueden dar en la especie humana. boca pequeña. Síndrome de Down Síndrome de Edwars Síndrome de Patau Trisomía 21 Trisomía 18 Trisomía 13 ó 15 ALTERACIONES EN LOS CROMOSOMAS SEXUALES Síndrome de Klinefelter 44 autosomas + XXY Son varones estériles con rasgos femeninos. comportamiento antisocial y la espermatogénesis puede o no estar alterada.6 ¿CUÁLES SON LAS APLICACIONES MÁS IMPORTANTES DE LA GENÉTICA? Andrea es una chica de 40 años muy agraciada vive con su pareja que es Ricardo y planean tener un hijo. baja estatura. lesiones cardiacas. mentón huido. polidactilia. Infantilismo y escaso desarrollo de las mamas y los genitales externos. En la pubertad no menstrúan ni desarrollan caracteres sexuales secundarios. ALTERACIONES EN LOS AUTOSOMAS SÍNDROME TIPO DE MUTACIÓN CARACTERÍSTICAS Y SÍNTOMAS DE LA MUTACIÓN Los afectados tienen retardo mental en diferente grado. aspecto hombruno. conducta agresiva. atrofia de ovarios. altos y de conducta controversial. Son fértiles. los hombres son estériles. cráneo ancho y marcha lenta. párpados rasgados. Los afectados presentan estatura elevada. corazón defectuoso. bajo coeficiente intelectual. lengua salida. lesiones cardiacas. Son mujeres fértiles de apariencia normal pero con tendencia al retardo mental. cómo podrías ayudarlos? 119 . escaso desarrollo de las gónadas y retraso mental. acné. ¿Si ellos fueran tus amigos. Labio leporino. Anomalías en la forma de la cabeza.GUÍA METODOLÓGICA DE BIOLOGÍA A continuación. un tamaño mayor de dientes. 3. boca pequeña. Síndrome del duplo Y 44 autosomas + XYY Síndrome de Turner Síndrome de Triple X 44 autosomas + X 44 autosomas + XXX Mujeres con baja estatura. Las mujeres son fértiles y los transmiten al 50% de su progenie. personalidad infantil. dobleces característicos en el cuello y retardo mental moderado. solo que no se atreven debido a que en las familias de ambos hay antecedentes de Síndrome de Down.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD La anemia falciforme es una enfermedad que se debe a una mutación en un nucleótido del gen que tiene información para la fabricación de la hemoglobina. A partir del alelo mutado se generan moléculas de hemoglobina anormales. Secuencia de ARNm: Secuencia proteica: 120 . Utilizando la tabla del código genético escribe la secuencia de aminoácidos que se sintetiza a partir de la hebra inferior del ADN. La secuencia de ADN que se muestra a continuación pertenece al gen que tiene la información para fabricar un fragmento de la hemoglobina normal: GTGCACCTGACTCCTGAGGAG CACGTGGACTGAGGACTCCTC a.

alguna malformación congénita (alteración del desarrollo anatómico que se presenta durante la vida intrauterina y se manifiesta al nacimiento) o cualquier enfermedad. coordinados por un genetista. Val-His-Leu-Trip-Pro-Val-Glu Compara esta secuencia con la anterior y determina cuál es el nucleótido que sufrió la mutación responsable de la anemia falciforme ¿De los tres tipos principales de mutación que existen ésta es de tipo? _______________________ ¿Y a la vez a cual subtipo pertenece? ____________________________ ¿Qué sucedió? _____________________________________________________ CONSEJO GENÉTICO El Consejo Genético es el estudio que se realiza a través de la valoración clínica y estudios especializados para saber si existe riesgo de que en una familia se pueda repetir. El fragmento de proteína que figura a continuación pertenece a la hemoglobina falciforme. la práctica del asesoramiento o consejo genético es muy importante en la prevención de enfermedades hereditarias y síndromes con malformaciones congénitas (que se presentan al nacimiento). etc). Por lo que. psicólogos. Este Consejo Genético puede ser previo a/o después de. endocrinólogos. Para impartir consejo genético se deben tener en cuenta los aspectos médicos y psicológicos tanto del paciente como de su familia. 121 . El estudio deberá explicar cuál será la evolución del defecto de nacimiento o enfermedad por la que se consulta. dentro de una familia. dietético o de rehabilitación y. existe el antecedente de uno o más casos con alguna alteración que puede ser hereditaria y en relación con la cual se consulta. b.GUÍA METODOLÓGICA DE BIOLOGÍA Acuérdate que la hebra de ARNm obtenido a partir de “leer” la hebra inferior del ADN es de secuencia igual a la hebra superior. El equipo que lo imparte está conformado por varios especialistas (ginecoobstetras. informar sobre las medidas preventivas que pueden tomarse. El primero es aquel que se imparte antes del nacimiento de un niño afectado y el segundo es el que se da cuando. sobre el manejo terapéutico. independientemente de que la causa sea o no genética (hereditaria). trabajadores sociales. cirujanos. sobre todo. o bien presentarse por primera vez. sólo que en vez de T tiene U.

familias con parientes afectados.mx/algo_leer/Genoma. manipulación genética y tratamiento quirúrgico prenatal. Consistió en obtener la secuencia completa de más de 3. trasplantes de células. parejas con un hijo afectado. es de gran valor para el diagnóstico de algunas malformaciones fetales. Se estima que. y la ultrasonografía. en total. La fetoscopía. ACTIVIDAD Realiza la lectura del artículo que se encuentra en el siguiente link http://www.unam.000 millones de pares de bases del ADN del genoma humano. 122 . que permite ver al feto por medio del endoscopio. deben ser unos treinta mil genes. Al confirmar el diagnóstico se toman las medidas terapéuticas y preventivas requeridas. Entre estos procedimientos está la amniocentesis. aborto de repetición. detectándose cualquier anomalía cromosómica numérica o estructural. que utiliza ondas de sonido de alta frecuencia para producir una imagen del feto en una pantalla. administración de enzimas. Es importante hacer notar que para algunos cromosomas las investigaciones han resultado muy fructíferas.GUÍA METODOLÓGICA DE BIOLOGÍA Las causas más frecuentes para solicitar asesoramiento genético son: personas que sufren un padecimiento genético. Algunos trastornos genéticos se pueden descubrir antes del nacimiento por medio de una serie de pruebas que constituyen el diagnóstico prenatal. como es el caso del cromosoma X.alumno. consanguinidad y mismo grupo étnico.pdf. entre otras. posteriormente realiza un mapa conceptual sobre el proyecto del genoma humano. En los últimos años la localización de genes ha tenido un notable avance. codificada en 23 pares de cromosomas contenidos en cada una de las células del cuerpo. pues en 1990 ya se habían localizado más de 600. que consiste en tomar una muestra de líquido amniótico que se analiza por medio de un cariotipo. tales como restricciones dietéticas. PROYECTO GENOMA HUMANO El Proyecto Genoma Humano (PGH) se inició en 1988 y se concluyó en el 2004.

Pero conviene recordar que ha funcionado.GUÍA METODOLÓGICA DE BIOLOGÍA INGENIERÍA GENÉTICA Es un conjunto de técnicas cuyo objetivo principal es la creación de nuevas combinaciones genéticas basándose en la manipulación directa del ADN. Mediante el cruce sexual. Con ello se pretende obtener productos cuyas características respondan más adecuadamente a las exigencias del productor o del consumidor. Se trata por lo tanto de una técnica basada en el azar en la que la probabilidad de encontrar la combinación genética adecuada es muy baja. Por contra. a partir del genoma de un individuo 123 . Esta denominación se utiliza sólo en España. En estas. ya que desde la antigüedad el hombre viene modificando el patrimonio genético de animales o plantas para crear nuevas razas de animales o variedades vegetales cuyo rendimiento industrial sea más adecuado. los ganaderos han obtenido durante siglos nuevas razas de vacuno que produjeran más leche y los agricultores han conseguido variedades vegetales de mayor interés agronómico. Daniel Ramón. ACTIVIDAD ESPECÍFICA: TRANSGÉNICOS Analiza el siguiente artículo cuestionando para qué y cómo puedes utilizar los organismos transgénicos y qué repercusiones pueden tener en ti el consumirlos. y como comentamos al principio. Al llevar a cabo estos cruces. Los alimentos transgénicos no representan algo nuevo. los mejoradores combinan de forma aleatoria los miles de genes de los genomas de dos cepas parentales intentando encontrar un genoma resultante que reúna los genes beneficiosos de ambos progenitores. Valencia. en el diseño de los alimentos transgénicos se utilizan técnicas de ingeniería genética. ya que en el resto de países de nuestro entorno se les incluye dentro del término más amplio de "nuevos alimentos" (en inglés "novel foods"). Realiza un ensayo al respecto. Fecha de Publicación: Abril de 1999 Alimentos transgénicos: objetivos y valores Alimento transgénico es aquel en cuyo diseño se han utilizado técnicas de ingeniería genética. y que la inmensa mayoría de alimentos animales o vegetales de nuestra dieta están constituidos por especies obtenidas mediante esta estrategia. Director del Instituto Agroquímica y Tecnología de Alimentos IATA-CSIF. Prof. considerando los aspectos bioéticos.

GUÍA METODOLÓGICA DE BIOLOGÍA

donador se aísla el gen que interesa expresar, se modifica in vitro y se introduce, ya sea en el genoma del propio individuo, ya sea en el genoma de un organismo receptor que puede ser un animal, un vegetal, o un microorganismo. Recordemos que el término transgénico hace referencia a la expresión de un gen proveniente de una especie de forma distinta. Así, sólo aquellos alimentos transgénicos en los que se hayan expresado genes de otras especies tendrían una denominación correcta. Las diferencias entre los alimentos de la biotecnología tradicional y los alimentos transgénicos son sólo técnicas. Por un lado, las técnicas de ingeniería genética son mucho más precisas que el cruce sexual, por lo tanto se pueden obtener resultados mucho más adecuados en un menor tiempo. Además, la ingeniería genética implica direccionalidad, o lo que es lo mismo, mayor control sobre el producto final frente al azar del cruce sexual. Finalmente, son mucho más potentes al permitir transferir genes de una especie a otra, o incluso de un reino a otro. Sin duda, esta última característica tiene repercusiones de índice ético o social. Se han comercializado unos pocos alimentos transgénicos, aunque muchos otros están en fase de experimentación o comercialización. Pueden ser transgénicos que portan múltiples copias del gen de la hormona de crecimiento de la trucha y ganan tamaño mucho más rápido con el consiguiente beneficio para el productor. La ingeniería genética permite expresar determinados genes en determinados tejidos. Así, se han expresado genes que codifican proteínas de alto valor añadido en la glándula mamaria de diferentes mamíferos. Son fármacos de alto valor añadido como el activador del plasminógeno o el factor antihemofílico, con lo que un rebaño de tamaño medio podría producir la suficiente cantidad de estos productos para poder atender la demanda de todos los enfermos actuales durante un año. Un beneficio espectacular para el consumidor. También se han aplicado técnicas de ingeniería genética en el caso de los alimentos fermentados. Se han construido bacterias lácticas o levaduras transgénicas que portan genes de otros organismos. Los resultados son quesos en los que es posible controlar, e incluso acortar, los tiempos de maduración sin pérdida de calidad, o vinos con un incremento de aroma afrutado, una característica organoléptica muy apreciada por el consumidor centroeuropeo. Basta echar un vistazo a los periódicos nacionales durante los últimos tres meses para comprender que, a pesar de sus enormes posibilidades, existe un debate social en torno a la comercialización de los alimentos transgénicos. Los miedos asociados a su ingesta son mucho mayores que los asociados al uso de cualquier otro producto de la ingeniería genética. ¿Por qué? Podemos encontrar varias razones pero la más importante es que con los alimentos transgénicos el consumidor siempre tiene la opción de escoger. Podemos decidir entre
124

GUÍA METODOLÓGICA DE BIOLOGÍA

consumir tomate transgénico o uno convencional, pero no sobre inyectarnos insulina transgénica, ya que no existe la alternativa contraria. A este hecho sumemos que alimentación es algo más que la necesidad fisiológica de obtener energía: alimentación es cultura. En este contexto deben entenderse todos los recelos en torno a la ingesta de estos productos. ¿Cual es la situación actual? Hay una disputa entre dos polos: las compañías multinacionales productoras y los grupos de presión (fundamentalmente organizaciones ecologistas) con sus mensajes contrarios. Esta controversia unida a la falta de divulgación científica adecuada confunden al consumidor que se pregunta: ¿son seguros los alimentos transgénicos? Desde un punto de vista científico la respuesta es clara: son al menos tan seguros como aquellos convencionales de los que proceden. Partamos de la base en que en alimentación, como en cualquier otra faceta de la vida, es imposible hablar de riesgo cero. Por eso los riesgos deben definirse por comparación con situaciones conocidas. Todos los alimentos transgénicos han tenido que pasar una serie de pruebas de laboratorio encaminadas a demostrar su inocuidad sanitaria. Como ejemplo baste decir que la compañía productora del tomate FlavrSavt TM, el primer alimento transgénico comercializado, tardó cuatro años en realizar todas las pruebas exigidas por la agencia estatal FDA (Food and DrugAdministration) hasta obtener el permiso de comercialización. Así ha sido con todos los alimentos que se han comercializado hasta la fecha, y así seguirá siendo, ya que la legislación americana y europea lo contempla. Las pruebas requeridas se basan en determinar la composición nutricional del alimento transgénico y detectar su posible alergenicidad o toxicidad. Todas estas pruebas no se exigen al resto de alimentos, aunque así debiera ser. Desde distintos frentes se ha postulado el riesgo que para el medio ambiente supone la construcción de estos alimentos, sobre todo la de los vegetales transgénicos. A menudo se habla de la posible transferencia de los genes exógenos desde la variedad transgénica a variedades silvestres. Esta transferencia se produce frecuentemente en la Naturaleza, en algunas especies convencionales más que en otras. Por eso podemos afirmar que, por ejemplo en Europa, la transferencia de genes es imposible si utilizamos maíz transgénico y probable si utilizamos soja transgénica. Resulta por lo tanto evidente que el control sobre este tipo de experimentos debe ser riguroso. Y de hecho así lo es al deberse aplicar las distintas reglamentaciones que legislan al respecto. En 1992, el Gobierno estadounidense declaró a través de la FDA que no necesitaba desarrollar una legislación especial para los alimentos transgénicos, al considerar que la existente para la comercialización de variedades obtenidas por métodos genéticos convencionales cubría todos los aspectos necesarios. Conviene destacar que con ello el legislador americano decidió

125

GUÍA METODOLÓGICA DE BIOLOGÍA

evaluar sólo el producto final en cuanto a su inocuidad sanitaria, obviando la técnica usada (cruce sexual vs ingeniería genética) para su diseño. La Comunidad Europea sin embargo decidió desarrollar una legislación específica para estos productos que considera tanto el alimento final como las técnicas utilizadas. El pasado mes de Julio se aprobó el Reglamento para la comercialización de los nuevos alimentos, que entre otros, incluye los alimentos transgénicos. En esta normativa se diseña un entramado burocrático por el que cada alimento transgénico deberá superar antes de su comercialización la aprobación por parte de un comité de expertos científicos nombrado por la Comisión Europea, así como el visto bueno de comités de cada uno de los países miembros. En Japón o Canadá también disponen de legislación para la comercialización de los alimentos transgénicos bastante similar, en cuanto a la aprobación por parte de comités, a la europea. Una de las cuestiones más consideradas en la reglamentación europea es la del etiquetado. ¿Deben ser etiquetados los alimentos transgénicos? Esta cuestión implica una pelea por intereses. Las compañías productoras son, en general contrarias a dicho etiquetado ya que temen una bajada en las ventas. Pero el consumidor tiene todo el derecho a estar informado. Las autoridades americanas han decidido etiquetar sólo aquellos alimentos transgénicos cuya composición varíe con respecto al convencional equivalente, o aquellos que contengan genes de reserva ética (un gen de animal expresado en un vegetal con el consiguiente problema para los vegetarianos), organismos modificados genéticamente vivos (un yogurt producido con una bacteria láctica transgénica), o la aparición en su composición de un producto con un efecto tóxico probable en una subpoblación (aparición de fenilalanina y riesgo para la fenilcetonúricos). La legislación europea es muy similar, pero ha sido objeto de un amplio debate, de forma que en estos momentos se prevé la modificación de dicho reglamento en lo concerniente al etiquetado y se prevé la obligatoriedad del etiquetado para todos los alimentos transgénicos. Curiosamente algunas compañías han decidido asumir, sin necesitarlo, el riesgo del etiquetado. Por ejemplo, Zeneca en Inglaterra decidió etiquetar una sopa obtenida a partir de tomates transgénicos, a pesar de la decisión del gobierno británico que le eximía del mismo. Acompañaron esta decisión con una campaña publicitaria explicando al consumidor la modificación genética introducida en el tomate transgénico, y el producto se ha vendido sin problemas. En este mismo país algunas cadenas de supermercados han anunciado públicamente que etiquetarán todos los alimentos transgénicos que se vendan en sus estanterías, independientemente de que así lo determinen los comités pertinentes. En resumen, el etiquetado es una cuestión de defensa e información del consumidor. La etiqueta es exigible, pero la etiqueta debe ser informativa. Y para ser informativa hace falta introducir al consumidor en términos como biotecnología, ingeniería genética y nutrición.
126

GUÍA METODOLÓGICA DE BIOLOGÍA

Se han realizado encuestas en varios países como Estados Unidos y Japón, así como en varios estados miembros de la Comunidad Europea. En general, los europeos somos los menos proclives a la comercialización de los alimentos transgénicos, aunque existen distintos criterios. Los países nórdicos, Austria y Luxemburgo, mantienen las posturas más contrarias. Existen una serie de criterios comunes entre todos los encuestados que se pueden resumir en: a) el consumidor acepta en mayor grado los alimentos transgénicos de origen vegetal y fermentado, y en mucha menor medida los de origen animal; b) se muestran más proclives a aceptar los alimentos transgénicos cuyo diseño favorece al consumidor, y menos los que favorecen al productor, y c) hay una exigencia mayoritaria del etiquetado. Los alimentos transgénicos son una realidad incuestionable. Los científicos que trabajamos en estos temas no podemos obviar sus claras repercusiones sociales y debemos hacer frente a nuestra obligación de informar a la sociedad sobre sus presuntos riesgos y sus enormes posibilidades.

RUBRICA PARA EVALUAR PORTAFOLIO DE EVIDENCIAS Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Asignatura:

PONDERACIÓN CRITERIOS EXCELENTE (4) MUY BIEN (3) BIEN (2) DEFICIENTE (1) PUNTAJE

Presentación del portafolio

Identifica y selecciona de una forma clara y detalla las actividades realizadas.

Identifica y selecciona parcialmente de una forma clara y detallada las actividades realizadas. El nivel de expresión escrita es clara pero no fundamental para su comprensión Utiliza información fundamental en ideas y argumentos sin un criterio

Identifica pero no selecciona de una forma clara y detalla las actividades realizadas. El nivel de expresión escrita es poco clara y no fundamental para su comprensión Utiliza información fundamental en ideas sin argumentos sin un

No identifica ni selecciona de una forma clara y detallada las actividades realizadas. El nivel de expresión escrita no es clara ni fundamental para su comprensión. Utiliza información sin ningún fund, ideas ni argumentos y sin un criterio

El nivel de expresión escrita es Redacción clara y clara y fundamental comprensiva para su comprensión. Inclusión de información diversa seleccionada Utiliza información fundamental en ideas y argumentos con un criterio

127

GUÍA METODOLÓGICA DE BIOLOGÍA
actual, y con criterio Equilibrio entre la información aportada procedente de fuentes externas, del profesor y la propia adecuado a su nivel adecuado a su nivel. Informa y aporta ideas propias relacionándolas con fuentes externas y las del profesor. Integra y relaciona todas las actividades y actúa con coherencia a la hora de organizar el portafolios Informa y aporta ideas propias sin relacionarlas con fuentes externas y con las del profesor. Integra y relaciona todas las actividades pero no actúa con coherencia a la hora de organizar el portafolios Selecciona actividades complementarias y optativas sin capacidad para decidir lo que se va a evaluar. Aporta contenidos, e ideas, sin sugerencias propias que lo hagan distinto del resto de sus compañeros. Asiste y participa en clase, realiza tareas complementarias sin adquirir un compromiso personal con la asignatura para lograr una buena evaluación. criterio adecuado a adecuado a su su nivel. nivel. .informa pero no aporta ideas ni las relaciona con fuentes externas ni con las del profesor No informa ni aporta ideas relacionadas con fuentes externas y con las del profesor No integra ni relaciona las actividades ni actúa con coherencia a la hora de organizar el portafolios No selecciona actividades complementarias ni optativas con capacidad para decidir lo que se va a evaluar. No aporta contenidos ideas ni sugerencias propias que lo hagan distinto del resto de sus compañeros Asiste pero no participa en clase ni realiza tareas complementarias, ni adquiere un compromiso personal con la asignatura para lograr una buena evaluación.

Organización e integración del portafolios

Integra pero no relaciona todas las actividades ni actúa con coherencia a la hora de organizar el portafolios Selecciona pocas actividades complementarias y optativas sin capacidad para decidir lo que se va a evaluar Aporta pocos contenidos ideas y sugerencias propias que lo hagan distinto del resto de sus compañeros Asiste y participa en clase, sin realizar tareas complementarias ni adquiriendo un compromiso personal con la asignatura para lograr una buena evaluación.

Selecciona actividades Selección de complementarias y actividades optativas con complementarias y capacidad para optativas decidir lo que se va a evaluar. Aportación de contenidos, ideas y sugerencias propias en las actividades Aporta contenidos, ideas, y sugerencias propias que lo hacen distinto del resto de sus compañeros. Asiste y participa en clase, realiza tareas complementarias adquiriendo un compromiso personal con la asignatura logrando una buena evaluación

Implicación, participación y compromiso

Total
REFERENCIAS: (Núñez Chan, 2002)

CLONACIÓN La clonación es la acción de reproducir a un ser de manera perfecta en el aspecto fisiológico y bioquímico de una célula originaria, es decir que, a partir de una célula de un individuo se crea otro exactamente igual al anterior. Un clon es el conjunto de individuos que desciende de otro por vía vegetativa o asexual. La clonación existe en la naturaleza paralelamente a la reproducción sexual. Los descendientes de los microorganismos que iniciaron la vida, eran idénticos a sus padres.

128

GUÍA METODOLÓGICA DE BIOLOGÍA

En 1997, IanWilmut, anunció que había clonado una oveja llamada Dolly. Esta oveja se convirtió en el primer mamífero clonado. En la clonación de Dolly se obtuvo un óvulo de oveja, se elimina su núcleo, se sustituye por un núcleo de célula de oveja adulta procedente del tejido mamario y se implanta en una tercera oveja que sirve como mamá de "alquiler" puesto que será la que lleve el embarazo (Fig. 3.20).

TERAPIA GÉNICA Es un tratamiento que reemplaza genes defectuosos por otros sanos. En el futuro, las enfermedades hereditarias podrán detectarse y curarse a tiempo gracias a este procedimiento. En 1990, se inició el primer estudio clínico de terapia génica humana, con una niña que recibió una transfusión de leucocitos procesados mediante ingeniería genética, para contener el alelo normal; en la actualidad la niña tiene un sistema inmune funcional En 1994 se iniciaron estudios experimentales para combatir la fibrosis quística, una enfermedad pulmonar hereditaria. Con técnicas de ingeniería genética se incluyó en un virus el gen normal. El virus se introdujo en los pulmones por medio de un aerosol bucal para que penetrara a las células que con esta información pudieran sintetizar la proteína que al faltar produce la enfermedad.

Fig. 3.20 Clonación de la oveja Dolly

129

se purifica y se transforma en un medicamento inyectable.biotecnologica. y también en el adulto. músculo cardíaco y esquelético. es decir. Disponible en http:///www. CÉLULAS MADRE Célula madre o stemcell se define como una célula progenitora.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD: LECHE CURATIVA El propósito de esta actividad es identificar los avances de la manipulación genética. 3. y son capaces de generar todos los diferentes tipos celulares del cuerpo. Células madre órgano-específicas ó multipotenciales. El ADN de las vacas se ha modificado para que generen leche con el precursor de la insulina. capaz de regenerar uno o más tipos celulares diferenciados. ¿Crees que esta técnica sea mejor que las anteriores?. Así. retina. También existen en más órganos como piel. páncreas. se clasifican en dos grupos: Células madre embrionarias ó pluripotenciales que derivan de la masa celular interna del blastocisto del embrión (7-14 días). Elabora una conclusión con base en la lectura y en tus respuestas. De él se extrae una molécula idéntica a la del ser humano. grasa subcutánea. mediante un proceso químico. que pueden generar todos los tipos celulares de la sangre y del sistema inmune. Fuente: “Vacas clonadas para producir insulina”. etc. Investiga cómo se obtenía anteriormente la insulina y responde las siguientes preguntas en tu cuaderno. Se cultivan tanto en in vitro (en el 130 . es muy rentable: con ella. se ha conseguido que el fármaco final sea igual a la hormona que los humanos sanos producen naturalmente. capaces de originar las células de un órgano concreto en el embrión. Consultado el 6 de julio de 2010. Un ejemplo de células madre órgano-específicas. Lee con atención la siguiente noticia Científicos argentinos han creado una vaca transgénica que produce insulina en su leche. sólo en Argentina los precios de la insulina bajarían 30%. autorenovable. ¿Por qué? 4. ¿Si fueras diabético usarías insulina con este origen? 5.com/vacas-clonadas-para-producir-insulina/(Adaptación) 2. cerebro. 1. Y además. En animales superiores. es el de las células de la médula ósea.

Pueden aparecer nuevos microorganismos patógenos que causen enfermedades desconocidas. La ética y las leyes no han avanzado al mismo ritmo que la ciencia. por lo que es imperioso el desarrollo de la Bioética y de una legislación adecuada para que estos nuevos conocimientos generen un desarrollo positivo y no se conviertan en una forma de control y exterminio. y dar lugar a otros tipos celulares que hasta ahora se pensaba que eran incapaces de generar. En la línea germinal se pide su prohibición en todo aquello que sea recomponer un programa genético humano. como in vivo (en un modelo animal) utilizándolas en la reparación de tejidos dañados. y que los organismos internacionales creados para ello sean capaces de vencer las reticencias que crean los intereses políticos y económicos. Al liberar nuevos organismos en el ambiente puede provocarse la desaparición de especies contra las que se lucha. Frente a los múltiples beneficios que ofrece este campo. que recoja las voces razonables de todos los sectores sociales.GUÍA METODOLÓGICA DE BIOLOGÍA laboratorio). Es decir. Se ha comprobado que células madre de adulto pueden reprogramarse (transdiferenciarse). logrando una legislación adecuada y justa. o que el uso de fármacos de diseño provoque efectos secundarios no deseados. con consecuencias aún 131 . ya no serían multipotenciales. Por todo ello. A pesar de todo. la aplicación de estas técnicas de trasferencia de células madre de adulto para el recambio y reparación de tejidos enfermos está todavía en sus comienzos. se encuentran algunos problemas que causa la aplicación de la Ingeniería Genética: Sanitarios. es preciso que los conocimientos y avances en Ingeniería Genética se consideren patrimonio de la humanidad. Los trabajos con embriones humanos con fines puramente experimentales se consideran un atentado a la dignidad de la especie humana. Ecológicos. IMPLICACIONES BIOÉTICAS EN LA GENÉTICA Los avances vertiginosos de la genética y otras ciencias nos hacen preguntarnos si el ser humano está listo para manejarlos correctamente. si no pluripotenciales.

El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral. Puntos 20 Puntos 40 Puntos 80 Puntos 100 Aspectos a mejorar : Estratégico Analiza las aplicaciones actuales de la genética mediante la investigación y elaboración de un ensayo crítico y reflexivo. Éticos y morales. Las aplicaciones de la biotecnología en el campo de la producción industrial. ya que cumplen una función en la cadena trófica de la naturaleza. de un ensayo. agrícola y ganadera. Criterios Analiza las aplicaciones actuales de la genética mediante la investigación y elaboración de un ensayo.GUÍA METODOLÓGICA DE BIOLOGÍA desconocidas. Se puede pensar en posibles nuevas contaminaciones debidas a un metabolismo incontrolado. Sociales y políticos. Ponderación Logros: MATRIZ DE VALORACIÓN DE COMPETENCIAS Pre-formal Receptivo Resolutivo Autónomo Analiza las Analiza las Investiga las aplicaciones Analiza las aplicaciones aplicaciones actuales de la aplicaciones actuales de la actuales de la genética actuales de la genética genética sin mediante la genética mediante una la investigación mediante la investigación elaboración y la investigación muy de un elaboración y elaboración completa y ensayo. pueden crear diferencias aún más grandes entre países ricos y pobres. de un de un ensayo. En el campo de la Terapia Génica es defendible este procedimiento cuando se utilice en células somáticas para corregir enfermedades. Puntos 100 EVALUACIÓN 132 . y atenta contra la intimidad a que tiene derecho toda persona. por ejemplo. La experimentación en la especie humana puede atentar contra su misma dignidad. elaboración resumen.

pp. Ana. 2ª. Biología. México. (2006). 133 . (2006). T.GUÍA METODOLÓGICA DE BIOLOGÍA DIAGNÓSTICA Examen diagnóstico Lluvia de ideas ACTIVIDADES DE APRENDIZAJE: • Problemario • Actividades de la Guía metodológica • Línea de Tiempo • Cariotipo y diagnóstico • Investigación documental • Ensayo • V de Gowin de actividades experimentales ACTIVIDAD ESPECÍFICA: • Portafolio de evidencias Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad FORMATIVA SUMATIVA 30% 20% 20% 30% BIBLIOGRAFÍA BÁSICA De Erice E. 704. E. SEP/Libros del Escarabajo. Granillo. Editorial McGraw Hill. Ciencia y Naturaleza. (2002). El Gran Libro de los Genes y el ADN.E. P. B. Los Transgénicos. Editorial Publicaciones Culturales. Colección Astrolabio. Biología. La ciencia de la vida. 3ra. Editorial Prentice Hall. Principios de Biología. Walter. y González A. Editorial Limusa Willey.Edición. pp. B. S. (2004). Biología. Colección Espejo de Urania. Valdivia. México. SEP/Usborne. México. SEP/Altea. BIBLIOGRAFÍA COMPLEMENTARIA Claybourne. 399. Audesirk. La Vida y sus Procesos. México. Colección Espejo de Urania. Edición. pp. 1ª. Nelson. Gideon E. México. G y Byers. Audesirk. Villarreal M. 407. R. México. (2004). Reimpresión de la Segunda Edición. (2009). (2008). Genes y ADN. Gómez Roig.

R.html Proyecto Biósfera.org My Heritage http://www. http://recursos. La Clonación 1.es/genealogia Genograma http://chato. Facultad de Ciencias. México. Colección Astrolabio.myheritage. México.org/esp/genomica/index.cnba.cnice. Jeremy (2003). (1997). UNAM.cl/blog/2001/01/genograma_arbol_genealogico.es/biosfera/ Embryos http://www. Gómez Roig. Facultad de Química. México. SEP/Planeta. VIDEOS RECOMENDADOS • Película GATACA • Película La Isla TIC’s Action Bioscience http://actionbioscience. Colección Espejo de Urania.embryos.mec. E.h tm 134 . (2000). R. Laboratorio de Historia de la Biología y Evolución. Genética para el Futuro.GUÍA METODOLÓGICA DE BIOLOGÍA Cherfas.botanica. SEP/Libros del Escarabajo. Colección Esto es Química ¿y qué?. El Genoma Humano.ar/Pakete/Dibulgeneral/LasMutaciones/Mutaciones. Noguera Solano. (2003). H.uba. y Ruiz Gutiérrez.html Mutaciones http://www. García. Universidad Nacional Autónoma de México.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 4 Evolución de los Seres Vivos 135 .

Obtiene. Explica las distintas teorías sobre el origen de la vida.4. 5. registra y sistematiza la información para responder a la pregunta de carácter científico.2. Estructura ideas y argumentos de manera clara. Asume una postura de respeto hacia los diferentes puntos de vista. Analiza. Ilustra las ideas de Lamarck. Argumenta las distintas teorías evolutivas. Interpreta un mapa mental de las evidencias de la evolución. reflexiona y compara los cambios genéticos que se han manifestado en los seres vivos como origen de la biodiversidad a través de una línea del tiempo. SABERES Procedimentales Redacta una reseña sobre el video proyectado.3 Asume una actitud constructiva. interculturalidad y creencias. Declarativos Analiza el concepto de evolución de los seres vivos mediante el video “Darwin y el árbol de la vida”. • CRITERIOS DE DESEMPEÑO Argumenta las diferentes teorías acerca del origen de la vida mediante una investigación documental. Darwin-Wallace y Neodarwinismo en equipo mediante un cartel. 6. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. 7. Argumenta las características de las diferentes teorías evolutivas para determinar los factores que influyen en los cambios genéticos con base en la adaptación de las especies mediante la elaboración de carteles. Actitudinales/V alorales Participa de forma colaborativa en equipos diversos. • • 136 .GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE: EVOLUCIÓN DE LOS SERES VIVOS TIEMPO: 18 hrs UNIDAD DE COMPETENCIA: Investiga las principales teorías sobre el origen y evolución de los seres vivos para explicar la diversidad. Rectifica preconcepciones personales o comunes sobre diversos fenómenos naturales a partir de evidencias científicas. 8. COMPETENCIAS Genéricas/Atributos Disciplinares 5. Reflexiona las implicaciones de la actividad humana como un aspecto modificante en la evolución de los seres vivos. que han manifestado a través del tiempo. Diseña una línea de tiempo sobre la evolución de una especie. 6. consultando fuentes relevantes y realizando experimentos pertinentes. a través de la comparación de los cambios genéticos. coherente y sintética.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. Debate en forma grupal el tema expuesto en equipo sobre las teorías del origen de la vida. Debate en forma grupal el tema expuesto en equipo sobre las teorías evolutivas. Evalúa argumentos y opiniones e identifica prejuicios y falacias.

Artículos de divulgación en revistas científicas. Escribe 5 palabras que se te vienen en mente al leer la palabra “Evolución” ________________________________________________________________ ________________________________________________________________ 2. ¿Existen pruebas de que la evolución existe? ¿cuáles? ________________________________________________________________ ________________________________________________________________ 137 . • • • • • • ESTRATEGIAS DE APRENDIZAJE Exposición Debate Mapa mental Cartel Ejercicios de Guía metodológica Línea de tiempo • • • • • • • • • RECURSOS DIDÁCTICOS Guía metodológica Video “Darwin y el árbol de la vida”. Libros y Revistas electrónicas.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • • • • • • Lluvia de ideas Análisis de medios Clase Magistral Debate Base orientadora de la acción (BOA) Asesoría metodológica y temática del bloque. Ilustraciones y animaciones. Escribe 3 personajes relacionados con la evolución ________________________________________________________________ ________________________________________________________________ 4. Pintarron. Equipo multimedia • • EVIDENCIAS Y/O PRODUCTOS Actividades de la guía didáctica del alumno Cartel sobre las ideas de Lamarck. Plumones. Presentaciones en Power Point. ¿Evolucionan todas las cosas? ________________________________________________________________ 3. Darwin-Wallace y Neodarwinismo en equipo Mapa mental de las evidencias de la evolución Línea de tiempo sobre la evolución de una especie • • EXPLORANDO TUS CONOCIMIENTOS 1.

GUÍA METODOLÓGICA DE BIOLOGÍA 138 .

sin ella no es posible entender las propiedades distintivas de los organismos. A través de los años han surgido diversas teorías que tratan de explicar cómo surgió la vida en nuestro planeta y cómo ésta ha cambiado a través del tiempo. la ciencia y para nuestra comprensión del mundo. crecientes. de hecho.9% de las especies que han existido alguna vez sobre la Tierra están actualmente extintas. 4. la evolución biológica es un cambio en las propiedades de las poblaciones de organismos que va más allá de su vida individual. 139 . la evolución consiste en una serie de cambios que se presentan a lo largo del tiempo involucrando a todo cuanto existe y es objeto de estudio por parte de la ciencia. desde cambios sutiles en la proporción de diferentes alelos dentro de una población (tal como los que determina el grupo sanguíneo) hasta las alteraciones sucesivas que marcan el desarrollo desde el organismo más primitivo hasta los seres vivos más complejos. más crucial actualmente para el bienestar humano. La evolución es el gran principio unificador de la Biología.1 ¿QUÉ ES LA EVOLUCIÓN BIOLÓGICA? En el sentido más amplio. ni las relaciones de mayor o menor proximidad que existen entre las distintas especies. Así entonces. una de las más antiguas en filosofía. La evolución biológica puede ser imperceptible o trascendente. sólidamente conectadas y fácilmente disponibles en museos. El 99.GUÍA METODOLÓGICA DE BIOLOGÍA 4. de una generación a otra. con unos pocos supervivientes. ¿CÓMO SE ORIGINÓ LA VIDA? La cuestión sobre el origen de la vida y por ende de los seres vivos es. todo lo que existe en el universo es objeto de su propio proceso evolutivo. La evolución es un concepto asombroso y convincente.2. Los cambios evolutivos son aquellos que se heredan a través del material genético. y en un cúmulo de estudios científicos evaluados por expertos de todo el mundo. La historia de la vida es una historia de extinción y muerte. Las pruebas que la sustentan son abundantes. libros y revistas. Desde esta perspectiva. sus adaptaciones al medio ambiente.

en trabajo por equipo. Abiogenistas Biogenistas Siglo II Siglo XVII Siglo XVIII Siglo XIX Siglo XX 140 . teoría (experimento) y fundamento en la fecha correspondiente en el lado que corresponda a la corriente ideológica de la teoría. autor.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – EL PENSAMIENTO DEL ORIGEN DE LA VIDA A TRAVÉS DEL TIEMPO Realiza una investigación documental acerca de las 4 teorías más relevantes acerca del origen de la vida y a partir de ésta. completa la siguiente línea del tiempo anotando el año.

141 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – TEORÍAS SOBRE EL ORIGEN DE LA VIDA A partir de la investigación documental elabora por equipo un mapa mental de los experimentos de las teorías que explicaron el origen de la vida. Posteriormente preséntalo en plenaria grupal.

carbohidratos y ácidos nucléicos) escribe una fórmula condensada. proteínas. En las biomoléculas (lípidos. Escribe los símbolos y fórmulas correspondientes en orden de evolución.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – LA EVOLUCIÓN QUÍMICA 1. 142 . Lípidos Proteínas Carbohidratos Ácidos nucleícos Alcoholes Ácidos grasos Aminoácidos Monosacáridos Bases nitrogenadas Ácido fosfórico Hidrocarburos Formaldehido Ácido cianhídrico Metano Agua Amoníaco Carbono Hidrógeno Oxígeno Nitrógeno 2. Convierte el siguiente esquema en fórmulas químicas correspondientes a cada átomo o molécula que se describe.

GUÍA METODOLÓGICA DE BIOLOGÍA 143 .

pero dotada ya de la maquinaria necesaria para realizar la transcripción y la traducción genética. urcariotas y bacterias Durante un período de más de 2. por lo que se puede pensar que se adaptaron a vivir en todos los ambientes posibles y "ensayarían" todos los posibles mecanismos para realizar su metabolismo. la teoría más aceptada en la actualidad es que: 144 . Responde las siguientes preguntas ¿Qué relación existe? ___________________________________________________________________________________ ___________________________________________________________________________________ __________________________________________________________________________ ¿Cuál fue la tendencia de esta evolución molecular? ___________________________________________________________________________________ _____________________________________________________________________________ 4. Así. solamente existieron estas formas celulares. De este tronco común surgirían en la evolución tres modelos de células procariontes: arqueas. La evolución celular se produjo en estrecha relación con la evolución primitiva de la atmósfera y de los océanos terrestres.3 ¿CÓMO SE ORIGINARON LAS CÉLULAS EUCARIONTES? Carl Woese en 1980 denominó protobionte o progenote al antepasado común de todos los organismos actuales (eubiontes) y representaría la unidad viviente más primitiva.GUÍA METODOLÓGICA DE BIOLOGÍA 5.000 millones de años.

La incorporación intracelular de estos primitivos procariontes a la primitiva célula urcariota. Estas formas celulares tienen organización procarionte y son de pequeño tamaño. A partir de ellas. 4. tuvo como origen la liberación de O2 y por tanto la transformación de la atmósfera reductora en la atmósfera oxidante que hoy conocemos. Lynn Margulis. englobaría (fagocitosis) a otras células procarióticas más pequeñas que tuvieran estructuras primitivas para metabolizar el CO2 atmosférico. como un proceso de nutrición autótrofa. le proporcionaría dos características fundamentales de las que carecía: • La capacidad de un metabolismo oxidativo. 145 . Se iniciaba así la fotosíntesis. en su teoría endosimbiótica (fig. El empleo del agua en la fotosíntesis como donante de electrones. Empezó una revolución del oxígeno que causaría la muerte de muchas formas celulares para las que fue un veneno.1 y 4. utilizarían como alimento las moléculas orgánicas presentes en el medio (sopa primigenia). esta primitiva célula en un momento dado. lo que dio lugar a la respiración aerobia. lo que le permitió aumentar de tamaño. propone que se originaron a partir de una primitiva célula procarionte. otras se adaptarían a su presencia y algunas otras aprendieron a utilizarlo para sus reacciones metabólicas.2). que perdió su pared celular. con lo cual la célula anaerobia pudo convertirse en aerobia. podría haber ocurrido una especie de “primera crisis ecológica” a nivel molecular.. TEORÍA ENDOSIMBIÓTICA El siguiente paso en la evolución celular fue la aparición de las eucariontes hace unos 1.500 millones de años. Algunas células “aprendieron” a fabricar las moléculas orgánicas mediante la fijación y reducción del CO2. Como estas moléculas terminarían por agotarse. realizando una nutrición heterótrofa aerobia. si no hubiera sido porque en algún momento de la evolución celular.GUÍA METODOLÓGICA DE BIOLOGÍA Las primeras células serían heterótrofas anaerobias. se piensa que evolucionaron las células eucariontes. y otras capaces de absorber la luz solar e iniciar el proceso fotosintético estableciéndose de esta manera una relación endosimbiótica conocida con el nombre de urcariota..

Esquema de la posible secuencia de eventos que originaron a las diversas células eucariontes Fig. 4. Para comprender mejor esta teoría es pertinente definir el término simbiosis.1. Se trata de una asociación prolongada de individuos (coexistencia) de diferente clase en una unidad morfológica con ventajas mutuas y significativas. 4. el término endosimbiosis se refiere a una relación simbiótica al interior de la célula. con algunas particularidades metabólicas que no se encontraban en los individuos separados y esta asociación se transmite de generación en generación.2 Proceso de Endosimbiosis 146 . Fig.GUÍA METODOLÓGICA DE BIOLOGÍA • La posibilidad de realizar la fotosíntesis y por tanto ser un organismo autótrofo capaz de utilizar como fuente de carbono el CO2 para producir moléculas orgánicas. Por tanto.

Poseen ADN circular al igual que las bacterias actuales. componentes esenciales para su duplicación independiente del núcleo celular. Estos organelos poseen ADN. tienen dimensiones y morfología parecidas a la de las bacterias. 147 . La importancia de estas observaciones radica en sugerir que estos organelos fueron organismos unicelulares capaces de autoreplicarse y sintetizar la totalidad de sus proteínas por si mismos. ARNm. Representación del tiempo biológico en horas.3. ribosomas. 4. organelos presentes en las células eucariontes.GUÍA METODOLÓGICA DE BIOLOGÍA Los fundamentos de la teoría endosimbiótica son: Las mitocondrias y cloroplastos. ARNt. Fig.

Las que sobrevivían permanecían invariables y tras cada catástrofe se producía una nueva creación divina. desde que éstas fueron creadas. En 1795. expuso la teoría del uniformismo. que las especies no han aparecido de la noche a la mañana y que deben tener antecesores. acaecidos en épocas remotas que acabaron con la fauna y flora existentes. George de Buffon (1707-1788) propuso que las especies (pero solo las no creadas por acción divina. para explicar su concepto del avance de las cosas vivientes desde lo inanimado a las plantas. La otra línea de pensamiento se basa en las teorías transformistas que establecen que las especies derivan unas de otras por una transformación a través del tiempo. que las características de los seres vivos permanecieron invariables y que el número de especies en la Tierra siempre fue igual.. A través de la historia se postularon dos líneas del pensamiento acerca de la evolución biológica. Éstas comprenden las teorías fijistas apoyadas hasta el siglo XVIII. James Hutton.4. con su especial creación del mundo construido literalmente en seis días. que dice que los seres vivos fueron creados por Dios. luego a los animales y finalmente pone al hombre en la "cumbre de la creación". 148 . pero algunos desaparecieron como consecuencia de diferentes cataclismos (el más reciente. ¿CÓMO EXPLICA LA EVOLUCIÓN LA DIVERSIDAD DE LOS SERES VIVOS? Aristóteles desarrolló su Scala Naturae.500 millones de años. es decir lo que decía el Génesis del Antiguo Testamento. George de Cuvier (1769-1832) postuló la teoría del catastrofismo. En la Edad Media se aceptaba la tradición judeocristiana. Afirmaban que no hay procesos de cambio. que planteaba que ciertos procesos geológicos operaron en el pasado de la misma forma que lo hace hoy en día llegando a establecer la edad de la Tierra en 4.. Esto fue una gran contribución al primitivo concepto de que todas las especies se originaban de un creador perfecto y por tanto no podían cambiar debido a su origen. que pretendían darle forma científica a la explicación bíblica sobre la crea-ción (también llamadas creacionistas). De esta manera explicaba la existencia de organismos extintos que se conocían sólo por sus restos fósiles. o Escala de la Naturaleza.GUÍA METODOLÓGICA DE BIOLOGÍA 4. el diluvio universal).) pueden cambiar.

constante y acumulativo de las fuerzas naturales había producido un cambio continuo en la Tierra. 4. 16. I. Oparin 149 .Jean Baptiste Lamarck • Teoría de la selección natural .Charles Darwin y Alfred Rusell Wallace • Teoría neodarwinista – Theodore Dobzhansky Fig. que los animales tenían que competir entre los de su misma especie y con los de distintas especies para sobrevivir. 8. Dentro de las teorías más relevantes para explicar el proceso evolutivo están: • Teoría de los caracteres adquiridos . 6. Louis Pasteur Fig. su libro “Los Principios de la Geología” tuvo un profundo efecto en Charles Darwin y Alfred Wallace.) lo que trae como consecuencia las guerras y la muerte por hambruna. los alimentos crecen en una progresión aritmética (por ejemplo.4.GUÍA METODOLÓGICA DE BIOLOGÍA Durante el siglo XIX El británico Charles Lyell refinó las ideas de Hutton. 4. 4. 8. etc. y concluyó que el efecto lento. Darwin pensó que en el reino animal pasaba lo mismo. etc. Robert Thomas Malthus (1766-1834) escribió el libro “Ensayo sobre el Principio de Población”. deduciendo la “lucha por la existencia” (principio del pensamiento maltusiano). donde menciona que mientras las poblaciones humanas crecen en una proporción geométrica (por ejemplo. 2. 32. A.). 4.5.

tiene toda una estructura admirablemente adaptada para comer en las ramas más altas de los árboles. tendrían tendencia a desaparecer" Autor_______________________________ 150 . es curioso observar el resultado en la forma particular y la talla de la jirafa (Camelo pardalis): sabemos que este animal. A. los individuos que llegaran más alto y que en tiempos de escasez fuesen capaces de llegar aunque fuera un poco más arriba que los demás. casi siempre árida y sin hierba. patas delanteras. en todos los individuos de su raza. después de un largo tiempo..GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . . . por su elevada estatura y por su cuello."En relación a las costumbres. le obligan a comer hojas de los árboles ya esforzarse continuamente por llegar. Lee detenidamente los siguientes textos. Haz un mapa mental de cada uno. LA CAUSA Y EL CUELLO DE LAS JIRAFAS 1. mientras que los individuos menos favorecidos por los mismos conceptos. eleva su cabeza y alcanza seis metros de altura " Autor_____________________________ B. se salvarían con más frecuencia. y esto debe ser un ventaja en tiempos de escasez.."La jirafa. De esta costumbre (de esforzarse por llegar) resulta. Estos se reproducirían entre sí y dejarían descendencia que habría heredado las mismas características corporales.EL EFECTO. que sus patas delanteras se han vuelto más largas que las traseras y que su cuello se ha alargado de tal manera que la jirafa. La jirafa puede así obtener comida al que no llegan otros ungulados que viven en el mismo lugar. cabeza y lengua muchos alargados. vive en lugares en los que la tierra . el más grande de todos los mamíferos. . Al originarse la jirafa. sin levantarse sobre las patas traseras.

GUÍA METODOLÓGICA DE BIOLOGÍA 2. TEXTO A HECHO que se expone TEXTO B RAZONES que se dan para explicar el hecho 151 . Interpreta las relaciones lógicas de ambos texto argumentativos y distingue el modelo explicativo de Darwin del de Lamarck.

Darwin nunca tuvo conocimiento de tales investigaciones lo que le impidió comprender la relación existente entre la selección natural y “los efectos del uso y del desuso”. Mendel. en caso contrario. publicó en 1866 sus descubrimientos sobre las leyes de la herencia. las cuales han ocurrido a lo largo del tiempo. no ocurren saltos ni interrupciones. sino que es un resultado aleatorio. 152 . sin embargo. únicamente afectaría a un grupo numeroso de organismos. • La selección natural condiciona el curso del proceso evolutivo. podemos considerar las ideas de Darwin en cuatro puntos: • Las especies se originan unas de otras por una serie de variaciones y mutaciones aleatorias. En resumen. esto es. en donde una forma pase a otra muy distinta. la evolución de las especies no está forzada ni dirigida por una presión ajena a dicho proceso. pero no al total de la especie.GUÍA METODOLÓGICA DE BIOLOGÍA AUTOR del texto RELACIONES LÓGICAS: ¿Cuál es la causa? ¿Cuál es la consecuencia? Un punto crucial de las teorías darwiniana y lamarkista es que no explican adecuadamente las variaciones que presentan los individuos y que tienen que ser forzosamente heredadas. • El proceso evolutivo es continuo y gradual en todos los individuos. es decir. • Todos los organismos semejantes están relacionados por medio de su historia evolutiva. donde se observan antepasados comunes.

GUÍA METODOLÓGICA DE BIOLOGÍA

MECANISMOS DE LA VARIABILIDAD
Después de varias discusiones entre los científicos sobre la evolución, parecía que se había comprendido como se había generado el proceso evolutivo en el ámbito de la selección natural, pero surgía una pregunta ¿Cómo se producía la variedad en la descendencia? Esto se debía a la presencia de flora y fauna muy parecida, que existía en diferentes partes del mundo; un ejemplo se dio en la variedad de tortugas y pinzones existentes en las islas Galápagos observadas por Darwin. Apoyándose en los experimentos de Mendel sobre genética, se vio que las características de los padres son transmitidas a los hijos, pero que estos adquieren características diferentes, esto se debe a los mecanismos generadores de variabilidad. Los mecanismos más importantes son: Reproducción sexual. Esta se da con la unión de los gametos masculino y femenino que origina a un individuo con características semejantes, pero diferentes a sus padres, es decir, se combinan, no se mezclan los caracteres paternos y maternos, a través de los genes. Mutaciones. Son cambios que son producidos en el material genético de los padres, y los hijos reciben dicha información ya alterada con lo cual se favorece al nuevo individuo ofreciéndole ventajas. Las mutaciones sólo son heredables cuando afectan a células reproductoras Microevolución. Es el proceso por el cual, a partir de una especie ya existente, se origina otra, y puede ocurrir por: Aislamiento geográfico: Esto se da cuando dos poblaciones de organismos similares quedan aisladas por barreras geográficas, evolucionan de forma distinta. Por ejemplo, las poblaciones de mamíferos de Australia al quedar aisladas evolucionaron de modo distinto a las del resto del mundo. Tendencias evolutivas diferentes: Es cuando en algunos individuos de una población se producen variaciones genéticas, que pueden dar origen a otra línea evolutiva. No interviene, pues, la selección natural. Por ejemplo, el elefante africano tiene orejas más grandes que el asiático, porque vive en regiones más cálidas y las orejas le permiten eliminar mayor cantidad de calor.
153

GUÍA METODOLÓGICA DE BIOLOGÍA

Fig. 4.6. Sinopsis del proceso evolutivo

ACTIVIDAD – FÓSIL VIVIENTE Se ha descubierto que existen una cuantas especies que son iguales a como eran hace millones de años. Dentro del campo de la biología se les denomina pancrónicas; aunque comúnmente son llamadas “fósiles vivientes”. Una especie de este tipo es el celacanto, un pez que tiene fósiles de una antigüedad de 80 m.a., pero que actualmente se le encuentra en aguas profundas cercanas a Madagascar. En el pasado habitaron prácticamente todos los océanos. Tomando en cuenta la teoría de la evolución por selección natural, encuentra las razones que expliquen por qué el celacanto no ha cambiado en 80 m.a.
154

GUÍA METODOLÓGICA DE BIOLOGÍA

ACTIVIDAD – LA SELECCIÓN NATURAL DE DARWIN Y WALLACE Elabora un mapa conceptual de la Teoría de la Selección Natural de Darwin que incluya por lo menos los siguientes conceptos: sobrepoblación, lucha por la existencia, variaciones, cambio gradual, poblaciones, adaptaciones, sobrevivencia del más apto, selección natural, medio ambiente, transmisión de rasgos heredables, especiación, extinción.

155

GUÍA METODOLÓGICA DE BIOLOGÍA

TEORÍA NEODARWINISTA En 1937, Theodore Dobzhansky publica su libro "Genética y el Origen de las Especies" donde incorporó a la teoría de Darwin, los postulados de las leyes de Mendel además de los conocimientos que ya se tenían sobre genética, bioquímica y paleontología, haciendo una síntesis y resultando en la Teoría Sintética de la Evolución o Neodarwinista. Ésta se basa en los cambios evolutivos que se llevan a cabo en las poblaciones, y no en los individuos (hay que recordar que Darwin únicamente observó las variaciones en los organismos). Un organismo nace, crece y con el tiempo muere, a través de su vida los individuos pueden sufrir cambios, pero su constitución genética permanece constante. Por otro lado, la constitución genética de una población puede variar de una generación a otra mediante procesos internos (mutaciones y recombinación génica) y procesos externos (selección natural y aislamiento reproductivo). Sus afirmaciones básicas son: • • • • Tal y como sostuvo Darwin, la evolución ocurre por selección natural. La variabilidad genética en una población se debe a la existencia de mutaciones. La selección natural actúa sobre las poblaciones y no sobre individuos aislados. La evolución ocurre a lo largo de miles y millones de años. Los cambios que se producen en las especies son pequeños y graduales.

4.5 ¿CUÁLES SON LAS EVIDENCIAS DE LA EVOLUCIÓN? La teoría de la evolución se basa en una serie de pruebas aportadas por diferentes disciplinas científicas y que infieren que todos los seres vivos actuales son el resultado de la evolución. Actualmente la comunidad científica no duda del hecho de la evolución, aunque hay diferentes hipótesis sobre cómo ha tenido lugar. Se puede poner un símil histórico para entender esta idea: ningún historiador pone en duda que el imperio romano cayó (esto es un hecho aceptado), pero, cuáles fueron las causas de la caída del imperio romano? Para responder esta pregunta hay diferentes ideas, diferentes hipótesis alternativas, que se ponen a discusión entre los historiadores.

156

GUÍA METODOLÓGICA DE BIOLOGÍA

Aunque hoy en día no hay que "demostrar" la evolución, en otras épocas sí que se ponía en duda y datos paleontológicos, anatómicos y embriológicos han sido utilizados como pruebas del hecho evolutivo. Son pruebas que permiten estable-cer relaciones de parentesco entre diferentes seres vivos. También los estudios de comparación de proteínas y ácidos nucléicos que aportan nueva luz sobre las relaciones entre los organismos.

ACTIVIDAD – LA PRUEBAS DE LA EVOLUCIÓN I. Evidencias embriológicas

Distintas etapas embrionarias de algunos vertebrados

La comparación de embriones de diferentes grupos de vertebrados ha sido considerada una prueba más de la evolución. 1. Escribe los argumentos que crees que usan los evolucionistas para apoyar sus ideas. _______________________________________________________________________________________ _______________________________________________________________________________________

157

GUÍA METODOLÓGICA DE BIOLOGÍA

_______________________________________________________________________________________ _______________________________________________________________________________________ 2. ¿Crees que la embriología comparada puede servir para establecer la noción de antepasado común? ¿Por qué? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ II. Evidencias anatómicas: Órganos homólogos, las extremidades de los vertebrados Investiga el nombre de cada uno de los huesos que constituyen las extremidades delanteras de los vertebrados mostrados en la siguiente imagen. Ilumina de diferente color cada hueso y escribe su nombre. Observa y responde: 1. ¿Por qué se puede decir que las extremidades de los vertebrados tienen la misma organización? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 2. Describe, a partir del modelo de organización general, las transformaciones que resultan de la adaptación al vuelo de los vertebrados.

_______________________________________________________________________________________ _______________________________________________________________________________________ 3. Formula una hipótesis que explique las semejanzas que has constatado en la organización de las extremidades de los vertebrados

158

GUÍA METODOLÓGICA DE BIOLOGÍA 159 .

GUÍA METODOLÓGICA DE BIOLOGÍA III. 1. ¿Qué tienen en común ambos animales? _______________________________________________________________________________________ _______________________________________________________________________________________ 2. Si comparas las extremidades traseras de la rana y el saltamontes. ¿podrías decir que tienen la misma función? y ¿tienen el mismo origen? ¿por qué? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 3. Haz una investigación documental en tu libreta sobre otros tres órganos análogos e ilustrala con dibujos 160 . Evidencias anatómicas: órganos análogos Observa detenidamente los animales de la siguiente imagen.

¿Qué semejanzas encuentras entre los vestigios de las extremidades posteriores de la ballena y del pitón? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 161 . Evidencias anatómicas: órganos vestigiales.GUÍA METODOLÓGICA DE BIOLOGÍA IV. 1.

¿Crees que se pueda encontrar una explicación que no implique evolución a la existencia de órganos vestigiales como estos? Razona tu respuesta. Formula una hipótesis para explicar las coincidencias observadas entre estos dos organismos (cuidado de no utilizar argumentos "lamarkistas" en su explicación) _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 3. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ 162 . si no hubiera evolución y compara tus reflexiones con el registro fósil que muestran las figuras. _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ Haz una investigación documental extensa en tu libreta de cuáles son los órganos vestigiales que presenta el ser humano V.GUÍA METODOLÓGICA DE BIOLOGÍA 2. Evidencias paleontológicas Razona qué esperaríamos encontrar en el registro fósil si no hubiera cambio.

GUÍA METODOLÓGICA DE BIOLOGÍA Diferentes géneros de animales parecidos a los caballos actuales 163 .

Los números se refieren al número de aminoácidos diferentes en el citrocromo C de la especie comparada. ¿Cuál par de especies está mas estrechamente relacionada entre sí? ¿Por qué? A. 2.GUÍA METODOLÓGICA DE BIOLOGÍA VI. En el siguiente cuadro se presentan las diferencias entre las secuencias de aminoácidos del citrocromo C obtenidas de diferentes animales. El citocromo C es una pequeña proteína (aproximadamente de unos 110 aminoácidos) que interviene en el transporte de electrones de la cadena respiratoria de los vegetales y animales. De acuerdo con el cuadro. con una diferencia de 51 aminoácidos en la cadena del citocromo C. con una diferencia de ______________________ y el más lejano es ________________________. Se pueden establecer ciertas comparaciones entre la secuencia de aminoácidos correspondientes a especies muy diferentes. Oveja – Chimpancé E. Esta molécula está presente en la mayoría de los organismos. el organismo que está evolutivamente más cercano al hombre es _____________________. Caracol – Chirivía _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 164 . Evidencias bioquímicas. 1. Humano – Carpa B. plantas y microorganismos. Levadura . Cascabel – Polilla C.Coliflor D.

e) Región Oriental: Asia tropical. lo que le da un gran peso en el proceso de comprobación de la Evolución. g) Región Oceánica: Islas oceánicas. con base en él completa el siguiente cuadro con la información que se te pide: 165 . En la figura puedes observar seis regiones biogeográficas y algunos animales característicos. Evidencias biogeográficas Según la Biogeografía existen siete grandes regiones en las que se presenta homogeneidad adaptativa florística. d) Región Etiópica: África. f) Región Austral: Australia. faunística y obviamente climatológica: a) Región Paleártica: Europa y zonas nórdicas de Asia. Nueva Zelanda y Nueva Guinea. c) Región Neotropical: Sudamérica. b) Región Neártica: Norteamérica.GUÍA METODOLÓGICA DE BIOLOGÍA VII. Puede decirse que la Biogeografía es la ciencia que conjunta muchas evidencias e igualmente aporta pruebas propias y muy actuales.

GUÍA METODOLÓGICA DE BIOLOGÍA 166 .

Los fósiles índice sólo se encuentran en rocas de una época especifica por lo tanto pueden determinar de manera indirecta la edad geológica de las rocas de un estrato dado. cuando las dos poblaciones vuelven a estar en contacto. el desierto. Esto requiere que se produzcan barreras reproductoras entre las especies incipientes. Se considera que una nueva especie puede originarse por este mecanismo cada millón de años. ésta se adapta progresivamente a las nuevas condiciones ambientales por medio de la selección natural. Básicamente son dos los métodos usados para calcular la edad de los fósiles: la datación relativa y la datación radiométrica. un río o una cordillera). dientes. Si las condiciones ambientales perduan por muchas generaciones. algodón.GUÍA METODOLÓGICA DE BIOLOGÍA ESPECIACIÓN La especiación es el proceso de generación de nuevas especies a partir de una y es el resultado de la adaptación. sus características fisiológicas y su relación evolutiva con otras especies. modificando algunas de sus características. por lo general. sus depredadores y la probable causa de su muerte. Permiten interpretar el ambiente que habitaron. De hecho. FÓSILES Los fósiles constituyen una prueba para el estudio de la evolución de la vida. Este fenómeno es poco común en animales pero muy frecuente en vegetales. álamo) se obtuvieron del cruzamiento de diversas variedades que. Un fósil no sólo se refiere a huesos. una subespecie o una variedad y si la duración del aislamiento geográfico es mayor. Cuando una población queda separada por barreras geográficas (como el mar. También pueden producirse nuevas especies por poliploidía y es una especiación extraordinariamente rápida ya que la producción de cromosomas se produce durante una generación. producen híbridos poliploídes. Se desarrollará una raza. manzano. tabaco. se habrá generado en la población una serie de cambios que la harán diferente de la población original. la ausencia de fertilización indica que cada una es una especie diferente. 167 . tejido o conchas conservadas en forma de roca sino que también se usa para designar toda huella o prueba dejada por algún ser vivo en el pasado. Técnicas de fechación en fósiles. muchas de las plantas domésticas (trigo.

Describe lo que sucedió en cada especie 168 . Esta es la línea evolutiva de la ballena azul.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – CÓMO SE ORIGINARON LAS BALLENAS Describe las transformaciones que resultan de la adaptación a la vida acuática de los vertebrados como la ballena. Explica cómo evolucionó y las adaptaciones que tuvieron que llevarse a cabo para llegar a la especie actual.

Así. La corteza terrestre se forma por capas de rocas super-puestas.7). aunque se usa en combinación con la datación radiométrica (fig. los fósiles encontrados en capas profundas son más antiguos que los hallados en capas superficiales. Cada isótopo se transforma en otro en un tiempo determinado llamado vida media que es el lapso en que la mitad de los isótopos de una muestra se transforman en isótopos de otro elemento (Tabla 4. Datación radiactiva. Las capas más profundas son las más antiguas. la edad aproximada de los fósiles. y las más superficiales las más recientes.8). Permite medir tiempos geológicos que se asignan en base a la velocidad de desintegración de los isótopos radioactivos. Este método es muy impreciso.1 y fig. 4. 169 . por simple comparación. 4. Esto permite calcular relativamente. siempre y cuando sea posible calcular la edad de un estrato.GUÍA METODOLÓGICA DE BIOLOGÍA __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ _________________________________________________________________________ Datación relativa.

Ejemplifica e ilustra tu mapa.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – TIPOS DE FOSILES Realiza un mapa conceptual a partir de una investigación documental sobre los tipos de fosilización que existe.8 Datación radiactiva del C14 170 . 4.7. Datación relativa Fig. Fig. 4.

4.1 Vida media de algunos elementos 171 .GUÍA METODOLÓGICA DE BIOLOGÍA Fig.6 Diferentes tipos de Fósiles Tabla 4.

Las cantidades para el siguiente periodo de 1 000 años (del año 1 000 al 2 000) se calculan como sigue: Cantidad desintegrada = 10% de 90 unidades = _____________ unidades Cantidad sobrante después de 2 000 años = 90 .10 = 90 unidades de este elemento 1 000 años después. el cual se desintegra aproximadamente 10% cada 1 000 años. Así. De acuerdo con lo anterior. ¿Qué porcentaje de carbono 14 se encontrará después de 10 000 años? _____ 2. 1. las cantidades faltantes en la tabla. Si en un fósil se observa que su cantidad de carbono 14 se ha reducido 35%. quedarán 100 .9 = ___________ unidades En la siguiente tabla se han organizado los resultados anteriores junto con los cálculos de otros dos periodos de 1 000 años. ¿qué edad aproximada tendrá este fósil? ______________________________ 3.) ____________________________ 172 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – UN CRONÓMETRO PARA EL PASADO En esta actividad se explicará cómo se obtienen las cantidades restantes de elementos radiactivos a través del tiempo para el fechamiento de fósiles. Tomemos como ejemplo el carbono 14. Para realizar algunos cálculos. comencemos con una cantidad de 100 unidades de este isótopo radiactivo. es decir. 10 unidades. Si en un fósil se observa que su cantidad de carbono 14 se ha reducido 20%. usando el mismo procedimiento. ¿qué edad aproximada tendrá este fósil? (Sugerencia: continúa los cálculos de la tabla anterior hasta llegar a este porcentaje. en los primeros 1 000 años se habrá desintegrado 10% de las 100 unidades. Comprueba los valores dados y calcula.

¿Qué hubiera sucedido si la atmósfera primitiva hubiera contenido oxígeno? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 2. ¿Por qué evolucionaron las células de consumidoras a productoras? 173 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDADES DE CIERRE DE BLOQUE 1.

GUÍA METODOLÓGICA DE BIOLOGÍA _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 3. Sugiere pruebas específicas que apoyen la idea de que las modificaciones provocadas por la acción directa del medio no se heredan _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 174 . ¿Por qué es importante el estudio de la Química para el conocimiento de los seres vivos? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 6. ¿A qué se debe la aparición de los organismos multicelulares? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 5. ¿Cuál es el efecto de la fotosíntesis sobre la atmósfera primitiva? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 4.

o entre razas de una misma especie que se encuentran en medios diferentes? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 10. de una especie animal o vegetal por acción de la selección natural? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 9. ¿En qué punto la teoría larmarkiana de la adaptación no está de acuerdo con las pruebas de que hoy disponemos? 175 . ¿En qué se diferencian y en qué se asemejan la selección artificial y la selección natural? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ ______________________________ 8.GUÍA METODOLÓGICA DE BIOLOGÍA 7. ¿Cómo puede explicarse la extinción. o la desaparición en un lugar. ¿Cómo explica la selección natural las diferencias en coloración o forma entre especies próximas que ocupan medios distintos.

cabeza y hombros aerodinámicos y cerdas rígidas en las plantas de los pies. se separó un grupo. Una vez ocurrida una mutación. ____________________________________________________________ − Los osos pardos (Ursus arctos). ¿qué debe ocurrir al gen para que el carácter quede permanente en el grupo? ________________________________________________________________________________ 12. lo que produjo una nueva especie: el oso polar (Ursus maritimus). el cual estuvo sometido a la presión selectiva de un ambiente adverso en las zonas más al norte. desde los bosques caducifolios hasta la tundra. en el color de su pelaje. _________________________________________________________________________________ 176 . desde hace 1. el que difiere del Ursus arctos. se asemejan estructuralmente. que lo aíslan del frío y le dan tracción en el suelo helado. Identifica a qué evidencias corresponden los siguientes ejemplos: − La familia de las cactáceas en los desiertos de América y la familia de las Euforbiáceas en los desiertos asiáticos y africanos desarrollan tallos carnosos con tejidos almacenadores de agua y espinas protectoras contra la pérdida de la misma.5 millones de años estuvieron ampliamente distribuidos en el hemisferio norte.GUÍA METODOLÓGICA DE BIOLOGÍA _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 11. y a pesar de no tener ningún parentesco. Explica el papel del aislamiento geográfico en el origen de las especies. siendo su dieta básicamente vegetariana y ocasionalmente carnívora. _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________ 13. Se dice que de esta especie tan difundida. dentadura tipo netamente carnívora.

• Cartel sobre las ideas de Lamarck.GUÍA METODOLÓGICA DE BIOLOGÍA − La familia de los cetáceos. incluye a ballenas. La rúbrica para su evaluación es la misma que para el bloque de Célula (página 91) EVALUACIÓN DIAGNÓSTICA Aplicación de examen diagnostico y lluvia de ideas. Examen departamental tipo CENEVAL o PISA 30% Laboratorio (evaluación V-Gowin) 20% Actividades de aprendizaje 20% Actividad específica por unidad 30% FORMATIVA SUMATIVA 177 . ¿Por qué los marsupiales están diseminados por Australia y apenas viven en otras partes? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ ACTIVIDAD ESPECÍFICA Elabora un mapa conceptual integrador que resuma los eventos del origen de la vida. • Ejercicios de la guía didáctica. delfines y marsopas y sus rasgos externos son semejantes a los de los tiburones y a otros peces grandes. _________________________________________________________________________________ 14. • Mapa mental de las evidencias de la evolución. ACTIVIDADES DE APRENDIZAJE: • Exposición por equipo. Darwin-Wallace y Neodarwinismo en equipo. pero los cetáceos son animales de sangre caliente. • Participación en el debate sobre las teorías del origen de la vida y evolutivas. pulmonados y en el interior de sus aletas hay huesos que indican una mano tetrápoda. origen de las células eucariontes. de la evolución a la pluricelularidad y de la evolución por selección natural. ACTIVIDAD ESPECÍFICA: • Línea de tiempo sobre la evolución de una especie.

los seres vivos Puntos: 80 Puntos: 100 Aspectos a mejorar : Ponderación: Logros: Puntos: 60 BIBLIOGRAFÍA BÁSICA Audesirk . T.actionbioscience. La ciencia.org/sopa.php 178 . Puntos: 30 Compara los cambios manifestados en los seres vivos. No.F. Pearson. Ciencia y Naturaleza. (2003) Sopa Prebiótica. Una entrevista con Douglas Futuyma en ActionBioscience. 128-135.org/esp/evolution/futuyma. España. Biología. A.org. Año 12.. CECSA México. R. Puntos: 100 Busca información sobre los cambios que han manifestado los seres vivos. (1987). (2008). pp. J.org (reproducido con permiso de Science Magazine).GUÍA METODOLÓGICA DE BIOLOGÍA MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios: Analiza. Segunda Edición.org. Zoología evolutiva de los vertebrados. http://www.L. Oram. Tellería J. Universidad Nacional Autónoma de México. B. 168 páginas. Argumenta Registra los los diferentes factores factores que evolutivos influyen en determinantes los cambios en los seres que sufren vivos. Chamizo. y Byers. Biología. Revista ¿Cómo ves? Dirección general de Divulgación de la Ciencia. Sistemas Vivientes. (2004) La Selección Natural: Cómo Funciona la Evolución. reflexiona y compara los cambios genéticos que se han manifestado en los seres vivos como origen de la biodiversidad a través de una línea del tiempo Pre-formal: Receptivo: Resolutivo: Autónomo: Estratégico: Propone cambios evolutivos en los seres vivos con base en las condiciones medio ambientales actuales.astroseti. 285-315. J.Prentice Hall. Editorial Síntesis. A. http://www. (1991).L. (2006).html Bada. y Lazcano. Nueva visita al Experimento de Miller en Astroseti. J. BIBLIOGRAFÍA COMPLEMENTARIA ActionBioscience.

html TIC’s Proyecto Biósfera. T.cnice. http://recursos.actionbioscience.html Evolutionibus (2004) El neodarwinismo y la Teoría Sintética http://www.GUÍA METODOLÓGICA DE BIOLOGÍA Eldredge.terra.org http://www.org/esp/evolution/ingman. N.actionbioscience.apologeticspress. (2001) El ADN Mitocondrial Esclarece la Evolución Humana en ActionBioscience.org/esp/evolution/eldredge.html Major. la Especiación y el Medio Ambiente en ActionBioscience.es/biosfera/ RECURSOS DIDÁCTICOS • • • • Video Cosmos de Carl Sagan Video La Eva Genética – Discovery Channel Video Las Galápagos Video Darwin y el árbol de la vida – BBC de Londres 179 . (2005) Creación vs Evolución: Darwin y la Evolución en ApologeticsPress.es/personal/cxc_9747/neodarwinismo.org http://www. (2000) Las Especies.mec. M.org http://www.org/espanol/articulos/405 Ingman.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 5 Biodiversidad y Medio Ambiente 180 .

Distingue los diferentes tipos de ecosistemas. CRITERIOS DE DESEMPEÑO 181 .2 Toma decisiones a partir de la valoración de las consecuencias de distintos hábitos de consumo y conductas de riesgo. 8. física y ecológica de los sistemas vivos. registra y sistematiza la información para responder a preguntas de carácter científico. UNIDAD DE COMPETENCIA: Interrelaciona el medio ambiente y su biodiversidad con el flujo de materia y energía de cada ecosistema para ubicarlos y valorar el equilibrio de la biosfera a través de una visita guiada a áreas naturales y la elaboración de un mapa mental integrador. 4. 13. económica y social de los seres vivos para su aprovechamiento racional. Distingue los factores bióticos y abióticos de un ecosistema. Relaciona los niveles de organización química. Identifica las causas y efectos de los problemas ambientales en los ecosistemas Actitudinales/Valorale s Valora la importancia médica. consultando fuentes relevantes y realizando experimentos pertinentes 11. 2.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE V: BIODIVERSIDAD Y MEDIO AMBIENTE TIEMPO: 45 hrs. Declarativos Explica la clasificación taxonómica de los organismos de acuerdo a las reglas de Linneo. Explica la estructura y función de los ecosistemas haciendo énfasis en el flujo de la materia y la energía. 6. a través de visitas guiadas a áreas naturales de su comunidad. COMPETENCIAS Genéricas Disciplinares 3. Organiza grupos y mesas de debate sobre las causas y consecuencias del deterioro ambiental y las alternativas para el manejo responsable de la biosfera Fomenta la conservación de la flora y fauna de su región/comunidad. Describe los niveles taxonómicos propuestos por Woese: Tres dominios y seis reinos. Obtiene. asumiendo consideraciones éticas. médica y económica. Analiza las leyes generales que rigen el funcionamiento del medio físico y valora las acciones humanas de impacto ambiental. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. Realiza actividades experimentales para identificar características generales de los seres vivos reportando los resultados en una V de Gowin. Fundamenta opiniones sobre los impactos de la ciencia y la tecnología en su vida cotidiana. imágenes e importancia.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad.3 Asume una actitud constructiva. SABERES Procedimentales Identifica a los seres vivos utilizando las reglas de la nomenclatura taxonómica binomial de Linneo a través de claves dicotómicas. Clasifica a los seres vivos de acuerdo a Carl Woese en tres dominios y seis reinos. señalando su importancia ecológica. Fundamenta que la ecología es el estudio de las relaciones de la biodiversidad con su medio ambiente. biológica. sus recursos naturales y considera la importancia de los ecosistemas locales. Elabora una presentación en power point de cada reino con características.

• Debate en plenaria. aplicando la V de Gowin.GUÍA METODOLÓGICA DE BIOLOGÍA Elabora un mapa mental integrador de los ciclos biogeoquímicos y la relación con el equilibrio ecosistémico • • • Analiza la estructura y las relaciones entre los componentes de los ecosistemas en un mapa mental integrador. lápices. • Actividades • Reporte • Cañón • DVD • Laboratorio • Artículos • Reportes experimentales. • Reporte de power point de los diferentes reinos dicotómica Investigación documental de actividades de guía metodológica. 182 . de visita guiada • Resolución • Plumones • Papel • Reporte • Mapa • Clave Bond mental integrador. plumas. Realiza actividades experimentales sobre biodiversidad y medio ambiente. • Reportes de actividades experimentales utilizando la metodología de la V de Gowin. ESTRATEGIAS DE ENSEÑANZA • Aplicación de preguntas generadoras • Presentaciones ESTRATEGIAS DE APRENDIZAJE • Elaboración de presentaciones en power point. • Software • Pizarrón escrito de problema ambiental. de divulgación científica • Videos • Libreta de apuntes. escrito de visita guiada. • Visita guiada. • Mapa mental integrador de actividades experimentales utilizando la V de Gowin. Valora la importancia de la interrelación de los seres vivos con su medio ambiente a través de visitas guiadas a áreas naturales. • RECURSOS DIDÁCTICOS • Guía metodológica de practicas educativo • Manual EVIDENCIAS Y/O PRODUCTOS • Portafolio electrónico con las presentaciones de power point.

¿Cuántos y cuáles son los reinos de los seres vivos? ___________________________________________________________________ ___________________________________________________________________ 2. Escribe el nombre científico de un organismo (que no sea el hombre. ¿Qué es la Biodiversidad? ______________________________________________________________________ ______________________________________________________________________ 4. Sabias que México es un país megadiverso ¿por qué? ______________________________________________________________________ ______________________________________________________________________ 5.GUÍA METODOLÓGICA DE BIOLOGÍA EXPLORANDO TUS CONOCIMIENTOS 1. Dibuja una cadena alimenticia 183 . Homo sapiens) ______________________________________________________________________ ______________________________________________________________________ 3.

GUÍA METODOLÓGICA DE BIOLOGÍA 184 .

Por lo tanto la Taxonomía biológica se encarga de elaborar inventarios de la biodiversidad a nivel mundial o regional. estudia las implicaciones evolutivas y por último proporciona un nombre exclusivo para cada grupo de seres vivos o fósiles. Sistema natural. el proceso evolutivo y la filogenia (origen de los organismos). La Taxonomía se encarga de clasificar a los seres vivos y ubicarlos en grupos específicos llamados taxones. se cree que existen alrededor de diez millones de organismos diferentes de los cuales solo se conocen científicamente 15 % (1. proporciona métodos que facilitan la identificación de los organismos. ecológicos y paleontológicos. forma u otros caracteres de los seres vivos. Señala que la variedad de formas de vida del planeta se relaciona con los procesos evolutivos de los seres vivos y por compartir ancestros comunes. ubicándolos en diferentes categorías.GUÍA METODOLÓGICA DE BIOLOGÍA 5. también utiliza otros estudios como los citológicos. 5. que permitían una clasificación con base en las 185 . NOMENCLATURA BINOMIAL DE LINNEO. La Sistemática se encarga de estudiar las semejanzas o diferencias entre los organismos. considera el beneficio.5 millones). embriológicos. hábito. Existe la necesidad de ordenar y organizar el elevado número de seres vivos para facilitar su conocimiento y análisis. El botánico sueco Carlos Linneo (1707-1778) (fig.1) desarrolló un método de clasificación que aún se utiliza en la actualidad. daño. Un sistema estrictamente utilitario. Existen varios tipos de clasificación: Sistema artificial. elabora un sistema de clasificación que sea aceptado mundialmente.1 ¿CÓMO SE CLASIFICAN A LOS SERES VIVOS? La diversidad biológica o biodiversidad se refiere a la enorme variedad de organismos vivos que existen en nuestro planeta. Asimismo utiliza datos comparativos para responder preguntas en relación con el nivel taxonómico. color. Esta clasificación considera características morfológicas similares entre los organismos (homologías). Este naturalista seleccionó rasgos físicos como tamaño y forma. Se basa exclusivamente en caracteres externos de los organismos. Sistema filogenético. así como también les asigna la nomenclatura adecuada.

todas las especies con caracteres semejantes las agrupó en la categoría superior llamada género y todos los géneros similares en familia. a menudo dos o más organismos no 186 . Los primeros nombres que tuvieron las plantas y animales eran nombres vernáculos o nombres comunes. división o Filo. reino y dominio (Tabla 5. La unidad de clasificación de los seres vivos es la especie. clase. pero estos tienen los siguientes inconvenientes: No son universales. NIVELES TAXONÓMICOS. Linneo también estableció la nomenclatura binomial para designar a las especies. Hay ocho categorías principales: especie. regla que hasta la actualidad es universalmente aceptada.1). Las categorías taxonómicas forman un orden jerárquico o posición taxonómica. sólo son aplicables a una lengua.GUÍA METODOLÓGICA DE BIOLOGÍA relaciones estrechas de los organismos. En este sistema el nombre científico de los organismos está escrito en latín. A Linneo se deben las agrupaciones de los organismos por sus semejanzas en categorías taxonómicas. por ejemplo: El perro doméstico lleva por nombre Canis familiaris. la segunda representa a la especie y por lo general es un nombre que describe al organismo. por ejemplo. la primera palabra identifica el género en el que se clasifica el organismo. El nombre científico de un organismo se forma de hecho de las dos categorías más pequeñas: el género y la especie. orden. que se ubicaría por encima del reino. donde Canis refiere a que el organismo pertenece al grupo de los carnívoros y familiaris indica que es un animal domesticado que sirve de compañía a la familia. que sólo pueden cruzarse entre sí y tienen un antecesor común. desde especie hasta dominio. por ejemplo él clasificó a las plantas con flores. es decir. Actualmente existe la tendencia de integrar una categoría nueva: el dominio. género. Cada categoría. es cada vez más general e incluye organismos cuyo antepasado común era cada vez más remoto en su relación evolutiva. REGLAS DE LA NOMENCLATURA BINOMIAL. y así sucesivamente. familia. que puede definirse como el conjunto de individuos similares estructural y funcionalmente. considerando el número de similitudes y el tipo de estructura de sus sistemas reproductores. una serie de niveles en los que la categoría mayor abarca a todas las demás.

Nombres vulgares del gorrión 187 .2. 1. 6. Carlos Linneo Tabla 5.2). El gorrión es un ejemplo de la confusión originada cuando se usan nombres comunes siendo su nombre científico en todos los países Paisser domesticus (Tabla 5.1 Posición taxonómica de algunas especies de plantas y animales país Estados Unidos Alemania Holanda Dinamarca Suecia Portugal Francia España Italia Noruega nombre común Sparrow english Haussperling Musch Grasspurv Hussparv Pardal Moineau domestique Gorrión Passera oltramontana Grasspurv Fig. Avena Dominio Reino Eukaria Plantae Roble blanco Eukaria Plantae Anthophyta Dicotyledoneae Fagales Fagaceae Quercus Quercus alba Elefante Eukaria Animalia Chordata Mammalia Proboscidea Elephantidae Elephas Elephas maximus Águila calva Eukaria Mosca de la fruta Eukaria Animalia Chordata Aves Falconiformes Falconidae Haliacetus Haliacetus leucocephalus Animalia Arthropoda Insecta Diptera Drosophilidae Drosophila Drosophila melanogaster División o Magnoliophyta Filo Clase Orden Familia Género Especie Liliopsida Poales Poaceae Avena Avena sativa Tabla 5.GUÍA METODOLÓGICA DE BIOLOGÍA relacionados tienen el mismo nombre común.

proviene de Boissier. Las normas básicas para la escritura de los nombres científicos son: • Se usa el latín o palabras latinizadas. • Cuando se imprime. ACTIVIDAD Investiga dos ejemplos donde el uso de nombres comunes conlleve a confusión. Quercus rotundifolia. malus = manzana en latín. 188 . Centáurea boissieri. el resto del nombre va en minúscula. el pino piñonero es Pinus pinea L. • Al final del nombre científico se acompaña el apellido abreviado del autor que lo describió. Cuando se escribe a mano o a máquina. Es un sustantivo en singular o una palabra tratada como tal (nombre uninominal). el nombre científico se escribe con letra cursiva (o itálica). Así. por ejemplo. un sustantivo en aposición (o yuxtaposición) con el género. se subraya. el encino es Quercus rotundifolia Lam.. por ejemplo. El nombre específico. Pyrus malus L. por ejemplo. • La primera letra del género va en mayúscula. Lam es abreviación de Lamarck y L de Linneo. Por lo general es: un adjetivo. por ejemplo.GUÍA METODOLÓGICA DE BIOLOGÍA El nombre científico de una especie es una combinación de dos palabras en latín: El nombre genérico. Puede ser el nombre de una persona latinizado en conmemoración. un nombre en conmemoración a una persona. hojas redondeadas. Argumenta qué se tendría que hacer e ilústralo con imágenes de las especies involucradas.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga la posición taxonómica de tres especies e ilústralas con una imagen. No se te olvide utilizar las reglas de nomenclatura científica Dominio: Reino: Phylum: Clase: Orden: Familia: Género: Especie: Nombre común: ___________________________________________________________________________________ Dominio: Reino: Phylum: Clase: Orden: Familia: Género: Especie: Nombre común: 189 .

________________________ 2. 1. ________________________ 190 .mx/pdf/NOM-059-ECOL-2001. ¡No olvides respetar las reglas de nomenclatura binomial.gob. Busca y enlista 15 especies con su nombre común y científico.pdf.biodiversidad.GUÍA METODOLÓGICA DE BIOLOGÍA Dominio: Reino: Phylum: Clase: Orden: Familia: Género: Especie: Nombre común: ¿Cuál de las tres especies investigadas está menos estrechamente relacionadas con las otras dos? ¿Por qué? __________________________________________________________________________________________ __________________________________________________________________________________________ ________________________________________________________________________________________ ACTIVIDAD Consulta la página electrónica: http://www.

GUÍA METODOLÓGICA DE BIOLOGÍA

3. ________________________ 4. ________________________ 5. ________________________ 6. ________________________ 7. ________________________ 8. ________________________ 9. ________________________ 10. ________________________ 11. ________________________ 12. ________________________ 13.________________________ 14.________________________ 15.________________________

5.2 LOS VIRUS, ¿VIVO O NO VIVO?
Los virus son parásitos intracelulares que no poseen metabolismo ni organización celular por lo que se les sitúa en el límite entre lo vivo y lo inerte. Son tan pequeños (entre 20 y 300 milimicras: µm) que sólo se pueden ver a través de un microscopio electrónico. Algunos tienen formas geómetricas regulares (icosaedro, helicoidal, etc.) algunos parecen bastones, cristales, filamentos, esferas y otros poseen una cabeza redonda, provista de una pequeña cola (Fig. 5.2).

191

GUÍA METODOLÓGICA DE BIOLOGÍA

Un virus es básicamente un agregado de material genético —ya sea ADN o ARN— dentro de una cubierta proteica llamada cápside, la cual, a su vez, está conformada de fragmentos denominados capsómeros. Algunos tienen una capa lipoproteica denominada envoltura viral (Fig. 5.3).

Fig. 5.2 Comparativo de tamaño y forma de varios grupos de virus

Los virus no se consideran dentro de los seis reinos de la vida, ya que carecen de muchas características propias de los seres vivientes. Los virus tienen diferentes
192

GUÍA METODOLÓGICA DE BIOLOGÍA

células hospederas ya que infectan a los animales incluido el hombre; a las plantas y los bacteriófagos que afectan a las bacterias. Cada tipo es independiente del resto, es decir, que los virus de plantas no pueden infectar animales ni bacterias y viceversa. Los virus son específicos de un cierto tipo celular siendo muy selectivos con sus hospederos y con las vías de entrada para infectarlos. Los métodos de entrada son muy especializados, y es una de las formas en las que los virus detectan a sus víctimas.

ACTIVIDAD Realiza una investigación documental sobre los virus y destaca su importancia económica, científica y médica a través de un mapa conceptual.

193

GUÍA METODOLÓGICA DE BIOLOGÍA

Fig. 5.3. Estructura del bacteriófago T4 y del virus VIH

ACTIVIDAD Consulta algunas referencias electrónicas y de tu biblioteca, contesta las siguientes preguntas: ¿Qué es un Prión? __________________________________________________________________________________________ ____________________________________________________________________ ¿Qué es un Viroide? __________________________________________________________________________________________ _____________________________________________________________________ Menciona algunas vacunas que previenen contra enfermedades de tipo viral. __________________________________________________________________________________________ ________________________________________________________________________________________

194

GUÍA METODOLÓGICA DE BIOLOGÍA

Comenta brevemente sobre el virus del papiloma humano y cuáles son sus consecuencias. __________________________________________________________________________________________ __________________________________________________________________________________________ __________________________________________________________________________________________ __________________________________________________________________________________________

REPLICACIÓN DE LOS VIRUS. Los virus tienen un solo propósito: reproducirse. Para llevarlo a cabo, tienen que apoderarse de la materia, la energía y la maquinaria de la célula hospedera adecuada introduciendo su material genético en la misma, fusionando la cubierta viral con la pared o la membrana de la célula y liberando sus genes dentro de ella. Si es un virus ADN, su material genético se inserta en el ADN de la célula hospedera. Si es un virus ARN (retrovirus), debe primero cambiar su ARN en ADN, poder insertarse. Después, los genes virales se copian muchísimas veces, los virus emplean las enzimas del hospedero para producir cápsides y otras proteínas virales. Los nuevos genes virales y las proteínas se ensamblan en partículas virales. Los nuevos virus se liberan de la célula hospedera sin destruirla o, eventualmente, el número de virus es tan grande que rompen la pared celular del hospedero para salir e infectar a otras células.

5.3 ¿CUAL ES EL SISTEMA ACTUAL DE CLASIFICACIÓN DE LOS SERES VIVOS?
PROPUESTA DE 3 DOMINIOS – 6 REINOS. Desde Aristóteles hasta Linneo, los biólogos dividían el mundo de los seres vivos en dos reinos: vegetal (Plantae), individuos inmóviles, autótrofos y fotosintéticos, y animal (Animalia), organismos móviles y heterótrofos. En 1866, el alemán Ernst Haeckel sugirió la conveniencia de constituir un tercer reino: el Protista, que comprendiera a los organismos unicelulares (bacterias, algas, hongos y protozoarios). En 1937, Chatton estableció un cuarto reino, el Monera, para abarcar a todos los organismos procariontes (bacterias y cianofitas), diferenciándolos de los eucariontes (plantas, animales y protistas). En 1969, el biólogo R. H. Whittaker, establece un
195

GUÍA METODOLÓGICA DE BIOLOGÍA

esquema de clasificación que reúne los organismos en cinco reinos. Él distinguió el reino Fungi (hongos y levaduras) como un reino separado de las otras formas de origen vegetal. Los hongos carecen de pigmentos fotosintéticos pero tienen núcleos y paredes celulares. En 1990, Carl Woese comprobó que por la secuenciación del ARNr, los procariontes se dividían en dos grupos: eubacterias y arqueobacterias. Propuso un nuevo taxón superior al reino que llamó dominio. Todos los seres vivos se agruparían en 3 dominios: Archaea (arqueobacterias), Bacteria (eubacterias) y Eukarya (protistas, hongos, animales y plantas) (fig. 5.4)
ACTIVIDAD Investiga e indica en la figura de abajo, el nombre de cada paso del proceso de replicación de un bacteriófago:

1. _____________

2. ________________ 6. ______________

3. _____________ 5. ______________

4. _________________

196

o sea que viven en condiciones extremas. Sicrófilas. Árbol evolutivo de los seis reinos de seres vivos DOMINIO ARCHAEA REINO ARQUEOBACTERIA Las arqueobacterias (del gr. Halófilas. Viven en regiones con altas concentraciones de sal como el Mar Muerto (con siete veces la concentración del agua de mar). manantiales calientes. Se desarrollan en manantiales azufrosos y respiraderos volcánicos en condiciones de alta temperatura y pH bajo. dióxido de carbono y azufre. aunque no todas lo son. Habitan en ciénegas y pantanos. Viven a temperaturas muy bajas. Presentan formas unicelulares procariontes. plantas de tratamiento de aguas negras. incluido hidrógeno.4. respiraderos de las profundidades marinas y en los estómagos de rumiantes. Se han encontrado en lagos congelados en la Antártida (hasta -7°C). Sus paredes celulares carecen del peptidoglucano presente en todas las eubacterias.. bakterion = bastón) se encuentran actualmente restringidas a hábitats marginales por lo que son extremófilas. Algunos tipos importantes de arqueas son: Metanógenas.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. 197 . Termoacidófilas. arkhaios = antiguo. Las arqueas se nutren de varias sustancias para obtener energía. 5.

Entre los géneros más representativos de estas algas están: Oscillatoria. 5. tienen pared celular compuesta de peptidoglicano y no poseen organelos membranosos ni formas multicelulares. Se clasifican en dos divisiones: Cyanobacteria o Cyanophyta (autótrofas) y Schizophyta o Eubacteria (heterótrofas). Morfología de una cianobacteria Las eubacterias son organismos unicelulares aparentemente simples. 5.5. No poseen núcleo verdadero sino un cromosoma circular. esta última les proporciona el color azul. Las cianobacterias o cianofitas (algas azul-verdes) de hábitat acuático. Nostoc. Los pigmentos no están contenidos en cloroplastos como en las células eucarióticas sino que forman parte de un sistema de membranas localizadas hacia el borde de la célula (fig.GUÍA METODOLÓGICA DE BIOLOGÍA DOMINIO BACTERIA REINO EUBACTERIA Organismos procariontes.5) Las cianobacterias se reproducen por fisión binaria o por fragmentación. Contienen clorofila además de otros pigmentos como xantofila. El citoplasma tiene un aspecto granular fino debido a la presencia de una gran cantidad de ribosomas y algunas bacterias tienen ADN menores extracromosómicos autónomos llamados plásmidos. Fig. caroteno y ficocianina. Anabaena. Spirulina y Lyngbya. La membrana celular es una bicapa lipídica como la de eucariontes rodeada por una 198 .

Existen cientos de especies de bacterias. Morfología de una eubacteria Fig. y.7). Pueden presentar nutrición autótrofa (fotosintética y quimiosintética) o heterótrofa (saprofita y parasitaria). en especial los bacilos. se reproducen por esporulación que consiste en formar endosporas cuando las condiciones no son favorables permaneciendo latentes por mucho tiempo. vibrios y espirilos (fig. hueco. especial y largo resultando en nuevas combinaciones genéticas. Algunas bacterias infecciosas tienen una capa viscosa que rodea a la pared celular llamada cápsula. que la protege del ataque de linfocitos del sistema inmune del hospedero. pero todas ellas tienen una de las cuatro formas existentes: cocos. De acuerdo a su respiración. bacilos. Muchas bacterias. 199 . Formas de las bacterias La mayoría de las bacterias se reproducen asexualmente por fisión binaria. 5.6). obligadas y estrictas). además. 5.6. 5. les sirve para deslizarse (fig 5. las bacterias pueden ser: aerobias y anaerobias (facultativas. Fig.GUÍA METODOLÓGICA DE BIOLOGÍA pared celular de péptidoglicano. Una forma de reproducción sexual es la conjugación en la que se transfieren plásmidos a través de un pelo sexual (pilli).7.

GUÍA METODOLÓGICA DE BIOLOGÍA Importancia evolutiva.9. coloniales. fungi.9). pero algunos lo pueden hacer sexualmente por medio de la conjugación. Ejemplos de protozoarios 200 . Poseen organelos como mitocondrias. Hace unos 2 mil millones de años. cloroplastos y corpúsculos basales (fig. creando el oxígeno atmosférico lo que permitió el desarrollo de formas de vida más complejas. 5. crisofitas y pirrofitas). multicelulares) y variedades nutricionales (heterótrofos.8. mastigóforos. Incluye una variedad de tipos de eucariontes (unicelulares. Fig. protistas fungales (mixomicetos. Casi todos los protistas se reproducen asexualmente por fisión binaria. plantae y animalia cuya principal característica es estar constituidos por células eucariontes. 6. Morfología de la Euglena Fig.9). cilióforos y esporozoarios) (fig. acrasiomicetos y oomicetos) y protozoarios (sarcodinos. REINO PROTISTA Los protistas se dividen en tres grandes grupos: las algas protistas (euglenofitas. DOMINIO EUKARYA A este dominio pertenecen los reinos protista. 5. Tienen un núcleo formado por varios cromosomas y limitado por una envoltura nuclear. autótrofos o una combinación de ambos). las cianobacterias ayudaron a formar y cambiar el medio ambiente inicial de la Tierra. 5.

10. 5. 5. 5. basidiomicetos (fig. El reino Fungi se clasifica en cuatro divisiones: zigomicetos. Éstas crecen y se ramifican formando redes complejas llamadas micelios. Las estructuras reproductoras son características que se usan para clasificar los hongos. La mayoría de los hongos están constituidos de filamentos ramificados. La reproducción asexual puede ocurrir por fragmentación de las hifas. o tubos.GUÍA METODOLÓGICA DE BIOLOGÍA REINO FUNGI Un hongo es un organismo constituido por células eucariontes con paredes celulares de quitina. 5.11. Ejemplos de deuteromicetos Los hongos son heterótrofos. ascomicetos. Morfología de Agaricus (basidiomiceto) Fig. Fig. secretan enzimas digestivas a su alrededor que degradan la materia orgánica que después absorben.10) y deuteromicetos (fig. consumen los restos y los desperdicios de otros organismos y otros son parásitos. Varía en tamaño.11). también pueden producir esporas sexuales y asexuales. desde unicelular (levadura) hasta pluricelulares (grandes setas). llamados hifas. Los hongos necesitan humedad. La mayoría son saprofitos. 201 . poca luz.

202 . También esquematiza el ciclo de vida de un champiñón. investiga cómo se conforma un liquen (dibuja un esquema) y que tipo de asociación ecológica representa.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Con apoyo de la bibliografía recomendada.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental acerca de la importancia de los organismos pertenecientes REINO IMPORTANCIA ECONÓMICA IMPORTANCIA ECOLÓGICA IMPORTANCIA MÉDICA Eubacteria Protista Fungi Comentario final ___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 203 .

algunas desarrollan rizoides para adherirse al sustrato. En 6 meses alcanza su largo máximo de entre 50 y 100 m. 5. Incluyen a las algas eucariontes (rodófitas. ni hojas verdaderas. además de clorofila a y c. que da el color pardo u olivo. Su crecimiento es grande y rápido. 5.13). feofitas. tallos. Pueden llevar a cabo la fotosíntesis a grandes profundidades (hasta a 175 m) debido a la ficoeritrina y a otros pigmentos que son azules (fícobilinas). u otro polisacárido.12). fícoxantina. PLANTAS NO VASCULARES Estas plantas no poseen tejido vascular y son las más sencillas y antiguas. DIVISIÓN RODOFITAS (ALGAS ROJAS) Son mayormente marinas tropicales. filamentosas o membranosas. Algunas depositan carbonato de calcio en la superficie de sus células que les dan consistencia dura y quebradiza (conocidas como algas coralinas) (fig. como las grandes masas de algas flotantes del género Sargassum. Sus células poseen pared celular compuesta de celulosa. El reino Plantae incluye a las plantas no vasculares y a las plantas vasculares o traqueofitas. La mayoría son acuáticas. La mayoría son multicelulares. No tienen raíces.GUÍA METODOLÓGICA DE BIOLOGÍA REINO PLANTAE Las plantas son organismos eucariontes que van desde unicelulares hasta árboles enormes. Las feofitas más abundantes son los Macrocystis. Obtienen sus nutrientes por medio de la fotosíntesis y absorción. clorófitas) y briofitas DIVISIÓN FEOFITAS (ALGAS PARDAS) Es un grupo de especies bentónicas marinas de las costas rocosas frías. Contienen. embebidos en una matriz de galactosa. 204 . Tienen aspecto filamentoso y ramificado. generalmente llamados kelps. Pueden crecer de 30 a 65 cm en un día. (fig. También se encuentran en aguas tropicales. La pared celular está formada de celulosa.

___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 205 . Ejemplos de rodófitas Fig. 5. tierra y en los árboles. nieve. Generalmente.GUÍA METODOLÓGICA DE BIOLOGÍA La mayoría de las algas rojas producen óvulos y espermatozoides en estructuras especializadas de sus ramas.11. Los pigmentos (clorofilas a y b) y las sustancias químicas en las paredes celulares de las algas verdes son muy parecidos a los de las plantas vasculares. 5. ACTIVIDAD Realiza una investigación documental a cerca de las diferencias químicas entre los distintos grupos de algas y completa el siguiente cuadro de doble entrada. almacenan su alimento como almidón. de varios metros de tamaño. Fig.12. Una vez concluido el cuadro realiza una reflexión del ¿porqué si todas son algas no se encuentran en el mismo reino? Argumenta tu respuesta. Desarrollan estructuras corporales que van desde unicelulares hasta formas masivas. pero las corrientes de agua llevan los espermatozoides hasta los óvulos. Ejemplos de feofitas DIVISIÓN CLOROFITAS (ALGAS VERDES) Grupo diverso que coloniza todo tipo de hábitats: agua dulce y salada. Ninguno de ellos se mueve.

Este grupo incluye las hepáticas y los musgos.GUÍA METODOLÓGICA DE BIOLOGÍA ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ TIPO DE ALGA PHYLUM/REINO TIPO DE CLOROFILA OTROS PIGMENTOS RESERVAS PARED CELULAR AZUL VERDE Cianofita Reino Eubacteria a VERDE Carotenos (rojo) Xantofilas (amarillo) Sílice CAFÉ Pirrófita Reino Protista Almidón Grasas ROJA ayd Celulosa DIVISIÓN BRIOFITAS (MUSGOS Y HEPÁTICAS) Las briofitas son las únicas plantas terrestres no vasculares. Todas son plantas pequeñas con pocos centímetros de largo. 206 .

207 . donde pueden crecer otras especies de plantas. tallos. ACTIVIDAD Busca en un libro de biología de tu biblioteca. No tienen raíces.GUÍA METODOLÓGICA DE BIOLOGÍA Viven en ambientes húmedos. esquematiza la estructura y el ciclo de vida de un musgo. casi todas viven agrupadas lo que les permite retener humedad. Las estructuras parecidas a raíces llamadas rizoides anclan a la planta a la tierra. Las briofitas favorecen la fertilidad de los suelos. ni hojas verdaderas.

Este grupo se divide en dos grandes categorías: plantas sin semilla que incluyen a las pteridofitas (helechos) y por el otro las plantas con semilla que comprenden a las coniferofitas (coníferas) y a las antofitas (plantas con flores).000 especies. en árboles y en riscos. La mayor parte de las plantas vasculares están adaptadas a una vida terrestre. Tienen hojas duras cubiertas por materiales cerosos como la cutina y adaptadas para retener agua. En el envés de las frondas se disponen los esporangios agrupados en soros. Los alimentos y otras sustancias elaboradas se transportan por el floema. Ambos tejidos están formados por células rígidas. en campos abiertos. La mayoría de las plantas de semilla están adaptadas para la vida en tierra. de alimento para el embrión y de una cubierta externa. En el interior de los esporangios están las esporas que son liberadas al exterior para su germinación. Se dividen en dos grupos: coniferofitas (gimnospermas) y antofitas (angiospermas). PLANTAS SIN SEMILLA (CRIPTÓGAMAS) DIVISIÓN PTERIDOFITAS (HELECHOS) Los helechos crecen en tierras húmedas. donde algunas especies de helechos arborescentes alcanzan hasta 25 m de alto. también sirven de sostén estructural a la planta. en bosques. Se encuentran en la mayoría de los ambientes terrestres y en muchos ambientes acuáticos. Una semilla es una estructura que se compone de un embrión vegetal. y unas hojas o frondas de diferentes tamaños con venas ramificadas llamadas pínnulas. que como resultado. La mayoría crece en bosques pluviales tropicales. PLANTAS CON SEMILLA (FANERÓGAMAS) Estas plantas se reproducen al formar semillas y son las más abundantes con más de 200.GUÍA METODOLÓGICA DE BIOLOGÍA DIVISIÓN TRAQUEOFITAS: PLANTAS VASCULARES Grupos de plantas más complejos. El alimento almacenado en las semillas le suple la energía para las etapas tempranas de crecimiento. Presentan un tallo más o menos desarrollado pero generalmente reducido a un rizoma subterráneo. el agua y los minerales van desde la tierra a todas las partes de la planta a través de un tejido conductor especializado: el xilema. 208 .

lupa. fronda en crecimiento. soros. hojas recicladas. pinnula. un helecho en maceta. rizomas. esporangios. Investiga sobre las plantas pteridofitas. 209 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Materiales por equipo: libro de biología. con apoyo de tu profesor identifica y realiza un dibujo indicando las siguientes partes del helecho: fronda.

Producen una resina en su savia que es "anticongelante". las cuales no están rodeadas de un fruto.000 especies aproximadamente. que es una característica de este grupo. lo que les permite seguir transportando nutrientes a temperaturas por debajo del punto de congelación. DIVISIÓN CONIFEROFITAS (CONÍFERAS) Las coníferas viven en latitudes frías y a grandes alturas. En este grupo se encuentran las cicadofitas (cícadas). Después de ser fecundado. Una parte de la flor es el ovario que contiene los óvulos. Las angiospermas incluyen diversas formas biológicas. Se dividen en dos clases: monocotiledóneas y dicotiledóneas. Abies (oyamel). Las coníferas son plantas que producen conos: la estructura que contienen las semillas de la planta. lo cual les permite seguir realizando la fotosíntesis y crecer lentamente en épocas difíciles. el óvulo se transforma en semilla y el ovario que lo rodea madura hasta convertirse en una estructura llamada fruto. en grupos grandes y densos que forman extensos bosques. y Juniperus (táscate) DIVISIÓN ANGIOSPERMAS (PLANTAS CON FLORES) Son más diversas que las gimnospermas.GUÍA METODOLÓGICA DE BIOLOGÍA GIMNOSPERMAS (PLANTAS SIN FLORES) Las gimnospermas tienen semillas desnudas. Entre las coníferas más conocidas se encuentran los géneros: Pinus (pinos). 210 . Existen 215. adaptadas a condiciones secas y frías: son perennifolias (hojas verdes todo el año). Taxodium (ahuehuete). Cupressus (cedro). ginkgofitas (ginkgos) y principalmente las coniferofitas (coníferas). hojas aciculadas (forma de aguja) y escamosas cubiertas de una cutícula gruesa que impide la evaporación. La flor. Se encuentra en gran diversidad de hábitats. Crecen como árboles o arbustos. aumenta las posibilidades de la planta de tener una reproducción exitosa.

y menciona la importancia económica de las coníferas.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Consulta páginas de internet y esquematiza el ciclo de vida del pino. 211 .

Con el siguiente esquema. observa tus plantas e identifica sus estructuras.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. Expongan en plenaria de grupo 212 . papel bond. lupa. 10 plantas con flor. Haz lo mismo con las semillas. Materiales en equipo: semillas diversas. dibújalas en el papel bond y señala a que clase pertenece.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Elabora un cuadro sinóptico de la clasificación del reino Plantae donde incluyas a todas la divisiones o phyla . recortes o dibujos. Comparen los mapas de todo el grupo 213 . realiza un mapa mental. con imágenes. e industrial de las plantas angiospermas. En un papel bond. puedes citar ejemplos que utilices en tu vida cotidiana. apóyate de libros de biología y utilizando las TIC. ACTIVIDAD Trabaja en pareja. indicando la importancia económica. médica.

guiándote del siguiente esquema. lupa. hojas recicladas. dibuja y señala cada parte. 214 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. Material en equipos: cinco flores diferentes. Observa e identifica las estructuras de las flores que llevaste a clase.

pared de la cavidad celómica. El ectodermo es la capa externa que da origen a epidermis y sus derivados. sistema excretor y reproductor (fig. páncreas. músculos. sistema nervioso.13). a manera de imágenes especulares. Existen unos 30 phyla de animales pero sólo 9 son importantes por el número de especies que los integran: poríferos. y su clasificación se basa en las siguientes características que comparten: Número de capas germinales. anélidos. nematodos. pluricelulares y heterótrofos. moluscos. El mesodermo es la capa intermedia que origina la pared interna del tubo digestivo. El endodermo es la capa interna que da origen al esqueleto.GUÍA METODOLÓGICA DE BIOLOGÍA REINO ANIMALIA Los animales son organismos eucariontes. equinodermos y cordados. Simetría es la posibilidad de dividir al individuo en partes iguales a partir de un eje que pase por su centro. Por ejemplo las medusas y las estrellas de mar. recubrimiento de la boca y nariz. Sus células carecen de pared celular y se organizan en tejidos. platelmintos. Obtienen sus nutrientes principalmente mediante la ingestión. vasos sanguíneos. izquierda y derecha. 5. Durante el desarrollo embrionario el embrión adquiere capas celulares a partir de las cuales se originan todos los tejidos.14). Por ejemplo la mosca y el hombre. Un organismo es asimétrico cuando no se pueden obtener partes iguales debido a que su forma es completamente irregular. hígado. Son móviles en muchos estadios de su vida. etc. mesenterio. sangre. cnidarios. órganos y sistemas. CARACTERÍSTICAS TAXONÓMICAS DE LOS ANIMALES La diversidad de este reino es enorme. algunas esponjas. tejidos conectivos. y vejiga urinaria. 5. debido a que la mayoría posee un sistema nervioso. (Fig. dermis. La simetría radial es aquella en la que el organismo puede ser dividido por cualquier plano que pase a partir de la boca a lo largo del cuerpo en partes iguales. Simetría. Presentan funciones desarrolladas de coordinación y movimiento. artrópodos. 215 . conductos respiratorios y pulmones. La simetría bilateral es aquella en la cual un solo plano pasa a lo largo del animal dividiéndolo en dos partes. Entre ellos tenemos a la amiba. uretra.

5.13. Son importantes para la clasificación. Los animales eucelomados presentan órganos internos en una cavidad corporal limitada por peritoneo (mesodermo) como es el caso de la lombriz de tierra y el ser humano (Fig. (fig. Metamerismo. presentan una red nerviosa. su desarrollo y posición en relación al tubo digestivo (dorsal. como es el caso de las esponjas y los gusanos planos. delimitado por mesodermo. Los animales se clasifican en acelomados si su cuerpo es sólido sin otra cavidad que la del tubo digestivo. El metamerismo es una repetición seriada de segmentos semejantes a lo largo del eje longitudinal del cuerpo. 5. artrópodos y cordados (fig. como en el caso de la lombriz intestinal. 5. como en los cordados. Los organismos pseudocelomados (falso celoma) sí tienen órganos internos dentro de un espacio corporal no delimitado pero éste no es de origen mesodérmico. Puede ser externo o exoesqueleto como en el calamar o erizo de mar o puede ser interno o endoesqueleto como en el humano (fig. Algunos animales.13).16) Esqueleto. o ventral. en su lugar.17). Los animales metaméricos son: anélidos. La cefalización es la diferenciación de un extremo cefálico o cabeza (centro del sistema nervioso y los órganos de los sentidos) y uno posterior o caudal. Capas embrionarias y presencia de celoma Celoma.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. como en los cnidarios. como en los artrópodos). cada segmento se llama metámero y está representado por un número de estructuras variable dependiendo del grupo animal del que se trate.15). Cefalización. El esqueleto está conformado por las estructuras que dan sostén al cuerpo. Cordón Nervioso Central. y que contiene las vísceras. El celoma es la cavidad general del cuerpo. 216 . 5. 5.

18). Ejemplos de metamerismo Fig. 217 .17. Cefalización Fig. no tienen poder de locomoción. Presentan una gran variedad de formas: redonda. desechos orgánicos y detritos (desechos orgánicos muy finos).15. Varían en tamaño desde 1 cm hasta más de 2m de diámetro. 5.GUÍA METODOLÓGICA DE BIOLOGÍA Características Únicas. Sus esqueletos están formados por espículas (de calcio o sílice) o de fibras proteicas de espongina. Son diblásticos. 5.16. 5. Presentan una abertura principal (ósculo) que utilizan para la excreción. Fig. no reaccionan a los estímulos y no tienen un medio aparente para capturar alimento. aplastados adheridos a rocas. de vaso. oblonga. Sus cuerpos están llenos de poros que utilizan para la circulación del agua. pero el ectodermo es interno y el endodermo es externo. Su alimento consiste en organismos microscópicos. otras forman crecimientos costrosos. Su color varía. Esqueleto PHYLUM PORIFEROS (ESPONJAS) Las esponjas viven adheridas a rocas o en el fondo marino. 5. 5. Tienen una cavidad interna llamada espongiocele (fig. Tipos de simetría Fig.14. Son las características únicas exclusivas de un phylum que no comparte con ningún otro y le otorga singularidad.

PHYLUM CNIDARIOS O CELENTERADOS La mayoría son marinos y su distribución es cosmopolita. Poseen una red nerviosa a través de su cuerpo que los hace sensibles a los estímulos. 5.) que les sirven de ataque y defensa. Poseen simetría radial. poseen una capa no germinal de material gelatinoso entre el endodermo y el ectodermo de nominada mesoglea. muscular. Clasificación. También presentan reproducción sexual. conectivo y reproductor. escifozoarios (medusas) y antozoarios (anémonas y corales). nervioso. Poseen nematocistos (estructuras urticantes. Los celenterados se clasifican en tres grupos distintos: hidrozoarios (hidras. 5.18. Obelia y Physalia). Presentan una cavidad con funciones digestivas conocida como celenterón con una boca por la cual ingresan los alimentos y se excretan los desechos y materiales digeribles (Fig. Anatomía de una esponja 218 .GUÍA METODOLÓGICA DE BIOLOGÍA Su reproducción es asexual y consiste en la gemación en la cual la esponja origina yemas sobre alguna parte de su cuerpo que eventualmente forman adultos maduros. Son los más simples de todos los metazoarios.19). Fig.19. Son diblásticos. Tienen los cinco tejidos básicos: epitelial. Tipos biológicos de cnidarios Fig. 5.

20. Los hay parásitos y de vida libre. Se dividen en tres clases turbelarios (planarias y nudibranquios).GUÍA METODOLÓGICA DE BIOLOGÍA PHYLUM PLATELMINTOS (GUSANOS PLANOS) Todos son tribásticos. acelomados y con simetría bilateral. trematodos (fasciola) y cestodos (solitaria. Ejemplos de platelmintos Fig.21). son comunes en la tierra. Todas las formas tienen sistema nervioso. 5. aparato excretor poco desarrollado. estos últimos.20). Presentan sexos separados y dimorfismo sexual. Existen parásitos y los hay de vida libre.21. 5. no tienen sistema digestivo. 5. Carecen de aparato respiratorio y circulatorio. 5. Anatomía de un nematodo 219 . sin embargo. PHYLUM NEMATODOS (GUSANOS REDONDOS) Son vermes cilíndricos y delgados con los extremos puntiagudos. excretor y reproductor. en el fango y en los organismos descompuestos (Fig. Fig. Tienen boca y ano. el sistema nervioso consta de un anillo periesofágico de que parten nervios longitudinales en dirección anterior y posterior. equinococo) (Fig.

que pueden sufrir modificaciones para convertirse en órganos masticadores o copuladores. Los anélidos se dividen en tres clases: poliquetos (gusanos marinos). Tienen un sistema circulatorio cerrado donde la sangre siempre está dentro de los vasos. Han desarrollado el primer celoma (cavidad interna) verdadero. 5. ostión). a menudo. Poseen simetría bilateral. Tienen un par de nefridios para la excreción en cada segmento del cuerpo. Los artrópodos incluyen alrededor de 1 millón de especies que ocupan prácticamente todo tipo de hábitat. Poseen un exoesqueleto segmentado formado de quitina. Presentan un pie ventral musculoso que utilizan para moverse.GUÍA METODOLÓGICA DE BIOLOGÍA PHYLUM ANÉLIDOS (GUSANOS ANILLADOS) El cuerpo de los anélidos se compone de secciones llamadas segmentos. oligoquetos (lombriz de tierra) e hirudíneos (sanguijuelas) (Fig. Viven en el suelo. El plano corporal es un “tubo dentro de un tubo”. 5. El tracto digestivo está completo. escafópodos (colmillo de elefante). ostra.22). Los moluscos son un grupo numeroso de organismos que se encuentran en hábitats que van desde los mares hasta los desiertos. tórax y abdomen. siendo el tubo interno el tracto digestivo. calamar y nautilo) (fig.23). Presentan apéndices articulados pares para la locomoción o natación. El cuerpo está dividido en tres partes: cabeza. Se clasifican en cinco clases distintas: anfineuros (quitón). gasterópodos (caracol de jardín) y cefalópodos (pulpo. en charcas y en los océanos. secreta una concha dura de calcio. PHYLUM ARTROPODOS. El tracto digestivo es completo y tiene dos aberturas: la boca y el ano. Dentro de la boca de muchos moluscos hay una estructura llamada rádula. Poseen pequeñas cerdas o quetas que utilizan para la locomoción. pelecípodos o bivalvos (almeja. en riachuelos de agua dulce. que se usa para raspar el alimento. desde el fondo de los mares hasta las cumbres más altas de las montañas. PHYLUM MOLUSCOS Es un grupo de invertebrados de cuerpo blando que poseen un manto que. 220 .

24) 221 . Ejemplos de anélidos Figura 5. El primer par son quelíceros. Presentan ojos simples llamados ocelos. Son principalmente terrestres. garrapatas). los cuatros pares restantes son patas ambulatorias. Casi todos son carnívoros.GUÍA METODOLÓGICA DE BIOLOGÍA Han desarrollado el más alto grado de cefalización de todos los invertebrados. La clase arácnida incluye arañas.22. modificados como pinzas o colmillos. ácaros y garrapatas. Fig. 5. un sistema circulatorio abierto y sexos separados. Han dado origen a los únicos invertebrados voladores. 5. el segundo par. Presentan ojos compuestos con una visión tipo mosaico. los artrópodos se dividen en 4 subphyla: quelicerados (arañas. funcionan como órganos de alimentación. unirramios. Ejemplos de moluscos SUBPHYLUM QUELICERADOS El cuerpo se compone de dos partes: cefalotórax y abdomen. presentan simetría bilateral. Basándose en la especialización de los segmentos. escorpiones. Además.23. son celomados (poseen un celoma reducido). a excepción de los cefalópodos. Clasificación. crustáceos (cangrejo. los pedipalpos. Los quelicerados tienen seis pares de apéndices en el cefalotórax. El cordón nervioso es ventral al tubo digestivo. escorpiones. (milpiés) y Hexápodos (insectos). cochinilla). (Fig.

y mandíbulas. mientras que otros.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Tienen un par de antenas. 5. las pulgas de agua y las cochinillas son ejemplos de crustáceos (Fig. Las langostas. que son partes bucales para masticar y romper el alimento. Ejemplos de quelicerados SUBPHYLUM CRUSTÁCEOS La mayoría de los crustáceos son marinos.24. viven en lugares húmedos de la tierra. además de la quitina. 5. El cuerpo de la mayoría de los crustáceos es segmentado compuesto de dos partes: cefalotórax y abdomen.25) SUBPHYLUM UNIRRAMIOS El subphylum Uniramia contiene la mayor cantidad de especies y el mayor número de organismos. aunque hay algunos dulceacuícolas. 222 . los camarones. Reciben este nombre debido a que sus apéndices no están ramificados. En la mayoría el exoesqueleto se endurece con compuestos de calcio. los cangrejos. Son de hábitat terrestre. que son apéndices sensoriales. como las cochinillas. Presentan dos pares de antenas.

En ocasiones tienen uno o dos pares de alas articuladas en el tórax. Ejemplos de crustáceos Los quilópodos presentan un cuerpo alargado formado por múltiples segmentos. La cabeza tiene dos ojos compuestos y ojos simples. Su cuerpo se divide en tres: cabeza.27). 5.26) SUBPHYLUM HEXAPODOS O INSECTOS Los insectos se encuentran en casi todos los ambientes habitables de la Tierra.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. incluyen un par de antenas y varios pares de piezas bucales (5. 5.25. Presentan tres pares de patas. por lo que son los únicos invertebrados que pueden volar. tórax y abdomen. 223 . Incluye a los ciempiés que poseen un par de patas en cada segmento y a los milpiés con dos pares de partas por segmento (Fig. Es el grupo más grande de artrópodos terrestres.28). proceso por el cual el animal pasa de etapa de larva a adulto (5. Presentan metamorfosis.

27. Las larvas tienen simetría bilateral y son parecidas a las de los cordados más primitivos.29). Tienen la simetría radial más avanzada.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. ofiuroideos (estrella serpiente). Anatomía del saltamontes Fig. 5. 224 . Carecen de cabeza y segmentación (Fig. Son los únicos que poseen un exoesqueleto de espinas calcáreas y un endoesqueleto de placas dérmicas. crinoideos (lirio de mar) y holoturoideos (pepino de mar).28. Son triblásticos. equinoideos (erizo de mar). 5. Metamorfosis incompleta y completa PHYLUM EQUINODERMOS Son los únicos que poseen un pie ambulacral en forma de tubo que usan para la locomoción. Los equinodermos se clasifican en cinco clases: asteroideos (estrella de mar). 5. Ejemplos de quilópodos Fig. Poseen un sistema nervioso radial sin cerebro. Brazos generalmente múltiplos de cinco y poseen glándulas digestivas denominadas ciegos hepáticos. Tienen branquias dérmicas y pedicelarios que las protegen. aprensión y para abrir las conchas de moluscos con los que se alimentan. Presentan ano en posición dorsal y una boca ventral. 5.26.

29. presentan una gran variedad de formas. y que son ejemplos de posibles eslabones que vincularían a vertebrados e invertebrados. 225 ..31). cefalización y metamerismo (segmentación del cuerpo). Anatomía de una estrella de mar PHYLUM CORDADOS Los cordados evolucionaron a lo largo de unos 500 millones de años. que muestran algunos de los rasgos característicos de los cordados. 5. Tienen notocorda que es una varilla delgada y flexible que da sostén al cuerpo y un cordón nervioso dorsal que corre a lo largo de la superficie superior del cuerpo Los cordados inferiores están formados por organismos menos evolucionados. evidencia de su gran capacidad de adaptación. urocordados (ascidias) y cefalocordados (anfioxo) (Fig. Presentan un endoesqueleto de tejido vivo en el cuál se insertan los músculos y también proporciona protección a órganos internos vitales. Tienen hendiduras branquiales faríngeas.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Un corazón situado en la parte ventral y un sistema circulatorio cerrado. 5. 5.30). Estos están clasificados en tres subphyla: hemicordados (gusano bellota) (Fig. Los cordados superiores constituyen el subphylum vertebrados constituido por animales con espina dorsal. Son eucelomados (con celoma verdadero) con simetría bilateral. o vestigios de ellas. Poseen un sistema nervioso dorsal tubular.

En los tiburones y las rayas. los sexos están separados y presentan fecundación interna. aunque las aletas están modificadas en las diferentes especies. peces cartilaginosos. reptiles. Algunas especies son ovíparas. Casi todos tienen escamas y aletas. son predadores y se alimentan de peces y otros animales marinos.30. ni escamas ni dientes verdaderos. Respiran por branquias. CLASE OSTEOICTIOS (PECES ÓSEOS) En los peces óseos. 5. En medio del hocico hay una sola abertura nasal. Branchiostoma CLASE AGNATOS (PECES SIN MANDÍBULA) No tienen aletas pareadas. La reproducción es sexual.GUÍA METODOLÓGICA DE BIOLOGÍA SUBPHYLUM VERTEBRADOS Estos animales presentan una columna vertebral. tienen un corazón de dos cámaras. Tienen un endoesqueleto que provee protección a los órganos internos. peces óseos. anfibios.31. Las hembras liberan sus huevos al agua. La mayoría poseen también una vejiga natatoria. Fig. donde son fecundados por los espermatozoides. Las rayas tienen cuerpo aplanado y aletas pectorales anchas en forma de alas. La mayoría de los tiburones son largos y delgados y pueden nadar rápidamente. Fig. Ejemplo de cefalocordado. que es una estructura llena de gases que ayuda a mantener al pez a flote en el agua. En general. Este subfilo se divide en siete clases: peces sin mandíbula. otras son ovovivíparas. Ejemplos de hemicordados CLASE CONDROICTIOS (PECES CARTILAGINOSOS) Los tiburones y las mantas (rayas) constituyen esta clase ya que tienen esqueletos de cartílago y no de hueso. 226 . 5. aves y mamíferos. el esqueleto se compone principalmente de hueso.

CARACTERISTIC AS UNICAS METAMERISMO CEFALIZACION CAPAS GERMINALES ESQUELETO PHYLUM Poriferos Cnidarios Platelmintos Nematodos Anélidos Moluscos Artrópodos Equinodermos Cordados 227 CORDON NERVIOSO CENTRAL SIMETRIA CELOMA CLASES . Posteriormente en plenaria se presenta para su retroalimentación.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y completa el siguiente cuadro de doble entrada.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental acerca de la importancia de los organismos del reino Animalia PHYLUM Poriferos IMPORTANCIA ECONÓMICA IMPORTANCIA ECOLÓGICA IMPORTANCIA MÉDICA Cnidarios Platelmintos Nematodos Anélidos Moluscos Artrópodos Equinodermos Cordados Comentario final ___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 228 .

Tienen un corazón de 4 cámaras. El vuelo es una de las características más importantes en las aves. Los anfibios son poiquilotermos y permanecen inactivos durante el tiempo frío. Los anfibios fueron los primeros vertebrados en adaptarse a la vida terrestre. los anfibios viven en tierra. El corazón de cuatro cámaras de un mamífero es una doble bomba que mantiene la sangre desoxi229 . Sus patas delanteras se han modificado y se han convertido en alas. CLASE REPTILES Estos animales son poiquilotermos.GUÍA METODOLÓGICA DE BIOLOGÍA CLASE ANFIBIOS Los anfibios son vertebrados que tienen branquias cuando son larvas y pulmones cuando son adultos. Sus cuerpos están cubiertos con plumas y pueden mantener constante la temperatura de su cuerpo (son homeotermos). Los reptiles se clasifican en cuatro ordenes: rincocéfalos (tatuara). CLASE AVES Las aves presentan bocas modificadas en picos. huesos finos y huecos. Como adultos. Poseen órganos reproductores adaptados a la fecundación interna. caudados (salamandras) y apodos (cecilias). cocodrilos (lagartos). al menos parte del tiempo y respiran por pulmones. Los huevos se fecundan dentro del cuerpo de la hembra. La piel de los reptiles es seca. CLASE MAMÍFEROS Un mamífero es un vertebrado que tiene pelo. quelonios (tortugas) y escamosos (lagartos y serpientes). la mayor parte de los anfibios jóvenes son acuáticos y respiran por medio de las branquias. Sus cuerpos están adaptados para satisfacer los requisitos del vuelo: tener poco peso y mucha potencia. y son homeotermos. gruesa e impermeable y protege al cuerpo de la desecación en climas muy cálidos y secos. Después que salen de los huevos. Los anfibios se dividen en tres ordenes: anuros (ranas y sapos). pero algunas especies pasan mucho tiempo en el agua. Están adaptados para la reproducción en tierra. Este período de inactividad se conoce como hibernación. cubiertos con una piel seca y escamosa. pulmones bien desarrollados. Sus patas traseras sirven de sostén al cuerpo. El huevo de los reptiles tiene un cascarón que evita que se seque en la tierra.

tigre. la parte que es el centro de interpretación sensorial y que controla las respuestas musculares. La mayoría de los mamíferos paren sus crías vivas. venado. cabra). perezoso). proboscídeos (elefante) y primates (lémures. expónganlo en plenaria para compartirlo con todo el grupo. quirópteros murciélagos). Cada mamífero tiene dientes de diferentes tipos para diferentes funciones. delfín). desdentados (oso hormiguero. marsupiales (canguro. Los mamíferos se clasifican en varios ordenes: monotremas (ornitorrinco. gorila). que se encuentran en las hembras. tlacuache). perisodáctilos (caballo. ACTIVIDAD Trabaja en pareja. es muy grande. el cerebro. musaraña).GUÍA METODOLÓGICA DE BIOLOGÍA genada separada de la oxigenada. En el mamífero. cetáceos (ballena. insectívoros (topo. 230 . Realicen el siguiente cuadro de doble entrada que resume las características principales de los seis reinos de seres vivos. morsa). Anota el nombre común con su nombre científico. equidna). roedores (ratón. oso). secretan leche que sirve como alimento para las crías durante las etapas del crecimiento inicial. Una vez concluido. artiodáctilos (alce. rinoceronte). chimpancé. pinnípedos (foca. En general los mamíferos son más inteligentes que otros vertebrados. sirenios (manatí). ACTIVIDAD Elabora un álbum de los órdenes de la clase Mammalia donde incluyas las características de cada uno con ejemplos e ilustraciones de los miembros que componen cada uno. carnívoros (lobo. ardilla). El embrión se desarrolla en el cuerpo de la madre dentro de un órgano muscular llamado útero. Las glándulas mamarias.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental acerca de la importancia de los organismos del phylum Cordados CLASE Agnatos IMPORTANCIA ECONÓMICA IMPORTANCIA ECOLÓGICA IMPORTANCIA MÉDICA Condroictios Osteoictios Anfibios Reptiles Aves Mamíferos Comentario final ___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 231 .

Al estudiar las relaciones entre los organismos y el ambiente en que viven. es la parte de la Biología que estudia las interrelaciones de los organismos entre sí y con su medio. Los organismos no viven aislados. y el nivel mínimo que compete a la ecología es el de organismo. Así. proveniente del griego oikos (casa) y logos (tratado). El ecosistema. utilizando diferentes niveles de organización o integración. constituye la unidad básica de la ecología y es un complejo formado por una serie de factores fisicoquímicos y los seres vivos que interactúan constantemente ocupando un área determinada. 232 . el término biosfera o ecósfera se aplica al sistema biológico amplio.4. que abarca a todos los organismos vivos del planeta y sus interacciones con el medio físico. prácticamente autosuficiente. un conjunto de ecosistemas forma un bioma caracterizado por un tipo vegetal determinado o cualquier otro aspecto del paisaje. Por último.GUÍA METODOLÓGICA DE BIOLOGÍA 5. Cada nivel tiene conceptos y atributos particulares. una hormiga. un junco. La comunidad es el conjunto de poblaciones vegetales y animales de diferentes especies que interactúan en un hábitat al mismo tiempo. ACTIVIDAD Dibuja un diagrama en que se ilustre la relación que hay entre la Ecología y las materias que integran tu plan de estudios. un alga. El término Ecología fue propuesto por el biólogo alemán Ernst Haeckel en 1869. un cardumen de atunes es un ejemplo de población. los fenómenos y procesos estudiados por los ecólogos han sido observados y estudiados desde hace varios siglos. pero muchos de los conceptos de Ecología son anteriores al término en un siglo o más. cuando habitan al mismo tiempo en un mismo lugar forman una población. Un individuo es un solo organismo de una especie determinada. la Ecología sistematiza el conocimiento que genera. Por ejemplo: un tiburón. Si bien la Ecología. ¿CÓMO SE RELACIONA LA BIODIVERSIDAD CON EL MEDIO AMBIENTE? La Ecología es una ciencia del siglo XX que nació como una respuesta al progresivo y acelerado proceso de deterioro y desequilibrio medio ambiental que padece la biosfera de nuestro planeta. como ciencia tiene apenas poco más de un siglo de vida.

233 . ecosistema. mimetismo. los factores abióticos de su ambiente. si se le considera en relación con otros individuos de igual o diferente especie. químico y biológico que le rodea. que solo los seres vivos pueden desarrollarla a través de procesos evolutivos de selección natural. Cambios externos que permiten que un organismo se confunda con el medio o imite formas. comunidad. agresivas. adaptaciones anatómicas. donde señalen nombre del científico. bioma. Por ejemplo. que van heredándose de una generación a otra para incrementar sus expectativas de sobrevivencia al medio físico. biosfera) ACTIVIDAD Investiga junto con otro compañero el desarrollo histórico de la “Ecología” y preséntenlo en la línea de tiempo trabajada anteriormente. camuflaje. ¿CUÁLES SON LOS FACTORES DE LOS ECOSISTEMAS? En forma aislada. es decir. año y su aportación. se observa que es afectado por diferentes factores bióticos. sonidos o colores de animales más peligrosos. el individuo es afectado por componentes que no tienen origen vital. población. Hay tres tipos de adaptaciones al ambiente: • Morfológicas o estructurales. debe tenerse claro.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Elabora un collage con distintos recortes donde señales los niveles de organización de la naturaleza que estudia la Ecología (organismo. Sin embargo. ADAPTACIONES AL AMBIENTE Para entender qué es una adaptación biológica.

¿Qué impacto ocasiona el desequilibrio de alguno de los factores en el ambiente? Plantea un ejemplo. 1. 234 . _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ ______________________________________________________________________________ POBLACIÓN La población es el conjunto de individuos de la misma especie que habitan en un área determinada. Por ejemplo. • Conductuales. diapausa. al reproducirse. que comparten cierto tipo de alimentos y que. intercambian información genética. Por ejemplo. migración. ACTIVIDAD Realiza una investigación documental de los factores abióticos y bióticos y a partir de lo investigado elabora en tu libreta un mapa conceptual de los factores que constituyen a los ecosistemas.GUÍA METODOLÓGICA DE BIOLOGÍA • Fisiológicas o funcionales son aquellas que guardan relación con el metabolismo y funcionamiento interno de diferentes órganos o partes del individuo. conductas. ¿Cómo se relacionan los factores bióticos y abióticos? _______________________________________________________________________________ _______________________________________________________________________________ 2. invernación. estivación. Son cambios de conducta de los organismos que permiten ajustarse a su ambiente o trasladarse periódicamente a otro. hibernación. cuando las condiciones ambientales son desfavorables. poiquilotermia y homeotermia.

distribución espacial. distribución de edades. fisiológicas y conductuales) y escribe dos ejemplos de cada una ¿Por qué la ballena. hasta de 800 metros. proporción de sexos. y a qué tipo de adaptación corresponde? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ACTIVIDAD Haz una investigación sobre las características dinámicas de la población: densidad.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los tipos de adaptaciones al ambiente (morfológicas. y por qué? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ¿Por qué muchas aves nidifican entre las rocas. puede estar expuesta a grandes diferencias de presión. tasa de mortalidad. tasa de natalidad. tasa de crecimiento. potencial biótico. al parecer sin inconveniente? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ¿Qué tipo de adaptación han desarrollado los osos polares. migración 235 . curva de sobrevivencia.

las relaciones que se establecen entre la natalidad. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ 236 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD La gráfica siguiente representa las curvas de crecimiento de dos poblaciones: A y B. la mortalidad y las migraciones a partir del año 2002. En cuál de las poblaciones de la gráfica se evidencia el potencial biótico? ¿Por qué? _______________________________________________________________________________ Menciona dos causas que determinaron en ambas poblaciones la reducción del número de organismos. _______________________________________________________________________________ _______________________________________________________________________________ ¿Qué le podría ocurrir a la población B en el transcurso de los próximos años? _______________________________________________________________________________ _______________________________________________________________________________ Explica en la población A.

incrementa la acción de la resistencia ambiental.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Explica y ejemplifica el siguiente planteamiento. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _____________________________ ACTIVIDAD – CURVA DE SOBREVIVENCIA La siguiente gráfica representa la curva de sobrevivencia de las poblaciones. 237 . Describe la gráfica y específica en qué casos ocurre una curva convexa. una curva cóncava y una línea recta. “La incidencia de los factores limitantes del medio ambiente sobre la población.

Explica que le sucederá a los ecosistemas de las zonas costeras de Cuba. si se vierten en los mismos desechos tóxicos industriales.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD La siguiente gráfica representa el comportamiento de una población de gaviotas en una zona costera de Cuba. 1. Explica el comportamiento de esta población de gaviotas del año 2000 al 2005. Argumenta 3 medidas que pueda aplicar el hombre para proteger el equilibrio de los ecosistemas costeros. ___________________________________________________________________________________ ___________________________________________________________________________________ _____________________________________________________________________________ 3. Sitúa en la gráfica el límite máximo ambiental. ___________________________________________________________________________________ ___________________________________________________________________________________ __________________________________________________________________________ 2. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 238 .

y limitado por ejemplo la parte inferior de un leño podrido. fisiológicos y bióticos que necesita un organismo para vivir.GUÍA METODOLÓGICA DE BIOLOGÍA HÁBITAT Y NICHO ECOLÓGICO El hábitat de un organismo es el lugar donde vive. En un hábitat particular pueden vivir varios animales o plantas. En contraste. en función de factores como el alimento disponible y el número de competidores. Puede ser vastísimo. por ejemplo. mientras que las tortugas adultas son consumidores primarios y se alimentan de plantas verdes como apio acuático. tortugas jóvenes de río son consumidores secundarios. El nicho ecológico no es un espacio demarcado físicamente. Depende de las adaptaciones estructurales del organismo. Algunos organismos. el nicho ecológico es el estado o el papel de un organismo en el ecosistema. sino una abstracción que comprende todos los factores físicos. Una de las generalizaciones importantes de la ecología es que dos especies no pueden ocupar el mismo nicho ecológico. comen caracoles. de sus respuestas fisiológicas y su conducta. suelo y agua. cuáles son sus límites de movimiento y sus efectos sobre otros organismos y sobre partes no vivientes del ambiente. pero siempre es una región bien delimitada físicamente. o muy pequeño. En cambio. ocupan sucesivamente nichos diferentes. Para describir el nicho ecológico de un organismo es preciso saber qué come y qué lo come a él. aire. o las grandes zonas continentales. Puede ser útil considerar al hábitat como la dirección de un organismo (donde vive) y al nicho ecológico como su profesión (lo que hace biológicamente). ACTIVIDAD Busca tres ejemplos de especies donde describas su hábitat y nicho ecológico. 239 . que se alimenta de plantas. su área física. gusanos e insectos. químicos. alguna parte específica de la superficie de la tierra. los animales con distintas fases en su ciclo vital. pero la rana adulta es un consumidor secundario y digiere insectos y otros animales. Ilústralo con imágenes. Una sola especie puede ocupar diferentes nichos en distintas regiones. como el océano. Un renacuajo es un consumidor primario.

32 Potencial biótico y resistencia ambiental Los factores denso-dependientes o intrínsecos son los que afectan y surgen dentro de la mima población. Fig. Por ejemplo: alimento. 5. Los factores denso-independientes o extrínsecos son los que afectan a la población y provienen del exterior. El balance de los ecosistemas surge del balance interno que existe entre el potencial biótico de cada especie con la resistencia ambiental del hábitat.GUÍA METODOLÓGICA DE BIOLOGÍA POTENCIAL BIÓTICO Y RESISTENCIA AMBIENTAL Cuando el índice de crecimiento en condiciones favorables es máximo (potencial biótico) las poblaciones tienen la capacidad máxima de aumentar el número de individuos. Por ejemplo: factores climáticos. lucha por recursos limitados. la resistencia ambiental es la suma de factores denso-dependientes y denso-independientes que contribuyen a disminuir el nacimiento y sobrevivencia de los organismos de una población (Fig. 240 . enfermedades. terremotos y la depredación.32). competencia interespecífica. 5. competencia intraespecífica. etc. rapacidad. el fuego. En cambio.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Grafica cómo sería la resistencia ambiental de la cucaracha y del oso panda. Explica el por qué de cada caso Cucaracha Oso panda Expón la importancia de la curva de sobrevivencia para una compañía de seguros de vida 241 .

la relación entre organismos de diferentes especies dentro de la comunidad se denomina interespecífica ACTIVIDAD .GUÍA METODOLÓGICA DE BIOLOGÍA RELACIONES ENTRE POBLACIONES Entre los individuos de una comunidad se establecen múltiples y diversas interacciones. La relación que se establece entre los individuos de una misma especie y una misma población. Asociación familiar: Asociación gregaria: Asociación colonial: Asociación estatal: 242 . se denomina intraespecífica.RELACIONES INTRAESPECÍFICAS Investiga en que consiste cada una de las relaciones intraespecíficas. A su vez. describe un ejemplo e ilústralo en cada caso.

La variedad de poblaciones que conforman una comunidad determina su diversidad.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . manteniendo un cierto equilibrio dinámico. Las comunidades pueden clasificarse por el tamaño y forma de vida de los organismos en: 243 .RELACIONES INTERESPECÍFICAS Considerando la tabla de abajo rellena los espacios vacios con los simbolos +. CONCEPTO DE COMUNIDAD Comunidad es el conjunto de poblaciones de animales y plantas que ocupan un área determinada con interdependencia mutua entre los individuos que la constituyen. así como las relaciones de dominancia y cobertura.ó 0 de las especies A y B de acuerdo a la descripción de la interacción. . Realiza una investigación donde documentes un ejemplo de cada una de las relaciones interespecíficas.

selva. denominadas estratos.5.33. el acahual (zonas de crecimiento secundario en las selvas) y malpaís (zona de crecimiento sobre suelos volcánicos). por lo que depende de las comunidades contiguas. desierto.GUÍA METODOLÓGICA DE BIOLOGÍA Comunidad mayor. Estratificación en un bosque 244 . 5. Se determinan en relación con su extensión. 5.). Por ejemplo. distinguiéndose cuatro estratos: arbóreo. se han hecho una serie de divisiones en capas de las comunidades que integran al ecosistema. Comunidad menor. Biomas o grandes conjuntos de organismos que habitan una amplia zona geográfica (tundra. En ecología vegetal es el conjunto de plantas pertenecientes a un límite de altura dado. etc. Comunidad dominante.34. el pino (Pinus sp) es la especie dominante del bosque de coníferas. Ecotono entre un bosque caducifolio y un bosque de coníferas Fig. arbustivo. subarbustivo y rasante o mucinal (Fig. Estratificación de las comunidades Con objeto de facilitar el estudio de la distribución de los organismos. Cuando una especie destaca por su biomasa y abundancia y es la que controla el flujo de energía dentro de la comunidad. Por ejemplo.34) Fig. taiga.

• Barreras biológicas. Entre éstas se hallan: • Barreras físicas. enemigos. es decir. por lo que es muy rico en diversidad y que caracterizan a un lugar determinado. como la ausencia de alimento apropiado o la presencia de competidores eficaces. la humedad (relativa. es decir. enfermedades.34). media. como la tierra para los animales acuáticos y el agua para muchos de los animales terrestres o la variación de las características del suelo y del agua. La estructura se relaciona además con el comportamiento de algunos de estos elementos. como la temperatura (media. Densidad y diversidad en las comunidades Se entiende por densidad al número de individuos de una misma especie que conforman una población en un área determinada. No sólo es la descripción del arreglo espacial en el plano vertical y horizontal de la comunidad sino también conocer las relaciones numéricas entre los organismos.GUÍA METODOLÓGICA DE BIOLOGÍA La composición de una comunidad se refiere a la enumeración de elementos que la conforman. la forma en que se reparten los recursos. Distribución de las comunidades. hacer una lista de las especies que integran la comunidad. Las comunidades vegetales dominantes en su estado de clímax tienen una fisonomía distinta a la de otras comunidades de plantas. etc. Un ecotono suele contener a organismos de cada una de las comunidades y además organismos característicos de la comunidad ecotonal. pero en todo caso es más angosta que las áreas de las comunidades adyacentes. que es una zona de unión que puede ser escasa o de una extensión lineal considerable. anual o mensual). a más individuos más densidad. La tendencia hacia una diversidad y densidad aumentada en las uniones de las comunidades se denomina efecto de borde. 245 . estacional o extrema). • Barreras climáticas. El término densidad no debe confundirse con diversidad que es el número de poblaciones de especies distintas que conforman una comunidad. etc. las cuales a su vez determinan el tipo de comunidades de animales. Los factores externos que limitan la distribución de las comunidades se denominan barreras. Estas barreras de transición entre dos o más comunidades diversas se denominan ecotonos (5.

35). por el cual la composición de especies de una comunidad se modifica como consecuencia de perturbaciones o cambios drásticos. algunos organismos o sus propágulos seguirán en el sitio y tendrán influencia durante la colonización. su biomasa servirá de sustrato a otras que sobrevivirán en el espacio que las pioneras dejaron. Si la perturbación no es tan drástica. Se reconocen dos tipos de sucesión. dependiendo de la magnitud de la perturbación que da inicio: primaria y secundaria.36). se adhieren a la roca volcánica y obtienen sus nutrientes disueltos en el agua de lluvia que retienen mediante estructuras de absorción. deshielos. cuando un volcán hace erupción y no quedan elementos de la comunidad previa. Por ejemplo.) o por la llegada o introducción de organismos foráneos u oportunistas que originan una serie de competencias con las especies autóctonas y en la que se impone la más adaptada. Las características de este espacio ya son distintas de las que prevalecían al comienzo de la colonización. SUCESIÓN ECOLÓGICA La sucesión ecológica es el proceso gradual que implica un reemplazamiento de individuos o de comunidades enteras. A las especies que ocupan las primeras etapas de la sucesión se les denomina pioneras. como producto de la muerte de los organismos (Fig. 5. Se denomina sucesión primaria a aquella que ocurre cuando la colonización empieza sin influencia de la comunidad anterior.GUÍA METODOLÓGICA DE BIOLOGÍA Las poblaciones en las comunidades son poco diversas cuando están sujetas a factores fisicoquímicos fuertemente limitativos pero la densidad aumenta si una población se ha adaptado a estos factores y las otras no como en el caso de la Artemia sp que es abundante en las salinas. etc. Posteriormente. pero no siempre ocurren estos casos. Las sucesiones se dan por cambios en los factores abióticos (humedad. por ejemplo. a este proceso se le denomina sucesión secundaria y es el que constantemente se desarrolla en todas las comunidades naturales. movimientos orogénicos. 5. los líquenes y musgos. por esto las sucesiones están relacionadas con la evolución de las especies. cuando los líquenes o musgos se establecieron (Fig. temperatura. En la sucesión de comunidades primero se dan pequeños cambios llamados microsucesiones que progresivamente conforman la sucesión principal. cuando especies mueren. 246 .

podemos referirnos a esta etapa como aquella en que la comunidad se reemplaza con las mismas especies y. A medida que la sucesión avanza. para alcanzar un máximo en una etapa intermedia. Sucesión ecológica secundaria 247 . la composición permanece también estable. ilústralo. La colmatación de lagos es un ejemplo de sucesión ecológica primaria ACTIVIDAD Investiga un ejemplo de sucesión ecológica primaria y otro de sucesión secundaria. La diversidad de especies también aumenta durante las primeras etapas sucesionales. Fig. El metabolismo o funcionamiento de las comunidades cambia a lo largo de la sucesión. ¿Qué tipo de sucesión ocurriría en una franja vacía en un bosque nacional y por qué? Fig. en pequeña o mediana escala. las relaciones tróficas se vuelven más complicadas. aun en aquellas comunidades aparentemente estables. En términos prácticos.5. que desencadenan procesos sucesionales.36. 5. en todas las comunidades. cercana al clímax. suceden muertes y reemplazamientos de especies.GUÍA METODOLÓGICA DE BIOLOGÍA A la etapa terminal de la sucesión se le denomina clímax. por tanto. Sin embargo.35.

En los suelos pantanosos se encuentra el cativo. 248 . en la desembocadura del río Tortuguero. En ellos crecen árboles como el sangrillo. los hombres de ciencia han comprobado que es notable el incremento de la población de tortugas de diferentes especies que van a desovar en esas playas. donde las preci-pitaciones pluviales oscilan entre los 3. Bosques de menor altura se localizan en el borde de las áreas pantanosas y en las márgenes de los cursos de agua.000 y los 5. por un lado. que llega a alcanzar 60 metros de alto. Por ejemplo. debido a su aislamiento. son los que regulan el almacenamiento y la liberación de elementos nutritivos. que alcanzan 300 metros de altitud.5 ¿CUÁL ES LA DINÁMICA DE LOS ECOSISTEMAS? Los ecosistemas se autoconservan y se autorregulan. En Tortuguero se localizan diferentes tipos de vegetación. conservó prácticamente inalterados todos sus valores naturales. y ya. en las playas hay numerosos cocoteros y palmeras que crecen prácticamente al borde del mar. A su lado proliferan nísperos. gavilanes y cedros machos.000 hectáreas de tierra firme. ACTIVIDAD PARQUE NACIONAL TORTUGUERO Lee detendamente la siguiente lectura El Parque Nacional Tortuguero está situado en la región noreste de Costa Rica. Durante siglos enteros esa zona. en los últimos años. En los años cincuenta de este siglo fue cuando se dejó sentir la presión humana con más fuerza.GUÍA METODOLÓGICA DE BIOLOGÍA 5. Los mecanismos de control. en pleno mar de las Antillas. Sólo desde el aire se puede uno dar idea del conjunto de esta inmensa selva lluviosa tropical. una de las zonas más lluviosas del país. Tortuguero constituye una inmensa llanura empantanada. especie de acacia. así como las aguas territoriales costarricenses frente a ellas. Para poder visitar el parque hay que hacerlo navegando en barca por los cientos de canales y lagunas pantanosas que lo forman. Su extensión abarca 21.000 mm anuales. La creación del área como parque nacional puso fin a todos los desmanes. y por el otro. Ya una crónica holandesa del año 1592 citaba la región de Tortuguero como zona tradicional de desove de las tortugas marinas. el pumpunjoche y el guácimo blanco. Sólo en su parte occidental están los cerros de Sierpe. la producción y descomposición de sustancias orgánicas. pues se recolectaban miles de huevos semanalmente para venderlos. desarrollándose diferentes ciclos de materiales y múltiples transferencias de energía.

A diferencia de la tortuga verde. cuyos antepasados vivieron hace más de 90 millones de años. En la parte occidental de Tortuguero. gavilanes. oropéndolas y colibríes. entre las que destacan tucanes. Se le persigue para obtener de ella el carey. desde la parte oriental de Venezuela hasta Yucatán. de movimientos lentos. uno de los mamíferos más amenazados de extinción. Esta migración de la tortuga verde se debe a que Costa Rica no tiene praderas submarinas donde las tortugas encuentran la base de su alimentación. de unos dos metros de longitud. de agosto a noviembre. guacamayos. de bellísimo color pardo oscuro. acompañados de guacimos y tabacones. en zonas no pantanosas. la de carey no anida en forma masiva en Tortuguero. el oso hormiguero gigante y el manigordo. que cubre el caparazón del animal. Entre los tesoros zoológicos que albergan estas veintiún mil hectáreas protegidas destaca el manatí. la de carey y la caguama o caballera. halcones. pelícanos. La tortuga de carey es una de las más pequeñas de la especie marina. Cuba y Florida. 249 . Numerosos caimanes viven en la orilla de los canales y aves de los más vistosos colores y variados tamaños anidan en ese espléndido lugar. Otra especie muy interesante es el gaspar. se alimenta fundamentalmente de grandes cantidades de plantas acuáticas flotantes. que además se ¡unta en grandes grupos para reproducirse. Jamaica. La especie se aparea en julio y agosto en dos bancos de fondo rocoso. Se han realizado estudios sobre la migración de las especies que visitan Tortuguero y se ha comprobado que se distribuyen por todo el Caribe Occidental. Aunque toda esta rica y variada fauna es importante. La más abundante de todas es la verde. utilizado en joyería. Actualmente se han identificado unas 350 especies. miles de tortugas se concentran para desovar en una sección comprendida entre la boca del río Tortuguero y la desembocadura del Parismina. frente a la desembocadura de Tortuguero. sustancia traslúcida. La tortuga verde realiza la puesta cada dos o tres años y en cada ocasión desova cuatro o cinco veces. considerado auténtico fósil viviente. máximo depredador del parque. Este inofensivo animal. la danta o tapir. zopilotes. Cada año.GUÍA METODOLÓGICA DE BIOLOGÍA Los bosques de palmas o yolillales ocupan grandes extensiones y se dan en suelos que están inundados la mayor parte del año. lo que destaca en Tortuguero es la zona de de-sove de las tortugas marinas. garcillas. Los bosques de Tortuguero están recorridos por el ¡aguar. Tres especies abandonan el mar para desovar en sus playas: la tortuga verde. pájaros fragata. se localizan los bosques de cedro macho y de gavilán. así como monos de diversas especies. un pez de agua dulce.

Transcribe el nombre de una barrera geográfica que se cita en el texto. Su presencia en las playas de Tortuguero es esporádica y no se puede considerar como habitual. ¿Qué fenómeno biológico destaca en Tortuguero? 8. ¿Cuál es el mamífero amenazado en Tortuguero? 4. ¿Cuáles serían los integrantes de una comunidad mayor en Tortuguero. Una vez leído el texto. ¿Cuál es la especie dominante de tortugas en la región citada en el texto? 9. Transcribe el nombre de una población en Tortuguero. El desove de las tortugas constituye uno de los fenómenos biológicos más interesantes que se pueden observar en Tortuguero. y cuáles los de una menor? 250 . 3. Transcribe el nombre de cinco especies de la comunidad que se alberga en los bosques de Tortuguero. ¿Cuál es el mayor depredador de tortugas? 6.GUÍA METODOLÓGICA DE BIOLOGÍA La tortuga caballera se caracteriza por el tamaño grande de su cabeza y porque se alimenta principalmente de erizos. 5. contesta las siguientes preguntas: 1. ¿Para qué se persigue a la tortuga de carey? 10. cangrejos y estrellas de mar. ¿Cuál es el área que ocupa la comunidad de los individuos referidos en el texto? 2. 7.

hasta llegar a los desintegradores que cerrarán el ciclo. ocuparía un tercer nivel. Por ejemplo. Fig. por lo que se dispone de mayor cantidad de energía en cada paso. durante la transferencia de masa y energía hay una enorme pérdida de energía que se libera en forma de calor. mientras que una oveja ocuparía el segundo nivel trófico.39). el cual se denomina nivel trófico. ocuparían un cuarto nivel.GUÍA METODOLÓGICA DE BIOLOGÍA CADENA ALIMENTICIA La cadena alimenticia es la serie de transformaciones que sufren la energía y la materia al pasar a través de los organismos que integran una comunidad. considerando que se tarta de un herbívoro. 5. cada eslabón de una cadena alimenticia representa un nivel diferente de alimentación. los organismos que se alimentan de carnívoros. como los buitres.37). 5. puesto que se alimenta de carne. En este flujo de energía.5.37. Así. se dice que se localizan en el mismo nivel trófico. en ella se indica quién se come a quién (Fig. un jaguar por el contrario. los vegetales ocupan el primer nivel trófico. los organismos pueden ser productores o consumidores. Cuando los organismos comparten la misma fuente de energía. que es menor si la cadena es más corta. Flujo de materia y energía en el ecosistema 251 . En una cadena alimenticia (Fig.

como las plantas. Los consumidores o heterótrofos obtienen su energía de los enlaces de carbono originados por los productores. Tipos de consumidores Fig. Niveles tróficos 252 . Es posible distinguir cuatro tipos de heterótrofos basándose en lo que comen: CONSUMIDOR herbívoros carnívoros omnívoros detritívoros NIVEL TRÓFICO primario secundario o superio todos los niveles --------------- FUENTE ALIMENTICIA plantas animales plantas y animales detrito Tabla 5. Los ejemplos más destacados son las plantas.2. como en la glucosa.GUÍA METODOLÓGICA DE BIOLOGÍA Los productores o autótrofos convierten la energía ambiental en enlaces de carbono. la energía solar para convertir el CO2 en glucosa (u otro azúcar). Otros productores son las bacterias quimiosintéticas que viven en las profundidades oceánicas. Las algas y las cianobacterias también son productores fotosintetizadores. que usan. Estas bacterias toman la energía de productos químicos provenientes del interior de la Tierra y con ella producen azúcares. 5.38. por medio de la fotosíntesis.

253 . si es del tamaño adecuado y se encuentra a una distancia apropiada.39. menos biomasa contendrá. etc. Un concepto muy importante es el de biomasa. Los omnívoros comen tanto animales como plantas. 5.38). Cadena alimenticia REDES ALIMENTICIAS El mundo real es mucho más complicado que una simple cadena alimenticia. la rana lo capturará para comérselo sin que importe el nivel trófico (Fig.40. los saltamontes comen hierbas. Los gavilanes no limitan sus dietas a lagartijas. mientras más alejado esté un nivel trófico de su fuente (detrito o productor). Aún cuando muchos organismos tienen dietas muy especializadas (como es el caso de los osos hormigueros). los carnívoros (excepto algunos muy especializados) no limitan su dieta sólo a organismos de un nivel trófico. las lagartijas comen otras cosas aparte de saltamontes.GUÍA METODOLÓGICA DE BIOLOGÍA Es importante observar que muchos animales no tienen dietas especializa das. y la única manera de desenredar las cadenas es seguir el curso de una cadena hacia atrás hasta llegar a la fuente. Una representación más realista de quien come a quien se llama red alimenticia. no discriminan entre insectos herbívoros y carnívoros. Igualmente. como se muestra en la Figura 5. Las ranas y sapos. 5. Podemos ver que una red alimenticia consiste de cadenas alimenticias interrelacionadas. Un principio general es que. en la mayoría no sucede así. Fig. PIRÁMIDES ALIMENTICIAS Mediante las cadenas alimenticias se va constituyendo la biomasa que es la estructura viva de un ecosistema y que se expresa en peso y calorías. por ejemplo.

mientras que un animal individual (en el caso que estamos analizando) puede pesar. quizás. debido a que el número de autótrofos es mayor al de consumidores (Fig. los árboles de un bosque superan a los animales pero. con un peso de cientos de kilos. un kilo. de hecho. Esta reducción en la biomasa se debe a varias razones: • No todos los organismos en los niveles inferiores son comidos • No todo lo que es comido es digerido • Siempre se pierde energía en forma de calor Es importante recordar que es más fácil detectar la disminución en el número si lo vemos en términos de biomasa. 5. algunos animales pequeños se alimentan de los frutos de árboles.40 Red alimenticia La estructura trófica de un ecosistema se representa gráficamente mediante una pirámide.44). un árbol individual puede ser muy grande. 5. En términos de peso combinado. La biomasa tiende a disminuir conforme se avanza en la cadena alimenticia. No es confiable el número de organismos en este caso debido a la gran variación en la biomasa de organismos individuales. 254 .GUÍA METODOLÓGICA DE BIOLOGÍA Fig. ahora bien. hay más individuos de animales que de árboles. Por ejemplo.

5.41. Pirámide de energía Fig. Cuando ocurre la respiración. Pirámide de número de individuos Fig.42.43. 5.5. Pirámide de biomasa Fig.41) y de energía (Fig.GUÍA METODOLÓGICA DE BIOLOGÍA Hay tres tipos de pirámides alimenticias: por número de individuos (Fig.43) Fig. 5. 5.5.44. que es usada por el organismo o perdida en forma de calor 255 . 5.42). de biomasa (Fig. estos enlaces se rompen y el carbono se combina con el oxígeno para formar CO2 y se libera energía. Pirámide trófica FLUJO DE ENERGÍA A TRAVÉS DEL ECOSISTEMA La energía "fluye" a través del ecosistema como enlaces carbono-carbono.

1. Recuerda la posición de cada uno de acuerdo al nivel trófico al que pertenece y traza la dirección de la flecha hacia quién es comido. ¿Quiénes están en la base de la red alimenticia?_________________________________ 2. ¿Qué pasará con los animales carnívoros? __________________________________________________________________________ 4. recortes o estampas de 12 organismos. Si en un ecosistema. todos los herbívoros murieran por una epidemia ¿Qué pasará con los vegetales? ____________________________________________________________________________ 3.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Elabora una red alimenticia utilizando dibujos. ¿Qué pasaría en la atmósfera si no existieran organismos productores? ___________________________________________________________________________ 256 .

el cual es mucho más activo y se desplaza. Al final. más velozmente entre los seres vivos y su medio.6 ¿CÓMO SE EQUILIBRAN CICLOS BIOGEOQUÍMICOS? La materia se compone de distintos elementos químicos. la energía restante es extraída (y perdida como calor) y los nutrientes inorgánicos son devueltos al suelo o agua para ser utilizados de nuevo. huesos y membranas celulares. Estos son pasados de organismo a organismo cuando uno es consumido por otro. La energía no se recicla en los ecosistemas. • Los nutrientes inorgánicos son reciclados pero la energía no 5. 257 . y el hierro en la sangre. esta fracción se llama pozo de intercambio. En esta etapa. Los autótrofos obtienen estos nutrientes inorgánicos del suelo o el agua que rodea la planta. el nitrógeno de los aminoácidos (las unidades de las proteínas). Los componentes de cada ciclo se conocen como pozos. en el flujo de materia y energía se puede generalizar que: • La fuente primaria de energía (en la mayoría de los ecosistemas) es el sol. todos los organismos mueren y se convierten en detrito. algunos de ellos indispensables para los seres vivos porque constituyen parte del citoplasma. alimento para los descomponedores. En resumen. • La energía y nutrientes pasan de un organismo a otro a través de la cadena alimenticia a medida que un organismo se come a otro. En la biosfera esos elementos circulan a lo largo de trayectorias mayores y menores. Los nutrientes inorgánicos son reciclados. Los nutrientes inorgánicos no contienen uniones carbono-carbono. Algunos de estos nutrientes inorgánicos son el fósforo de dientes. la energía no. uno mayor y el otro menor. mientras que el segundo se compone por una menor cantidad de materiales. • Los descomponedores extraen la energía mantenida en los restos de los organismos.GUÍA METODOLÓGICA DE BIOLOGÍA Toda la energía proviene del sol. por tanto. el primero está compuesto por materiales abundantes de escaso dinamismo y de orden inerte (sin vida). • El destino final de la energía en los ecosistemas es perderse como calor. y su destino final es perderse en forma de calor. conocidas como ciclos biogeoquímicos.

a pesar de esta gran abundancia. porque antes de aprovecharlo es necesario transformarlo en nitratos solubles. una buena proporción de los cuerpos de los seres vivos está constituida por agua (70% en humanos) y dos terceras partes de la superficie terrestre están cubiertas por este líquido. etc. Las plantas convierten los nitratos en aminoácidos. Las proteínas vegetales pueden seguir uno de dos caminos: • Transformarse en proteínas animales que se convierten en urea. amoniaco o ácido úrico. si son del tipo desnitrificante. Desde el punto de vista ecológico. 258 . Esta transformación la realizan bacterias fijadoras de nitrógeno en las raíces de leguminosas. actúan las bacterias putrificantes que producen amoniaco. los seres vivos no usan el nitrógeno en forma gaseosa. Gracias a sus características fisicoquímicas. o nitratos si actúan las nitritobacterias. Al morir el animal.45). 5. nitrógeno y carbono) y sedimentarios (ciclos del azufre y fósforo) CICLO DEL NITRÓGENO El nitrógeno constituye el 78% del aire. De esta manera. CICLO DEL AGUA El agua es un compuesto esencial para la vida en nuestro planeta.46). • Cuando muere la planta. por el estado físico de los materiales. el agua es una molécula de gran estabilidad que permite que muchas sustancias químicas se disuelvan en ella y se vuelvan accesibles para los seres vivos (Fig. los nitratos pasan al suelo y están disponibles para que los absorban las plantas a través de su raíz. se descompone en compuestos de amonio que son atacados por otras bacterias que producen nitrógeno atmosférico (N2). sobre los cuales actúan las nitritobacterias o bacterias putrificantes para producir nitratos o nitrógeno molecular con los que. por su localización. que son la estructura primaria de las proteínas (Fig. los ciclos biogeoquímicos se clasifican en gaseosos (ciclos del agua. 5. finalmente.GUÍA METODOLÓGICA DE BIOLOGÍA Los ciclos se clasifican bajo diferentes puntos de vista: por su función. se reinicia el ciclo.

5. la utilizan y la regresan a la atmósfera en forma de vapor de agua por medio de la transpiración de sus hojas. ya sea como vapor de agua disperso o en forma de nubes. ríos y lagunas. incluidos los glaciares. En forma gaseosa se encuentra en la atmósfera. Ciclo del nitrógeno Las plantas toman a través de sus raíces los nutrientes del suelo disueltos en agua. nieve o granizo y se vuelve a almacenar en los cuerpos de agua. Las plantas extraen el agua del subsuelo. o bien en mantos acuíferos subterráneos. Parte de los acuíferos corren como ríos subterráneos. El agua se encuentra almacenada en forma sólida en las enormes masas de hielo polar. moviéndose por la atmósfera. Ahí se condensa y regresa a la superficie en forma de lluvia.45. en todos los cuerpos de agua. El agua se evapora de todas las superficies donde se encuentra. desembocando nuevamente en cuerpos de agua exteriores.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. pasando del estado líquido al de vapor. donde se almacena. El movimiento del agua descrito por el ciclo hidrológico se realiza mediante procesos físicos. 259 . en su forma líquida. como mares. Los animales dependen del agua presente en los tejidos pulmonares para realizar el intercambio gaseoso y tomar el vital oxígeno del aire. Buena parte del agua de lluvia se permea a través del suelo hasta llegar a los mantos freáticos.

CICLO DEL AZUFRE El ciclo del azufre es de particular interés. la compactación del suelo y la tala de los bosques han disminuido la cantidad de agua que se infiltra en el subsuelo y aumentado la que regresa a los océanos. cistina y cisteína. Por otro lado. ya que la creación de presas.47). forma parte de los aminoácidos. el 80% restante recarga el suelo y los mantos freáticos. 5.46. porque a pesar de ser un elemento menor sus estados de oxidación le permiten combinarse con muy variados cationes bajo condiciones fisicoquímicas contrastantes (Fig.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Además. 5. la extracción del agua subterránea por medio de pozos para la irrigación ha alterado también estas proporciones. Ciclo del agua Se estima que el 20% de la lluvia anual se deposita en los océanos. 260 . este elemento desempeña un importante papel en el metabolismo de plantas y animales. la pavimentación. Pero estas proporciones se han visto seriamente alteradas por la actividad humana.

También participa en la reducción bacteriana de los sulfatos. la excreción de los animales aporta sulfatos al ciclo. En el proceso de la producción primaria se incorpora el azufre en forman sulfatos y. Fig. el azufre se puede encontrar en distintas combinaciones: • Sulfuros. • Sulfatos (combinado con múltiples cationes) comunes en depósitos sedimentarios en fondos lacustres y marinos por descomposición incompleta de la materia orgánica. Presentes en las rocas ígneas. • Estado nativo: se presenta en forma de moléculas unidas. gaseosa y sólida de la superficie terrestre.GUÍA METODOLÓGICA DE BIOLOGÍA En la corteza terrestre. 261 . reducen los sulfatos (SO4 → H2S) y otras más oxidan los sulfuros (tiobacilos). denominadas "desulfovibriones". 5. Ciclo del azufre Este ciclo y el del nitrógeno se afectan cada vez más debido a la contaminación atmosférica porque los óxidos de nitrógeno y de azufre circulan rápidamente y en poca concentración. en contraste. Este elemento se caracteriza porque implica las fases líquida.47. pero la combustión de petróleo (o sus derivados) y del carbón incrementan su concentración. está relacionado con emanaciones de carácter volcánico y es producido por la oxidación incompleta del ión sulfuro. Algunas bacterias transforman: H2S → S → SO4 y otras.

262 .48). es que este gas es usado por los vegetales en la producción de carbohidratos (Fig. En la atmósfera se encuentra el dióxido de carbono (CO2) y la proporción que representa es sostenida por plantas y animales porque es un producto final de la respiración. como carbohidratos. grasas y proteínas. 5. Otro aspecto importante. Los carbohidratos siguen distintos trayectos: • Un animal los consume al alimentarse de plantas para obtener energía liberando CO2.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. que pasa de nueva cuenta a la atmósfera. 5.48. Ciclo del carbono (dióxido de carbono) CICLO DEL CARBONO (DEL DIÓXIDO DE CARBONO) El metabolismo de los seres vivos requiere de muchos compuestos para su desarrollo y contienen un importante elemento: el carbono. • Al morir plantas y animales se descomponen las sustancias orgánicas de que están formados.

Desafortunadamente. La mayor reserva de fósforo está en la corteza terrestre y en los depósitos de rocas marinas. en los cuales se alimentan básicamente de peces. donde se disuelve en el agua del terreno para ser utilizado por los vegetales. de moléculas almacenadoras de energía (ATP). 263 . El fósforo biológico forma parte del esqueleto de los vertebrados (como fosfatos de calcio) y sólo una pequeña cantidad participa en el citoplasma celular. así. Durante este ciclo: • Se libera fósforo de las rocas y el suelo hacia los ecosistemas. al quedar sepultadas y al someterse a grandes presiones forman carbón.GUÍA METODOLÓGICA DE BIOLOGÍA • Las plantas. en estos últimos se forman nódulos con una alta proporción de P2O5 (30%) (Fig. del cual es liberado para incorporarse en los ecosistemas. la participación del hombre ha provocado alteraciones al acelerar las pérdidas de fósforo por la excesiva extracción de roca fosfatada de origen geológico antiguo. y se encuentra también en los huesos y dientes de animales. también es un componente de los ácidos nucléicos. CICLO DEL FÓSFORO El ciclo de este elemento tiene como pozo depósito las rocas de la corteza. éste retoma al suelo para después sedimentarse en los lagos y en los mares. también las corrientes marinas ascendentes han hecho aflorar sedimentos ricos en fósforo orgánico. hulla. el cual originará turba. que al ser empleados como combustibles o por influencias climáticas. lignito o petróleo. regresa a la atmósfera como CO2.49). Un epiciclo de este elemento está vinculado con las aves marinas que depositan gradualmente guano en los litorales. aunque una buena parte se aloja en los sedimentos de aguas profundas y poco profundas. proporción similar al contenido de las rocas ígneas. 5. El fósforo es un elemento que forma parte del citoplasma celular. Los herbívoros tienen un porcentaje mucho más alto de fósforo en su esqueleto y también lo eliminan a gran velocidad mediante las heces fecales. las plantas superiores contienen tres décimas del 1% de su materia seca en fósforo.

GUÍA METODOLÓGICA DE BIOLOGÍA • Los animales obtienen fósforo al alimentarse de las plantas o de otros animales que las hayan ingerido. tierra y aire de la superficie terrestre funcionan como un solo y gran ecosistema denominado biosfera 264 . Ciclo del fósforo La conclusión fundamental del estudio de los ciclos biogeoquímicos. los vientos de procedencia marina transportan una parte significativa del sodio que las corrientes fluviales proporcionan a las aguas oceánicas. la integración de las interfases agua. también deposita pequeñas cantidades de fosfatos en la tierra o en el agua. Fig. como se denomina al excremento de muchas aves. por ejemplo. 5.49. Este gran proceso cíclico permite mantener la salinidad marina y un intercambio de elementos entre mar y tierra con la participación innegable de la atmósfera. • El guano. • Al morir las plantas o animales liberan fósforo que se reintegra al suelo. Así. Dicho elemento puede disolverse o ser acarreado por las lluvias a los mantos acuíferos o al océano. es que forman el gran ciclo geoquímico realizado entre los océanos y las masas continentales.

Sin embargo es posible construir. unidades ecológicas superiores de mayor cuantía. Es así como todos los ecosistemas de estructura y organización semejante se agrupan bajo el concepto de bioma. Rastrea una molécula de fósforo de una roca rica en fosfato al ADN de un carnívoro. Explica cómo llega el gas nitrógeno del aire a la plantas __________________________________________________________________________________________ __________________________________________________________________________________________ 4. ya que se conjugan todos los eslabones necesarios para constituir un ciclo energético completo.7 ¿CUÁLES SON LAS GRANDES DIVISIONES DE LA BIOSFERA? La cualidad más relevante del ecosistema estriba en su independencia energética. ¿De donde proviene el CO2 que utilizan las plantas en la fotosíntesis? __________________________________________________________________________________ 2. ¿Cómo han alterado las actividades humanas el ciclo del carbono y cuáles son las consecuencias para el clima futuro? __________________________________________________________________________________________ __________________________________________________________________________________________ _________________________________________________________________________________________ 3.¿Qué hace que el ciclo del fósforo sea fundamentalmente diferente de los ciclos del carbono y del nitrógeno? __________________________________________________________________________________________ __________________________________________________________________________________________ _________________________________________________________________________________________ 5. El ecosistema ocupa entre todas las categorías de organismos ecológicos un lugar principal porque representa la unidad de convivencia energéticamente autárquica más pequeña. 265 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Utiliza los esquemas de los diferentes ciclos biogeoquímicos para responder a las siguientes preguntas 1. su autarquía. en un plano abstracto.

Se nombra por el tipo dominante de vegetación. no nos referimos a la selva amazónica o a la selva africana sino a todas las selvas del orbe. ¿Esperarías encontrar exactamente las mismas especies de animales y plantas en la región de la tundra de Alaska y en la región de la tundra de los Andes? ¿Por qué? 4. Explica el porqué de esta afirmación 266 . En el siguiente cuadro comparativo se dan a conocer algunas características abióticas y bióticas de los Biomas Terrestres (Tabla 5. con una cierta regularidad tanto en el plano horizontal (latitud) como en el vertical (altitud). Haz escuchado el comercial que dice “Apaga la luz porque se inunda Tabasco”. por el contrario. formadas por los diversos ecosistemas terrestres donde viven comunidades de plantas y animales (bióticos). y cuya distribución está determinada por el clima. ¿Qué diferencia existe entre el bioma desierto y el ecosistema desierto? Escribe un ejemplo 2. Los biomas no se distribuyen en forma aleatoria sino. El conjunto de todos los biomas viene a integrar por último la biosfera. cada uno se superpone en una vasta zona de transición llamada ecotonía.3) ACTIVIDAD Contesta en tu libreta las siguientes preguntas respecto a los biomas 1. por el contrario. Un bioma no es un lugar.GUÍA METODOLÓGICA DE BIOLOGÍA Los biomas son las comunidades típicas de las grandes regiones climáticas. es una categoría. Cuando hablamos de la selva. Un bioma es una comunidad de plantas y animales con formas de vida y condiciones ambientales similares e incluye varias comunidades y estados de desarrollo. presión atmosférica. BIOMAS TERRESTRES Son extensas regiones geográficas. es decir por factores fisicoquímicos llamados abióticos. ¿Por qué se encuentran biomas similares en grandes latitudes y en grandes altitudes? 3. altitud. suelo. que poseen características y adaptaciones apropiadas para el ambiente en que se desenvuelven. sino que. No suele haber línea de demarcación precisa entre biomas adyacentes.

centro de Canadá. Musaraña y Linces. lianas y enredadera. Olmos. marta y visón Bosque Caducifolio Bosque de Coníferas Los suelos son ricos porque la meteorización es alta y la actividad biológica también. Del nivel o estrato superior: monos. cuyas hojas en forma de aguja son perennes (siempre verdes) lo que les permiten soportar bien las heladas y perder poca agua. Ciervo. Norte de Canadá. Durango. de lluvia anual Todas las regiones cercanas al ecuador tienen en común el ser calurosas. la capa más profunda siempre es helada llamada Permafrost Flora Fauna Tundra Sur Caribú. Robles. alces. en México Chihuahua. en ambas. etc. Las especies de árboles que forman el bosque son muy numerosas: Hayas. Congo.3. Árboles de conífera como el Pino y el Abeto. etcétera con mucha humedad y escasa luminosidad. No es apto para la agricultura (en tres o cuatro cosechas pierde sus nutrientes). nevadas intensas y cortos periodos de verano. EUA y en México en laderas de la Sierra Madres y el eje volcánico transversal Clima Polar frío todo el año. Roedores.15ºC y 5ºC 300 mm. con inviernos largos. hojas que chorrean para evitar el exceso de agua y el lavado de nutrientes. Lobos. periodos secos. y reptiles. de lluvia anual Frío o templado y húmedo. Puerco Espín. herbívoros: venados.GUÍA METODOLÓGICA DE BIOLOGÍA Bioma Localización Regiones cercanas a casquetes polares: Alaska. ya que el suelo desnudo se hace costroso. de lluvia anual Templado con las cuatro estaciones del año bien marcadas y alternancia de lluvias. Teca. Canadá. en zonas de las altas montañas: Siberia. La temperatura media anual es de 23'C. Las temperaturas medias oscilan entre . Biomas Terrestres Suelo Permanentemente helado. osos polar. parte de Chiapas y Tabasco. Castaños. en la cuenca del Amazonas de América del Sur. Arbustos. Ébano. tienen una temperatura que oscila entre los 20-25ºC. orquídea). en las aguas superficiales gran diversidad de peces. Gato montés. Cedro. epífitas (p/e. solo unos centímetros se deshiela en verano. debido a que la mayor parte de los nutrientes se encuentran en los seres vivos y no en el suelo. su color es café forestal. y en México. Bosque Tropical 267 . Si este ecosistema es destruido. Árboles de 10-20 mts. el suelo es de color grisáceo y muy ácido. serpientes e insectos. Sur de Veracruz. debido a la lenta descomposición del material vegetal de la superficie. plantas herbáceas. en los estratos más bajos: batracios. lobo blanco. su recuperación es casi imposible de lograr. etc. y algunas coníferas enanas Relieve accidentado. tormentas. alcanzan temperaturas 10 a 20°C en verano y -15ºC y +5ºC en invierno. Alces. Norte de Groenlandia y Siberia Al sur de la tundra. Nogal. Helechos. Michoacán (Sierra Madre Occidental) Países centrales de Europa. centro de EUA. Avellanos. y en la norte Reno. musgos. Se encuentra en las regiones ecuatoriales o cercanas a él. Caoba. zorro plateado. pingüino y aves Tundra Líquenes. De 250 a 500 mm. de lluvia anual Tabla 5. De los 2000-10000 mm. Castores. aves canoras. El suelo es de tipo pantanoso débil y pobre. Ardillas. jabalíes. Entre 500 y 1000 mm. foca.

siendo poco productivos. acelerando la mineralización del suelo y plantas que se adaptan a esas condiciones. lobo. lo que facilita la propagación de incendios. El suelo negro de la pradera (chernoziem) está entre los mejores para cultivar maíz y trigo. Cebras. Mamíferos: zorra. Arcilloso e impermeable. Entre los 250 y 600 mm. en zonas centrales de África. Coyote.GUÍA METODOLÓGICA DE BIOLOGÍA Ucrania hasta Mongolia. nogales. etc. Búfalos y grandes mamíferos carniceros. Un promedio de 200 mm. El fuego agiliza el crecimiento de las hierbas y frena el desarrollo de los árboles. Rinocerontes. Antílope. Chile. Sabana Desierto Se desarrollan cactus. pastos y gramíneas Representados por: Antílopes. Lobo. Suroeste de EUA y en el noroeste de la República Mexicana en Sonora Desértico puede alcanzar una temperatura hasta de 58º C por la mañana y por la noche en algunas zonas han llegado hasta -5ºC o 6ºC. algunos reptiles. temperaturas medias de 23º C 600 mm. (se descomponen rápidamente). de lluvia anual Se ubica en regiones tropicales. plantas herbáceas y matorrales Gacela. Es cálido con largos periodos de sequía. Perú. plantas herbáceas hierbas. de lluvia anual Se localiza en África. coyote. Jirafas. Estepa y Pampas Su vegetación es predominan los pastizales. Asia. de lluvia anual Acumula mucho humus formado por la gran cantidad de materia orgánica que aportan las hierbas al suelo. roedores y aves de rapiña. Su temperatura oscila entre 20 a 29 °C. avestruz. Los suelos pueden ser de color: marrón claro. contribuyendo a la sequedad ya que drena rápidamente la escasa precipitación. 268 . América y Australia. Elefantes. Australia. Praderas. La arena es un sustrato común. yucas. Linces y algunos roedores Los árboles están dispersos los más frecuentes son Acacias y Baobabes. Son de tipo calcáreo y altamente salino. gris o amarillentos. América del Norte (pradera) y en la del Sur (pampa) Es semidesértico con largos periodos de sequía. Presenta alternancia de una estación húmeda y otra seca y árida.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga y colorea en el planisferio los Biomas terrestres del mundo. 269 . Utiliza un código de colores para identificarlos.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga y colorea en el mapa los Biomas que existen en México. 270 . Utiliza un código de colores para identificarlos.

deforestación. extinción de especies. lluvia ácida. construir un mapa mental de la crisis ambiental interrelacionando las causas y consecuencias de estos problemas. incendios forestales. efecto invernadero. introducción de especie exóticas. A partir de lo investigado. 271 . caza. tráfico de especies. pérdida de biodiversidad. Usa sólo los nombres de los problemas Elabóralo en un pliego de papel y exponlo al grupo.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Retoma la actividad del mapa conceptual de causas y consecuencias de la crisis ambiental y los esquemas de los ciclos biogeoquímicos e indica con un asterisco qué parte del ciclo es afectada y cuál es el problema que lo ocasiona ACTIVIDAD ESPECÍFICA Haz una investigación documental sobre los siguientes problemas ambientales documentando su definición así como sus causas y consecuencias: contaminación del aire. suelo y agua. deterioro de la capa de ozono. calentamiento global. sobrepastoreo. por equipo.

sin él. y ramas se presentan jerarquía y por código de colores ramas distintos. mayoría son de gran colorido en el mapa. Agrupación. Agrupación. en el en el mapa. jerarquía y ramas se presentan por código de 2 o menos colores. Algunas de las palabras e ideas (1 o 2) no están conectadas correctamente. La mayoría de las palabras e ideas están mal conectadas. Logra establecer conexiones Conexiones adecuadas entre las e palabras e ideas intergrupos claves. Con mapa y estas son de muy poco color o poco colorido. para desarrollar adecuadamente el tema. DEFICIENTE (1) Seleccionan con mucha dificultad la idea principal y palabras e ideas subordinadas son incorrectas. Utiliza flechas y/o código de símbolos. jerarquía Agrupación. a través de flechas o usando un código de símbolos. Varias de las palabras e ideas están conectadas incorrectamente. PUNTAJE Asignatura: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Contenidos Ubican la idea principal en el centro. Las palabras e ideas Ubicación y subordinadas se agrupación presentan en forma radial y se agrupan de acuerdo a su naturaleza y jerarquía. por colores Ubican la idea principal en el centro. COMENTARIOS: REFERENCIAS: (Landsberger. Imágenes del mapa TOTAL: Utiliza más del 90% Utiliza más del 70% de imágenes que son de imágenes. Solo hace uso de flechas o de código de símbolos. Presentan pequeños errores (1 o 2) al agrupar las palabras e ideas subordinadas de acuerdo a su naturaleza y jerarquía. Solo hace uso de flechas o de código de símbolos. y la de gran colorido. jerarquía y ramas solo algunas se presentan por código de colores distintos. MUY BIEN (3) Seleccionan la idea principal e incluyen casi todas las palabras e ideas subordinadas para desarrollar el tema BIEN (2) Tienen cierta dificultad para seleccionar la idea principal e incluyen algunas de las palabras e ideas subordinadas para desarrollar el tema. Agrupación. Utiliza menos del Utiliza más del 50% 50% de imágenes de imágenes. Ubican la idea principal al centro pero presentan de 3 a 4 errores al agrupar las palabras e ideas subordinas de acuerdo a su naturaleza y/o jerarquía. 2005) 272 . No ubican la idea principal al centro y/o presentan 5 o más errores al agrupar las palabras e ideas subordinadas de acuerdo a su naturaleza y/o jerarquía.GUÍA METODOLÓGICA DE BIOLOGÍA RUBRICA PARA EVALUAR MAPAS MENTALES Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: PONDERACIÓN CRITERIOS EXCELENTE (4) Identifican fácilmente la idea principal e incluyen todas las palabras y/o ideas subordinadas. jerarquía y ramas la mayoría se presentan por código de colores distintos. Agrupación.

constituye el agua libre hasta la profundidad máxima que alcanza a penetrar la luz. magnesio. que constituyen cerca del 90 % de los elementos disueltos en el agua de mar. es el punto clave entre los océanos y la atmósfera en el ciclo hidrológico de la naturaleza. 273 . como los lagos. ECOSISTEMAS DULCEACUÍCOLAS La ciencia que estudia los ecosistemas de agua dulce se llama Limnología.GUÍA METODOLÓGICA DE BIOLOGÍA ECOSISTEMAS ACUÁTICOS ECOSISTEMAS OCEÁNICOS Éstos cubren entre el 70 y 71% de la superficie terrestre formada por el agua marina. la zona limnética (las aguas alejadas de la orilla) y la zona profunda ubicada debajo de la anterior. Ártico y Antártico. y ríos llamados bioma lótico. constituyen el 1% de agua dulce. y donde el zooplancton constituye el principal componente de la comunidad de consumidores de primer orden. Litoral lacustre (lagos y lagunas). y la que estudia los ecosistemas de agua salada se llama oceanografía. charcas. calcio y potasio. En la tabla 5. como el sodio y el cloro cloruro de sodio. y los de aguas de movimiento como: fuentes. arroyos.4 se presentan algunos factores bióticos y abióticos de los océanos. Atlántico. contiene sustancias sólidas en disolución. El agua del mar. pantanos y las turberas llamados bioma léntico. Zona limnética. aquí se produce el máximo desarrollo de fitoplancton. El océano está dividido por los continentes y grandes archipiélagos en cinco partes que son los Océanos: Pacífico. pues la luz penetra hasta el fondo. BIOMAS LÉNTICOS Se distinguen 3 zonas: el litoral. Los ecosistemas dulceacuícolas. Índico. por lo que está integrado por dos grandes tipos de ecosistemas: los de aguas quietas. aquí es más abundante la vida.

crustáceos.000 m. con una media de 7000 a 8000 m de profundidad. Tabla 5. Fótica: es la zona hasta donde penetra la luz llegando esta hasta los 200 m de profundidad. Algunas características de Ecosistemas Marinos FORMAS DE VIDA TOPOGRAFÍA 274 . PRESIÓN ATMOSFÉRICA ZONAS DE LUZ SALINIDAD Aproximadamente del 3. ballenas. Se localizan en el fondo oceánico.4. Fosas abisales: Son las partes más profundas de los océanos.GUÍA METODOLÓGICA DE BIOLOGÍA CARACTERÍSTICAS TEMPERATURA DESCRIPCIÓN La media oscila entre 2 – 30oC. huevos. etc Organismos bentónicos.. anélidos. etc. Viven flotando en las aguas y se mueven principalmente arrastrados por las corrientes. Afótica: a partir de 200 m. Se localizan en las aguas libres. calamares. que pueden llegar a medir miles de kilómetros de largo. Ésta aumenta 1 atmósfera por cada 10 m de profundidad. Suele contener vida marina en abundancia y la mayor parte de la pesca se realiza en esta zona. su anchura es muy variable de una zona a otra. larvas. corales. estrellas. Organismos planctónicos. Por ejemplo: algas microscópicas (fitoplancton). Talud Continental: continuación de la Plataforma que se puede considerar ya como verdadera zona Oceánica. Plataforma Continental: parte del Continente pero sumergida. sin relación con el fondo oceánico. protozoos.5% Organismos pelágicos. Por ejemplo: cardúmenes de peces. donde no hay luz. medusas. peces de fondo.) Plataforma litoral o costera: es la zona más cercana a la tierra. los organismos que se encuentran en las profundidades marinas pueden llegar a soportar presiones de unas 1000 atmósferas. etc. con una profundidad media de 200 m y pendientes generalmente suaves. moluscos. Aquí se encuentra la cuarta parte de la producción mundial de petróleo y gas procedente de las rocas que se encuentran debajo de estas plataformas. presenta pendientes muy acusadas y va desde 200 m hasta 4. Son numerosos entre ellos están las algas. por ejemplo. pequeños crustáceos.

. Al fluir el río. Curso inferior. y sus habitantes más característicos son: las bacterias. La erosión es mayor y los ríos suelen formar valles en forma de V al encajarse en el relieve aunque hay excepciones. llamadas deltas. que pueden llegar a formar lagos en herradura. que sufren escasez de oxígeno en el hipolimnion durante el verano BIOMAS LÓTICOS Conforme a su curso se clasifican en: Curso Superior. lo cual se debe. algunos gusanos. capaces de sobrevivir con poca luz y baja concentración de oxígeno. de plancton. principalmente. el hipolimnion. Generalmente. moluscos etc. a las fluctuaciones de la pendiente y a la influencia que reciben con respecto al caudal y sedimentos de sus afluentes. coincide con las áreas montañosas de una cuenca determinada. donde suele formar meandros: establece curvas regulares. acarrea grandes cantidades de sedimentos. Lagos eutróficos ricos en nutrientes y con una elevada productividad primaria debido al denso fitoplancton y a la vegetación de los márgenes. De acuerdo a su tipología ecológica se clasifican en: Lagos oligotróficos con nutrientes escasos. el cual contiene tanto agua dulce como salada pues es el punto donde se unen ambas. Aquí se alternan las áreas o zonas donde el río erosiona y donde deposita parte de sus sedimentos.GUÍA METODOLÓGICA DE BIOLOGÍA Zona profunda. los hongos descomponedores. los que pueden dar origen a islas. rica en oxígenos y con una baja densidad. 275 . Curso medio. una zona de agua fría profunda. Fluye en áreas relativamente planas. se encuentra por debajo de la zona limnética. Un río que termina en una boca muy ancha y profunda se llama estuario.

un estuario y un arrecife de coral. ESTUARIO MANGLAR ARRECIFE DE CORAL 276 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga e ilustra las características de un manglar.

Estratégico Analiza la estructura y las relaciones entre los componentes de los diferentes ecosistemas en un mapa mental integrador.GUÍA METODOLÓGICA DE BIOLOGÍA EVALUACIÓN DIAGNÓSTICA Se toma en cuenta los conocimientos previos a partir de la técnica lluvia de ideas y de la aplicación del examen diagnóstico. reflexiva. ACTIVIDADES DE APRENDIZAJE: FORMATIVA • Ejercicios de la guía metodológica • Debate grupal • V de Gowin • Presentación de exposiciones en power point ACTIVIDAD ESPECÍFICA: • Mapa mental integrador • Reporte de visita guiada a áreas naturales • Portafolio • Rúbrica Examen departamental tipo CENEVAL o PISA 30% Laboratorio (evaluación V-Gowin) 20% Actividades de aprendizaje 20% Actividad específica por unidad 30% SUMATIVA Criterios Analiza la estructura y las relaciones entre los componentes de los ecosistemas en un mapa mental integrador. ecosistemas y componentes componentes sus relaciones de los de los en un mapa ecosistemas ecosistemas mental en un mapa de una forma mental crítica y integrador. en integrador. sugiriendo propuestas para la conservación de los ecosistemas Puntos: 100 Ponderación Logros: Puntos: 30 Puntos: 60 Puntos: 80 Puntos: 100 Aspectos a mejorar : 277 . MATRIZ DE VALORACIÓN DE COMPETENCIAS Pre-formal Receptivo Resolutivo Autónomo Identifica los Describe Analiza la Analiza la componentes algunos estructura y estructura y de los componentes las relaciones las relaciones de los entre los entre los ecosistemas. un mapa mental integrador.

376 pp. 249-300. Ed. Editorial Médica Panamericana. México. (1980).GUÍA METODOLÓGICA DE BIOLOGÍA BIBLIOGRAFÍA BÁSICA Banchs. pp. A. Nesman. y Barnes N. Publicaciones Cultural. La Vida y sus Procesos. pp.. Correo del Maestro.tecnun. et al. Quinta reimpresión. Libro electrónico Ciencias de la Tierra y del Medio Ambiente: Tema 5: Principales ecosistemas >> Biomas terrestres. 427477. El Mundo de la Ecología. (1998). B. Cultural S. 278 . (1992). A. (2006). Zoología de los Invertebrados. La Ciencia en la Historia.D. 655 pp. pp 12-26 Biagi. CECSA.Tesoros de la Biodiversidad. A. La Prensa Médica Mexicana. Biología General. Botánica Básica. Valdivia. www. Bernal. (2003). y Villareal. Joseph y Tola José. Ecología Humana. (2005) Las Plantas. SEP/Santillana. Biología. G. Ed. México. H. Interamericana. 715-736. S. Publicaciones cultural.S. Granillo. México. C. y Hernández M.R. Cervantes M. México. Colombia. P. A. Ed. México. J. (2006). Publicaciones Cultural. F. (2000) Biología.es/asignaturas/ecologia/hipertexto/05PrinEcos/120BiomTer. (1994). Coello. P. Enfermedades Parasitarias. pp. México. México. Publicaciones Cultural. México. (1986). Colección Espejo de Urania. Vázquez Conde. México. R. Océano País España Barnes. (2004) Biología Experimental.htm Marten. México. Cronquist. Conceptos Básicos del Desarrollo Sustentable. pp 4-8 BIBLIOGRAFÍA COMPLEMENTARIA Cervantes. Nueva Imagen UNAM. Vázquez. J. (2005). (2003). Curtis H. Biología I. País España. Preservación de la Naturaleza. Atlas Mundial del Medio Ambiente. (1989). Biosca. D.

Kapicka y Lundgren. D. (1996). Biología. Mc Graw Hill. y Lazcano.php Biggs. Consejo Nacional de Ciencia y Tecnología Fondo de Cultura Económica. 960 paginas.php 279 . J. segunda edición. Buican. La ciencia/ 25 desde México. Nueva visita al Experimento de Miller” en Astroseti.mx/Biodiversitas/resultados. la dinámica de la vida. 737 páginas. Acento editorial.L. Historia de la Biología.html Revista electrónica Biodiversitas http://www. (1999).astroseti. (1975).org (reproducido con permiso de Science Magazine). México. 91páginas.biodiversidad. VIDEOS RECOMENDADOS • El Mundo de los Insectos • Biodiversidad • Sexo en el arrecife • Planeta Tierra • Video La Marcha de los Pingüinos • Huella ecológica en la web • Videojuego en línea Honoloko • Literatura del tema TIC’s Action Bioscience http://actionbioscience. Consejo Nacional para la enseñanza de la Biología. España. (2003) “Sopa Prebiótica. CECSA. A. Bada. http://www. Biología.GUÍA METODOLÓGICA DE BIOLOGÍA Piñero Daniel.org/esp/biodiversidad/index. México.org/sopa. serie Flash.gob. (1987) De las bacterias al hombre: la Evolución.

conabio.mx/wwfmex/ecosistemas.org.es/biosfera/ Secretaria del Medio Ambiente http://www.ilce.wwf.cnice.conacyt.Ministerios de Educación y Ciencia http://recursos.mx 2010 Año internacional de la Biodiversidad http://www.mx Consejo Nacional de Ciencia y Tecnología: Revista Ciencia y Desarrollo http://www.ve/~rubenhg/ Naturaleza Mexicana http://www.cbd.sma.ula.htm LibroBOTÁNICAOnLine http://www.gob.mx/redescolar/proyectos/reinos_pri2006/index.int/2010/welcome/ La Vida entre Reinos http://redescolar.php Proyecto Biosfera .edu.GUÍA METODOLÓGICA DE BIOLOGÍA Comisión Nacional para el Conocimiento y Uso de la Biodiversidad http://www.df.mec.forest.gob.mx/comunicacion/revista 280 .

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 6 Introducción a la Anatomía y Fisiología Humana 281 .

COMPETENCIAS Genéricas/Atributos Disciplinares 3. satisfacer necesidades o demostrar principios científicos. Muestra actitudes de respeto al trabajo y opiniones de sus compañeros. CRITERIOS DE DESEMPEÑO • Identifica la estructura de los órganos y sistemas del cuerpo humano a través de modelos anatómicos. Diseña modelos o prototipos para resolver problemas. Explica las medidas de higiene y prevención de la salud Actitudinales/ Valorales Se desempeña activa y responsablemente en trabajos individuales y por equipo. 8.3 Asume una actitud constructiva.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE VI: INTRODUCCIÓN A LA ANATOMÍA Y FISIOLOGÍA HUMANA TIEMPO: 25 horas UNIDAD DE COMPETENCIA: Identifica la organización del cuerpo humano y la función que desempeñan los sistemas en el mantenimiento de la homeostasis del mismo. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo. Declarativos Identifica la estructura y función de los tejidos del cuerpo humano.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. Reflexiona de manera crítica e informada sobre las medidas de higiene y salud para tener una buena calidad de vida. para tomar decisiones en el cuidado de su cuerpo a través del uso de modelos anatómicos. SABERES Procedimentales Describe la estructura y función de los tejidos del cuerpo humano a través de modelos y observación al microscopio de muestras histológicas. sus procesos vitales y el entorno al que pertenece. Identifica la estructura y función de los órganos y sistemas del cuerpo humano. 9.2 Ordena información de acuerdo a categorías jerarquías y relaciones.2 Toma decisiones a partir de la valoración de las consecuencias de distintos hábitos de consumo y conductas de riesgo. Identifica órganos y sistemas en un pollo. Relaciona la estructura y función de los diferentes órganos y sistemas a través de mapas mentales. • 282 . Elabora reportes de laboratorio a través de una V de Gowin. 5. conferencias y trípticos la importancia de tomar medidas para prevenir enfermedades. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. Construye modelos anatómicos para identificar los órganos de los respectivos sistemas Relaciona la estructura y función de los diferentes órganos y sistemas a través de mapas mentales Aplica y difunde medidas de higiene y salud para prevenir enfermedades a través del uso de medios de comunicación. 5. 12. Promueve y difunde a través de periódicos murales.

• Elaboración de anatómico humano power point de laboratorio (V de Gowin) sistemas del cuerpo humano. • Actividades ESTRATEGIAS DE APRENDIZAJE • Elaboración de mapa mental • Construcción RECURSOS DIDÁCTICOS • Guía metodológica • Videos • Láminas • Rotafolio • Modelo experimentales • Ilustraciones • Mapas de EVIDENCIAS Y/O PRODUCTOS • Actividades de la guía metodológica de biología. Escribe el nombre de cinco huesos del cuerpo _________________________________________________________________________ 283 . material de difusión • Reporte • Presentaciones en • Modelos de los de laboratorio en V de Gowin de actividades de la guía metodológica • Computadora • Cañón • Apoyo • Mapa mental • Material de difusión • Resolución bibliográfico • Laboratorio experimental • Muestras biológicas e histológicas de disección • Estuche EXPLORANDO TUS CONOCIMIENTOS 1. • Investigaciones modelos • Investigación documentales • Reporte mentales documental. Escribe el nombre de tres glándulas del cuerpo _________________________________________________________________________ 2.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • Clase magistral. ¿Qué diferencias hay entre venas y arterias? _________________________________________________________________________ 4. ¿En dónde se lleva a cabo el intercambio gaseoso en la respiración pulmonar? _________________________________________________________________________ 3.

GUÍA METODOLÓGICA DE BIOLOGÍA 284 .

mientras que la fisiología estudia la función de las diferentes estructuras corporales. que son agrupaciones de diferentes tejidos especializados con una función establecida. cartílago. INTRODUCCIÓN La anatomía es la rama de la medicina que estudia la forma y estructura del cuerpo así como sus partes constitutivas. los médicos estiman que entre el 40% y 70% de todas las alteraciones funcionales (enfermedades) tienen origen psicosomático atribuible a la vida personal y social de cada individuo. sociales y culturales en la vida de un individuo no son ajenas al funcionamiento fisiológico del cuerpo. El cuerpo humano no es simplemente un agregado de órganos. sino una unidad organizada y bien coordinada que funciona como un todo integrado. que forma el corazón • Músculo liso. sangre y linfa (transporte) y el estroma de los ovarios (sostén) Está dividido en tres grupos: Conectivo Muscular Contracción por la presencia de actina y miosina • Músculo estriado.1. Esta unidad morfológica y fisiológica se logra por medio de un elevado nivel de organización estructural y numerosos mecanismos de control relacionados entre sí. el muscular y el tejido nervioso (Tabla 6. el conjuntivo. Se reconocen cuatro tipos fundamentales de tejidos: el epitelial.1). forma encéfalo y médula espinal (sistema nervioso Central) y tejido nervioso (Sistema nervioso periférico) Tabla 6.GUÍA METODOLÓGICA DE BIOLOGÍA 6. que forma órganos internos como el tubo digestivo. Las influencias personales. hueso (soporte). que forma la musculatura corporal • Músculo cardiaco. El cuerpo humano esta integrado por diferentes sistemas. estos sistemas están formados a su vez por órganos. La neurona es la unidad estructural y funcional.1 Nervioso Conducción de impulsos nerviosos 285 . TEJIDO Epitelial FUNCIONES Protección y producción de hormonas. vasos sanguíneos Forma el sistema nervioso. enzimas y sudor Unión y sostén de otros tejidos IMPORTANCIA • Forma membranas que cubren el cuerpo y revisten cavidades • Forma glándulas endocrinas (hormonas) y glándulas exocrinas (sudor) Forma tendones (unión).

en un adulto cubre un área total de más de 1. 286 .GUÍA METODOLÓGICA DE BIOLOGÍA 6.5 metros cuadrados. ¿CÓMO FUNCIONA EL SISTEMA TEGUMENTARIO? El órgano más grande del cuerpo es la piel.1. La piel se conoce como tegumento y se compone de uno o más tejidos que protegen al cuerpo del ambiente. ACTIVIDAD Realiza una Investigación documental de las funciones que tiene la piel. A partir de esta información realiza un mapa conceptual de las funciones de la piel.

287 . Haz una investigación experimental y escribe la función de cada parte.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Escribe los nombres correspondientes a cada estructura que señalan las líneas de la siguiente figura esquemática.

6. unas anchas constituidas por proteínas contráctiles de miosina y otras bandas o estrías delgadas constituidas por proteínas contráctiles de actina (fig. físicos y químicos. intestinos. Fig. 288 . a diferencia de los músculos cardiaco y liso que presentan automatismo. vasos sanguíneos. Contracción muscular La diferencia es que el músculo esquelético funciona en forma voluntaria median-te estímulos nerviosos.). ¿CÓMO FUNCIONA EL SISTEMA MUSCULAR? El sistema muscular está constituido por células que reciben el nombre de miocitos.1).1. liso y cardiaco. las del músculo liso cuentan con un solo núcleo oval casi central. 6. la unión de un gran número de miocitos forman las fibras musculares que al unirse a su vez forman órganos llamados músculos.GUÍA METODOLÓGICA DE BIOLOGÍA 6. En el humano se han clasificado en tres tipos: esquelético o estriado. su estructura es similar a la del músculo esquelético o estriado. son células alargadas con muchos núcleos. Las células del músculo esquelético o estriado y del cardiaco. El músculo cardiaco se localiza en el espesor de las cavidades del corazón. regulados por centros nerviosos especializados y por hormonas. El músculo esquelético se le denomina así porque se encuentra adherido al esqueleto y estriado porque al microscopio se observan bandas o estrías. etc. El músculo liso se le llama así porque no presenta bandas o estrías y se localiza en las paredes de las vísceras huecas (estómago.2.

extensión. depresión. supinación. abducción. 289 . dilatación y oposición. oclusión. elevación. pronación.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga en qué consisten los siguientes movimientos voluntarios de los músculos: flexión. aducción. En la imagen coloca el tipo de movimiento de que se trate en la letra correspondiente.

por ejemplo para “doblar” el brazo. 290 . las contracciones involuntarias del corazón (sístole y diástole). los músculos jalan no empujan. función presente casi en la totalidad de los organismos heterótrofos para poder buscar su alimento. por lo tanto para que exista un movimiento completo es necesario que existan músculos antagónicos. para volver a extenderse se necesita que se contraigan músculos localizados en su región posterior (fig.1). los movimientos del tubo digestivo a los cuales se les denomina perístalsis.2. cuya finalidad es la locomoción). Músculos importantes en el ser humano Los músculos cardiaco y liso que presentan automatismo y regidos por centros nerviosos especializados.GUÍA METODOLÓGICA DE BIOLOGÍA La contracción de un músculo se debe a la atracción de sus fibras por estímulos que cambian sus cargas de tipo eléctrico que al encontrarse de diferente carga se atraen dando como resultado el acortamiento del conjunto. Figura 6. tenemos como ejemplo de sus movimientos. 6. La diversidad de movimientos que se efectúan se debe a la combinación de contracción y relajación de los músculos esqueléticos. es necesario que existan músculos en su región anterior.

• Producir elementos formes de la sangre como son los glóbulos rojos y blancos. Las funciones del esqueleto son: • Servir como una estructura sólida que constituye un armazón que da soporte y forma. de soporte a la cuál se le denomina esqueleto.3. en el interior de la médula ósea.GUÍA METODOLÓGICA DE BIOLOGÍA 6. el humano esta constituido por la unión de diversos huesos en numero promedio de 204. constituidos de calcio y fósforo que forman a los huesos (fig. • Proteger a órganos muy delicados.2). como las vibraciones sonoras en el oído. al esqueleto se le van a unir una gran cantidad de diversos músculos que le van a dar movimiento. • Almacén de calcio y fósforo. Estructura de un hueso largo 291 .2. La unión de los diversos huesos van a formar una estructura que sirve de armazón. 6. • Participar en la conducción sensorial. formando cavidades como las del cráneo y cavidad torácica. ¿CÓMO FUNCIONA EL SISTEMA ÓSEO? El sistema óseo está constituido por células que reciben el nombre de osteocitos. 6.

radio.2).3. peroné) Huesos cortos (falanges) Huesos planos (huesos del cráneo. cubito.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. huesos de la cadera) Huesos irregulares (vértebras.3) a los huesos localizados a los lados de la línea media del cuerpo se les denomina esqueleto apendicular (huesos de los brazos y piernas. hueso del pecho y sacro) (fig. tibia. 6. A los huesos planos se les consideran las siguientes regiones. fémur. omoplatos. columna vertebral. huesos del carpo y metacarpo) A los extremos de los huesos largos se les denomina epífisis y a su cuerpo diáfisis. bordes y ángulos (fig. caras. 292 . 6. huesos de la cadera. Los huesos se clasifican en: • • • • Huesos largos (húmero. Huesos del cráneo A los huesos localizados sobre la línea media del cuerpo se les denomina esqueleto axial (huesos del cráneo. 6.

son varios los elementos que participan los cuales son: ligamentos y tendones. Utiliza un segundo color para iluminar el esqueleto apendicular. meniscos y líquido sinovial. En ambos casos escribe el nombre de los huesos principales que reconozcas.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Ilumina el esqueleto axial y de un color. La unión de los diversos huesos se les llama articulación. 293 . cápsula articular.

GUÍA METODOLÓGICA DE BIOLOGÍA

6.4. ¿CÓMO FUNCIONA EL SISTEMA DIGESTIVO?
La digestión es el proceso mediante el cual el alimento que ingiere un organismo es descompuesto en moléculas lo suficientemente pequeñas como para que entren las células. Entre estas moléculas se encuentran los monosacáridos, los aminoácidos, ácidos grasos, hierro y otros minerales. Por esta razón el alimento debe ser ingerido, digerido y absorbido. En los animales superiores la digestión tiene lugar en un largo tubo que va desde la boca al ano y que tiene diferentes zonas especializadas para cada proceso de la digestión.

Figura 6.4. Sistema digestivo

294

GUÍA METODOLÓGICA DE BIOLOGÍA

Las funciones de la digestión son: • Ingestión. Los alimentos son introducidos al tracto digestivo por un orificio generalmente llamado boca. • Destrucción mecánica. Los alimentos se rompen en partes más pequeñas la intervención de los colmillos y otras piezas dentales y el mezclado de la cavidad digestiva. • Destrucción química. Las partículas de los alimentos se exponen a enzimas y líquidos digestivos a fin de que las moléculas grandes se desdoblen en unidades más pequeñas. • Absorción. Las moléculas pequeñas deben pasar a las células (Fig. 6.5). • Eliminación. Los materiales no digeribles deben ser expulsados del cuerpo.

Fig. 6.5. Estructura interna del intestino delgado

295

GUÍA METODOLÓGICA DE BIOLOGÍA

ESTRUCTURA Cavidad bucal

FUNCIÓN Es el lugar de entrada de los alimentos al organismo. Está provisto de 32 dientes encargados de triturar el alimento. Conduce el bolo alimenticio hacia el esófago, donde la epiglotis evita que el alimento pase al tracto respiratorio.. Conduce los alimentos hacia el estómago. Es una bolsa musculosa en forma de J en donde los alimentos son transformados por acción de los jugos gástricos. Es un tubo de 7 m de largo que tiene en su interior una serie de microvellosidades encargadas de absorber a la sangre los alimentos. Es un tubo grueso y corto.. Por él se expulsa la sustancias no absorbidas por las vellosidades intestinales y se absorbe el agua. Almacena los residuos Expulsa las heces fecales
Tabla 6.2. Órganos principales del sistema digestivo

Faringe Esófago Estómago

Intestino delgado

Intestino grueso Recto Ano

ESTRUCTURA Páncreas (jugo pancreático) Hígado (bilis) Glándulas parótidas Glándulas del intestino delgado

FUNCIÓN Desdobla las proteínas intactas, convierte las dextrinas en maltosa y desdobla las grasas neutras. Emulsifica las grasas neutras y participa en la absorción de los productos de la descomposición de las grasas neutras. Producen y secretan amilasa salival (ptialina) Glucólisis y proteólisis
Tabla 6.3. Glándulas anexas del sistema digestivo

296

GUÍA METODOLÓGICA DE BIOLOGÍA

ACTIVIDAD A partir de las Tablas 6.2 y 6.3 y con la información proporcionada en esta guía, construye un mapa conceptual integrador que involucre la ruta del alimento, los órganos por donde pasa, las glándulas anexas, las funciones de la digestión.

297

GUÍA METODOLÓGICA DE BIOLOGÍA

6.5. ¿CÓMO FUNCIONA EL SISTEMA RESPIRATORIO?
Se llama sistema respiratorio al conjunto de estructuras del organismo que permite la captación del oxígeno del aire y la eliminación del dióxido de carbono producido en su interior. Este proceso se conoce como respiración. El sistema respiratorio transporta el aire hacia los pulmones y realiza el intercam-bio gaseoso (Fig. 6.6) que se lleva a cabo en ellos. Esta constituido por órganos de transporte y órganos de intercambio gaseoso, que permiten la llegada de oxígeno a la sangre y la eliminación del bióxido de carbono. Los pulmones son los órganos más importantes de este sistema y se encuentran protegidos por una membrana de doble capa llamada pleura. Se encuentran alojados en las partes laterales de la cavidad torácica, cubiertos principalmente por las costillas. El pulmón derecho es mayor que el izquierdo consta de tres lóbulos, mientras que el otro solo tiene dos. Durante la inhalación la cavidad torácica se expande, esto sucede cuando el diafragma y los músculos intercostales se contraen levantando las costillas hacia arriba y hacia fuera. La exhalación se produce cuando los músculos se relajan, la relajación hace que las costillas se muevan hacia abajo y hacia adentro disminuyendo el tamaño de la cavidad torácica y obligando al aire a salir de los pulmones.

ÓRGANO
Nariz Faringe

ESTRUCTURA
Fosas nasales Cámara común al aparato digestivo y respiratorio Formada por secciones de cartílago y cuerdas vocales Tubo flexible con paredes de cartílago cubiertos con membranas mucosas Tubos flexibles cartilaginosos Tubos flexibles cartilaginosos

FUNCIÓN
Humedece calienta y purifica el aire Conduce el aire hacia la laringe y expulsa moco y partículas Produce tonos de voz e interviene en el proceso de la tos. Conducto de paso que da origen a los bronquios Conducen el aire hacia los pulmones Conducen el aire hacia los alvéolos

Laringe Tráquea

Bronquios Bronquíolos

Tabla 6.4. Órganos conductores del sistema respiratorio

298

GUÍA METODOLÓGICA DE BIOLOGÍA

ACTIVIDAD Escribe el nombre del órgano que corresponda e ilumínalo de diferente color

El aire que queda en los pulmones después de la exhalación impide que los alvéolos se colapsen. Durante la respiración normal se introducen 500 ml de aire, de los cuales 350 ml llegan a los alvéolos. La frecuencia respiratoria se controla por el centro respiratorio del encéfalo, cada contracción es estimulada por impulsos que provienen de células nerviosas. El centro respiratorio ajusta la frecuencia respiratoria y el volumen para cumplir con las necesidades del cuerpo.
299

los ventrículos.8) Las gruesas paredes del corazón forman el miocardio. estos impulsos eléctricos producen el latido del corazón. Las arteriolas son las últimas ramas del sistema arterial.6. en la orina. ¿CÓMO FUNCIONA EL SISTEMA CIRCULATORIO? El sistema circulatorio sirve para llevar los alimentos y el oxígeno a las células. 6. Intercambio gaseoso 6. 300 . Alvéolos pulmonares Fig. entre la aurícula y ventrículo izquierdo esta la válvula mitral. que está circulando constantemente. La contracción del corazón está determinada por impulsos eléctricos. están constituidos por las arterias.6. transporte de hormonas. Las arterias salen del corazón. es un órgano situado en el interior del tórax entre ambos pulmones está integrado por músculo estriado cardiaco. Entre la aurícula y el ventrículo derecho hay una válvula llamada tricúspide. De toda esta labor se encarga la sangre. Las venas transportan sangre de los tejidos hacia las aurículas del corazón. nutrición. y por el aire exhalado en los pulmones. (Fig. Las funciones básicas del sistema circulatorio son la oxigenación celular (parte de la respiración celular). 6.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.7. y para recoger los desechos metabólicos que se eliminarán por los riñones. Son gruesas y elásticas y nacen en los ventrículos aportan sangre a los órganos del cuerpo. llamado nodo sinusal. Actúan como válvulas de control a través de las cuáles se manda sangre hacia los capilares. rico en dióxido de carbono (CO2). que provienen de un tejido especializado a manera de marcapasos natural situado en la aurícula derecha. por ellas fluye rápidamente la sangre a presión debido a la elasticidad y resistencia de sus paredes. interviene en la regulación ácido-base y en la concentración de agua celular El corazón. regulación de la temperatura corporal. La presión del sistema venoso es muy baja. Este órgano funciona como bomba y presenta dos cavidades superiores llamadas aurículas y otras dos inferiores. Son pequeñas y con una poderosa pared muscular. venas y capilares. Los vasos sanguíneos. 6.

las células sanguíneas o elementos formes (eritrocitos. En ella se distingue una parte líquida. Intercambian líquidos.___________________________________ 2. Para movilizar la sangre.______________________________________ 301 . nutrientes. electrolitos. Esto genera la presión arterial que es más alta durante la sístole y disminuye durante la diástole. uno de contracción o sístole. y una parte sólida. hormonas y otras sustancias entre la sangre y los espacios intersticiales.GUÍA METODOLÓGICA DE BIOLOGÍA sus paredes son delgadas y poco elásticas. leucocitos y plaquetas).______________________________________ 7. Son sumamente delgados que penetran por todos los órganos del cuerpo. 3. y otro de dilatación o diástole.___________________________________ 12.______________________________________ 11.______________________________________ 13.______________________________________ 1. En los capilares se realiza el intercambio gaseoso entre la sangre y las células. La sangre está contenida en el cuerpo en cantidad de unos 4 a 6 litros.______________________________________ 10.______________________________________ 9.______________________________________ 6. el plasma.______________________________________ 5. Las vénulas reciben la sangre de los capilares antes de llamarles venas.______________________________________ 8. el corazón presenta dos movimientos o latidos. ACTIVIDAD Identifica y escribe el nombre de cada estructura que señalan los números y líneas sobre el esquema del corazón.______________________________________ 4.

6. La válvula tricúspide evita el reflujo de sangre hacia la aurícula.9). Fig. 6. ya que se cierra por completo durante la contracción del ventrículo derecho. hacia el ventrículo derecho. En su recorrido a través de los pulmones (circulación pulmonar).9. impulsa la sangre a través de un orificio. la sangre se oxigena.GUÍA METODOLÓGICA DE BIOLOGÍA Circulación sanguínea La sangre procedente del organismo (circulación sistémica) llega a la aurícula derecha a través de dos venas principales: la vena cava superior y la vena cava inferior. Cuando la aurícula derecha se contrae. La contracción de este ventrículo conduce la sangre hacia los pulmones. regresando al corazón por medio de las cuatro venas pulmonares que desembocan en la aurícula izquierda. la sangre pasa al ventrículo izquierdo y desde allí a la aorta gracias a la contracción ventricular. La válvula bicúspide o mitral evita el reflujo de sangre del ventrículo hacia la aurícula izquierda (fig. Circulación sanguínea 302 . Cuando esta cavidad se contrae. la válvula auriculoventricular.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los componentes de la sangre. A partir de ésta elabora un mapa conceptual 303 .

para defender el cuerpo al exponer bacterias y virus a los leucocitos. primero el cuerpo debe reconocer el antígeno y segundo debe buscar la manera de deshacerse de él. B. El timo. Transportar grasas del intestino al torrente sanguíneo. estas partículas de grasa representan el 1% del fluido linfático. Algunos linfocitos primero pasan por el timo. El intestino delgado tiene muchos capilares linfáticos. el bazo. en tanto que los otros se llaman células B. los nodos linfáticos y algunas células como los linfocitos T y los linfocitos B forman el sistema inmunológico del cuerpo. Como resultado del metabolismo celular.7 ¿CÓMO FUNCIONA EL SISTEMA LINFÁTICO? En el organismo humano existen dos tipos de sistemas de transporte: el sistema circulatorio y el sistema linfático. Para esto es necesaria la acción de los leucocitos que tienen como función reconocer a los antígenos. Una vez en la linfa. Después de una comida rica en grasa. pero pueden moverse fácilmente a través de las aberturas de la células capilares linfáticas. Una parte de estos desechos se dirige al extremo venoso del capilar.GUÍA METODOLÓGICA DE BIOLOGÍA 6. bazo y tonsilas (amígdalas). Estas células se reproducen en la médula ósea y de aquí pasan a la sangre. C. La respuesta inmunológica se efectúa en dos partes. el resto hacia los extremos cerrados de los vasos linfáticos. Limpiar y regresar los desechos celulares a la sangre. son bombeadas hacia una gran vena que llega al corazón. Dar la respuesta inmunológica. que forman una red distribuida por todo el cuerpo. estas se recombinan viajando por estos vasos quilíferos. Las funciones principales de éste sistema son: A. al que se integran. El sistema linfático consta de: una red de capilares linfáticos que conducen linfa y de tejido linfático formado por nodos linfáticos. Estas partículas son muy grandes para que puedan difundir al interior de los capilares sanguíneos. por esto se denominan células T. Después de absorber las grasas digeridas en el interior de los vasos quilíferos o linfáticos. 304 . los órganos linfáticos como el timo. un tipo de glóbulos blancos. se difunden sustancias de desecho hacia el líquido extracelular. El sistema linfático produce linfocitos. el resto hacia los extremos venoso del capilar. a los nodos linfáticos y al bazo.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre la respuesta inmune humoral y celular y dibuja un esquema de las mismas 305 .

Esta sin embargo. es decir. Estructura del riñón 6. a través de pequeñas redes de capilares que se conocen como glomérulos. determina la cantidad de agua y de sales que hay en el organismo en cada momento.11). principalmente la urea. En conjunto. La eliminación final de la orina se realiza a través de la uretra. siempre pensamos en la eliminación de produc-tos de desecho.10.GUÍA METODOLÓGICA DE BIOLOGÍA 6. finalmente el ultrafiltrado llega al túbulo colector. un sistema regulador del medio interno. el asa de Henle y túbulo contorneado distal. Estructura de una nefrona 306 . Durante este recorrido la composición del líquido va variando y el agua es recuperada. 6. ¿CÓMO FUNCIONA EL SISTEMA EXCRETOR? Cuando hablamos de excreción. la vejiga urinaria por medio del uréter. y expulsa el exceso de ellas de modo que se mantenga constante la composición química y el volumen del medio interno (homeostasis). A través de las redes de los capilares se produce un ultrafiltrado. La orina que se produce en el riñón pasa a los cálices menores y de éstos a los cálices mayores. cada uno de los cuales está asociado a una cápsula renal (cápsula de Bowman).11. sucesivamente por el túbulo contorneado proximal. carente de células sanguíneas y de proteínas que se van acumulando en la cápsula renal antes de pasar. 6. constituyéndose así la primera parte de una nefrona (fig. La sangre llega al riñón (fig. 6.10) por medio de la arteria renal. El sistema urinario elimina los productos nitrogenados. un glomérulo y una cápsula renal forman un corpúsculo renal. La excreción es además. y regula el equilibrio hídrico y salino (electrolitos).8. es sólo una de sus funciones.

9. 307 . la sangre circula. el estómago realiza la digestión y los pul-mones transportan aire. al estar leyendo esta página se realizan procesos muy complejos en el cerebro. a veces simultáneamente. Asimismo se pueden percibir sonidos que se producen alrededor o sentir frío o calor al palpar un libro con los dedos. algunas voluntarias y otras no. Completa el siguiente cuadro con los datos faltantes en cada recuadro. si se piensa un poco en él se advertirá que lleva acabo muchas actividades. Por ejemplo. ¿CÓMO FUNCIONA EL SISTEMA NERVIOSO? El cuerpo humano es una maravilla en complejidad y coordinación. En el interior del cuerpo el corazón late.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. 6. Todas estas actividades se realizan simultánea y requieren de un centro de control que las coordina: el sistema nervioso.

en el sistema que nos ocupa. Fig. llamadas neuronas. • Transmitir la señal a otras células nerviosas. glándulas o músculos. la cual puede estar localizada a cierta distancia.12) está constituida por cuatro regiones distintas: las dendritas. muy especializa-das e incapaces de reproducirse. el axón y las terminales sinápticas. Esta información y mensajes van en forma de señales eléctricas (impulso nervioso). • Integra la información que recibe y producir una señal de respuesta adecuada. LAS NEURONAS El sistema nervioso está compuesto por células. La neurona es la unidad fundamental del sistema nervioso y básicamente cumple las siguientes funciones: • Recibe la información del medio interno o externo y de otras neuronas. 308 . Así como también estructuras que envían mensajes apartes del cuerpo que producen una respuesta específica (efectores). Cada neurona (fig. • Coordinar las actividades metabólicas que mantienen la integridad de la célula.12 neurona El sistema nervioso se divide para su estudio en sistema nervioso central y sistema nervioso periférico.GUÍA METODOLÓGICA DE BIOLOGÍA El sistema nervioso cumple con dos funciones básicas que son la coordinación de las diferentes acciones del cuerpo y la coordinación de las respuestas del cuerpo al mundo externo. el cuerpo celular o soma. Hay. 6. • Conducir la señal a la terminación nerviosa correspondiente. estructuras que reciben información proveniente del medio tanto interno como externo (receptores). 6.

que es un líquido claro parecido a la linfa que actúa fundamentalmente como amortiguador. que protege a la médula espinal. Fig. El puente interviene en la transición entre el dormir y el despertar y entre los diversos estadios del sueño.13) es un cable neural que se extiende dentro del canal de la columna vertebral. desde la base del encéfalo hasta la cadera. las meninges (duramadre. mesencéfalo y procencéfalo (fig. La médula espinal tiene como funciones conducir señales desde y hacia el encéfalo y controlar las actividades reflejas. En el centro de la médula espinal se localizan cuerpos de neuronas formando un área en forma de mariposa que es llamada la sustancia gris. la presión sanguínea y la deglución. Está rodeada por haces de axones llamados sustancia blanca. Consta de 3 partes: rombencéfalo. La médula espinal (fig. 6. El rombencéfalo está formado por la médula oblonga . El cerebelo coordina las actividades musculares(como caminar). Es la parte del sistema nervioso que recibe y procesa la información de los receptores.GUÍA METODOLÓGICA DE BIOLOGÍA SISTEMA NERVIOSO CENTRAL Consta de encéfalo y médula espinal.14). la frecuencia cardiaca. 309 . 6. genera pensamientos y emociones. Inicia respuesta. La médula oblonga controla diversas funciones autónomas como respirar. que protege al encéfalo. El sistema nervioso central consiste principalmen-te en neuronas de asociación. aracnoides y piamadre). 6. Médula espinal El encéfalo se localiza dentro de la cavidad craneana y tiene un peso aproximado de 1500g. Los órganos que protegen al sistema nervioso central son el cráneo. almacena recuerdos.13. y el líquido cefalorraquídeo. que son membranas de tejido conectivo. el puente y el cerebelo. y la columna vertebral.

en el tono muscular y en ciertos movimientos y reflejos. El tálamo lleva información sensorial al sistema límbico y al cerebro. Incluye principalmen-te a las áreas motora y sensitiva y áreas de asociación que analizan la información sensorial y planean los movimientos. impulsos y conductas. 6. Estas estructuras trabajan juntas para producir las emociones más básicas. de la piel y del interior del cuerpo. La corteza cerebral se divide en dos partes llamadas hemisferios cerebrales. en aspectos emotivos. El sistema límbico es un grupo de estructuras localizado en un arco que se encuentra entre le tálamo y el cerebro. El sistema límbico comprende al hipotálamo. incluyendo miedo. Filtra la entrada de información sensorial antes de que llegue a las regiones conscientes del encéfalo. cumple una función importante en el sueño.GUÍA METODOLÓGICA DE BIOLOGÍA El mesencéfalo contiene la formación reticular. sed y placer y las respuestas sexuales.14. que se comunican mediante una gran haz de axones. porciones del tálamo. En los humanos la corteza cerebral constituye la mayor parte del encéfalo. Encéfalo 310 . el cuerpo calloso. El procencéfalo. la amígdala y el hipocampo. como la proveniente de las vías auditiva y visual. comprende las siguientes partes: El tálamo. la memoria y la iniciación de acciones voluntarias. Fig. llamado también cerebro. el sistema límbico y la corteza cerebral. es la capa más externa del procencéfalo. tranquilidad. La corteza cerebral es el centro del procesamiento de información. rabia.

En los nervios periféricos existen axones de neuronas sensitivas y motoras. excretor y circulatorio.GUÍA METODOLÓGICA DE BIOLOGÍA SISTEMA NERVIOSO PERIFÉRICO Consta de nervios periféricos que unen al encéfalo y a la médula espinal con el resto del cuerpo. los órganos de los sentidos y los órganos de los sistemas digestivos. 6. respiratorio. incluyendo los músculos. Sistema nervioso autónomo 311 .15. La porción motora del sistema nervioso periférico puede subdividirse en dos partes: el sistema nervioso somático y el sistema nervioso autónomo. y las neuronas motoras llevan respuestas o señales desde le sistema nervioso central a los órganos y músculos. Las neuronas sensitivas llevan información sensitiva hacia el sistema nervioso central que proviene de todas las partes del cuerpo.

El sistema nervioso autónomo controla las respuestas involuntarias al influir sobre órganos. en el agua y en los alimentos. El sistema nervioso autónomo es controlado tanto por la médula como el hipotálamo del encéfalo (fig. dirige el mantenimiento de actividades como la digestión. Estimulados por substancias químicas que se encuentran en el aire. • Fotorreceptores. ORGANOS DE LOS SENTIDOS Desde el nacimiento se entra en contacto con el mundo que nos rodea en diferentes formas.15) consta de dos divisiones. 312 . glándulas y músculo liso. el tacto. luz. dolor. El sistema nervioso simpático prepara al cuerpo para las situaciones estresantes o que requieran actividad. 6.GUÍA METODOLÓGICA DE BIOLOGÍA El sistema nervioso somático controla los movimientos voluntarios al activar los músculos esqueléticos. A través del sistema nervioso y los órganos de los sentidos se reciben los estímulos como sensaciones de color.-Se encuentran en los ojos y son estimulados por la luz. el sistema nervioso simpático y el parasimpático. el olfato. Los órganos de los sentidos son el gusto. la vista y el oído.20) El sistema nervioso autónomo (fig. la presión y otros estímulos mecánicos. • Mecanorreceptores. 5. En el cuerpo humano se presentan 3 tipos de receptores que se clasifican como: • Quimiorreceptores. del tipo “pelea o huida” mientras que el sistema nervioso parasimpático domina durante tiempos de “descanso”. Se encuentran en la piel y en los oídos y responden a las vibraciones. Estos receptores se encuentran en la boca y en la nariz. estos dos sistemas hacen contacto sináptico con los mismos órganos. pero producen efectos opuestos. Las señales del mundo exterior son captadas por los receptores de los sentidos como estímulos que se envían al encéfalo. sonido.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Con la información proporcionada elabora un cuadro sinóptico de cómo está organizado el Sistema Nervioso 313 .

314 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los órganos de los sentidos y construye un mapa conceptual de los mismos.

testículos Las glándulas exocrinas liberan sus secreciones sobre la superficie interna o externa de los tejidos cutáneos. Ejemplo: prolactina • Inhibitorio. paratiroides. Por ejemplo: insulina y glucagón • Sinergista. Ejemplo: somatostatina • Antagonista. páncreas. Disminuye actividad en un tejido. Las hormonas se producen en pequeñas cantidades. Ejemplo: gonadotropina ACTIVIDAD A continuación realiza una investigación documental y completa los recuadros vacíos del nombre de la glándula. Las más importantes son: hipófisis. tiroides. según corresponda 315 .10. viajan por la sangre. Promueve actividad en un tejido. Cuando un par de hormonas tiene efectos opuestos entre sí. afectan tejidos que pueden encontrarse lejos del punto de origen de la hormona y su efecto es directamente proporcional a su concentración. ovarios. controla muchas de las funciones del cuerpo. por medio de mensajeros químicos llamados hormonas. se liberan al espacio intercelular. ¿CÓMO FUNCIONA EL SISTEMA ENDOCRINO? Junto con el sistema nervioso.GUÍA METODOLÓGICA DE BIOLOGÍA 6. suprarrenales. Una hormona es una sustancia química producida por una célula que afecta el metabolismo de otra célula. Las glándulas endocrinas liberan sus secreciones directamente en el torrente sanguíneo. la mucosa del estómago o el revestimiento de los conductos pancreáticos. Cuando dos hormonas en conjunto tienen un efecto más potente que cuando se encuentran separadas. Esta es una hormona que altera el metabolismo de otro tejido endocrino. Ejemplo: hGH y T3/T4 • Trópica. Sus efectos son: • Estimulante. del nombre de la hormona o la función de ésta.

Epífisis Melatonina 316 . Hipersecreción se distingue porque promueve pigmentación en los melanocitos. se almacena en la pituitaria.GUÍA METODOLÓGICA DE BIOLOGÍA GLAN DULA HORMONA Somatotropina (hormona de crecimiento humana. (hGH) FUNCIÓN Acelera indirectamente el anabolismo proteico. Hipófisis Posterior Producida por el hipotálamo. absorción y catabolismo de grasas. disminuye el catabolismo de carbohidratos. Luteinizante (LH) Estimulante de Melanocitos (MSH) Antidiurética (vasopresina) ADH Se cree que ayuda a mantener la sensibilidad de la adrenal a la ACTH. Contribuye junto con la prolactina una lactancia exitosa. en la adultez genera acromegalia. Estimula secreción láctea en las glándulas mamarias. Hiposecreción en la niñez produce enanismo hipofisiario o proporcional. Estimula desarrollo de túbulos seminíferos y mantiene espermatogénesis en el hombre. Hipersecreción causa galactorrea en personas no lactantes Hipófisis Anterior Tiroideoestimulante TSH Promueve el crecimiento y desarrollo normal de la corteza adrenal y estimula sus secreciones Estimula maduración de folículos primarios y secreción de estrógenos en la mujer. Estimula contracción uterina y expulsión de leche. Una hipersecreción en la niñez genera gigantismo.

GUÍA METODOLÓGICA DE BIOLOGÍA Triyodotironina Tetrayodotironina T3. 317 . T4 Regula (disminuyendo) la concentración de calcio en la sangre estimulando la actividad de los osteoblastos (estimula depósito de sales en huesos) y reduciendo la de los osteoclastos Paratiroides Paratohormona PTH Timosinas Familia de hormonas que estimulan la producción y maduración de linfocitos T Mineralocorticoides (aldosterona. Gonadocorticoides Médula adrenal Prolongan e incrementan el efecto de la estimulación simpática del sistema nervioso autónomo en situaciones de estrés. etc) Corteza adrenal Acelera la gluconeogénesis y el catabolismo lípido.

Ovario Progesterona Mucosa gastrointestinal Gastrina Secretina Colecistocinina 318 .GUÍA METODOLÓGICA DE BIOLOGÍA Glucagón Estimula la entrada de nutrientes a las células y favorece su metabolismo. Disminuye concentración de glucosa en sangre Somatostatina Testículo Desarrollo y mantenimiento de características sexuales femeninas y ovulación.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Ubica cada glándula y escribe su nombre en la línea. Colorea cada glándula de distinto color 319 .

útero y vagina. que consisten en los labios mayores. presentándose variedad y lo más importante evolución. y un sistema de órganos sexuales accesorios que consisten principalmente en una serie compleja de conductos. glándulas bulbouretrales o de Cowper y vesículas seminales. Las características sexuales secundarias. Desde luego se hallan bajo el influjo constante de las hormonas sexuales femeninas. caracterizan a una mujer en su exterior. oviductos o trompas de Falopio. Además los genitales externos o vulva. que se conocen como órganos reproductores internos. El sistema reproductor femenino está formado por ovarios. 320 . principalmente sirve como medio de transporte para los espermatozoides. 6. se mezclan para formar el semen.GUÍA METODOLÓGICA DE BIOLOGÍA 6. como glándulas endocrinas. finalmente el pene (órgano de penetración) (fig. ¿CÓMO FUNCIONA EL SISTEMA REPRODUCTOR? En la reproducción sexual se necesita la participación de la pareja ya que cada uno aporta su célula sexual correspondiente que lleva la mitad de la información genética. SISTEMA REPRODUCTOR MASCULINO. En el cuerpo del hombre. labios menores y clítoris. y contiene sustancias nutritivas para ellos.11. como ya se mencionó. El líquido seminal que se mezcla con los espermatozoides antes de la eyaculación tiene gran importancia y variedad de funciones.16). para que al unirse las dos células (fecundación) den origen al nuevo ser con rasgos de los dos participantes. Las características sexuales de la mujer. ayuda a protegerlos de los efectos nocivos de la acidez del tracto genital femenino. y el líquido seminal secretado por los conductos y glándulas. los espermatozoides producidos en los testículos. las características primarias incluyen las gónadas. tres conjuntos de glándulas llamadas próstata. ya que elaboran y secretan hormonas sexuales. Estas estructuras en conjunto contribuyen a la formación y transporte del líquido seminal. Así. también se distinguen como primarias y secundarias. SISTEMA REPRODUCTOR FEMENINO. llamadas testículos. pero además sirve para lubricar los conductos a través de los cuales pasan los espermatozoides. Los testículos son órganos tanto citógenos o productores de células nuevas.

Vesículas seminales. Secretan moco para lubricar la uretra peneana y la vagina.4. Tabla 6. Glándulas de Cowper (bulbouretrales). Se retan sustancias básicas que neutralizan la acidez vaginal.16. Deposita los espermatozoides en el sistema reproductor femenino. Almacenan y conducen espermatozoides a la uretra. Conduce el semen desde el conducto deferente y la orina desde la vejiga al meato urinario (punta externa). 6. además contienen factores que aumentan la motilidad de los espermatozoides. Secretan substancias que contienen fructuosa (fuente de energía) y prostaglandinas (se supone que ocasionan cambios en la posición de los órganos reproductores femeninos para asegurar y ayudar al transporte de los espermas en su interior durante la búsqueda del óvulo). Principales órganos del Sistema Reproductor Masculino 321 . Pene FUNCION Produce espermatozoides y testosterona. Sistema reproductor masculino ESTRUCTURA Testículo Epidídimo y conducto deferente Uretra.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Próstata.

322 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y explica qué sucede en la siguiente figura de los túbulos seminíferos.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y explica qué sucede en la siguiente figura del ovario 323 .

17. Sistema reproductor femenino ESTRUCTURA Ovario Trompa de Falopio u oviducto FUNCION Produce óvulos. 6. progesterona y estrógenos Transportan los óvulos desde los ovarios hasta el útero Útero El endometrio se engruesa para anidar al óvulo. Aloja y alimenta al feto cuando hay embarazo Funciona como receptáculo de los espermatozoides durante el coito Sitio de extrema sensibilidad Se hincha al llenarse de sangre durante la excitación sexual. Vagina Vulva Clítoris 324 .GUÍA METODOLÓGICA DE BIOLOGÍA Fig.

GUÍA METODOLÓGICA DE BIOLOGÍA ANTICONCEPCIÓN El criterio para recomendar y utilizar un método anticonceptivo en los jóvenes y adolescentes es muy diferente del empleado para las personas de mayor edad. Realízalo en varios pliegos de papel bond y señala con un mismo color los órganos pertenecientes a cada sistema. Hay diferentes métodos anticonceptivos que pueden ser utilizados por jóvenes y adolescentes. Es el Médico quien deberá orientarlos y guiarlos. los métodos naturales y los métodos quirúrgicos o definitivos. Al final. En la vida sexual de los jóvenes hay que tomar en cuenta diversos factores como la frecuencia de actividad sexual. no requieren de la consulta médica para su prescripción. para que después los juntes e interrelaciones. Muchos de estos anticonceptivos pueden ser en realidad una mezcla o combinación de dos o más métodos y cada uno de ellos tienen las indicaciones de uso para obtener buenos resultados y alcanzar su máxima efectividad. para que de manera conjunta se tome una decisión adecuada a cada situación. Solo los llamados anticonceptivos de barrera como el condón y las espumas. el tipo de pareja (sí es estable o no). jaleas y óvulos anticonceptivos. el desarrollo físico y emocional. Debes incluir todos los órganos y sistemas del cuerpo. Se sugiere que elaboren un mapa conceptual por cada sistema (como el mapa del sistema digestivo de la página 298). en plenaria se presentará el mapa conceptual. ACTIVIDAD Se conformarán equipos de cuatro integrantes. así como la actividad y la motivación para la utilización de los métodos anticonceptivos. los dispositivos intrauterinos (DIU). Los métodos y técnicas anticonceptivas se clasifican en diversos grupos según determinadas características: los anticonceptivos de barrera física. Utilizando los conocimientos acerca de la estructura y funcionamientos de cada uno de los órganos y sistemas del cuerpo humano realiza un mapa conceptual integrador donde señales la interrelación que existe entre los diferentes órganos de los diferentes sistemas. de barrera química. los anticonceptivos hormonales. 325 .

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y llena el siguiente cuadro de los métodos anticonceptivos 326 .

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Completa la tabla escribiendo el nombre de los órganos y las funciones que realiza cada sistema del cuerpo humano SISTEMA ÓRGANOS FUNCIÓN Tegumentario Muscular Óseo Digestivo Respiratorio Circulatorio Linfático Excretor Nervioso Endocrino Reproductor 327 .

Reimpresión. Ciencia y Naturaleza. 328 . Arquetipo Grupo Editorial.GUÍA METODOLÓGICA DE BIOLOGÍA EVALUACIÓN A través de esquemas impresos de cada uno de los sistemas del cuerpo humano se le indicará al alumno que identifique y escriba las estructuras que los componen. Puntos 30 Puntos 5 Puntos 20 Puntos 30 Aspectos a mejorar : BIBLIOGRAFÍA BÁSICA Atlas Visual del Cuerpo Humano (2009). Biología. Receptivo Relaciona la estructura y función de algunos órganos de los sistemas del cuerpo humano a través de mapas mentales Puntos 10 Resolutivo Relaciona la estructura y función de los órganos y algunos sistemas del cuerpo humano a través de mapas mentales Autónomo Relaciona la estructura y función de los órganos y sistemas del cuerpo humano a través de mapas mentales Estratégico Relaciona como la estructura de órganos y sistemas del cuerpo humano trabajan de manera conjunta desempeñando una función coordinada. T. Segunda Edición. B. Audesirk . y Byers. PearsonPrentice Hall. (2008). • Elaboración de material de difusión. ACTIVIDAD ESPECÍFICA: • Portafolio de evidencias Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad DIAGNÓSTICA FORMATIVA SUMATIVA 30% 20% 20% 30% MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios Relaciona la estructura y función de los diferentes órganos y sistemas del cuerpo humano a través de mapas mentales Ponderación Logros: Pre-formal Identifica la estructura y la función de los diferentes sistemas del cuerpo humano a través de mapas mentales. ACTIVIDADES DE APRENDIZAJE: • Resolución de las actividades de la Guía Metodológica • Elaboración de modelos anatómicos • Investigación documental • Reportes de laboratorio en V de Gowin • Construcción de mapas mentales.

Finn. 3ra. Anne M. (2007). Revista On Line de Educación. Editorial Mc Graw-Hilll. Ed. Tres Guerras Jesús: (2009) Anatomía y Fisiología del Cuerpo Humano. evolución. J. Octava Edición. www.org/teen/en_espanol/cuerpo/lungs_esp. Nelson. VIDEOS RECOMENDADOS • Atlas del Cuerpo Humano. Ed. Vol. Discovery Channnel. Editorial océano. Médica Panamericana. Fundamentos de Anatomía y Fisiología. Villee. España. 4 La piel (DVD en español) • Atlas del Cuerpo Humano. Grupo Docente. España. Primera Edición en español. 5 Glándulas y Hormonas (DVD en español) • La Increíble Máquina Humana. Anatomía Comparada. Anagnostakos. Ed. (1999).com. México. Tortora. Médica Panamericana. Claude A. Planeta de Agostini. Histología. Gilroy. Anagnostakos. (2002) Principios de Biología. Gerald y J. Mc. Principios de Anatomía y Fisiología. Editorial Limusa Willey. Geneser. Gerald y J. J. Graw Hill/ Interamericana. Médica Panamericana. Vol. (2011). Ed. BIBLIOGRAFÌA COMPLEMENTARIA Atlas visual de las ciencias. Ed. Prometeheus: (2011) Atlas de Anatomía Fichas de autoevaluación. Reimpresión de la Segunda Edición.McGraw-Hill/Interamericana. • Universo Interior. séptima edición. Ed. Discovery Channnel. National Geographic • Cuerpo humano. función. 11ª edición.GUÍA METODOLÓGICA DE BIOLOGÍA Tortora.html 329 . TIC’s http://kidshealth. (2000). (2000) Biología. Kardong. (2011). Gideon E. Introducción al Cuerpo Humano. Médica Panamericana. Tercera Edición. Video Shark. Kenneth V.

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->