P. 1
CANNABINOIDES Y CÁNCER DE PRÓSTATA (tesis doctoral de Nuria Olea Herrero)

CANNABINOIDES Y CÁNCER DE PRÓSTATA (tesis doctoral de Nuria Olea Herrero)

|Views: 753|Likes:
Publicado porFrancisco Bengochea
Efecto de los cannabinoides en células tumorales de próstata PC-3. Papel del receptor CB2.
Efecto de los cannabinoides en células tumorales de próstata PC-3. Papel del receptor CB2.

More info:

Published by: Francisco Bengochea on Apr 30, 2012
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

05/22/2013

pdf

text

original

Sections

Universidad de Alcalá

Departamento de Bioquímica y Biología
Molecular






EFECTO DE LOS CANNABINOIDES EN
CÉLULAS TUMORALES DE PRÓSTATA PC-3.
PAPEL DEL RECEPTOR CB2


Tesis Doctoral

Nuria Olea Herrero
Madrid, 2010





Financiación








































FINANCIACIÓN




Financiación

Esta Tesis Doctoral ha sido realizada gracias a la financiación de los siguientes proyectos de
investigación por diferentes organismos públicos:

TÍTULO DEL PROYECTO: "Efecto de agonistas y antagonistas de cannabinoides y vanilloides
sobre la proliferación de células tumorales de próstata. Estudio in
vitro e in vivo”.
ENTIDAD FINANCIADORA: CAM, GR/SAL/0640/2004
DURACIÓN: 2005
INVESTIGADOR PRINCIPAL: Inés Díaz-Laviada Marturet


TÍTULO DE PROYECTO: "Efecto de los agonistas de cannabinoides y vanilloides sobre la
diferenciación neuroendocrina de células tumorales de próstata”.
ENTIDAD FINANCIADORA: MEC, SAF 2005-00602
DURACIÓN: 2005-2008
INVESTIGADOR PRINCIPAL: Inés Díaz-Laviada Marturet


TÍTULO DE PROYECTO: “Mecanismos de acción de los cannabinoides sobre células
tumorales de próstata. Diferenciación neuroendocrina”.
ENTIDAD FINANCIADORA: CCG06-UAH/SAL-0562
DURACIÓN: 2007
INVESTIGADOR PRINCIPAL: Inés Díaz-Laviada Marturet


TÍTULO DE PROYECTO: “ESTUDIO DE LA NEUROFARMACOLOGÍA Y POTENCIAL
TERAPÉUTICO DEL SISTEMA ENDOCANNABINOIDE”
ENTIDAD FINANCIADORA : CAM S-Sal-0261-2006
DURACIÓN: 2007-2010
INVESTIGADOR PRINCIPAL: Manuel Guzmán Pastor


Financiación


TÍTULO DEL PROYECTO: Estudio Del Sistema Endocannabinoide en CélulasTumorales.
Regulación de la Secreción de Citoquinas e Implicaciones
Metabólicas”.
ENTIDAD FINANCIADORA: SAF2008-03220
DURACIÓN: 2009-2011
INVESTIGADOR PRINCIPAL: Inés Díaz-Laviada Marturet


TITULO DEL PROYECTO: Acción de componentes naturales sobre la proliferación y
secreción de citoquinas en células tumorales de próstata.
ENTIDAD FINANCIADORA: Comunidad Castilla-LaMancha, PII1/09-0165-0822
DURACIÓN: 2009-2011
INVESTIGADOR PRINCIPAL: Inés Díaz-Laviada Marturet


TITULO DEL PROYECTO: “Propiedades antitumorales de los vanilloides en células
tumorales de próstata”
ENTIDAD FINANCIADORA: CAM/UAH, CCG08-UAH/BIO-3914
DURACION: 2009
INVESTIGADOR PRINCIPAL: Sophie Malagarie-Cazenave


Agradecimientos






























AGRADECIMIENTOS


Agradecimientos



En primer lugar tengo que agradecer a mi Directora de Tesis, la Doctora Inés Díaz-Laviada,
haberme dado la gran oportunidad de cumplir este sueño. Gracias por llevarme de la mano en el arduo
camino de la ciencia, pero sobre todo por tu aliento. Gracias por aceptar ser mi maestra, por enseñarme lo
que es el rigor científico y gracias también por tu gran calidad humana.

A la Universidad de Alcalá y al Departamento de Bioquímica y Biología Molecular, por permitirme
realizar aquí la Tesis Doctoral. También a todo el personal del Departamento de Bioquímica así como de
los Centros de Apoyo de la Universidad de Alcalá. Gracias a Angélica por facilitarme tantísimo lo relativo a
la burocracia. A Juan y Guillermo, por sus lecciones de seguridad en el laboratorio, así como por su gran
ayuda y disposición. A Rafa por su amable ayuda con los trámites de las becas. Y a Aurora por su diligente
labor en la gestión.

A mis compañeros de laboratorio, sin los cuales este trabajo habría sido irrealizable. Gracias a Lidia
y María, por mis primeras lecciones sobre ciencia empírica y por su infinita comprensión en mis primeros
días de laboratorio. A Ana, por ser mi guía durante toda esta Tesis; qué hubiera hecho yo sin ella… Y
también por ser el ejemplo del esfuerzo, el tesón y el amor al trabajo. A Sophie, por su gran cariño y
camaradería, siempre dispuesta a pararlo todo para escucharme y regalarme su comprensión, además de
por todas sus sabias lecciones. A Diana, por enseñarme tantas cosas, por sus infinitos ánimos y su enorme
confianza, pero sobretodo, por su dulce afecto tan reconfortante. Y a mis últimos compañeros de
laboratorio, Sergio, Marta y Cecilia, por renovar con su ímpetu mi ilusión por la ciencia. Gracias a todos y
cada uno también por ser además de compañeros, amigos.

Gracias igualmente a todos mis compañeros del Departamento de Bioquímica. No puedo dejar aquí
de nombrar a algunos, los más cercanos. Gracias a Ana Fernández, Ana Valdehíta, Ana Bajo, Eva Vacas y
a todos los demás miembros de su laboratorio por la solicitud y el compañerismo. A Borja, Luís y Eva por
su inestimable ayuda y sus ánimos. Y especialmente, gracias a Alberto por ilustrarme en tantas ocasiones,
por ser siempre una referencia y por estar en todo momento más que dispuesto a ayudar; a Luís, por su
grandísimo apoyo y su desinteresado y desmedido favor; y a Arantxa, por su increíble ímpetu, su alegría y,
ante todo, por su especial cariño. Gracias a todos por regalarme además su enorme amistad.

Agradecimientos



Al grupo de Bioquímica del Hospital Ramón y Cajal. Gracias al Doctor Javier Martínez Botas y al
Doctor Diego Gómez-Coronado por darme la oportunidad de trabajar en su grupo y por instruirme en la
Biología Molecular. Al Doctor Miguel Ángel Lasunción, por permitirme también formar parte de su grupo y
por lo mucho que aprendí durante sus seminarios. Y a todos mis compañeros, por nuestras innumerables
charlas sobre ciencia, vuestro gran apoyo y acertado consejo. Gracias necesariamente también por vuestra
amistad, de forma especial a Alberto, Carolina, David y Andrea.

Gracias también al Doctor Neil Perkins y a su grupo, por acogerme en su laboratorio y poner
además a mi disposición todos los medios del mismo. La estancia en su laboratorio significó para mí una
única y valiosísima oportunidad.

Gracias al Doctor Jorge Montserrat, a Miguel y a Leticia, por su inestimable ayuda esclareciendo
mis dudas sobre Inmunología y por guiarme en los experimentos con los linfocitos. Gracias aquí también a
todos los voluntarios que hicieron posible estos experimentos.

Tengo demasiado asimismo que agradecer a todos mis amigos fuera del ámbito laboral, tanto de la
universidad como de Guadalajara, sin cuyo apoyo este trabajo habría sido muy difícil de realizar. Gracias
por compartir tanto conmigo, por regalarme vuestras magníficas risas y por calmar mis lágrimas. Gracias
por estar siempre ahí y, más aún, por contar siempre conmigo. Tardé en encontrarles en mi camino, pero
desde luego la espera no fue baladí.

Por último, a mi familia, especialmente a mi madre y a mi hermana. Me siento terriblemente
afortunada de contar con su protección, cariño y comprensión. Gracias por darme tanto y por apoyarme en
cada uno de los pasos que me han llevado hasta aquí.



Abreviaturas








































ABREVIATURAS

Abreviaturas


AA Ácido araquidónico
AEA Anandamida
2-AG 2-Araquidonil-glicerol
AP-1 Proteína activada 1
AR Receptor de andrógenos
A-SMasa Esfingomielinasa ácida
ATCC American Type Culture Collection
ATF4 Factor de transcripción 4
ATF6 Factor de transcripción 6
ATP Adenosina trifosfato
BAFFR Factor activador de células B
BCR Receptor de células B
BPH Hiperplasia benigna de próstata
BSA Albúmina sérica bovina
cAMP Adenosin monofosfato cíclico
CB1 Receptor de cannabinoides tipo 1
CB2 Receptor de cannabinoides tipo 2
CBC Cannabicromeno
CBD Cannabidiol
CBG Cannabigerol
CBN Cannabinol
CD40 Cluster de diferenciación 40
CerS Ceramida sintasa
CerK Ceramida quinasa
C1P Ceramida 1 fosfato
CPZ Capsazepina
cox-2 Cicloxigenasa tipo 2
CREB Proteína de unión a elementos de respuesta a AMP cíclico
CTL Células T citotóxicas
CYP450s Citocromo P-450 s
DAG Diacilglicerol
DAGL Diacilglicerol lipasa
DAPI 4´, 6´-diamidino-2-fenilindol
DCFH-DA 6-carboxi-2´,7´-diclorodihidrofluoresceina acetoximetilester
DETAPAC Ácido dietilenotriaminopentacético
DED Dominio efector de muerte
DD Dominio de muerte
DMSO Dimetil sulfóxido
DOPG Dileoyl-fosfatidilglicerol
dpm desintegraciones por minuto
EGF Factor de crecimiento epidérmico
ERSA Elemento de respuesta a estrés de retículo
ERK Quinasa regulada por señales extracelulares
FADD Dominio de muerte asociado a Fas
FAAH Enzima aminohidrolasa de ácidos grasos
FAK Quinasa de adhesión focal

Abreviaturas


FBS Suero fetal bovino
FITC Isotiocianato de fluorisceína
gp130 glicoproteína 130
GRP78 Chaperona regulada por glucosa 78
HDL Lipoproteínas de alta densidad
HRP Peroxidasa de rábano
IkB Proteína inhibidora de NFkB
IKK Quinasa de los inhibidores de NFkB
IL-1 Interleuquina 1
IL-1R Receptor de IL-1
IL-6 Interleuquina 6
IL-6Ra Receptor de IL-6 alfa
IP Ioduro de propididio
IRE1 Enzima dependiente de insitol 1
ITS Insulina, transferrina, selenio
Jak Janus quinasa
JNK c-Jun N-terminal quinasa
KSR Quinasa supresora de Ras
MAPK Proteína quinasa activada por mitógenos
MAP2K Proteína quinasa activada por mitógenos
MAP3K Proteína quinasa quinasa quinasa activada por mitógenos
MAP4K Proteína quinasa quinasa quinasa quinasa quinasa activada
por mitógenos
MEK Quinasa activada por mitógenos
MET Metanandamida
mRNA RNA mensajero
mTOR Proteína diana de rampamicina en los mamíferos
MTT Bromuro de 3-[4,5-dimetiltiazol-2-il]-2,5-difenil-tetrazol
NADA N-araquidonil-dopamina
NAC N-acetil- cisteína
NAPE N-araquidonoil-fosfatidiletanolamina
NAPE-PLD Fosfolipasa D selectiva para NAPE
NEMO Modulador esencial de NFkB
NGF Factor de crecimiento nervioso
NIDDM Diabetes mellitus no insulino dependiente
NIK Quinasa inuctora de NFkB
NFκB Factor nuclear kappa B
N-SMasa Esfingomielinasa neutra
LOX Lipoxigenasa
O-AEA O-araquidonil-etanolamina o virodhamina
PA Ácido fosfatídico
PAK Proteína quinasa activada por p21
PAP Fosfatasa ácida prostática
PBS Tampón fosfato salino
PEA N-palmitoiletanolamina
PERK Quinasa del retículo endoplasmático
PC Fosfatidil colina

Abreviaturas

PI Fosfatidilinosítidos
PIA Atrofia proliferativa inflamatoria
PIN Neoplasia intraepitelial prostática
PIP Fosfatidilinositol 4-fosfato
PI3K Fosfatidil inositol 3-quinasa
PKA Proteína quinasa A
PKB Proteína quinasa B
PKC Proteína quinasa C
PMSF Fenil metilsulfonilfluoruro
PLA1 Fosfolipasa 1
PLD Fosfolipasa A
PLC Fosfolipasa C
PLD Fosfolipasa D
PP1 Proteían fosfatasa 1
PP2A Proteían fosfatasa 2A
PSA Antígeno prostático específico
RHD Dominio homólogo a Rel
RTK Receptor tirosina quinasa
SDS Dodecil sulfato sódico
sgp130 glicoproteína 130 soluble
sIL-6R Receptor de IL-6 soluble
SM Esfingomielina
SMasa Esfingomielinasa
SPT Serina palmitoil transferasa
siRNA RNA de interferencia
STAT Factor de transcripción transductores de la señal y activadores
de transcripción
STI Inhibidor de tripsina de soja
THC Δ
9
- Tetrahidrocannabinol
TEA Trietanolamina
TCA Ácido tricloroacético
TLC Cromatografía en capa fina
TLR Receptor similar a Toll
TMB 3,3´,5,5´- tetrametilbenzidina
TNF Factor de necrosis tumoral
TNFR Receptor de TNF
Tris 2-amino-2-(hidroximetil)-1,3-propanediol
TRP Canal activado por potencial transitorio
TRPA Canal activado por potencial transitorio tipo ankirina
TRPC Canal activado por potencial transitorio canónico
TRPM Canal activado por potencial transitorio tipo melastatina
TRPML Canal activado por potencial transitorio tipo mucopolina
TRPP Canal activado por potencial transitorio tipo policistina
TRPV Canal activado por potencial transitorio tipo vanilloide
UPR Respuesta al mal plegamiento de proteínas
VEGF Factor de crecimiento del endotelio vascular
XBP1 Proteína 1 de unión a X-box

Índice







































ÍNDICE



Índice

ÍNDICE

INTRODUCCIÓN 1
1.- LA PRÓSTATA 3
1.1.- Próstata normal 3
1.1.1. Anatomía de la próstata 3
1.1.1. Histología de la próstata 4
1.2.- Patologías de la próstata 5
1.2.1.Prostatitis 5
1.2.2.Hiperplasia benigna de prostáta (HBP) 6
1.2.3.Cáncer de próstata 7
1.2.3.1.Estados premalignos 7
1.2.3.2.Desarrollo y evolución del cáncer 9
1.2.3.3 Fases del cáncer de próstata 9
1.2.3.4 Modelos celulares 11
2.- MECANISMOS MOLECULARES Y CELULARES IMPLICADOS EN EL
CÁNCER DE PRÓSTATA. POSIBLES DIANAS TERAPÉUTICAS 14
2.1.Señalización celular 14
2.1.2.Vías de señalización que conducen a apoptosis 14
2.1.2.Vías de proliferación implicadas en
crecimiento y supervivenciacelular 20
2.2.Sistema inmune: Inmunoterapia 23
2.2.1.Papel de las células T 24
2.2.2.Papel de la IL-6 26
2.2.3.Papel del factor nuclear kappa B 29
3.- CANNABINOIDES Y SISTEMA ENDOCANNABINOIDE 32
3.1.Reseña histórica 32
3.2.Tipos de cannabinoides 33
3.2.1.Compuestos bioactivos de Cannabis sativa 34
3.2.2.Ligandos endógenos 34
3.2.3. Ligandos sintéticos 35
3.3.Receptores de cannabinoides 36

Índice



3.3.1.CB1 y CB2 37
3.3.2.GPR-55 37
3.3.3. TRPV1 38
3.4.Mecanismos de transducción a través de CB1 y CB2 39
3.5.Cannabinoides y cáncer 40
3.5.1.Cannabinoides y cáncer de próstata 42
3.5.2.Cannabinoides y sistema inmune 42

HIPÓTESIS Y OBJETIVOS 45

MATERIALES Y METODOS 49
1.- MATERIALES 51
1.1.- Materiales empleados en cultivos celulares 51
1.2.- Reactivos empleados en la elaboración de tampones 51
1.3.- Agonistas, antagonistas e inhibidores 52
1.4.- Líneas celulares 52
2.- MÉTODOS 53
2.1.- Medida de la viabilidad celular mediante MTT 53
2.2.- Medida de la división celular mediante incorporación de [
3
H]-timidina 54
2.3.- Tinción de células con Ioduro de Propidio para análisis del cilo c
elular por citometría de flujo 54
2.4.- Unión de Ioduro de Propidio y anexina V-FITC 54
2.5.- Tinción de núcleos con DAPI 55
2.6.- Medida de los niveles de ceramida 55
2.6.1.- Extracción de lípidos 55
2.6.2.- Cuantificación de ceramidas 56
2.7.- Determinación de niveles de IL-6

57
2.8.- Determinación de niveles de IL-17 57
2.8.1.- Aislamiento de células mononucleares 57
2.8.2.- ELISA de IL-17 58
2.9.- Separación de fracción particulada y solube de las células 58
2.10.- Separación núcleo / citosol 59
2.11.- Cuantificación de proteínas 59

Índice

2.12.- Electroforesis en gel de poliacrilamida-SDS e inmunopredetección
de proteínas 60
2.13.- Silenciamiento con RNA de interferencia 62
2.14.- Aislamiento de RNA 63
2.15.- Retrotranscripción(RT) 63
2.16.- PCR a tiempo real (RT-PCR ó qPCR) 64
2.17.- Ensayo de inmunoprecipitación de la cromatina (CHIP) 65
2.17.1.-Fijación de la unión DNA-proteínas y fragmentación
del DNA 65
2.17.2.- Inmunoprecipitación 66
2.17.3.- Aislamiento de DNA 66
2.17.4.- Cuantificación de las muestras 66
2.18.- Experimentación animal 67
2.18.1.- Animales 67
2.18.2.- Inducción de tumores 67
2.18.3.- Tratamiento de las muestras 68
2.19.-Análisis estadístico 68

RESULTADOS 69
1.-EFECTO DE MET Y JWH015 SOBRE EL CRECIMIENTO Y MUERTE
CELULAR 71
2.- PAPEL DEL RECEPTOR CB2 EN EL EFECTO ANTIPROLIFERATIVO
DE LOS CANNABINOIDES 77
3.- ESTUDIO DE LA SEÑALIZACIÓN CELULAR ACTIVADA POR
CANNABINOIDES 81
3.1.- Síntesis de ceramida 81
3.2.- Cascadas de señalización intracelulares 85
4.- EFECTO ANTITUMORAL IN VIVO DE JWH015 87
5.- ESTUDIO DE LA SECRECIÓN DE IL-6 89
5.1.- Papel de CB2 91
5.2.- Papel de la síntesis de ceramida en la secreción de IL-6 98
5.3- Señalización celular implicada en la secreción de IL-6 93
5.3.1.Ruta de señlaización de NFκB 93

Índice



5.3.2. Ruta de señlaización de PI3K/Akt 97
5.3.3. NFκB controla la expresión de IL-6 99
6- PAPEL DE IL-6 EN EL CRECIMIENTO Y MUERTE CELULAR 100
6.1.- Funcionalidad de la IL-6 secretada por las células PC-3 100
6.2.- Efecto de IL-6 sobre la viabilidad celular 102
6.3- Expresión y actividad de STAT3 102
7- ACTIVACIÓN DE LA RESPUESTA TH17 103

DISCUSIÓN 105
1.-EFECTO ANTIPROLIFERATIVO DE LOS CANNABINOIDES 107
2.- MECANISMO DE ACCIÓN DE LOS CANNBINOIDES SOBRE LAS C
ÉLULAS PC-3 111
3.- SECRECIÓN DE IL-6 INDUCIDA POR LOS CANNABINOIDES 115
4.- PAPEL DE IL-6 SOBRE EL CRECIMIENTO Y LA MUERTE CELULAR 118
4.- ACTIVACIÓN DE LA RESPUESTA TH17 121
4.- PAPEL DE DEL RECEPTOR CB2 122

CONCLUSIONES 127

BIBLIOGRAFÍA 131

ANEXO I: SUMMARY 149

ANEXO II: PUBLICACIONES A LAS QUE HA DADO
LUGAR ESTA TESIS DOCTORAL 155






















“La utopía está en el horizonte. Camino
dos pasos, ella se aleja dos pasos y el
horizonte se corre diez pasos más allá.
¿Entonces para qué sirve la utopía? Para
eso, sirve para caminar. “

Eduardo Galeano




“Jamás el esfuerzo desayuda a la fortuna”

Fernando de Rojas




Introducción































INTRODUCCIÓN






Introducción

1.- LA PRÓSTATA
3

Figura 1. Ubicación regional de la próstata.
1.1.- Próstata normal

La próstata es una glándula túbulo-alveolar del órgano reproductor masculino, de pequeño
tamaño, situada debajo de la vejiga y delante del recto, que envuelve la primera porción de la uretra
(figura 1). Se desarrolla por invaginación del epitelio desde la uretra durante el tercer mes de gestación
bajo la influencia del mesénquima. Permanece sin cambios hasta la pubertad, cuando se produce un
aumento de su tamaño que puede alcanzar unos 20 g en un adulto de 25 ó 30 años. Su función es
segregar un líquido ligeramente alcalino que forma parte del semen y que protege a los espermatozoides,
neutralizando el pH ácido de la vagina y aumentando así su supervivencia.

Próstata
Uretra
Pene
Testículos
Epidídimo Escroto
Túnica
testicular
Ano
Vesícula
seminal
Recto
Vejiga
1.1.1 Anatomía de la próstata

Según la clasificación de McNeal, la próstata está formada por una zona fibromuscular anterior y
una zona glandular, dividida a su vez en tres zonas: la zona central, cruzada por los conductos
eyaculadores que supone un 25% de la glándula, la zona de transición, que rodea a la uretra posterior
con un 5% del volumen glandular y la zona periférica, con un 70% del volumen glandular (McNeal, 1968).
En la zona de transición es dónde se origina la hiperplasia benigna de próstata (BPH), mientras que en la
periférica es dónde se desarrolla principalmente el cáncer de próstata (De Marzo et al., 2007). También

Introducción

existe otra clasificación, menos utilizada, que divide anatómicamente a la próstata en cinco lóbulos:
anterior, posterior, medio y dos laterales (figura 2).
Lóbulos laterales
Lóbulo anterior
Cápsula prostática
Lóbulo medio
Lóbulo posterior
Conductos eyaculadores
Uretra
B) A)
Zona central
Zona de transición
Zona periférica

Figura 2. Anatomía de la próstata. A) Esquema de las zonas de la glándula prostática según la clasificación de
McNeal (vista anteroposterior). B) Esquema de la clasificación de la próstata en lóbulos.


1.1.2 Histología de la próstata

La glándula prostática está formada por dos tipos de tejidos: estroma y epitelio-glandular (figura
3). El estroma rodea el epitelio y ambos tejidos interaccionan entre sí mediante la secreción de
andrógenos, hormonas esteriodeas, factores de crecimiento y mediadores que regulan el crecimiento y la
diferenciación, manteniendo así la homeostasis de la próstata. Los separa una membrana basal, una
capa de tejido conectivo y una capa de glicosa-aminoglicanos, polisacáridos y glicolípidos que conforman
la denominada matriz extracelular. Dicha matriz tiene una función conectora y de comunicación que es
fundamental (Nieto et al., 2007; Cunha, 2008).

• El estroma se conforma de músculo liso, colágeno y fibroblastos, además de contener terminales
nerviosos, vasos sanguíneos y células infiltradas del sistema inmune.

• El epitelio está formado por distintas capas de células:

- Las células luminales secretoras son las más cercanas a la luz de la glándula y las más
abundantes en el tejido normal. Forman un compartimento exocrino que secreta antígeno específico
prostático (PSA) y fosfatasa ácida prostática (PAP) en el lumen glandular. Estas dos proteínas sirven de
4


Introducción

marcador tumoral, ya que sus niveles se modifican en el cáncer. Son las células más diferenciadas y
expresan altos niveles del receptor de andrógenos (AR), dependiendo así de la presencia de andrógenos
para su supervivencia.
marcador tumoral, ya que sus niveles se modifican en el cáncer. Son las células más diferenciadas y
expresan altos niveles del receptor de andrógenos (AR), dependiendo así de la presencia de andrógenos
para su supervivencia.
- Las células basales forman la membrana basal. Están relativamente indiferenciadas y
no posen actividad secretora. Presentan niveles bajos o nulos del AR, por lo que son andrógeno
independientes. Sí expresan receptor de estrógenos (ER) y responden a éstos proliferando.
- Las células basales forman la membrana basal. Están relativamente indiferenciadas y
no posen actividad secretora. Presentan niveles bajos o nulos del AR, por lo que son andrógeno
independientes. Sí expresan receptor de estrógenos (ER) y responden a éstos proliferando.
- También existe un pequeño número de células neuroendocrinas en el compartimento
basal, que secretan serotonina y otros neuropéptidos (Lang et al., 2009).
- También existe un pequeño número de células neuroendocrinas en el compartimento
basal, que secretan serotonina y otros neuropéptidos (Lang et al., 2009).
5

Figura
- Además hay un reducido número de células madre, que originan todos los tipos
celulares del epitelio al diferenciarse, dependiendo del balance entre estrógenos y andrógenos (Sun et al.,
- Además hay un reducido número de células madre, que originan todos los tipos
celulares del epitelio al diferenciarse, dependiendo del balance entre estrógenos y andrógenos (Sun et al.,
3. Histología de la próstata. Células que conforman la unidad epitelial y estromal.
2009).
está provocada por una infección bacteriana y puede ser aguda o crónica, si se reitera. La no bacteriana
suele ser la más frecuente, y a su vez se divide en in itos en el fluido
Células que conforman la unidad epitelial y estromal.
2009).
está provocada por una infección bacteriana y puede ser aguda o crónica, si se reitera. La no bacteriana
suele ser la más frecuente, y a su vez se divide en in itos en el fluido

1.2.- Patologías de la próstata 1.2.- Patologías de la próstata

1.2.1 Prostatitis 1.2.1 Prostatitis

Es una manifestación que incluye distintos procesos de naturaleza inflamatoria o infecciosa que
afectan a la glándula prostática. Se puede clasificar en dos clases, bacteriana y no bacteriana. La primera
prostático, y no inflamatoria, que se da en ausencia de inflamación urogenital. También existe una
tercera, no asintomática, que sólo se manifiesta al explorar la próstata a causa de otras patologías
(Krieger et al., 2008) .
Es una manifestación que incluye distintos procesos de naturaleza inflamatoria o infecciosa que
afectan a la glándula prostática. Se puede clasificar en dos clases, bacteriana y no bacteriana. La primera
prostático, y no inflamatoria, que se da en ausencia de inflamación urogenital. También existe una
tercera, no asintomática, que sólo se manifiesta al explorar la próstata a causa de otras patologías
(Krieger et al., 2008) .
flamatoria, con presencia de leucoc flamatoria, con presencia de leucoc
AR AR AR AR
Células luminales
secretoras
Células basales
Células
neuroendocrinas
Células estromales
Células madre
Epitelio
Estroma

Introducción

6

ción. Una continua exposición de la próstata a la inflamación puede conducir a
cambios

e caracteriza por una proliferación anormal de las
células de la próstata, y normalmente acontece en la zona de transición periuretral de la glándula
(Ember

La prostatitis crónica puede ocasionar daño celular en el estroma y en el epitelio, causando
frecuentemente inflama
dramáticos en la estructura y función de las proteínas, así como alteraciones genéticas,
produciendo daño tisular que puede inducir neoplasia (Karan et al., 2009; Khandrika et al., 2009).
Distintas fuentes asocian de hecho la prostatitis con el inicio y progresión de la hiperplasia benigna de
próstata (Begley et al., 2008; Delongchamps et al., 2008; Penna et al., 2009) así como del cáncer de
próstata (De Marzo et al., 2007; Sciarra et al., 2007; Rebbeck et al., 2008; Wong et al., 2009), pudiendo
ser también esta alteración el eslabón que une ambas patologías.


1.2.2 Hiperplasia Benigna de próstata
La hiperplasia benigna de próstata (BPH) s
ton et al., 2008). Existen distintos factores que pueden influir en la aparición de esta patología. El
más relevante de ellos es la edad, ocurriendo frecuentemente una remodelación tisular en la próstata,
principalmente en la zona de transición, que viene acompañada de la alteración de las delicadas
interacciones entre el estroma y el epitelio. Estas modificaciones suelen afectar sobre todo a las células
basales, que cambian su metabolismo y se convierten en hipertróficas (Geramoutsos et al., 2004). Las
alteraciones hormonales también están presentes en el desarrollo de la BPH. Existe un incremento de la
señalización androgénica en la BPH, que afecta a las células luminales secretoras, que dependen de
andrógenos para diferenciarse (Roberts et al., 2004a; Roberts et al., 2004b). Por otro lado, un aumento
de la estimulación estrogénica puede producir crecimiento aberrante en las células epiteliales y un
aumento en la proliferación de las células estromales (Prins et al., 2008). Por último la asociación entre la
BPH y el síndrome metabólico ha sido estudiada recientemente, considerándose la diabetes mellitus no
insulinodependiete (NIDDM), la hipertensión, la obesidad y los altos niveles de lipoproteínas de alta
densidad (HDL) factores de riesgo para la BHP (Briganti, 2009).
La BPH, aunque no es considerada un estado premaligno, sí puede ser empleada como un factor
de prognosis del cáncer de próstata (Alcaraz et al., 2009).



Introducción

7

1.2.3 Cáncer de próstata
l cáncer de próstata es el tumor maligno más diagnosticado en varones en el mundo occidental,
el segun
1.2.3.1 Estados premalignos
La patogénesis del cáncer de próstata incluye tanto elementos hereditarios como ambientales.
Dentro
• trofia proliferativa inflamatoria
La atrofia proliferativa inflamatoria (PIA) es una atrofia focal de la glándula prostática ocasionada
por dañ
unque la mayoría de las atrofias focales se consideran quiescentes, algunas de las células
dañad

E
do tumor maligno más frecuente del sexo masculino y la segunda causa de muerte por cáncer en
el varón (Crawford et al., 2009; Sorensen et al., 2010).


de éstos últimos, el 20 % de todos los cánceres en adultos derivan de un estado de inflamación
crónica. Esta inflamación puede provocar una atrofia en el epitelio que termina desarrollando un estado
premaligno previo al cáncer (De Marzo et al., 2007; Rebbeck et al., 2008; Vindrieux et al., 2009). Se
diferencian dos estados premalignos que secuencialmente pueden dar lugar al desarrollo del tumor.

A

os repetidos en el epitelio derivados de la inflamación crónica. Las características principales de
este estado premaligno son la presencia de células inflamatorias tanto en el epitelio como en el estroma,
que producen daño y muerte celular, causando una remodelación del tejido que morfológicamente se
manifiesta como una atrofia del estroma con cantidad variable de fibrosis (Joshua et al., 2008). Los
agentes oxidantes provenientes de las células inflamatorias infiltradas que no se destoxifican, las toxinas
derivadas de la dieta, o la orina que refluye dentro de la próstata, pueden ocasionar la proliferación
discreta del epitelio glandular con apariencia morfológica de una simple atrofia o una hiperplasia post-
atrófica (Sciarra et al., 2007).

A
as pueden proliferar dando lugar al desarrollo del cáncer o, más comúnmente, al segundo de los
estados premalignos, la neoplasia intraepitelial prostática.

Introducción

• Neoplasia intraepitelial prostática

La neoplasia intraepitelial prostática (PIN) es una proliferación preneoplásica que suele darse en
la zona periférica de la glándula prostática, conservándose la estructura del acino y de los ductos, pero
existiendo daños y modificaciones celulares. Se puede producir por daños repetidos en el epitelio que
ocurren principalmente durante la PIA, induciendo una excesiva proliferación al intentar ser reparados que
en ocasiones conduce a daños irreversibles en el genoma. Adicionalmente se produce un incremento de
células epiteliales que poseen un fenotipo intermedio entre células basales y luminales. En algunas de
estas células ocurren modificaciones somáticas que incrementan la inestabilidad genética induciendo
cambios irrevocables que dan lugar al desarrollo del cáncer (De Marzo et al., 2007). Por otro lado se
incrementa la secreción de enzimas proteolíticas que causan degradación de la membrana basal, lo que
permite la invasión del estroma y, en el peor de los casos, la invasión a otros tejidos (Kryczek et al.,
2009a) (figura 4).

Mutaciones somáticas
Cambios génicos agresivos
PIA PIN
Próstata
normal
Cáncer de próstata no
agresivo
Cáncer de próstata
invasivo
Figura 4. Modelo celular de progresión en el cáncer de próstata. Existen dos estados premalignos anteriores a la
aparición del tumor, la atrofia proliferativa inflamatoria (PIA) y la neoplasia intraepitelial prostática (PIN) que pueden
terminar dando lugar al cáncer de próstata. En el primero existe una atrofia celular en la zona epitelial y una inflamación
crónica y en el segundo hay un estado precanceroso de las células epiteliales, con cambios citológicos anticipatorios del
cáncer, aunque se conserva la membrana basal, si bien más reducida. En último término se desarrolla un
adenocarcinoma. (Modificado de Witte, 2009).

8


Introducción

9

1.2.3.2 Desarrollo y evolución del cáncer

Como ya se ha descrito, las patologías benignas y los estados premalignos de la próstata pueden
ser factores biológicos de riesgo en la progresión del cáncer de próstata. Aún así, la etiología del cáncer
de próstata está lejos de ser elucidada. Entre las posibles causas moleculares que influyen en su
desarrollo se encuentran tanto mutaciones y cambios en la función de diversos oncogenes y genes
supresores de tumores (Ramsay et al., 2009), como alteraciones en las distintas interacciones entre los
componentes estromal y epitelial de la próstata. Estas alteraciones involucran a diversas hormonas y
factores de crecimiento que en condiciones normales regulan adecuadamente los procesos de desarrollo,
maduración y crecimiento tisular prostático (Liu et al., 2009). En último término se desarrolla un cáncer de
próstata, siendo el más frecuente el adenocarcinoma (se da en más del 95% de los casos), aunque
también pueden surgir otros tumores como sarcomas y pequeños carcinomas celulares (van Bokhoven et
al., 2003).

El adenocarcinoma es un tumor maligno de las células secretoras en el cual las células pierden
su función y estructura, desapareciendo la lámina basal y ocurriendo un crecimiento descontrolado. Se
desarrolla en dos fases, una dependiente de andrógenos, en la cual la privación androgénica frena la
progresión del tumor y otra independiente de andrógenos, en la que la próstata responde a otras
hormonas que normalmente no son ligandos del AR.

1.2.3.3 Fases del cáncer de próstata

• Fase andrógeno dependiente

Los andrógenos son un importante factor de crecimiento en la próstata normal, donde
ejercen sus efectos por unión al AR localizado en el citoplasma de las células estromales y secretoras del
epitelio. El AR es un factor transcripcional miembro de la familia de receptores de hormonas esteroideas.
Al producirse la unión con los andrógenos, el AR se transloca al núcleo, donde regula la expresión de una
gran cantidad de genes involucrados en procesos tales como proliferación, diferenciación, apoptosis y
secreción. Los andrógenos, por tanto, regulan el balance entre proliferación y supervivencia dentro de la
próstata, controlando su homeostasis (Nieto et al., 2007).


Introducción

10

Los andrógenos además, estimulan distintos procesos inflamatorios que dan lugar a las ya
mencionadas lesiones benignas y estados premalignos los cuales, si adquieren características malignas,
evolucionan a un cáncer de próstata. Por ello, el tratamiento más común en la primera fase del cáncer de
próstata es la terapia por ablación de andrógenos. Hay dos aproximaciones para conseguir esta ablación.
La primera se realiza mediante la administración oral de anti-andrógenos, que inhiben directamente la
unión de los andrógenos a su receptor y la liberación de la hormona liberadora de gonadotropina (GnRH),
que actúa a nivel del eje hipotalámico-pituitario-gonadal, disminuyendo la producción de andrógenos
indirectamente al reducir los niveles de gonadotropina. La segunda se consigue mediante cirugía,
practicando una orquidectomía y/o prostactectomía radical, que se realiza cuando el tumor está localizado
(Vindrieux et al., 2009). Desafortunadamente el 20 % de los pacientes no tienen una buena respuesta, o
incluso cuando el tratamiento funciona, finalmente en el 80 % de los casos se da una regresión clínica,
resurgiendo el proceso canceroso esta vez como un tumor capaz de crecer en ausencia de andrógenos
(Ramsay et al., 2009).

• Fase andrógeno independiente

La independencia a andrógenos se define como un estado clínico dentro del cáncer de
próstata en el cual las células son capaces de sobrevivir y proliferar sin participación de las señales
producidas por los andrógenos circulantes. La reducción en los niveles de andrógenos que se provoca en
la terapia hormonal o en la prostactectomía radical puede favorecer la selección de células minoritarias
capaces de crecer en ausencia de andrógenos. Esta resistencia puede ocurrir por distintas causas que
afectan a la regulación de la señalización del AR, haciendo que éste esté activo en ausencia de ligando,
como son: sobreexpresión del AR, mutaciones activadas por los bajos niveles de andrógenos o por otros
ligandos esteriodeos, activación del AR por ligandos no esteroideos tales como factores de crecimiento y
citoquinas, expresión alterada de co-activadores o co-represores y procesamiento proteolítico del AR
transformándose en una isoforma no dependiente de andrógenos (Devlin et al., 2009). Además también
pueden activarse oncogenes o bloquearse genes supresores de tumores, permitiéndose de esta forma la
proliferación descontrolada en independencia de andrógenos (Ramsay et al., 2009).

A nivel histológico, en el estado final el tumor se vuelve heterogéneo, dándose una mezcla de
células alteradas capaces de proliferar y metastatizar que incluyen no solo células luminales, sino
también células basales, neuroendocrinas o células con un fenotipo intermedio (Kelly et al., 2008). En
este contexto, estudios recientes han demostrado que las células madre pueden promover la malignidad

Introducción

11

en las últimas fases de la enfermedad. Sobre el papel de las células madre en el desarrollo del cáncer
existen dos teorías. La teoría clásica defiende que todas las células cancerosas son igualmente malignas,
pero sólo algunos clones poseen características biológicas favorables que permiten que el tumor siga
creciendo. La segunda teoría sugiere que en el tumor se mantiene una jerarquía similar a la del tejido
normal, existiendo sólo una subpoblación de células en la cima de esta jerarquía que son capaces de
promover la malignidad (Lawson et al., 2007; Lang et al., 2009). Estas células presentan propiedades
características de las células madre adultas, incluyendo mecanismos anti-apoptóticos, resistencia a
quimioterapia e independencia de andrógenos (Antonarakis et al., 2010a).

Una vez el cáncer se vuelve andrógeno-independiente las opciones terapéuticas son muy
limitadas. Frecuentemente se administran al paciente una variedad de compuestos quimioterapéuticos
para combatir la enfermedad, pero este tratamiento suele tener sólo un éxito modesto, debido a
problemas de toxicidad y a la adquisición de una resistencia a drogas a la que es particularmente
propensa el cáncer de próstata (Lee et al., 2008).

1.2.3.4 Modelos celulares

La naturaleza heterogénea del cáncer de próstata dificulta la comprensión de los factores
involucrados en la iniciación y progresión de la enfermedad. Esta compleja naturaleza hace necesario el
uso de modelos experimentales in vitro representativos de los diferentes estados de la enfermedad que
ayude al estudio de los mecanismos involucrados en la iniciación y progresión del tumor. La mayoría de
los estudios in vitro se han focalizado en tres líneas celulares, LNCaP, PC-3 y DU 145. Todas tienen
morfología epitelial y fueron desarrolladas entre 1977 y 1980.

• La línea LNCaP es una línea bien establecida procedente de una metástasis a un nódulo
linfático supraclavicular de un adenocarcinoma prostático. Estas células expresan el AR y son
dependientes de andrógenos para su crecimiento, aunque en condiciones de cultivo pueden llegar a
perder el AR tras un gran número de pases. Mantienen las características propias de las células normales
de próstata. Por tanto, esta línea se podría considerar representativa de un estado temprano del cáncer
de próstata andrógeno-dependiente.

• La línea PC-3 deriva de una metástasis ósea de un adenocarcinoma de próstata de grado
IV. Posee características típicas de las células epiteliales neoplásicas, presentando numerosas

Introducción

microvellosidades, uniones celulares complejas y orgánulos como el núcleo, nucléolo y mitocondrias
anormales. Exhibe baja actividad fosfatasa ácida alcalina, así como niveles reducidos de 5-alfa-
reductasa. Es una línea casi tripliode con un número modal de 62 cromosomas. Su tiempo de replicación
es aproximadamente de 33 h, y generan tumores de 1-3 cm de diámetro aproximadamente a los 60 días
al ser inyectadas subcutáneamente en ratones atímicos desnudos. No responden a la ausencia de
andrógenos, glucocorticoides, factor de crecimiento epidérmico (EGF) o factor de crecimiento de
fibroblastos (FGF), presentando un acelerado crecimiento (Dozmorov et al., 2009). En la tabla 1 se
recogen los principales genes relacionados con tumorogénesis cuya expresión varía en esta línea celular.

GEN

FUNCIÓN GRADO DE
EXPRESIÓN EN PC-3
REFERENCIA
H-ras Proto-oncogen Sobre-expresado (Yamazaki et al., 1994)
c-myc Proto-oncogen Sobre-expresado (Rijnders et al., 1985)
p53 Supresor tumoral, factor de
transcripción, proteína pro-
apoptótica
Inexistente en este tipo
celular
(Navone et al., 1993)
Bin1 Supresor tumoral, inhibe la
transformación maligna por
interacción con c-myc
Expresión reducida (Ge et al., 2000)
NFκB Factor de transcripción Actividad elevada (Lindholm et al., 2000)
IKK Incrementa la actividad de
NFκB
Constitutivamente activa (Palayoor et al., 1999)
Bcl-2 Proteína anti-apoptótica Sobre-expresado (Fahy et al., 2005)
Bcl-Xl Proteína anti-apoptótica Sobre-expresado (Li et al., 2001)
PTEN Supresor tumoral Inexistente en este tipo
celular
(Davies et al., 1999)
p-glicoproteína Asociada con resistencia a
drogas
Altos niveles (Theyer et al., 1993)
AR Receptor de andrógenos Mutado (Kaighn et al., 1979; van
Bokhoven et al., 2001)
P16(INK4) Supresor de tumoral Baja expresión (Yang et al., 1998)
Activador de
plasminógeno
Implicado en angiogénesis Baja expresión (Vaarala et al., 2000)
MXB GTPasa Baja expresión (Vaarala et al., 2000)
Tabla 1: Alteraciones genéticas en la línea celular PC-3.
12


Introducción

• La línea DU 145 proviene de una metástasis cerebral de un carcinoma prostático. Son las
células más agresivas, no presentan sensibilidad a andrógenos, son débilmente positivas para la
fosfatasa ácida alcalina y no expresan antígeno prostático. Presentan microvellosidades, desmosomas y
mitocondrias anormales.

Las líneas celulares DU 145 y PC-3 tienen un fenotipo más agresivo y son capaces de crecer en
ausencia de andrógenos, representando un avanzado estado de la enfermedad (Dozmorov et al., 2009).

• La línea RWPE-1 son células epiteliales derivadas de la zona periférica de una próstata
histológicamente normal inmortalizada con una copia simple del virus del papiloma humano (HPV-18). La
transfección con el virus del papiloma humano tiene un especial interés ya que este virus está involucrado
en una gran variedad de cánceres anogenitales, pudiendo también estar implicado en la carcinogénesis
del cáncer de próstata.
Figura 5. Líneas celulares comúnmente usadas en el estudio del cáncer de próstata. La línea LNCaP responde a
andrógenos y por tanto representa una fase temprana de la enfermedad. Las líneas PC-3 y DU 145 son insensibles a
andrógenos por lo que se usan como modelos de la fase independiente de andrógenos. La línea RWPE-1 se utiliza
como modelo de célula epitelial no tumoral.

En este trabajo se ha empleado principalmente la línea PC-3 y ocasionalmente LNCaP, DU 145 y
RWPE-1 para comparar los efectos de los cannabinoides en otras células de próstata.
13


Introducción

14

2.- MECANISMOS MOLECULARES Y CELULARES
IMPLICADOS EN EL CÁNCER DE PRÓSTATA.
POSIBLES DIANAS TERAPÉUTICAS.

Como ya se ha visto, los tratamientos para el cáncer de próstata en su fase independiente de
andrógenos son muy limitados y, además de su elevada toxicidad suelen ser ineficaces, recurriendo en el
95 % de los casos el proceso tumoral. En este sentido, continuamente se están buscando dianas
terapéuticas alternativas que estén involucradas en los distintos procesos biológicos del cáncer de
próstata, centrándose la investigación en factores de supervivencia, apoptosis, resistencia a drogas,
angiogénesis, regulación epigenética, evasión y potenciación de la respuesta inmune. En muchos de
estos procesos la modificación aberrante de la señalización celular tiene un papel clave. Por todo ello, los
avances en el conocimiento de las rutas de señalización implicadas en la carcinogénesis de próstata
permiten abrir una nueva vía en la investigación para el desarrollo de nuevos fármacos selectivos,
capaces de afectar únicamente a una de estas vías de señalización sin interferir inespecíficamente en el
resto (Ramsay et al., 2009).

2.1.- Señalización celular

2.1.1 Vías de señalización que conducen a apoptosis

La apoptosis, o muerte celular programada, es un tipo de muerte celular inducida genéticamente a
través de un programa de suicidio celular. Juega un papel crucial durante el desarrollo, pero también en
la carcinogénesis, ya que al funcionar como un mecanismo de protección contra la formación y el
desarrollo del tumor su desregulación puede propiciar el proceso tumoral (Russo et al., 2010).
Terapéuticamente puede inducirse por múltiples tratamientos, entre ellos radiación, quimioterapia y
drogas inductoras de señales apoptóticas (Mahmood et al., 2010).

Existen dos vías apoptóticas, la intrínseca o mitocondrial y la extrínseca. Ambas se llevan a cabo
principalmente a través de la activación de una cascada de reacciones proteolíticas mediadas por
distintos miembros de la familia cisteinil-aspartato proteasas, también conocidas como caspasas. Estas
proteínas se sintetizan como pro-enzimas que se activan por proteólisis en respuesta a estímulos

Introducción

15

externos (vía extrínseca) tales como ligandos de los receptores de muerte celular, o internos (vía
intrínseca), incluyendo daño en el DNA, privación de citoquinas y factores de crecimiento, que provocan
daños en distintos componentes celulares. Se organizan dentro de una cascada compuesta de caspasas
iniciadoras, caspasa 8 en la vía extrínseca o caspasa 9 en la intrínseca, que al ser activadas provocan la
ruptura de las caspasas efectoras, principalmente la caspasa 3. Éstas últimas llevan a cabo la ruptura de
muchas proteínas celulares y subsecuentemente, alteraciones morfológicas y cambios en el metabolismo
que culminan con la muerte controlada de la célula (Kumar, 2009; Duncan et al., 2010; Lamkanfi et al.,
2010)

La vía extrínseca se produce a través de la señalización transducida por receptores de muerte
celular. Estos receptores pertenecen a la familia de receptores del factor de necrosis tumoral (TNFR) que
poseen una región de unos 80 aminoácidos llamada dominio de muerte (DD), que juega un papel
principal en la transmisión de la señal apoptótica. Sus ligandos son miembros de la familia del factor de
necrosis tumoral (TNF), que incluyen a FASL, TNF-α y ligandos inductores de apoptosis relacionados con
TNF-α (TRAIL). La unión ligando-receptor desencadena un agrupamiento de los receptores,
generalmente mediado por la ceramida localizada en la membrana celular, que permite la formación del
complejo de señalización de muerte celular (DISC). Este complejo está formado por una proteína
adaptadora con un dominio de muerte asociado a Fas (FADD), procaspasa-8 y el inhibidor apoptótico c-
FLIP. Cuando FADD se une al receptor por medio de su dominio de muerte (DD) y a la procaspasa 8 por
su dominio efector de muerte (DED), se produce la activación de la procaspasa 8, desencadenando la
cascada de activación de caspasas, en este caso de las caspasas 3 y 7, induciendo en último término la
muerte celular (Schwarze et al., 2008; Mahmood et al., 2010) (figura 6).

La vía intrínseca requiere la disrupción de la membrana mitocondrial por proteínas de la familia
Bcl-2, formándose un poro en la membrana mitocondrial y liberándose proteínas mitocondriales como el
citocromo c. La familia Bcl-2 se caracteriza por poseer regiones específicas de homología a Bcl-2 (BH1,
BH2, BH3 y BH4). Puede dividirse en proteínas pro-apoptóticas y anti-apoptóticas. Las proteínas pro-
apoptóticas incluyen proteínas tales como Bax, Bcl-Xs, Bak, Bok/Mtd, que contienen 2 ó 3 dominios de
homología a Bcl-2 (BH), y otras como Bad, Bik/Nbk, Bid, Hrk/DP5, Bim/Bod y Blk, con sólo un dominio 3
de homología a Bcl-2 (BH3). Las anti-apoptóticas incluyen proteínas como Bcl-2, Bcl-XL, Bcl-w, A1/Bfl-1,
Mcl-1 y Boo/Diva, que contienen 3 ó 4 regiones de homología con Bcl-2. La sobre-expresión de proteínas
anti-apoptóticas inhibe la liberación del citocromo c de la mitocondria, mientras que la sobre-expresión de

Introducción

proteínas pro-apoptóticas induce su liberación. Al liberarse el citocromo c del espacio intermembrana de
la mitocondria pasa al citoplasma dónde, junto a otros factores citosólicos, como factor 1 activador de
proteasas apoptóticas (Apaf-1) y procaspasa 9, promueve la formación del complejo activador de
caspasas, el apoptosoma, desencadenando la activación de caspasa 9, que a su vez activa a sus
caspasas efectoras, caspasa 3, 6 y 7, iniciando así la cascada apoptótica (Liao et al., 2007; Russo et al.,
2010).
16

Figura 6. Esquema de las principales rutas apoptóticas. La vía extrínseca se induce por factores externos capaces de
unirse a los receptores de muerte celular, formándose el complejo de muerte celular y activándose la caspasa 8. La vía
intrínseca se activa en presencia de estímulos apoptóticos internos, como daño en el DNA, permeabilizándose la
membrana mitocondrial y produciéndose la liberación al citoplasma del citocromo c, que activa el apoptosoma y a la
caspasa 9.

• Papel del estrés de retículo en la apoptosis


El retículo endoplasmático (ER) es el sitio de síntesis y plegamiento de un tercio de las proteínas
celulares, principalmente proteínas secretoras y de unión a membrana. Es también un elemento clave en
el tráfico de vesículas, además de participar en la síntesis de lípidos y de esteroides, biogénesis de
membrana y almacenamiento del calcio intracelular. Además de este amplio número de funciones
biológicas, se comporta como un sensor de daños celulares, a los que responde mediante una respuesta
llamada “estrés de retículo” (Schwarze et al., 2008). El estrés de retículo se produce por alteraciones de
la homeostasis celular que causan depleción de Ca
2+
o de moléculas donadoras de energía, así como por
infecciones virales, bloqueándose la síntesis de proteínas. Se produce de esta forma una acumulación de
proteínas mal plegadas que inducen un mecanismo conocido como “respuesta a proteínas mal plegadas”
DD
Receptor de
muerte
Factores de
crecimiento
procaspasa 9
procaspasa 8
FADD
c-FLIP
Caspasa
3,6,7
Bcl-2
Caspasa 8
Caspasa 9
Apaf
Citocromo c
Vía extrínseca
Vía intrínseca
DIS
DED DED
C
DD

Introducción

(UPR). Esta UPR se inicia por mediación de una chaperona de 78 kDa regulada por glucosa (GRP78),
que en condiciones normales está unida a tres proteínas transmembrana que actúan como sensores de
estrés, la quinasa del retículo endoplasmático pancreático (PERK), el factor de transcripción activador 6
(ATF6) y la enzima dependiente de inositol (IRE1), manteniéndolas en un estado inactivo. Al aumentar las
proteínas con un mal plegamiento compiten con los sensores de estrés por su unión a GRP78,
liberándose éstos y activándose de forma secuencial. PERK activo fosforila al factor iniciador de la
síntesis de proteínas en eucariotas, eIF2α, inactivándolo, inhibiendo así la transcripción dependiente de
Cap, pero permitiendo la IRES dependiente y activando además al factor de transcripción ATF4, que se
transloca al núcleo y regula la expresión de genes implicados en la homeostasis del ER. ATF6 se
proteoliza y se activa en el aparato de Glogi, translocándose al núcleo, dónde induce la expresión de
genes con elementos de respuesta al estrés de retículo (ERSA), entre otros CHOP y la proteína 1 de
unión a X-box (XBP1). XBP1 ha de sufrir un procesamiento post-transcripcional llevado a cabo por IRE1,
lo cual permite su translocación al núcleo y la activación de genes inducibles por estrés responsables de
la degradación de las proteínas mal plegadas (Szegezdi et al., 2006; Healy et al., 2009) (figura 7).
Reacción redox
Transporte y síntesis
de aa
Respuesta a estrés
CHOP
XBP1
Chaperonas
CHOP
Chaperonas
Genes de
degradación de
proteínas
Figura 7. Esquema de las principales rutas implicadas en la respuesta UPR. Bajo agregación de proteínas mal
plegadas, GRP78 se disocia de los tres sensores de estrés de retículo, PERK, ATF6 e IRE1, permitiendo su activación.
La activación de estas proteínas ocurre de manera secuencial de la siguiente manera: PERK, ATF6 e IRE1. La
activación de PERK bloquea eIF2α, lo que permite la translocación de ATF4 al núcleo, activándose la transcripción
independiente de eIF2α. ATF6 se activa por proteólisis, translocándose al núcleo y regulando la expresión de
chaperonas del ER, así como de XBP1. XBP1 es un factor transcripcional cuyo mRNA ha de modificarse por splicing,
siendo el encargado de esta modificación IRE1. XBP1 una vez modificado se transloca al núcleo, activando la expresión
de chaperonas y de genes involucrados en degradación de proteínas (Modificado de Szegezdi et al, .2006).

17


Introducción

18


Aunque la respuesta UPR es principalmente una respuesta pro-supervivencia, en situaciones de
estrés prolongadas que no logran resolverse, puede inducir apoptosis, considerándose incluso el estrés
de retículo una nueva vía de inducción de apoptosis (Heath-Engel et al., 2008; Repicky et al., 2008). Si
bien los mecanismos biológicos por los que ocurre está relación no están claros, se sabe que distintos
miembros de la familia Bcl-2 pueden regular la homeostasis del calcio intracelular, afectando así el
intercambio de calcio entre el retículo y la mitocondria, pudiendo traducirse estos cambios en la activación
de la vía intrínseca apoptótica (Schwarze et al., 2008).

• Papel de la ceramida en la apoptosis


Los esfingolípidos complejos son los principales constituyentes de la membrana celular. Además
de este papel estructural, algunos de ellos también poseen importantes propiedades bioactivas. Están
formados por esfingosina unida a un ácido graso de longitud variable (entre 14 y 16 carbonos), que forma
la molécula de ceramida, al que se une un grupo polar. La ceramida, además de formar parte de los
esfingolípidos, actúa como segundo mensajero regulando vías de señalización celular implicadas en
procesos biológicos como diferenciación, tráfico celular, parada del ciclo celular, proliferación y apoptosis
(Mao et al., 2008; Arana et al., 2010; Gangoiti et al., 2010).

La ceramida puede generarse a través de dos rutas: por síntesis de novo y por degradación de
esfingolmielina (SM) de la membrana plasmática por esfingomielinasas (SMasas). La primera vía, la de
síntesis de novo, es una ruta anabólica que comienza con la condensación de serina y palmitoil coenzima
A por la enzima serina palmitoil transferasa (SPT) rindiendo 3-cetoesfinganina. Posteriormente se reduce
la 3-cetoesfinganina a esfinganina, e inmediatamente se acila por la dihidroceramida sintasa, también
denominada ceramida sintasa (CerS), rindiendo dihidroceramida. Existen seis CerS conocidas, que
muestran diferente preferencia por distintos sustratos acil-coenzima A, generando distintas especies de
ceramidas. Por último, acontece la desaturación de dihidroceramida, originando ceramida. Ceramida
también puede formarse directamente a partir de esfingosina por acción de la ceramida sintasa. La
segunda vía de generación de ceramida es una vía catabólica. La ceramida se origina directamente a
partir de la hidrólisis de esfingomielina por un grupo de enzimas llamadas esfingomielinasas, rindiendo
también una molécula de fosforilcolina (Gangoiti et al., 2010) (figura 8).


Introducción

Ceramida actúa como precursor de distintos esfingolípidos complejos. Cerebrósidos y gangliósidos
se sintetizan mediante distintas enzimas biosintéticas que añaden sustituyentes específicos en la posición
C1. SM se genera a través de la unión de un grupo de fosforilcolina proveniente de la fosfatidil colina (PC)
por la SM sintasa. Además, ceramida puede fosforilarse por la enzima ceramida quinasa (CerK),
formando ceramida-1-P (C1P), regulador clave de la homeostasis celular, implicado también en procesos
de inflamación (Saddoughi et al., 2008; Arana et al., 2010; Gangoiti et al., 2010).
serina + palmitoil-CoA
19

Figura 8. Vías de síntesis de ceramida. Existen dos rutas que llevan a la generación de ceramida: la síntesis de novo a
partir de la condensación de esfingolípidos del retículo endoplasmático y el aparato de Golgi, y la hidrólisis de
esfingomielina de la membrana plasmática por esfingomielinasas.
El papel principal de ceramida como segundo mensajero consiste en mediar en respuestas que
conducen a apoptosis y parada de ciclo celular, aunque también está implicada en la señalización celular
que regula otras respuestas muy diversas, como adhesión, angiogénesis, tráfico celular e inflamación.
Ceramida puede interaccionar con fosfatasas y quinasas que regulan importantes vías implicadas en
crecimiento celular y la apoptosis, como proteína quinasa C (PKC), MAP quinasas y proteína fosfatasas 1
y 2 (PP1 y PP2A) (Saddoughi et al., 2008). Por otro lado, C1P posee funciones antagónicas a las de
ceramida. Presenta un papel mitogénico, promoviendo respuestas de supervivencia y crecimiento celular
a través de la regulación de diferentes vías de señalización, como la proteína quinasa quinasa activada
por mitógenos (MEK), PI3K/Akt y c-Jun terminal quinasa (JNK). Además de esta función mitogénica, C1P
está fuertemente implicada en respuestas inflamatorias y en regulación de fagocitosis (Saddoughi et al.,
2008; Arana et al., 2010; Levi et al., 2010).

ceramida
esfingomielina
Esfingomielinasas
dihidroceramida
esfinganina
3-cetoesfinganina
ceramida
sintasa
SÍNTESIS DE NOVO
HIDRÓLISIS DE
ESFINGOMIELINA

Introducción

20

2.1.2 Vías de señalización implicadas en proliferación y supervivencia
celular

Durante la génesis y el desarrollo del cáncer, además de alterarse los mecanismos anti-
apoptóticos, frecuentemente se modifican los mecanismos de supervivencia celular, siendo el balance
entre ambos procesos clave en el control y tratamiento de la enfermedad. Entre los mecanismos que
regulan la supervivencia celular y que habitualmente están implicados en el cáncer, destacan la vía
PI3K/Akt/mTOR y las cascadas de MAPKs.

• Vía PI3K/Akt/mTOR


En el 50-80% de los casos de cáncer de próstata avanzado y aproximadamente en el 20% de las
lesiones localizadas se pierde el gen supresor de tumores PTEN (Lee et al., 2008; Antonarakis et al.,
2010a). Este gen es un regulador negativo de la ruta de la fosfatidilinositol 3-quinasa (PI3K),
encontrándose así esta vía sobre-activada frecuentemente en el cáncer de próstata. Esta vía regula
múltiples procesos celulares, principalmente supervivencia, progresión del ciclo celular y transformación
neoplásica (Antonarakis et al., 2010a; Mahajan et al., 2010).

PI3K es una proteína con un dominio catalítico capaz de convertir fosfatidil inositol 4,5 bisfosfato
(PIP
2
) en fosfatidil inositol trisfosfato (PIP
3
), fosfolípido que actúa como segundo mensajero, activando
indirectamente a la proteína quinasa B (PKB)/Akt. Una vez activada, Akt puede fosforilar entre otros
sustratos a la proteína diana de rapamicina en los mamíferos (mTOR). mTOR es una serina/treonina
quinasa que regula la expresión de genes implicados en crecimiento, como c-Myc, ciclina D1 y el factor
de crecimiento del endotelio vascular (VEGF) (Lee et al., 2008; Ramsay et al., 2009; Antonarakis et al.,
2010a). Adicionalmente Akt también es capaz de translocarse al núcleo, donde afecta directa o
indirectamente a la actividad de múltiples reguladores de la transcripción, como CREB (proteína de unión
a elementos de respuesta a AMP cíclico), el factor nuclear kappa B (NFκB) y el factor de transcripción
forkhead, que regulan la proliferación y crecimiento celular. Akt también puede inactivar por fosforilación
varios factores apoptóticos, como procaspasa 9 y el miembro pro-apoptótico de la familia Bcl-2, Bad
(Kitagawa et al., 2002; Fresno Vara et al., 2004; Lee et al., 2008; Qiao et al., 2008) (figura 9).

Introducción

Factores de
crecimiento
PTEN
21

Figura 9. Vía PI3K/PTEN/Akt/mTOR. Distintos factores de crecimiento pueden activar a PI3K, fosforilando PIP2 a PIP3,
segundo mensajero que activa a su vez a Akt. Akt posee un amplio espectro de dianas reguladoras del crecimiento y
apoptosis.

• Proteínas quinasas activadas por mitógenos


Las proteínas quinasas activadas por mitógenos (MAPKs) son una familia de serina/treonina
quinasas que median la señalización intracelular implicada en una amplia variedad de procesos tales
como proliferación celular, diferenciación, supervivencia, muerte celular y transformación. La familia de
MAPKs está compuesta por varias proteínas, entre las que destacan la quinasa regulada por señales
extracelulares (ERK), p38, y c-Jun NH
2
-terminal quinasa (JNK). Cada una de estas MAPK son el último
elemento de una cascada de señalización en la que participan al menos tres quinasas que se activan en
tándem, una MAPK quinasa quinasa (MAP3K), una MAPK quinasa (MAP2K) y la propia MAPK. La
señalización culmina con la unión de las MAPKs a factores de transcripción, activándolos y modulando de
esta forma la expresión de genes a través de fosforilación de residuos serina/treonina. También pueden
fosforilar proteínas citoplasmáticas, principalmente proteínas implicadas en procesos apoptóticos, como
algunos miembros de la familia Bcl-2 y proteínas del citoesqueleto (Junttila et al., 2008; Lee et al., 2008;
Huang et al., 2009) (figura 10).

PI3K
CREB
Caspasa 9
Akt
PIP2
p
p
PIP3
p
p
p
NFkB
mTOR
Bad

Introducción

MAP4K/GTPasa Ras
MAP3k Raf ASK1,MEKK1,ML3…
MAP2K MEK M2K3/M2K6 M2K4/M2K7
MAPK ERK p38 JNK
Respuestas celulares Proliferación celular
Migración
Diferenciación
Proliferación celular
Diferenciación y apoptosis
Respuestas inflamatorias
22


Figura 10. Ruta de señalización celular de las vías MAPKs. La ruta de las MAPK está compuesta por una serie de
activaciones secuenciales de MAPK: primero MAP3K, segundo MAP2K y por último MAPK. En ocasiones existen
adicionalmente otras quinasas que activan a MAP3K, las MAP4K. Los efectores últimos de esta ruta, las MAPK, son
ERK, p38 y JNK. MAPK activan un amplio rango de sustratos implicados en diversas funciones celulares, entre ellas
supervivencia celular, apoptosis e inflamación.
La señalización regulada por MAPK ha sido implicada en la patogénesis de varias enfermedades,
incluido el cáncer (Kim et al., 2010). Aunque en el cáncer de próstata no ha sido una ruta muy estudiada,
en los trabajos realizados sobre el tema existe divergencia, relacionándola unos con el desarrollo del
cáncer, y otros con su regresión, siendo necesarios más estudios para aclarar su papel en el cáncer de
próstata (Lee et al., 2008).

Vía de ERK

Esta vía se considera una vía promotora de supervivencia. Se activa por una gran variedad de
mitógenos y de ésteres de forbol. La señal se inicia por Ras, una GTPasa que se activa por receptores
tirosin-quinasa (RTK), seguida de activación de Raf. Raf también puede activarse, así como inhibirse, por
varias quinasas, como PKC, proteína quinasa A (PKA) y proteína quinasa activada por p21 (PAK). Una
vez activada, Raf se une y fosforila a sus sustratos diana, MEK1 y MEK2, con mediación de la quinasa
supresora de Ras (KSR). MEK1/2 activa directamente a las quinasas ERK1 y ERK2, que regulan la
actividad de múltiples dianas, entre ellas diferente miembros pro-apoptóticos de la familia Bcl-2 y factores
de transcripción como FOXO3A, CREB, NFκB y c-Fos (Lee et al., 2008; Kim et al., 2010).



Introducción

23

Vía de JNK

La vía de JNK puede participar en procesos de apoptosis, supervivencia o proliferación
dependiendo de los distintos estímulos. Se activa en respuesta a estrés y citoquinas. Existen numerosas
MAP3Ks capaces de activar esta vía, entre ellas ASK1, HPK1, MLK-3, M3K1–4, TAK-1 y TPL-2. Estas
activan dos MAP2K, M2K4 o M2K7, ambas necesarias para activar JNK. El principal sustrato de JNK es
c-Jun, pero también puede activar otros factores de transcripción tales como ATF-2, Elk-1, MEF-2c, p53 y
c-Myc. Además, JNK puede activar proteínas anti-apoptóticas, entre ellas Bcl-2 y Bcl-x (Junttila et al.,
2008; Kim et al., 2010).

Vía de p38

Esta vía está implicada en un amplio rango de funciones celulares, incluyendo apoptosis,
regulación del ciclo celular, inducción de la expresión de citoquinas y diferenciación. Se activa
principalmente en respuesta a estrés y por moléculas proinflamatorias, como TNFα e interleuquina 1 (IL-
1) (Feng et al., 2009). Estos estímulos activan las mismas MAP3K que actúan en la vía de JNK, como
ASK1 y TAKI, que a su vez activan las MAP2K, M2K3 y M2K6, que por último activan a p38 (Junttila et
al., 2008; Feng et al., 2009).


2.2.- Sistema inmune: Inmunoterapia

En los últimos años la implicación del sistema inmune en el tratamiento del cáncer está tomando
una gran relevancia. Es ampliamente conocido que los pacientes inmunosuprimidos poseen mayor
susceptibilidad a generar distintos tipos de cáncer (Arnon et al., 2008). En este sentido el sistema inmune
puede generar respuestas antitumorales que eviten el desarrollo del tumor, siendo la supresión de estas
respuestas uno de los factores clave para la supervivencia tumoral y la invasión. Por tanto, entrenar al
sistema inmune para inducir una respuesta contra el tumor es el principal objetivo en todas las
aproximaciones inmunoterapéuticas (Arnon et al., 2008; Shields et al., 2010).

En el caso del cáncer de próstata el éxito de la inmunoterapia es más conflictivo debido al papel ya
mencionado de la inflamación en el origen y progresión de esta enfermedad. Este hecho induce a pensar
que el cáncer de próstata no es un tipo de cáncer susceptible al uso de inmunoterapia. No obstante,

Introducción

24

evidencias recientes sugieren que el cáncer de próstata es más inmunogénico de lo que se pensaba,
habiendo pacientes que generan autoanticuerpos espontáneamente. Además, al ser una enfermedad de
lenta progresión permite que la estimulación del sistema inmune genere con el tiempo una respuesta anti-
tumoral eficaz. Así, aunque el uso de inmunoterapia en el cáncer de próstata ha de hacerse de manera
altamente controlada, no sólo estimulando, si no también modulando el sistema inmune, actualmente
existen varias terapias inmunológicas en fase clínica de desarrollo, entre ellas dos vacunas y un inhibidor
de un factor regulador negativo de la activación de los linfocitos (Harzstark et al., 2009; Antonarakis et al.,
2010a).

2.2.1 Papel de las células T

El uso de una estimulación global del sistema inmune podría aumentar las reacciones inmunes
inespecíficas en el cáncer de próstata y aumentar la respuesta inflamatoria. Los principales mediadores y
efectores inespecíficos del sistema inmune son las citoquinas, el sistema del complemento y las proteínas
de fase aguda, además de algunos componentes celulares como los neutrófilos, macrófagos y células
natural killer. En contraste, la inmunidad adaptativa puede usarse como específica en inmunoterapia, ya
que este componente del sistema inmune puede ser amplificado y dirigido propiamente contra las células
tumorales. Las células que median principalmente en las respuestas antitumorales son los linfocitos T
(Carlsson et al., 2007). Así, la generación de reacciones tumor-específicas ejecutadas por los linfocitos T,
ya sea a través de una vacuna o por el uso de anticuerpos, es una de las aproximaciones más
prometedoras en inmunoterapia dirigida (Kubler et al., 2008; Reiter et al., 2009). En el caso del cáncer de
próstata, concurren varios factores que potencian el uso de las células T como posibles antitumorales;
existe un gran número de proteínas con expresión específica o preferencial en la próstata que pueden ser
usadas como antígenos asociados al tumor contra los que lanzar la respuesta inmune y, al mismo tiempo,
la próstata es un órgano prescindible no vital, lo cual permite una inmunoterapia dirigida (Carlsson et al.,
2007).

Los linfocitos T se originan en el timo, como células T nativas o naïve, que circulan por el torrente
sanguíneo y migran a los órganos linfoides periféricos, desde dónde vuelven a la sangre, recirculando
entre ambas localizaciones hasta que encuentran al antígeno. Estas células participan en la respuesta
inmunitaria adaptativa, pero para ello han de proliferar y diferenciarse a células T efectoras, capaces de
destruir los agentes patógenos. Existen dos clases de células T efectoras, que se diferencian por la

Introducción

25

expresión en membrana de dos moléculas de superficie diferentes que van a determinar sus funciones
efectoras (figura 11).
• Células T citotóxicas (CTL) son células CD8+. Reconocen y lisan las células que
presentan antígenos anormales en su membrana, ya sean células anormales del organismo, como
células neoplásicas, o células infectadas por microorganismos intracelulares.
• Células T colaboradoras o helper (Th) son células CD4+. Activan, por medio de la
secreción de citoquinas, a las células B y macrófagos que han capturado el antígeno, ayudándolos a
destruir los microorganismos extracelulares o que viven en vesículas fagocíticas. Tras la activación,
pueden diferenciarse a su vez en tres subtipos. Las células Th1 conducen la respuesta inmune mediada
por células implicada en daño tisular e infección contra parásitos intracelulares. Las células Th2 median
la producción de IgE, estando particularmente involucradas en la respuesta de los eosinófilos, alergia e
infecciones por helmintos y otros parásitos extracelulares. El tercer subtipo de Th son las células Th17,
definidas por la producción de IL-17 y están relacionadas con inflamación autoinmune e inmunidad
antimicrobiana (Harrington et al., 2006; Stockinger et al., 2007; Awasthi et al., 2008).
En todas las poblaciones de linfocitos, B, T o natural killer, existen células reguladoras
especializadas en suprimir la respuesta inmune contra antígenos propios específicos. Los linfocitos T que
forman parte de éstas células moduladoras se incluirían en otro subtipo de células T distintas de las
células efectoras, las células T reguladoras (Treg). Éstas expresan en su membrana la molécula de
superficie CD25 (Amarnath et al., 2007; Li et al., 2010) y son las responsables de desencadenar la
respuesta especializada en mantener la tolerancia a lo propio. Además se ha visto que pueden participar
como supresores de la respuesta antitumoral (Sfanos et al., 2008).
Se cree que los linfocitos Treg y Th17 tienen un origen común y son mutuamente excluyentes. Su
activación es dependiente del cóctel de citoquinas presente, en el que juega un papel relevante la
interleuquina-6 (IL-6), que dirime la diferenciación hacia Th17 (Bettelli et al., 2006; O'Garra et al., 2008;
Volpe et al., 2008; Basso et al., 2009).

Introducción

26

A pesar de que las células del sistema inmune con mayor relevancia en la lucha contra el tumor
son los linfocitos T citotóxicos, cada vez existen más evidencias de la implicación de los linfocitos Th17 en
esta respuesta antitumoral. Recientemente se ha demostrado esta capacidad antitumoral tanto en
experimentos in vitro, dónde las células Th17 son capaces de inducir regresión tumoral, como en un
modelo in vivo, en el que ratones deficientes en IL-17 presentan un crecimiento tumoral mayor (Kryczek
et al., 2009b). Además, los linfocitos Th17 podrían contribuir también a la acción antitumoral de los
linfocitos T citotóxicos (Martin-Orozco et al., 2009).

2.2.2 Papel de Interleuquina-6

El papel de las citoquinas como principales moduladoras del sistema inmune hace de éstas un
factor crucial en la inmunoterapia, siendo el uso de fármacos que regulan sus niveles, junto con el de las
vacunas, una de las estrategias más empleadas en las aproximaciones inmunoterapéuticas dirigidas al
tratamiento del cáncer. En el cáncer de próstata el uso de vacunas para generar efectos antitumorales
parece ser insuficiente (Slovin, 2008). Esto sugiere que es necesario el uso de una terapia combinada
con citoquinas o inhibidores específicos para aumentar significativamente su eficacia, además de para
validar el papel de las células inmunes en la respuesta antitumoral (Kubler et al., 2008; Antonarakis et al.,
2010b). Por otro lado, las células de próstata pueden secretar citoquinas proinflamatorias que participan
Figura 11. Diferenciación de linfocitos T inducida por citoquinas. Las células T nativas pueden activarse por las
células dendríticas y formar distintas poblaciones de células T efectoras según el cóctel de citoquinas presente, originando
así células Th1, Th2, Th17 y Treg (Modificado de O’Garra et al., 2008).
Th17
Treg
TGFβ
TGFβ
IL-6
Th2
Th1
IFNγ
IL-4
Cél ul a T
nati va
Cél ul a
dendríti ca

Introducción

27

activamente en el reclutamiento y activación de células del sistema inmune (Wong et al., 2009), factor
clave en el desarrollo de respuestas antitumorales inducidas por la inmunidad adaptativa (Evans et al.,
2008; Reiter et al., 2009).

La IL-6 es una citoquina pleiotrópica que participa en distintos aspectos biológicos del cáncer. En
próstata es una de las citoquinas con mayor relevancia, ya que no sólo regula respuestas inflamatorias,
sino también crecimiento celular y resistencia a drogas (Pu et al., 2004; Culig, 2005). Está considerada
una citoquina proinflamatoria, lo cual, junto con el hecho de que se sobre-exprese en el cáncer de
próstata ha hecho que se la relacione con su patogénesis (Nakashima et al., 2000; Cabrespine et al.,
2007; Bouraoui et al., 2008). Sin embargo, estudios recientes refutan esta hipótesis, al no encontrar
relación entre el incremento en los niveles de IL-6 circulante y el riesgo en el cáncer de próstata, así como
tampoco un incremento de la proliferación in vitro de células de cáncer próstata en respuesta a la IL-6
(Xing et al., 2001; Pierce et al., 2009). Es más, el papel proinflamatorio de esta citoquina podría resultar
beneficioso, ya que las respuestas inflamatorias pueden tener un papel adaptativo si están circunscritas
en el tiempo. Así, en pacientes sometidos a radioterapia ocurre un aumento de los niveles de citoquinas
proinflamatorias como parte de una respuesta coordinada diseñada para controlar los daños inducidos
por la radiación, promoviendo la reparación tisular (Hagemann et al., 2007; Sepah et al., 2009).

• Señalización celular inducida por IL-6

IL-6 ejerce sus efectos celulares a través de la formación de un complejo receptor localizado en la
membrana, compuesto por el receptor de IL-6 alfa (IL-6Rα), proteína transmembrana glicosilada
perteneciente a la superfamilia clásica de los receptores de citoquinas tipo 1, y por la glicoproteína 130
(gp130), un receptor de citoquinas transmembrana. IL-6 se une a IL-6Rα y la formación de este complejo
atrae a gp130, que dimeriza permitiendo la transmisión de la señal intracelular. Ni IL-6 ni IL-6Rα por sí
solos son capaces de unirse y activar gp130 (Bouraoui et al., 2008). Principalmente la señal se transduce
a través de tirosinas quinasas de la familia Janus, también conocidas como Janus quinasa (Jak1, Jak2,
Jak3 y Tyck2) y factores de transcripción de la familia STAT (transductores de la señal y activadores de
transcripción). Otras vías alternativas de transducción son la vía de PI3K/Akt y MAPK (Yang et al., 2003;
Hodge et al., 2005; Cabrespine et al., 2007; Santer et al., 2010).


Introducción

Existe una forma soluble del IL-6Rα (sIL-6R), generada por splicing alternativo o por ruptura del IL-
6Rα unido a la membrana, capaz de unirse a la citoquina. El complejo IL-6/sIL-6R puede activar gp130
en ausencia de IL-6Rα. Esta señalización alternativa se conoce como trans-señalización de IL-6. En
contraste con otros receptores de citoquinas solubles sIL-6R facilita la actividad de la IL-6, pudiendo tanto
amplificar la señal producida por IL-6Rα como activarla en células que no presentan este receptor.
También existe una forma soluble de la proteína gp130 (sgp130), pero ésta sólo inhibe la activación del
complejo IL-6/sIL-6R, sin interferir en la actividad del complejo IL-6/ IL-6Rα (Santer et al., 2010).
IL-6
28


STAT3

Gp130 está asociada a distintas Jak (Jak1, Jak2 y Tyk2), que se activan cuando esta dimeriza,
fosforilando a la propia gp130 en su extremo citoplasmático. Esta fosforilación, que ocurre en varios
residuos, es reconocida por los miembros de la familia STAT, que se unen a gp130. Entonces Jak
fosforila a los distintos STAT, activándolos y permitiendo la formación de dímeros. Estos dímeros se
translocan al núcleo, dónde regulan la transcripción de múltiples genes. Posteriormente son inactivados
por desfosforilación, volviendo al citoplasma (Bromberg, 2002; Hodge et al., 2005).

Figura 12. Señalización celular de IL-6 vía STAT3. La unión de IL-6 al receptor IL-6Rα produce la dimerización de gp130,
y activación de Jak. Jak activado fosforila a gp130, que es reconocido por STAT3, que se fosforila por Jak, permitiendo la
formación de dímeros activados, que se translocan al núcleo para regular la transcripción.
Jak
p
Jak
p
STAT3 STAT3
STAT3
p
S T A T 3
p
STAT3
p
S T A T 3
p
I
L
-
6
R
α
g
p
1
3
0
g
p
1
3
0
p p

Introducción

29

Las proteínas STAT son una familia de factores de transcripción formada por siete miembros:
STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b y STAT6, estando algunos de ellos asociados con
diversos tipos de cáncer. STAT1 y STAT5 se encuentran constitutivamente activados en algunas
leucemias, aunque es STAT3 el que con más frecuencia se altera en varios tipos de cáncer, entre ellos el
cáncer de próstata (Horvath, 2000; Turkson et al., 2000; Barton et al., 2001; Hodge et al., 2005), por lo
que incluso es considerado un oncogén (Levy et al., 2006). Más aún, STAT3 modula la transcripción de
diversos genes que promueven supervivencia y proliferación, entre ellos proteínas anti-apoptóticas como
Bcl-x y Bcl-2 y genes implicados en la progresión del ciclo celular, como la ciclina D1 (Bowman et al.,
2001; Garcia et al., 2001). Además, la inhibición de STAT3 está implicada en el mecanismo de acción de
diversas drogas antitumorales (Bispo de Jesus et al., 2008; Chesnokov et al., 2009; Hahm et al., 2010).

2.2.2.1 Papel del factor nuclear kappa B

NFκB es un factor de transcripción pleiotrópico que desempeña una función central en la respuesta
inmune innata y en la adquirida, induciendo la expresión de genes que codifican citoquinas
proinflamatorias, quimioquinas y moléculas de adhesión. Pero también participa en otras funciones
biológicas, entre ellas proliferación celular y apoptosis. Su papel en estos fenómenos celulares es
controvertido y, aunque normalmente participa en procesos anti-apoptóticos, en ciertas ocasiones posee
una función antitumoral (Perkins et al., 2006; Chen et al., 2008b). Este factor y muchas de sus múltiples
proteínas reguladoras, ente ellas miembros de la familia Bcl-3, están fuertemente implicados en varios
tipos de tumores sólidos y hematológicos (Sun et al., 2007). Todo esto hace de NFκB un posible eslabón
de unión entre inflamación y progresión del cáncer (Kim et al., 2006).

En mamíferos existen cinco genes NFκB relacionados por un dominio N-terminal de
aproximadamente 300 aminoácidos llamado dominio homólogo a Rel (RHD) en el que se localizan
secuencias tanto de unión a DNA y a inhibidores, como de dimerización. Estos cinco genes (tabla 2) dan
lugar a siete proteínas diferentes, que se dividen en dos clases según su dominio RHD, que forman
distintas subunidades de NFκB:

Clase I: incluye NFκB1 (p50 y su precursor p105) y NFκB2 (p52 y su precursor p100)
Clase II: RelA (p65), RelB y c-Rel


Introducción

Las subunidades de clase I, p50 y p52, se sintetizan como precursores, p105 y p100
respectivamente, que son procesados por el proteosoma, donde se elimina su extremo carboxilo-terminal
dando lugar a las formas activas p50 y p52. Las subunidades de clase II poseen un dominio de
transactivación en su extremo C-terminal, que es el responsable de la activación génica.
Clase Proteína Otros nombres Gen
I
NF-κB1 p105 → p50 NFKB1
NF-κB2 p100 → p52 NFKB2
II
RelA p65 RELA
RelB RELB
c-Rel REL

Tabla 2. Proteínas de la familia NFκB.
Estas subunidades forman varios homodímeros y heterodímeros, siendo el más común el formado
por las subunidades p50/p65. Al ser el dímero más común, el término NFκB generalmente se usa para
referirse a este heterodímero p50/p65, aunque este nombre puede aplicarse también a otros dímeros
compuestos por diferentes subunidades de NFκB. En ausencia de activación, los dímeros permanecen
secuestrados en el citoplasma por proteínas inhibidoras llamadas IκBs. Cuando existe un estímulo
activador estas proteínas inhibidoras son fosforiladas por la familia de las quinasas de los inhibidores de
NFκB (IKKs), activándose su degradación. La familia IKK está constituida por IKKα, IKKβ e
IKKγ, también llamada modulador esencial de NFκB (NEMO). Cuando se degrada el inhibidor IκB se
produce la liberación de NFκB, permitiendo así su activación y translocación al núcleo, donde regula la
transcripción de distintos genes (Hayden et al., 2008; Mohamed et al., 2009).

NFκB se activa por varios estímulos como lipopolisacáridos bacterianos, ésteres de forbol, virus,
estrés oxidativo, luz ultravioleta, radiación ionizante y drogas genotóxicas. Su activación se produce por
las vías de señalización del receptor 1 del factor de necrosis tumoral (TNFR1), el receptor 1 de
interleuquina 1 (IL-1R1), el receptor similar a Toll (TLR), el receptor de células B (BCR), el receptor de
células T (TCR), receptor de linfotoxina b (LTbR), el factor activador de células B (BAFFR) y el cluster de
diferenciación 40 (CD40) (Gloire et al., 2006).

30


Introducción

Existen dos vías principales de activación de NFκB (figura 13):

La vía clásica o canónica, en la que participa el heterodímero p50/p65, que permanece
secuestrado en el citosol por el inhibidor IκBα. El complejo IKKα/β fosforila al inhibidor de NFκB, IκBα,
liberando así al heterodímero p50/p65, que se transloca al núcleo. En esta ruta también interviene NEMO,
el cual es requerido para la interacción del complejo IKKα/β con proteínas anteriores en la cascada de
transducción de la señal.

La vía no canónica es independiente de IKKβ y en ella participa el dímero p52/RelB y la quinasa
inductora de NF-κB (NIK). NIK fosforila al homodímero IKKα desencadenando su activación y la
fosforilación de p100 por IKKα, lo que conduce a la proteolización de esta subunidad a p52 y la
translocación al núcleo del dímero p52/RelB (Perkins et al., 2006; Mohamed et al., 2009).

31



IKKγ
NEMO
IKK
NEMO
p50
p65
p
p105
p65
IκBα
p100
RelB
NIK
p52
RelB
p
p IκBα
p p
p
Vía canónica
Vía no canónica
p
Figura 13. Vías principales de activación de NFκB. En la vía clásica o canónica, IKKβ activa al inhibidor de NFκB,
IκBα, liberando así al heterodímero p50/RelA, que se transloca al núcleo, regulando la transducción de distintos genes.
La vía no canónica es independiente de IKKβ, activándose p100 por IKKα, lo que conduce a la proteolización de esta
subunidad a p52, y la translocación al núcleo del dímero p52/RelB.

Introducción

32

3.- CANNABINOIDES Y SISTEMA ENDOCANNABINOIDE

3.1.- Reseña histórica

La marihuana y el hachís, componentes de distintas partes de la planta Cannabis sativa,
constituyen una de las drogas más antiguas usadas por el hombre y una de las más empleadas en los
países occidentales. La popularidad de la marihuana como droga de recreo se debe a su capacidad para
alterar la percepción sensorial provocando euforia y júbilo. Además de este uso lúdico, los constituyentes
de la planta también han sido usados durante décadas como drogas medicinales, debido a sus
propiedades sobre procesos neuroconductales tales como la memoria, el humor y el apetito (Pacher et
al., 2006; Greineisen et al., 2010). Sin embargo en 1937, debido a los peligros derivados del uso de esta
droga, se prohibió en los Estados Unidos. El aislamiento en 1964 del mayor componente psicotrópico de
la planta el delta-9-tetrahidrocannabinol (THC), estimuló durante la década de los setenta la generación
de un amplio rango de análogos sintéticos con propiedades similares a las del componente de la planta.
Más de dos décadas después del descubrimiento del THC se identificó el primer receptor de
cannabinoides en el organismo llamado CB1

(Devane et al., 1988) Por su homología se identificó un
segundo receptor de cannabinoides llamado CB2

(Munro et al., 1993). El descubrimiento de receptores
específicos de cannabinoides implicaba que debían de existir ligandos endógenos capaces de unirse a
estos receptores. El primer cannabinoide endógeno descubierto fue la anandamida y su hallazgo permitió
observar que otro metabolito previamente conocido era capaz de unirse con gran afinidad a CB1 y CB2,
el 2 araquidonilglicerol (2AG). Los endocannabinoides pueden reproducir la mayoría de los efectos
descritos para fitocannabinoides, mostrando una actividad cannabinoimimética (Di Marzo, 2009).

Tanto el descubrimiento de la estructura del THC, como el hallazgo de los componentes
endógenos capaces de unirse o actuar como los cannabinoides de la planta, despertó de nuevo el interés
sobre el uso terapéutico de los cannabinoides, existiendo en la actualidad en uso médico dos agonistas
de los receptores cannabinoides (el dronabinol y la nabilona), un extracto de cannabis (el Sativex®)
(Gerra et al., 2010).






Introducción

3.2.- Tipos de cannabinoides

Los cannabinoides se pueden dividir por su origen en tres clases: los provenientes de la planta o
fitocannabinoides, los endógenos o endocannabinoides y los cannabinoides sintéticos, sustancias
sintetizadas en el laboratorio capaces de unirse a los receptores de cannabinoides. Estos últimos se
dividen a su vez en dos clases en base a su estructura: cannabinoides clásicos, que poseen una
estructura parecida a la de los fitocannabinoides y cannabinoides no clásicos, con una estructura química
que difiere altamente de la del THC (tabla 3).
Naturales Endógenos Sintéticos
Clásicos
No cl ási cos
THC
AEA
HU-210
Cannabivariol
2-AG
Nabilona
Virodamina
(-)-Cannabidiol
(CBD)
WIN 55,212-2
NADA CP55940
Ácido ajulémico
Figura 14. Distintos tipos de cannabinoides
33


Introducción

34

3.2.1 Compuestos bioactivos de Cannabis sativa

De los aproximadamente 500 compuestos presentes en la planta Cannabis sativa, sólo unos 70
son considerados cannabinoides. Poseen una estructura tricíclica con hidrocarburos oxigenados de 21C
formados generalmente por tres anillos, ciclohexeno, tetrahidropirano y benceno. De todos ellos, el
principal componente activo es el THC. Presenta propiedades hidrofóbicas al poseer una estructura
común tricíclica con un anillo fenólico, un anillo de pirano central y un anillo ciclohexilo monoinsaturado
(Nahas, 2002), lo que le proporciona una particular farmacocinética en el organismo. Otros cannabinoides
presentes en la planta, en menor medida que el THC, son el cannabigerol (CBG), el cannabicromeno
(CBC), el cannabidiol (CBD) y el cannabinol (CBN). La concentración de cannabinoides varía según la
variedad del cannabis y por lo general se encuentran en una planta solamente tres o cuatro
cannabinoides en concentraciones superiores al 0.1%. Aunque el THC es el mayor responsable de los
efectos farmacológicos del cannabis, incluyendo sus consecuencias psicoactivas, otros compuestos de la
planta también poseen efecto biológico, especialmente el CBD, un fitocannabinoide no psicoactivo que
tiene propiedades antiinflamatorias, analgésicas y ansiolíticas (Nahas et al., 2002; De Backer et al.,
2009).

3.2.2 Ligandos endógenos

Los endocannabinoides encontrados hasta la fecha pertenecen a la familia de los eicosanoides
que presentan afinidad por los receptores de cannabinoides. Son derivados de ácidos grasos
poliinsaturados de cadena larga unidos a un grupo más polar mediante enlace amida, éster o éter.
Incluyen la anandamida (N-araquidonoil etanolamina, AEA), 2-araquidonoil glicerol (2-AG), 2-araquidonoil
gliceril eter (noladina, 2-AGE), O-araquidonoil etanolamina (virodamina) y N-araquidonoil dopamina
(NADA) (De Petrocellis, 2004; Singh and Budhiraja, 2006). Existen otros dos metabolitos estructuralmente
relacionados con los anteriores, la N-oleoiletanolamina (OEA) y la N-palmitoiletanolamina (PEA), que se
distribuyen en bajas concentraciones por el sistema nervioso central, pero su clasificación dentro de los
endocannabinoides está sujeta a debate, ya que no tienen afinidad ni por CB1 ni por CB2 (Burstein et al.,
2009; Sagar et al., 2009; De Petrocellis et al., 2010).



Introducción

35

Los endocannabinoides se consideran una nueva clase de reguladores lipídicos. No se almacenan
en vesículas, como los neurotransmisores clásicos, sino que se sintetizan rápidamente a partir de un
precursor lipídico, siendo inmediatamente liberados al espacio extracelular o actuando directamente en la
misma membrana celular (Sagar et al., 2009). AEA, OEA y PEA se sintetizan a partir de su
correspondiente precursor, N-araquidonoil fosfatidil etanolamina (NAPE), N-oleoil fosfatidil etanolamina o
N-palmitoil fosfatidil etanolamina respectivamente. El precursor es hidrolizado por una fosfodiestarasa
específica, muy similar a la fosfolipasa D (PLD) denominada NAPE-PLD, que ha sido clonada y
caracterizada (Okamoto et al., 2004). Existen también dos vías alternativas en las que participan la
fosfolipasa C (PLC) y la αβ hidrolasa (αβH4)-GDE (Sagar et al., 2009).

El precursor inmediato de 2-AG es el diacilglicerol (DAG). El DAG se produce por hidrólisis de los
fosfoinosítidos de membrana (PI) o del ácido fosfatídico (PA) dependiendo del tipo celular. Existen dos
diacilglicerol lipasas (DAGL) específicas, DAGLα y DAGLβ, que catalizan la hidrólisis del DAG a 2AG,
liberando el AG de la posición 1. También se ha propuesto que la síntesis de 2-AG pueda darse por la
fosfolipasa A1 (PLA1) y fosfolipasa C (PLC) (Sagar et al., 2009).

La finalización de la señal de anandamida se realiza mediante transporte de AEA al interior
celular y posterior hidrólisis por una amidohidrolasa de ácidos grasos (FAAH) que rinde ácido
araquidónico (AA) y etanolamina, mientras que el 2-AG se hidrolizaría fundamentalmente por una
monoacilglicerol lipasa. AEA y 2-AG pueden también ser sustratos de las cicloxigenasas tipo-2 (cox-2),
lipoxigensas (LOX) y citocromo P-450s (CYP450s) (McFarland et al., 2004; Burstein et al., 2009; Sagar et
al., 2009).

3.2.3 Ligandos sintéticos

Se ha desarrollado un amplio espectro de cannabinoides sintéticos con diferentes actividades y
afinidades por los receptores, lo que supone una herramienta muy útil para el estudio de las posibilidades
terapéuticas de los cannabinoides. Dentro de éstos compuestos se encuentran tanto agonistas como
antagonistas de los dos receptores de cannabinoides, o selectivamente de uno de los dos tipos de
receptores (Kogan et al., 2006; Petrosino et al., 2009). Los dos cannabinoides empleados en esta Tesis
doctoral se engloban dentro de este tipo de sustancias sintéticas. El primero de ellos es el análogo
modificado del endocannabinoide anandamida, (R)-(+)-araquidonoil-1’-hidroxi-2’-propilamida o (R)-(+)-

Introducción

metanandamida (MET). La introducción de los grupos metilo en el carbono dos de la anandamida
produce un aumento de su estabilidad metabólica y una mayor afinidad por los receptores de
cannabinoides. Posee afinidad por ambos receptores aunque se une con mayor afinidad a CB1 (Abadji et
al., 1994; Lin et al., 1998; Goutopoulos et al., 2001; Goutopoulos et al., 2002). El segundo es JWH015,
agonista selectivo del receptor CB2 (Showalter et al., 1996; Griffin et al., 1997; Huffman, 2000; Petrosino
et al., 2009).

JWH015 Metanandamida
36

3.3.- Receptores de cannabinoides

Figura 15: Estructura química de MET y JWH015
La fuerte hidrofobicidad del THC hizo pensar inicialmente que los efectos de los cannabinoides
podrían estar causados por perturbaciones en la membrana o por interacciones con sitios de unión
inespecíficos. Sin embargo, el descubrimiento de los receptores CB1 y CB2 demostró que esto no era
así, aunque no se descarta un mecanismo adicional por inserción en la membrana plasmática. Además,
cada vez son más abundantes los datos que sugieren la existencia de otros receptores de cannabinoides
entre los receptores huérfanos GPCRs (Petrosino et al., 2009).

Todos estos receptores, juntos con los endocannabinoides y las enzimas encargadas de su
síntesis y metabolismo constituyen el llamado sistema endocannabinoide (figura 16) (Pacher et al., 2006;
Pertwee, 2009; Pisanti et al., 2009a).




Introducción

CB
2
GPR55
CB
1
TRPV1
37


3.3.1 CB1 y CB2

Las principales dianas moleculares de los endocannabinoides son los receptores de
cannabinoides tipo 1 (CB1) y tipo 2 (CB2). Ambos están formados por un único polipéptido con siete
pasos transmembrana α-hélice, un extremo N-terminal glicosilado y un extremo C-terminal intracelular.
Son receptores acoplados a proteínas G, fundamentalmente a Gi/o. CB1 está principalmente expresado
en células neuronales del sistema nervioso central, donde media la liberación y recaptación de varios
neurotransmisores. CB2 presenta una expresión más periférica, localizándose especialmente en células
del sistema inmune, afectando a la liberación de mensajeros químicos, como las citoquinas, pudiendo
también regular el tráfico intracelular. A pesar de estas dos localizaciones preferenciales, ambos
receptores se encuentran también expresados en distintos tejidos periféricos (Kogan et al., 2006;
Pertwee, 2009; Greineisen et al., 2010).

3.3.2 GPR-55

Recientemente se ha sugerido la existencia de un posible tercer receptor de cannabinoides, el
receptor huérfano GPR-55, que reconoce varios cannabinoides y fitocannabinoides, aunque la
farmacología de este receptor no permite incluirlo dentro de los receptores de cannabinoides. GPR-55
parece ser un receptor de lisofosfatilinositol que puede responder también a anandamida. Este receptor
Figura 16: Sistema endocannabinoide
γ
β
GDP
GTP
G
αi/o
γ
β
GDP
GTP
G
αi/o γ
β
GDP
GTP
G
αi/o
MGL
Ca
2+
FAAH
AA AA
AEA
Etanol ami da
+ +
2-AG
Gl i cerol

Introducción

38

activa a Gα12 y Gα13. Por hibridación in situ su tránscrito ha sido detectado en el núcleo caudado y
putamen, pero no en el hipocampo, tálamo, cerebelo, puente ni cortex frontal (Brown et al., 2009;
Godlewski et al., 2009; Ross, 2009).

También existe otro receptor huérfano identificado mediante aproximaciones informáticas, el GPR-
119, que une OEA. Su mRNA ha sido localizado en tejido pancreático e intestinal (Godlewski et al., 2009;
De Petrocellis et al., 2010).

3.3.3 TRPV1

Algunos de los endocannabinoides pueden unirse, además, al receptor de vanilloides TRPV1 que
constituye un canal catiónico no selectivo de cationes divalentes. Por ello se ha considerado a CB1 y CB2
como receptores metabotrópicos de cannabinoides, mientras que TRPV1 sería el receptor ionotrópico.
Este receptor pertenece a la familia de los canales activados por potenciales transitorios (TRP), que se
dividen en las siguientes subfamilias: TRPC (canónica), TRPA (tipo ankirina), TRPM (tipo melastatina),
TRPP (tipo policistina), TRPML (tipo mucolipina) y TRPV (tipo vanilloide). Los canales TRP poseen seis
dominios transmembrana con una puerta de entrada para varios tipos de cationes, incluyendo Ca
2+
. Son
estimulados por agentes físicos, como la temperatura, la luz y presión mecánica, o químicos, como
ácidos, álcalis y xenobióticos. Están formados en su forma activa por tetrámeros, dependiendo su
actividad de fosforilaciones ejercidas por quinasas que regulan su función, como PKC, PKA y calcio-
calmodulina quinasa (Sagar et al., 2009; De Petrocellis et al., 2010).

Existen seis tipos de receptores TRPV, numerados del 1 al 6. Todos ellos canales de Ca
2+
o
cationes, aunque únicamente TRPV1 puede ser activado por AEA. Entre los ligandos exógenos capaces
de activar TRPV1 destaca la capsaicina, el componente picante de los pimientos, que al unirse a TRPV1
lo activa, produciendo la sensación de calor característica (De Petrocellis et al., 2010). Existen varios
antagonistas de TRPV1, siendo la capsazepina (CPZ) uno de los más utilizados.






Introducción

39

3.4.- Mecanismos de transducción a través de CB1 y CB2

Como ya se ha comentado los receptores de cannabinoides son miembros de la superfamilia de los
GPCRs. Inicialmente se describió que ejercían sus efectos biológicos acoplados principalmente a
proteínas G
i/o
, pudiendo también activar G
s
y G
q/11
. Este acoplamiento genera un intercambio guanosina
trisfosfato (GTP) / guanosina difosfato (GDP) y subsecuentemente la liberación de las subunidades α y
βγ, que pueden regular la actividad de múltiples efectores entre los que destaca la adenililciclasa. El
receptor CB1 también puede inhibir varios canales iónicos, entre ellos de calcio, potasio y sodio, a través
de la subunidad βγ. Los distintos miembros de la familia MAPK también pueden ser activados por los dos
receptores de cannabinoides por medio de tres posibles mecanismos: transactivación de receptores
tirosina quinasa (RTKs), activación de la ruta de la PI3K/Akt y activación de la quinasa de adhesión focal
(FAK), regulando así el crecimiento celular (Cabral et al., 2009; Turu et al., 2010).

Además también pueden regular los niveles de calcio intracelular mediante la activación de PLC,
metabolismo del ácido araquidónico, síntesis de ceramida y producción de óxido nítrico. Asimismo
pueden regular la transcripción por medio de distintos factores de transcripción, entre ellos c-Fos, Kros-24
y NFκB (Diaz-Laviada et al., 2005; Pacher et al., 2006; Dalton et al., 2009).

Los dos receptores de cannabinoides poseen una señalización extremadamente compleja. Ambos
están acoplados a proteínas G sensibles a toxina pertusis, pero no participan en idénticas señales de
transducción. Por ejemplo, mientras que el receptor CB1 puede activar distintos tipos de canales iónicos,
el receptor CB2 es incapaz de activarlos, o lo hace débilmente. Esta divergencia en la señalización puede
estar debida a que cada receptor puede acoplarse a un subtipo distinto de proteínas G. Otros niveles de
complejidad en la señalización derivan de la posible interacción con lipid rafts capaces de controlar el
tráfico y la señalización de los receptores, de la existencia de una gran variedad de mecanismos de
desensibilización que limitan la duración y amplitud de la señal y, por último, de la capacidad de los
GPCRs de organizarse dentro de una nueva unidad de señalización (McAllister et al., 2002; Bosier et al.,
2010).

Aunque ejercen sus efectos principalmente a través de proteínas G, en ciertas ocasiones pueden
actuar de forma independiente a estas proteínas. Así, los cannabinoides pueden inducir hidrólisis de
esfingomielina a través de la interacción con la proteína adaptadora FAN, sin mediación de proteínas G.

Introducción

40

La señalización a través de arrestinas también podría estar ser regulada por los cannabinoides de forma
independiente de proteínas G (Diaz-Laviada et al., 2005).

3.5.-Cannabinoides y cáncer

El hecho de que el sistema endocannabinoide esté altamente conservado entre especies así
como la ubicua expresión de los endocannabnoides y su papel como moduladores de proteínas y factores
nucleares que regulan la supervivencia, proliferación y la diferenciación celular, sugiere que los
endocannabinoides pueden estar involucrados en el control de procesos fundamentales tales como la
homeostasis celular y posiblemente también en transformación neoplásica (Pisanti et al., 2009a).

Los efectos paliativos de los cannabinoides en enfermedades de cáncer están bien
caracterizados; entre ellos destacan la inhibición de náuseas y emesis, estimulación del apetito y alivio
del dolor. Tres de los medicamentos derivados del cannabis, Marinol, Cesament y Sativex, están
indicados en el tratamiento de estas alteraciones. Su aplicación como agentes anticancerígenos se
encuentra aún en fase de investigación preclínica, pero numerosos estudios sugieren que los
cannabinoides también pueden inhibir el crecimiento tumoral. Los mecanismos por los que los
cannabinoides ejercen este efecto antitumoral son variados e incluyen la inducción de apoptosis en
células tumorales, efectos antiproliferativos y antimetastásicos a través de la inhibición de angiogénesis y
migración celular, y efectos citotóxicos y citoestáticos (Pacher et al., 2006; Vidinsky et al., 2006; Pisanti et
al., 2009a; Pisanti et al., 2009b).

La plasticidad del sistema endocannabinoide bajo determinadas alteraciones puede ser una
reacción adaptativa con el fin de restaurar la homeostasis perturbada por estas alteraciones. En este
sentido, se han detectado niveles elevados de cannabinoides en varios tipos de tumores comparando con
tejidos sanos como por ejemplo en glioblastoma, menangioma, adenoma pituitario, adenoma de próstata,
adenoma de colon y sarcoma endometrial. También se ha descrito en algunos casos un incremento en
los niveles de las enzimas encargadas del metabolismo de los endocannabinoides, existiendo una
correlación entre los niveles de estas enzimas y la progresión del cáncer como ocurre en adenocarcinoma
prostático y adenocarcinoma pancreático. En lo que respecta a los receptores de cannabinoides existen
varias evidencias que sugieren que alteraciones en su nivel de expresión juegan un papel importante en
tumores hematológicos y en varios tumores sólidos. Esto ocurre entre otros en el cáncer de próstata y en

Introducción

41

tumores hepáticos, donde los dos receptores de cannabinoides se sobre-expresan respecto del tejido
normal. En los tumores hematológicos existen datos contradictorios, encontrando células de leucemia que
expresan CB2 pero no CB1, y en algunos casos expresión de CB1

en linfomas, pero no en células B
normales (McKallip et al., 2002; Sarfaraz et al., 2005; Gustafsson et al., 2006; Xu et al., 2006). La
expresión diferencial de estos receptores entre el tejido normal y el tumoral puede ser de especial interés
para entender mejor el papel del sistema endocannabinoide en la generación y el mantenimiento de las
neoplasias, pudiendo también resultar ventajosa en la terapia farmacológica. Todas estas alteraciones en
los distintos miembros del sistema endocannabinoide podrían sugerir un posible papel antitumoral de los
endocannabinoides en los primeros estados del desarrollo del cáncer (Pisanti et al., 2009a). En este
sentido los cannabinoides inhiben el crecimiento de diversas líneas tumorales a través de distintos
mecanismos de señalización celular, entre los que se incluye inhibición de rutas que regulan el
crecimiento celular, especialmente las MAPKs, parada del ciclo celular por inhibición de distintos
oncogenes como K-ras, inducción de apoptosis a través de un incremento en los niveles de ceramida y
alteración de proteínas de estrés (Vidinsky et al., 2006; Sarfaraz et al., 2008; Pisanti et al., 2009a). Sólo
existe un estudio publicado en el que los cannabinoides presentaran un efecto protumoral en distintas
líneas cancerígenas usando dosis bajas de éstos, del orden nanomolar (Hart et al., 2004), pero son
mucho más numerosos los estudios que demuestran los efectos pro-apoptóticos y antiproliferativos. En
este mismo estudio el empleo de dosis más elevadas los cannabinoides produjo muerte celular y
apoptosis (Melck et al., 2000).

A pesar de las múltiples evidencias preclínicas existentes sobre el uso terapéutico de los
cannabinoides como drogas antitumorales, hasta la fecha sólo existe un ensayo en fase clínica I
aprobado por el Ministerio Español de Sanidad en 2002 (Guzman et al., 2006). El objetivo de este estudio
era evaluar la administración intratumoral de THC en pacientes de glioblastoma multiforme recurrente, un
tumor primario muy agresivo de pobre prognosis. Se encontró que la administración intracraneal de THC
era segura y no presentaba efectos psicoactivos, disminuyó la proliferación celular del tumor e indujo
apoptosis, pero tuvo un tenue impacto sobre la media de supervivencia de estos pacientes (Alexander et
al., 2009; Pisanti et al., 2009a).




Introducción

42

3.5.1 Cannabinoides y cáncer de próstata

En las células tumorales de próstata existe expresión tanto de CB1 como de CB2 (Ruiz-Llorente et
al., 2003; Sanchez et al., 2003b), y además sus niveles se incrementan con respecto a la próstata normal
(Sarfaraz et al., 2005). El efecto de los cannabinoides en el cáncer de próstata es bimodal dependo de la
dosis empleada; dosis del orden nanomolar producen un efecto mitogénico (Sanchez et al., 2003b) y a
dosis más elevadas, en el rango micromolar, se ha observado una inducción de apoptosis (Ruiz et al.,
1999; Mimeault et al., 2003b) o una parada del ciclo celular (Sarfaraz et al., 2006). El efecto mitogénico
de los cannabinoides parece ocurrir a través de la señalización dependiente de cAMP y por modulación
de la expresión del AR (Sanchez et al., 2003b; Sanchez et al., 2004; Sarfaraz et al., 2005; Sarfaraz et al.,
2006), mientras que la inhibición de la proliferación puede acontecer además de por una inhibición en la
expresión del AR (Sarfaraz et al., 2005), por modulación de la señalización provocada por diversos
factores de crecimiento, como EGF y NGF (De Petrocellis et al., 1998; Melck et al., 2000; Mimeault et al.,
2003a; Mimeault et al., 2003b) y por un incremento en los niveles de ceramida (Gewies et al., 2000). La
invasión tumoral también puede ser inhibida por los cannabinoides a través de CB1 (Nithipatikom et al.,
2004).

3.5.2 Cannabinoides y sistema inmune

La relevancia del sistema endocannabinoide sobre el sistema inmune se pone de manifiesto no
sólo por la presencia de los receptores de cannabinoides en las células inmunes, principalmente del
receptor CB2, si no por otras evidencias como el aumento en los niveles de endocannabinoides y el
aumento en la expresión de CB2 que se produce durante la inflamación y al ser estimuladas las células
inmunes por bacterias (Pacher et al., 2006; Cabral et al., 2009). Por otra parte los cannabinoides inducen
la secreción de diferentes citoquinas, promoviendo tanto efectos pro-inflamatorios como anti-inflamatorios
que modulan la hematopoyesis y el crecimiento tumoral (Pacher et al., 2006; Jean-Gilles et al., 2010).

El papel del sistema inmune en el control del desarrollo del cáncer también es clave, como
demuestra el hecho de que los individuos inmunodeprimidos tengan mayor riesgo de desarrollar cáncer
(Oruc et al., 2004). En este sentido, los cannabinoides pueden ser especialmente importantes, ya que se
conocen bien sus efectos inmunorreguladores, modulando distintos componentes del sistema inmune
(Klein, 2005; Tanasescu et al., 2010). Una de las respuestas que éstos inducen sobre el sistema inmune

Introducción

43

es la inmunosupresión, lo que podría provocar una tolerancia al tumor, que implicaría un riesgo derivado
del uso terapéutico de los cannabinoides (Klein, 2005). A pesar de esto, existen pocas evidencias que
relacionen los cannabinoides con una respuesta protumoral, y se cree que la capacidad intrínseca del
tumor de responder a los cannabinoides es crítica para resolver el balance entre tolerancia al tumor y
respuesta antitumoral y, en consecuencia, entre progresión y regresión del cáncer. Cuando el tumor es
capaz de responder a los cannabinoides, tanto el tumor como las células inmunes son dianas de los
cannabinoides, produciéndose una regresión tumoral. Cuando el tumor no responde a los cannabinoides,
podría prevalecer el efecto inmunosupresor, desarrollándose una tolerancia al tumor que permite el
crecimiento tumoral o neoplasia (Flygare et al., 2005; Bifulco et al., 2008; Pisanti et al., 2009a). Aún así,
son muchos más los estudios que revelan un claro papel antitumoral de los cannabinoides, no sólo a
través de la inducción de apoptosis y parada de ciclo celular, si no regulando otros muchos procesos
involucrados en el desarrollo y progresión del cáncer, como inhibición de angiogénesis e invasión tumoral
(Ramer et al., 2008). La capacidad de los cannabinoides de modular el sistema inmune también podría
estar relacionada con este papel antitumoral, ya que los cannabinoides son capaces de inducir migración y
diferenciación celular, especialmente en los linfocitos T (Pisanti et al., 2009b) y modular la secreción de
citoquinas (Klein, 2005). Todas estas reacciones serían susceptibles de ser empleadas para lanzar
respuestas celulares contra el tumor (Ribeiro et al., 2010). Es más, se ha demostrado que los
cannabinoides influyen en la diferenciación de los linfocitos T a través del receptor CB2 (Yuan et al., 2002;
Klein et al., 2004), y estos linfocitos son principales responsables de las respuestas antitumorales del
sistema inmune (Shafer-Weaver et al., 2007). Por tanto, los cannabinoides podrían regular la homeostasis
del sistema inmune fundamentalmente a través del receptor CB2, modulando la secreción de citoquinas e
influyendo en la diferenciación, migración y proliferación de las células inmunes y al mismo tiempo
resultarían antitumorales efectivos, pudiendo el receptor CB2 servir de unión entre el sistema inmune y la
respuesta antitumoral (Cabral et al., 2009; Tanasescu et al., 2010).




Hipótesis y Objetivos

























HIPÓTESIS Y OBJETIVOS






Hipótesis y Objetivos

47



El cáncer de próstata es uno de los tumores malignos con mayor incidencia y el más
frecuentemente diagnosticado. Aunque en su fase andrógeno dependiente responde exitosamente al
tratamiento por privación androgénica, la enfermedad suele recurrir desarrollando una resistencia a esta
ablación hormonal. Mientras el tumor está localizado, puede tratarse por extirpación de la próstata
(prostatectomía) o radioterapia, pero cuando la neoplasia está más avanzada y es capaz de metastatizar
no existe ningún tratamiento eficaz y la media de supervivencia de estos pacientes es muy reducida. El
tratamiento actual para estos pacientes es la quimioterapia con agentes citotóxicos. Pero hasta ahora
sólo se logra aumentar su supervivencia unos meses, siendo de hecho la metástasis de próstata la
segunda causa de muerte en el varón. Por todo ello, continuamente se está investigando en el desarrollo
de nuevos medicamentos capaces de frenar el desarrollo tumoral, siendo necesario el uso de nuevas
aproximaciones y/o nuevos medicamentos eficaces en el tratamiento del cáncer de próstata.

En este sentido se ha mostrado en numerosos tipos de cáncer que los cannabinoides afectan a
muchos de los procesos celulares implicados en el desarrollo del tumor, presentando una gran variedad
de efectos anticancerígenos. Además, en el cáncer de próstata se expresan varios componentes del
sistema endocannabinoide, entre ellos los receptores de cannabinoides (Ruiz-Llorente et al., 2003), el
receptor TRPV1 (Sanchez et al., 2005), así como la enzima FAAH (Ruiz-Llorente et al., 2004) lo que le
hace susceptible al tratamiento con fármacos que afecten a alguno de estos componentes.

Por todo ello nos propusimos estudiar el efecto de los cannabinoides en las células tumorales de
cáncer de próstata PC-3, analizando su mecanismo de acción. Con este fin se propusieron los siguientes
objetivos:


1. - Determinar el efecto de los cannabinoides sobre el crecimiento y muerte de las células
PC-3.
2. - Estudiar el papel de los receptores de cannabinoides en el efecto sobre el crecimiento y
muerte celular.


Hipótesis y Objetivos

48

3. - Analizar los mecanismos de acción de los cannabinoides, profundizando en el papel de la
síntesis de ceramida y en las rutas de señalización celular implicadas.
4. - Comprobar el efecto in vivo de los cannabinoides sobre el crecimiento tumoral.
5. - Valorar la acción de los cannabinoides sobre la secreción de IL-6, así como las rutas de
señalización implicadas.
6. - Estudiar el posible papel de IL-6 sobre el crecimiento y muerte celular.
7. - Establecer el efecto de IL-6 sobre la diferenciación de los linfocitos Th17.



Materiales y Métodos































MATERIALES Y MÉTODOS






Materiales y Métodos

51

1.- MATERIALES

1.1.- Materiales empleados en los cultivos celulares

Para la realización de los cultivos celulares fueron empleados los siguientes materiales:

Placas, frascos de cultivo y pipetas de dos casas comerciales: Falcon® Becton Dickinson
Labware (New Jersey, USA) y Nunc
TM
Brand Products (Roskilde, Dinamarca).
Medio RPMI 1640 con L-glutamina estéril de la casa comercial Gibco BRL (Escocia, Reino
Unido), suplementado con suero fetal bovino también de Gibco BRL o con ITS (5 ng/ml de insulina, 5
mg/ml de transferrina y 5 ng/ml de selenio) de Sigma (St. Louis, USA).
Medio Keratinocyte-SFM suplementado con extracto de pituitaria bovina (0.05 mg/ml) y factor de
crecimiento epidérmico recombinante (5 ng/ml), ambos de Gibco BRL.
Solución de antibiótico (penicilina G 100 UI/ml, sulfato de estreptomicina 100 μg/ml y
anfotericina B 0.25 μg/ml) de Invitrogen (Paisley, UK).
Solución de tripsina de la marca comercial Gibco BRL (Escocia, Reino Unido).

1.2.- Reactivos empleados en la elaboración de tampones

Para la elaboración de los diferentes tampones fueron empleados lo siguientes reactivos:

Ácido acético, acetato potásico, acetona, etanol, metanol, NaCl, NaOH, sulfato amónico, ácido
tricloroacético (TCA) y 2-amino-2-(hidroximetil)-1,3-propanediol (Tris) se obtuvieron de Panreac
(Barcelona, España).
Albúmina sérica bovina (BSA) de Roche Diagnostic Corporation (Indianapolis, USA).
Aprotinina, leupeptina, inhibidor de tripsina de soja (STI), azida sódica, azul de bromofenol,
bromuro de etidio, dimetil sulfóxido (DMSO), gelatina, glicina, trietanolamina (TEA), leupeptina, β-
mercaptoetanol, fenil metilsulfonilfluoruro (PMSF) y tween-20, de Sigma (St. Louis, MO, USA).
Sacarosa, glicerol, CaCl
2
, MgCl
2
, KCl, DTT, EDTA, EGTA, KCl, DTT, K
2
HPO
4
, KH
2
PO
4
y SDS
de Merck (Darmstadt, Alemania).

Materiales y Métodos

52

Cloroformo, acetona, ácido perclórico y ácido acético de Sigma (St. Louis, MO, USA), metanol
de Panreac (Barcelona, España).
Dioleil-fosfatidilglicerol (DOPG) de Avanti Polar Lipids (Alabaster, USA) y el ácido
dietilenotriaminopentacético (DETAPAC) de Calbiochem (La Jolla, USA).

1.3.- Agonistas, antagonistas e inhibidores

Los cannabinoides R-(+)-metanandamida (MET) y JWH015 proceden de Sigma (St. Louis, MO,
USA). Capsacepina procede de Tocris (Bristol, UK). Los antagonistas de los receptores de cannabinoides
CB1 y CB2, SR 141716 (SR1) y SR 144528 (SR2) respectivamente, provienen de Sanofi Recherche
(Montpelier, France).
El inhibidor de ceramida sintasa, fumonisina B1, procede de Sigma (St. Louis, MO, USA) y el de
esfingomielinasa, D609, de Calbiochem (La Jolla, USA). El inhibidor LY294002 procede de Alexis
Bichemicals (Lausen, Switzerland).

1.4.- Líneas celulares

Se utilizaron tres líneas celulares tumorales epiteliales de próstata humana, LNCaP, PC-3 y DU
145 y una línea celular de próstata no tumoral, RWPE-1, que fueron obtenidas de ATCC (American Type
Culture Collection, Rockville, MD, USA): PC-3 (ATTC Nº CRL-1435), LNCaP clon FGR (ATCC Nº CRL-
1740), DU 145 (HTB-81) y RWPE-1 (ATCC Nº CRL-11609). La línea LNCaP, proviene de una metástasis
a un ganglio linfático de un carcinoma prostático, responde a andrógenos, y por tanto representa el
estadio 1 de la enfermedad. La línea PC-3 deriva de una metástasis ósea de un adenocarcinoma de
próstata de grado IV. Es insensible a andrógenos, por lo que se usa como modelo de la fase dos de la
enfermedad. La línea DU 145 proviene de una metástasis cerebral de un carcinoma prostático. Al igual
que la línea PC-3 no presenta sensibilidad a andrógenos. Y la línea RWPE-1 se utiliza como control no
tumoral.

Las líneas celulares PC-3 y LNCaP se descongelaron en pases bajos, se sembraron a una
densidad de 15x10
3
-22 x10
3
células/cm
2
y se mantuvieron en medio RPMI 1640 suplementado con 10%
de suero fetal bovino (FBS) en presencia de 1% de solución de antibiótico, a 37 ºC en un ambiente
húmedo y con un 5 % de CO
2
. Los medios se cambiaban cada dos días y cuando las células llegaban a

Materiales y Métodos

53

un 70-90% de confluencia se les añadía tripsina/EDTA para levantarlas, se recogían con medio RPMI
1640, se centrifugaban a 400 g y se volvían a sembrar. Para realizar los distintos ensayos, antes de
alcanzar la confluencia, se retiraba el medio con suero y se incubaban las células en medio definido
(RPMI 1640 suplementado con ITS al 5% en el caso de PC-3 y RPMI 1640 sin suplementar en el caso de
LNCaP) durante 24 h y a continuación se administraban los tratamientos necesarios para la realización de
los diversos experimentos.

Las células RWPE-1 se sembraban a densidades de 3 x10
4
células/cm
2
y se mantenían en medio
Keratinocyte-SFM suplementado con extracto de pituitaria bovina (0.05 mg/ml), factor de crecimiento
epidérmico recombinante (5 ng/ml) en presencia de 1% de solución de antibiótico, a 37 ºC y con un 5 %
de CO
2
.

Se usó también la línea HepG2 (ATCC Nº HB-8565
TM
), procedente de un carcinoma hepatocelular,
como control para algunos ensayos. Estas células se sembraron a una densidad 5000 células/cm
2
y se
mantuvieron en medio DMEN suplementado con 10 % de FBS en presencia de 1 % de solución de
antibiótico, a 37 ºC en un ambiente húmedo y con un 5 % de CO
2
.

2.- MÉTODOS

2.1.- Medida de la viabilidad celular mediante MTT

Tras tratar a las células con diferentes agonistas y antagonistas, se incubaron con 0.5 mg/ml de
MTT (Bromuro de 3-[4,5-dimetiltiazol-2-il]-2,5-difenil-tetrazol) durante 1-2 h a 37ºC en oscuridad,
apareciendo un precipitado de color azulado que correspondía a la formación de cristales de formazán.
Posteriormente, este precipitado se solubilizó con isopropanol ácido, se agitaron suavemente las placas
para obtener una coloración homogénea y se valoraron las absorbancias a 570 nm y a 630 nm con un
espectrofotómetro de placas (ELX 800 Bio-Tek Intruments, INC). La diferencia de ambas absorbancias
obtenida en las células control se consideró el 100% de viabilidad, y la viabilidad de las células tratadas
se determinó por comparación con respecto a este dato.


Materiales y Métodos

54

2.2.- Medida de la división celular mediante incorporación de
[
3
H]-timidina

Las células se trataron con diferentes compuestos, manteniéndolas a 37ºC durante dos días. 16 h
antes de finalizar el ensayo, se añadió [
3
H]-timidina (Amersham Biosciences, Buckinghamshire, UK) (1
μCi/pocillo). Posteriormente, después de lavar las placas cuidadosamente con PBS, se precipitaron las
proteínas con ácido tricloroacético (TCA) al 10% durante 15 min a 4ºC y pasado este tiempo, se
levantaron y neutralizaron con NaOH 1 N durante 1 hora a temperatura ambiente. Posteriormente se
recogió el medio de incubación, se adicionó 2 ml de líquido de centelleo (Optiphase “Hisafe” 3 de Wallac
(Turku, Finlandia)) y se valoró la cantidad de [
3
H] presente en cada vial con un contador de centelleo
líquido (Wallac Guardian 1414 Liquid Scintilliation Counter). Los datos obtenidos se expresan como
desintegraciones por minuto (dpm).

2.3.- Tinción de células con Ioduro de Propidio para análisis del ciclo
celular por citometría de flujo

Se sembraron las células a una densidad de 2 x10
5
células por pocillo. Una vez realizados los
tratamientos se tripsinizaron y centrifugaron a 2000 g durante 5 min. A continuación se resuspendieron en
una solución de Nonidet P-40 (Roche Diagnostic Corporation, Indianapolis, USA) al 0.1% y 0.5 mg/ml
RNAsa (Rochester, NY, USA) durante 30 min en completa oscuridad, y transcurrido ese tiempo se
incubaron durante 5 min con 0.05 mg/ml de ioduro de propidio (IP) (Calbiochem USA). Posteriormente se
realizaron las medidas de fluorescencia mediante citometría de flujo (FACSCalibur de Becton Dickinson).
Los porcentajes de las células en diferentes fases del ciclo celular, así como las células hipodiploides
(sub G1), que corresponden a células muertas, se calcularon a partir de los histogramas de contenido de
DNA, utilizando el programa WinMDI 2.8.

2.4.- Unión de Ioduro de Propidio y Anexina V-FITC

Se empleó el kit comercial Annexin V-FITC apoptosis detection kit (BD, Nueva Jersey). Se
sembraron las células en placas de seis pocillos con una densidad de 2 x10
5
células por pocillo. Una vez
realizados los tratamientos, se tripsinizaron las células y se centrifugaron a 400 g durante 5 min y se
resuspendieron con 0.5 ml de tampón de unión frío 1X (Hepes 0.1 M /NaOH, pH 7.4, NaCl 1.4 M, CaCl
2

Materiales y Métodos

55

25 mM). Posteriormente se añadió a cada muestra 5 μl de Anexina V conjugada con isotiocianato de
fluoresceína (FITC) y 5 μl de IP, incubándose 15 min a temperatura ambiente en oscuridad.
Posteriormente se añadieron 400 μl de tampón de unión frío y seguidamente se analizaron las muestras
mediante citómetro (FACSCalibur de Becton Dickinson).

2.5.- Tinción de núcleos con DAPI

Las células PC-3 se sembraron en cubreobjetos de cristal (12 mm de diámetro) dentro de placas de
6 pocillos a una densidad de 1x10
5
células por pocillo. Tras el tratamiento, los cubreobjetos se lavaron 3
veces en PBS y se fijaron las células con paraformaldehído 3.7% en PBS, durante 5 min a temperatura
ambiente. Se realizaron otros dos lavados en PBS y se permeabilizaron con Tritón X-100 ( Sigma, St.
Louis, MO, USA) al 0.05% en PBS durante 5 min. Posteriormente se lavaron las células de nuevo con
PBS y se realizó la incubación con 1 μg/ml del fluorocromo DAPI (4´, 6´-diamidino-2-fenilindol)
(Calbiochem, La Jolla, USA) en PBS durante 20 min a temperatura ambiente y en oscuridad. Por último,
se lavaron los cubreobjetos con PBS, se realizó el montaje de la preparación con la solución
Vectashield® (Vector Laboratories, Burlingame, CA, USA) y se observó mediante microscopio de
fluorescencia.

2.6.- Medida de niveles de ceramida

2.6.1 Extracción de lípidos

Las células se sembraron en placas P-100 con una densidad de 1x10
6
células/placa. Al finalizar los
tratamientos, las células se rasparon con PBS se centrifugaron a 400 g durante 5 min. Se retiró el PBS y
se congeló el sedimento a –80 ºC. Posteriormente se añadió un volumen de 600 μl de agua destilada a
cada muestra, se resuspendió el sedimento y se sonicaron las muestras durante 10 s a temperatura
ambiente.

La extracción se realizó en un volumen de 500 μl, dejando el resto para la valoración de la
concentración de proteínas totales. Se añadieron 2.5 ml de una mezcla de cloroformo:metanol (2:1, v:v) a
cada muestra y posteriormente se agitaron los tubos durante 5-10 s hasta que la mezcla quedó
emulsionada. Se centrifugaron los tubos a 1000 g durante 10 min.

Materiales y Métodos

56

Se recogió la fase inferior (donde se encuentran los lípidos celulares) y posteriormente estas
muestras fueron evaporadas con nitrógeno gaseoso para evitar la oxidación lipídica. Las muestras se
guardaron a -20 ºC hasta su valoración.

2.6.2 Cuantificación de ceramida

La cuantificación de los niveles de ceramida se llevó a cabo según el método de DAG quinasa (Van
Veldhoven et al., 1992), basado en la detección de la fosforilación de las ceramida por la enzima DAG
quinasa que convierte a las ceramida presentes en ceramida-1-fosfato utilizando γ[
32
P]ATP como
sustrato.

Los extractos lipídicos se resuspendieron en 40 μl de una solución detergente (di-oléoil-fosfatidil-
glicerol/octal-beta-glucósido), se agitaron y se sonicaron en un baño durante 10 min. Posteriormente se
añadió la enzima DAG quinasa de E.coli (Calbiochem, La Jolla, USA) a una concentración de 0.1 mg/ml,
en presencia de 0.4 μCi de γ[
32
P]ATP (Perkin Elmer, Massachussets, USA) y se incubaron las muestras a
temperatura ambiente durante 30 min. Para parar la reacción, se añadió a cada muestra 250 μl de ácido
perclórico 1 %, 400 μl de cloroformo y 400 μl de metanol, se agitaron las muestras y posteriormente se
centrifugaron a 594 g durante 10 min. Se recogió la fase inferior a la que se añadió 400 μl de ácido
perclórico/metanol (7:1 v:v) y se volvió a centrifugar durante 10 min a 594 g, recogiendo la fase inferior
donde se encuentran los lípidos fosforilados. Esta fase se evaporó mediante nitrógeno gaseoso y
posteriormente se resuspendió en 30 μl de cloroformo/metanol (2:1 v:v). Las muestras se separaron por
cromatografía en capa fina (TLC). Para ello, se aplicaron en una placa de silicagel TLC (Whatman, New
Jersey, USA) efectuándose la migración en el sistema cloroformo/acetona/metanol/ácido acético/agua
(50:20:15:10:5, v:v:v:v:v). Al finalizar la TLC, los lípidos se localizaron por exposición a una película
radiográfica, durante toda la noche. Después de revelar la película, las bandas correspondientes a la
ceramida-1-fosfato fueron raspadas y se valoró la cantidad de [
32
P]ATP incorporado mediante la adición
de 2.5 ml de líquido de centelleo (Optiphase “Hisafe” 3 de Wallac (Turku, Finlandia)) utilizando un
contador de centelleo líquido (Wallac Guardian 1414 Liquid Scintilliation Counter).

La cantidad de ceramida se calculó en picomoles (pmol) refiriendo las cpm a un control interno. Los
datos se expresan como porcentaje de pmol de ceramida por mg de proteína de la muestra.

Materiales y Métodos

57

2.7.- Determinación de niveles de IL-6

La cuantificación de los niveles de IL-6 fue realizada en los sobrenadantes de las células en cultivo
por ensayo ELISA (ensayo inmunoabsorbente ligado a enzima) tipo sandwich, siguiendo las instrucciones
del fabricante (Diaclon Reserche, Besaçon, Francie). Se sembraron las células en placas de 24 pocillos a
una densidad de 1x10
4
células por pocillo. Tras los diferentes tratamientos, los sobrenadantes celulares
fueron recogidos y diluidos en PBS.

Se incubaron los sobrenadantes celulares durante una hora en una placa de 96 pocillos
MaxiSorp™ (Nunc
TM
, Roskilde, Dinamarca), previamente cubierta con anticuerpo anti-IL-6 humana. Tras
lavar la placa con PBS conteniendo 0.05 % de Tween 20, ésta fue incubada con anti-IL-6 biotinilado
durante una hora a temperatura ambiente. Se lavó la placa con PBS-Tween y se incubó con la enzima
peroxidasa de rábano (HRP) conjugada con estreptavidina durante 20 min a temperatura ambiente.
Posteriormente se lavaron las placas y se incubaron con el sustrato de HRP, TMB (3,3´,5,5´-
tetrametilbenzidina), durante 10 min. La reacción se detuvo al añadir 1M H
2
SO
4,
y se midió la absorbancia
a 450 nm en un espectrofotómetro de placas (ELX 800 Bio-Tek Intruments, INC).

En algunos de los ensayos se empleó IL-6 recombinante de humano procedente de Prepotech
(Paris, France).

2.8.-Determinación de niveles de IL-17

2.8.1 Aislamiento de células mononucleares

Para la obtención de células mononucleares se extrajo sangre periférica de voluntarios sanos, y se
realizó una separación en gradiente de densidad con ficoll. La muestra de sangre se diluyó 1:1 con suero
fisiológico y se pipeteó cuidadosamente medio volumen de Lymphoprep
TM
(compuesto por ficoll y metrizoato
sódico) en la base de esta dilución, de forma que se generó un lecho de Lymphoprep sobre el que
descansaba la sangre diluida. Se centrifugó sin freno a 4 ºC durante 5 min a 49 g incrementando
posteriormente la aceleración de forma secuencial, primero a 194 g 10 min, y por último a 292 g 30 min. Se
obtuvo de esta forma un gradiente de ficoll en el que se distribuyeron las células sanguíneas atendiendo a su
diferente densidad. Se recogió la fracción mononuclear y se lavaron dos veces las células con suero

Materiales y Métodos

58

fisiológico, centrifugando 10 min a 304 g cada vez. El sedimento de células se resuspendió en medio RPMI
con 10 % de suero y se sembraron las células en una placa de 24 pocillos a una densidad de 5 x10
5
células
por pocillo

2.8.2 ELISA de IL-17

La cuantificación de los niveles de IL-17 fue realizada en los sobrenadantes de las células
mononucleares mediante ensayo ELISA, siguiendo las instrucciones del fabricante (Diaclon Reserche,
Besaçon, France). Las células mononucleares fueron sometidas a distintos tratamientos, tras lo cual los
sobrenadantes celulares fueron recogidos y congelados.

Se incubaron los sobrenadantes celulares durante dos horas en una placa de 96 pocillos
MaxiSorp™ (Nunc
TM
, Roskilde, Dinamarca), previamente cubierta con anticuerpo anti-IL-17 humana. Tras
lavar la placa con PBS conteniendo 0.05 % de Tween 20, ésta fue incubada con anti-IL-6 biotinilado
durante una hora a temperatura ambiente. Se lavó la placa con PBS-Tween y se incubó con la enzima
HRP conjugada con estreptavidina durante 20 min a temperatura ambiente. Posteriormente se lavaron las
placas y se incubaron con el sustrato de HRP, TMB, durante 10 min. La reacción se detuvo al añadir
H
2
SO
4
1M y se midió la absorbancia a 450 nm en un espectrofotómetro de placas (ELX 800 Bio-Tek
Intruments, INC).

2.9.- Separación de las fracciones particulada y soluble de las células

Para la obtención de las fracciones particulada y soluble de las células PC-3 en cultivo, se
levantaron éstas de la placa con tampón de homogeneización A (Tris-HCl 50 mM, pH 7.4, 2-
mercaptoetanol 10 mM, EDTA 5 mM, EGTA 1 mM, PMSF 1 mM, STI 10 μg/ml, leupeptina 5 μg/ml y
aprotinina 5 μg/ml) mediante raspado en hielo. Posteriormente se procedió a la ruptura de la membrana
celular por sonicación en un sonicador de punta de BRANSON Sonic power company (Rochester, NY,
USA). Inmediatamente después las muestras fueron centrifugadas a 49000 g durante 1 h y 30 min a 4 ºC
y posteriormente se recogió, por una parte el sobrenadante (que corresponde a la fracción soluble) y por
otra el sedimento (que corresponde a la fracción particulada). El sedimento se resuspendió en tampón de
homogeneización A y se homogeneizó por pipeteo o sonicación. Ambas fracciones se almacenaron a –80
ºC hasta su utilización.

Materiales y Métodos

59

2.10.- Separación núcleo / citosol

Las células se sembraron en placas petri y, tras los diferentes estímulos, se tripsinizaron con 2 ml
de tripsina y se centrifugaron a 329 g. Se lavaron con 5 ml de PBS frío, se resuspendieron en 1 ml de
tampón A (Hepes 10mM pH7.9, MgCl
2
1.5 mM,

KCl 10 mM, DTT 1mM, PMSF 0.5 mM, NaF 5 mM,
leupeptina 2 μg/ml, aprotinina 10 μg/ml, PMSF 0.1 mM) y se lavaron tres veces con este tampón,
centrifugando cada vez 2 min a 329 g a 4 º C. El precipitado se lisó con 100 μl de tampón de lisis A con
NP-40 0.5% durante 30 min en hielo. Las muestras se centrifugaron a 16060 g durante 10 min a 4 ºC. Se
recogió en este punto el sobrenadante como extracto citosólico, se lavaron las muertas con 1 ml de
tampón A y se centrifugaron a 16060 g durante 5 min a 4 º C. El sedimento se resuspendió en 40 μl de
tampón C (Hepes 20mM, NaCl 420mM, MgCl
2
1.5 mM
,
DTT 1mM, glicerol 25% (v/v), NaF 5 mM,
leupeptina 2 μg/ml, aprotinina 10 μg/ml, PMSF 0.1 mM) y se congeló a -20º C. Las muestras se
descongelaron a 4º C y se centrifugaron a 16060 g 15 min a 4º C. El sobrenadante se recolectó como
extracto nuclear.

2.11.-Cuantificación de proteínas

Para la obtención de proteínas totales de las células PC-3 en cultivo, se levantaron las células de la
placa con tampón de homogeneización B (Tris-HCl 50 mM, pH 7.4, Tritón X-100 20%, Na
3
V0
4
1 mM, β-
glicerofosfato 10 mM, NaF 5 mM, leupeptina 2 μg/ml, aprotinina 10 μg/ml, PMSF 0.1 mM) mediante el
raspado en hielo. Posteriormente, las muestras recogidas se dejaron a 4 ºC durante al menos 30 min.
Inmediatamente después se centrifugaron a 16600 g durante 15 min a 4ºC, recogiendo el sobrenadante,
donde se encuentran las proteínas del lisado celular.
La cuantificación de proteínas se realizó en estos extractos mediante el método de Bradford
(Bradford, 1976) utilizando un reactivo comercial de BioRad (Richmond, CA, USA) y una curva estándar
de 1-20 μg/μl de BSA.







Materiales y Métodos

60

2.12.- Electroforesis en gel de poliacrilamida-SDS e inmunodetección
de proteínas

Se pipetearon 10-30 μg de proteína de las diferentes fracciones y se sometieron las muestras a
desnaturalización por calor a 95 ºC durante 5 min en un tampón de carga, SBL [(Sample Buffer Laemmli)
(Tris 0.06 M, pH 6.8, SDS 2 %, glicerol 10 %, β-mercaptoetanol 5 %, azul de bromofenol 0.001 %)]. Las
muestras se cargaron en geles al 10 % ó 12 % de acrilamida/bisacrilamida, dependiendo de la proteína a
detectar, en condiciones desnaturalizantes (PAGE-SDS) y fueron sometidas a electroforesis de tipo
vertical en un sistema de BioRad (Richmond, CA, USA) a 100 V y temperatura ambiente. El tampón de
electroforesis que se utilizó estaba compuesto por Tris 25 mM, pH 8.3, Glicina 0.2 M y SDS 0.1%. Se
utilizaron marcadores de bajo peso molecular de BioRad Laboratories (Richmond, CA, USA).

Tras la separación electroforética de las proteínas, se transfirieron a una membrana de
nitrocelulosa de BioRad (Richmond, CA, USA), mediante la aplicación de un campo eléctrico de 100 V
durante 2 h en tampón de transferencia (Tris 25 mM, Glicina 192 mM y Metanol 20 %) a 4 ºC. Finalizada
la transferencia, para bloquear los sitios de unión inespecíficos a la membrana, ésta se incubó durante 1
h y 30 min a temperatura ambiente con tampón PBS-Tween al 0.01% que contenía leche desnatada en
polvo al 5 %. Posteriormente, las membranas se incubaron con el anticuerpo primario específico de la
proteína a estudiar, diluido con el mismo tampón, durante toda la noche a 4 ºC. Se realizaron dos lavados
rápidos de las membranas y se incubaron con el anticuerpo secundario correspondiente conjugado con
peroxidasa durante 1 h a temperatura ambiente. Por último, se realizaron cinco lavados de 5 min y se
procedió al revelado de la señal utilizando sustrato quimioluminiscente ECL
TM
(Millipore, Billerica,
Massachusetts). Tras un breve tiempo de exposición, se revelaron las autoluminografías. Las placas
fotográficas utilizadas fueron Hyperfilm
TM
ECL de Amersham Biosciences (Buckinghamshire, Reino
Unido). El análisis densitométrico de las bandas obtenidas se realizó con el programa Scion Image (Scion
Corporation, Maryland, USA). Los datos se refieren a la cantidad de tubulina, utilizada como control de
carga de cada pocillo.






Materiales y Métodos

61

Los distintos anticuerpos utilizados, se detallan a continuación:

ANTICUERPO Naturaleza Casa comercial
Actina monoclonal Oncogene
p-AKT(Trh308) policlonal Cell signaling
p-AKT(Ser 473) policlonal Cell signaling
p- eIF2α policlonal ABCAM
eIF2α monoclonal ABCAM
p-ERK monoclonal Santa Cruz
ERK2 policlonal Cell Signaling
p-JNK monoclonal Cell Signaling
JNK policlonal Cell Signaling
Caspasa 8 monoclonal Cell Signaling
Caspasa 9 monoclonal Santa Cruz
Citocromo c monoclonal BD Laboratories
p-P38 monoclonal Cell signaling
P38 policlonal Cell signaling
P65 policlonal Santa Cruz
pIκBα monoclonal Cell signaling
IκBα policlonal Santa Cruz
pIKK α/β policlonal Cell signaling
IKK β policlonal Santa Cruz
Nucleoporina monoclonal BD Laboratories
p-STAT3 monoclonal Santa Cruz
STAT3 monoclonal Santa Cruz
α-Tubulina monoclonal SIGMA
Tubulina monoclonal SIGMA

Como anticuerpos secundarios se utilizaron los siguientes anticuerpos conjugados con peroxidasa:
IgG anti-mouse de Sigma (St. Louis, USA), IgG anti-rabbit (Calbiochem, USA) e IgG anti-goat de Santa
Cruz Biotecnology ( Santa Cruz, CA, USA).


Materiales y Métodos

62

2.13.- Silenciamiento con RNA de interferencia

La tecnología del silenciamiento con RNA de interferencia (siRNA) permite inhibir específicamente
la expresión de proteínas al transfectar las células con oligonucleótidos de un número bajo pares de
bases que se unen al RNA mensajero (mRNA) específico y producen su degradación (Fire et al., 1998).

Para la realización de estos experimentos, se sembraron 2x10
5
células/pocillo en placas P-6. Al día
siguiente se procedió a realizar la transfección con los siRNAs correspondientes, que fueron sintetizados
in vitro empleando el sistema de construcción Ambion Silencer
TM
(Ambion, Austin, USA). Se comprobó en
la base de datos del genoma humano mediante el programa BLAST (www.ncbi.nlm.nih.gov), que los
oligonucleótidos prediseñados no presentaban semejanza con otros genes del genoma. En la tabla se
recogen las secuencias de oligonucleóticos diseñados contra CB
2
, ceramida quinasa e IKKβ:

Proteína Sentido 5´-3 Antisentido 5´-3
CB2 GGCCUCUUCCCAAUUUAAAtt UUUAAAUUGGGAAGAGGCCtc.
Ceramida quinasa UGCCUGCUCUGUGCCUGUAdTdT UACAGGCACAGAGCAGGCAdTdT
IKKβ GACUGGAGCUGGUUACAGAtt UCUGUAACCAGCUCCAGUCta

Como control de las transfecciones se usaron siRNAs con la misma secuencia del siRNA pero con
las bases desordenadas (scrambled). En este caso también se comprobó mediante el programa BLAST
que no afectaban a ningún gen del genoma humano.

Primero se diluyeron los oligonucleótidos del gen específico en medio Optimen (Invitrogen, Paisley,
UK) al que posteriormente se añadió una solución de Optimen más lipofectamina 2000 (Invitrogen,
Paisley, UK) y la mezcla se incubó durante 20 min a temperatura ambiente. Después de lavar las células
dos veces con PBS se añadió la mezcla de transfección con una concentración final de siRNAs de 100
nM.

Se incubaron las células toda la noche en estufa a 37 ºC y 5 % CO
2
y al día siguiente se retiró el
medio de transfección, se lavaron las células con PBS y se añadió 1 ml de medio RPMI con 10 % de
FBS. Después de la transfección, las células se dejaron crecer en condiciones normales durante 48 ó 72

Materiales y Métodos

63

h según el experimento, para permitir la inhibición de la expresión de la proteína. Posteriormente se
realizaron los tratamientos correspondientes.

2.14.- Aislamiento de RNA

La extracción de RNA de las células en cultivo se realizó con el kit comercial TriReagent
TM
(Sigma,
St. Louis, MO, USA). Tras los distintos tiempos de tratamiento de las células, se retiró el medio y se
añadió 1ml de TriReagent
TM
por cada placa P-100. El lisado resultante se pasó a un tubo de 1.5 ml al que
se añadió 0.2 ml de cloroformo. Tras agitar durante 15 s se dejó a temperatura ambiente durante 10 min.
La mezcla se centrifugó a 12000 g durante 15 min a 4º C. Se recogió cuidadosamente la fase acuosa y
se añadió 0.5 ml de isopropanol, se dejó durante 5-10 min a temperatura ambiente y posteriormente se
centrífugo a 12000 g durante 10 min a 4º C. El precipitado se lavó con 1 ml de etanol al 75 % y se volvió a
centrifugar a 10000 g durante 5 min a 4º C. Finalmente el precipitado se secó y se resuspendió en agua
libre de RNAsas.
A continuación se determinó la cantidad y la calidad del RNA midiendo la absorbancia de la
muestra a 260 nm y 280 nm. Para el cálculo de la concentración de RNA se consideró que una unidad de
absorbancia a 260 nm corresponde a 44 μg/ml de RNA. El grado de pureza del RNA extraído se estimó
calculando la relación 260/280; esta relación debe ser superior a 1,8 para trabajar con muestras puras.
Además se analizó su integridad mediante electroforesis en gel de agarosa.

2.15.- Retrotranscripción (RT)

Se realizó la retrotrascripción con 50 ng de mRNA, al que se añadió 1 μl de Random Hexamers
(Promega, Madison, USA) llevándose la mezcla a un volumen final de 15 μl. Se incubaron las muestras a
70ºC durante 5 min y luego se enfriaron a 4 ºC, para eliminar posibles estructuras secundarias negativas
para la reacción. Posteriormente se añadió la mezcla de retrotranscripción formada por:
Tampón de reacción (M-MLV buffer 5x) (Promega, Wisconsin, USA): 5 μl.
DNTPs (AB gene, Surrey, UK): 1,25 μl de un stock de 20mM.
Inhibidor de RNAasa (Promega, Wisconsin, USA): 0,75 μl de un stock de 40 U/μl.
Agua DEPC: 2.5 μl
M-MLV RT (Moloney Murine Leukemia Virus Retrotranscriptase) (Promega, Wisconsin-USA): 0,5 μl
de un stock de 200 U/μl.

Materiales y Métodos

64

El volumen final de la reacción fue de 25 μl.
Posteriormente la reacción se incubó en un termociclador (AB 7500 Fast), programado a 37 ºC
durante una hora dejándose durante 3 min a 90 ºC para que se inactivara la enzima. Por último se
cuantificó la cantidad de DNA sintetizado en el fotómetro Nanodrop® (Wilmington, USA).

2.16.-PCR a tiempo real (RT-PCR ó qPCR)

La PCR cuantitativa a tiempo real se realizó siguiendo el método de SYBR Green (Applied
Biosystems, Foster City, USA). Se utilizó 5 μl de una dilución 1/100 del producto de reacción de la
retrotranscripción, añadiéndose la siguiente mezcla de reacción:

2X SYBR
®
Green PCR Master Mix

(Applied Biosystems, Foster City, USA): 10 μl
Primers (forward/reverse 10 μM): 1.4 μl
MgCl2 (50 mM): 0.4 μl
Agua DEPC: 1.8 - 4.8 μl

Las secuencias de los oligonucleótidos que fueron elegidas como cebadores para la amplificación
del gen de IL-6 fueron las siguientes:

Proteína Sentido 5´-3 Antisentido 5´-3
IL-6 CACTGGCAGAAAACAACC AACTCCAAAAGACCAGTGAT

Para amplificar los genes, se introdujeron las muestras en el termociclador (AB 7500 Fast, Applied
Biosciences) con las siguientes condiciones:
95 ºC durante 10 s
40 ciclos de 94 ºC 3 s, 60 ºC 40 s
95 ºC durante 15 s
60 ºC durante 1 min
95 ºC durante 15 s


Materiales y Métodos

65

Para visualizar y comprobar el tamaño de los productos de la PCR, se realizó una electroforesis del
producto de la reacción en gel de agarosa al 1 %. Las bandas se observaron por la exposición a la luz
U.V. del gel previamente teñido con bromuro de etidio.
La cuantificación relativa de los genes de interés se calculó usando el método de comparación de
los valores Ct (ciclo umbral), dónde Ct se define como el número de ciclo a partir del cual el producto es
detectado por fluorescencia o el ciclo a partir del cual comienza la amplificación de manera exponencial.
Para ello se usó la siguiente fórmula:
2
-∆∆Ct


Siendo ∆∆Ct igual a ∆Ct muestra problema menos ∆Ct muestra control y ∆Ct, la diferencia entre
Ct obtenido en la amplificación del gen objeto de estudio en la muestra y un gen constitutivo de la misma
muestra frente al cual se normaliza la cuantificación, en este caso el gen de la actina.

2.17.- Ensayo de inmunoprecipitación de la cromatina (CHIP)

La inmunoprecipitación de la cromatina es una técnica que permite analizar si una proteína
concreta se une a una secuencia específica del DNA. Consta de cuatro pasos diferentes que se
desglosan a continuación.

2.17.1 Fijación de la unión DNA-proteína y fragmentación del DNA

Las células se sembraron en un frasco de cultivo de 75 mm
2
y se incubaron con los diferentes
tratamientos. Cuando alcanzaron el 70-80 % de confluencia se fijó la unión del DNA a las proteínas
asociadas añadiendo paraformaldehído al 1% durante 10 min a temperatura ambiente. Se lavaron dos
veces las células con PBS y se rasparon en tampón de lisis (Tris-HCl 50 mM, pH 8.1, SDS 1%, EDTA 10
mM, PMSF 1 mM, leupeptina 1 μg/ml, aprotinina 1 μg/ml). Tras 10 min de incubación a 4 º C, se
sonicaron las muestras 10 veces durante 30 min, a intervalos de al menos 40 min. Se centrifugaron a
13684 g a 4 ºC. Se recogió el sobrenadante y se diluyó cinco veces en tampón de dilución (Tris-HCl 20
mM, pH 8.1, Tritón X-100 1%, EDTA 2 mM, NaCl 150 mM).




Materiales y Métodos

66

2.17.2 Inmunoprecipitación

Se añadieron 2 μg de DNA de esperma de salmón (Sigma, St. Louis, USA) y 25 μl de bolitas de
sefarosa diluidas al 50% y se prelavaron las muestras 2 h a 4 ºC. Se centrifugaron las muestras a 1520 g
durante 5 min a 4 ºC. Se tomaron 500 μl de sobrenadante que se incubó con 1 μg de anticuerpo anti
NFκB p65 durante toda la noche a 4 ºC. 20 μl fueron reservados como control. Los complejos inmunes
fueron capturados por incubación durante 1 h a 4ºC con 2 μg de DNA de esperma de salmón y 25 μl de
bolitas de sefarosa diluidas al 50%. Se centrifugaron las muestras a 1520 g 5 a 4 ºC, se lavó el
precipitado y se centrifugó a 1520 g cada vez, durante 5 min secuencialmente con los siguientes
tampones: TSE 1 (Tris-HCl 20 mM, pH 8.1, SDS 0.1%,Triton X-100 1%, EDTA 2 mM, NaCl 150 mM), TSE
2 (Tris-HCl 20 mM, pH 8.1,SDS 0.1%, Tritón X-100 1%, EDTA 2 mM, NaCl 500 mM), tampón 3 (Tris-HCl
10 mM, pH 8.1, LiCl 0.25 M, Nonidet P-40 1%, desoxicolato 1%, EDTA 1 mM,) y tampón TE (Tris-HCl
10mM, EDTA 1mM). Finalmente se eluyeron los complejos inmunes con 500 μl de tampón de elución
(SDS 1%, NaHCO
3
0.1 M) durante 30 min a temperatura ambiente. Las muestras se centrifugaron a 1520
g 5 min a temperatura ambiente y se recuperó el sobrenadante. La unión proteína-DNA se revirtió
incubando los sobrenadantes a 65 ºC toda la noche. En este punto también se incubó el control.

2.17.3 Aislamiento del DNA

El DNA se aisló por extracción en fenol-cloroformo-isoamílico del siguiente modo:
Se añadió 1 μl de glicógeno y un volumen de fenol-cloroformo-isoamílico (1:1:0.02), agitándose
durante 30 seg. Las muestras se centrifugaron a 16060 g durante 5 min a 4 ºC. Se recogió la fase acuosa
y se precipitó añadiendo 0.1 volúmenes de AcNa 3M pH 5.2 y 2 volúmenes de EtOH 100% e incubando al
menos 2 h a -20 ºC. Las muertas se centrifugaron a 16060 g durante 15 min a 4 ºC y se lavó el sedimento
con EtOH 70%. Se centrifugó a 16060 g durante 15 min y el sedimento fue disuelto en 20-50 μl de agua.

2.17.4 Cuantificación de las muestras

Se emplearon 5 μl del DNA aislado de las muestras inmunuprecipitadas y 2 μl del control como
molde en una reacción de qPCR realizada tal y como se describe en el apartado 2.16. Se utilizaron
oligonucleótidos correspondientes a una secuencia de unión a NFκB del promotor de IL-6, previamente
descrita (Shimizu et al., 1990; Gruss et al., 1992). Se comprobó mediante el uso de bases de datos de

Materiales y Métodos

secuencias de DNA (http://www.genomatix.de/cgi-bin/matinspector_prof/mat_fam.pl) que esta secuencia
era un sitio de unión NFκB. Las secuencias de los oligonucleótidos que fueron elegidas como cebadores
fueron las siguientes:


Proteína Sentido 5´-3 Antisentido 5´-3
IL-6 CCCCACCCTCACCCTCCAACAA TGAGCCTCAGACATCTCCAGTCCT

2.18.-Experimentación animal

2.18.1 Animales

Se utilizaron ratones macho atímicos nu/nu (BALB/cOlaHsd-Foxn1
nu
) de seis semanas de edad
(Harlan Ibérica, Barcelona, España). Al no poseer timo o ser este rudimentario, estos animales tienen una
deficiencia de células T (Pantelouris, 1968) presentando una falta de respuesta inmune dependiente del
timo, lo que permite que puedan ser receptores de tumores humanos.
Estos animales fueron mantenidos en una zona de cuarentena en el Centro de Experimentación
Animal de la Universidad de Alcalá, con ciclos constantes de luz/oscuridad de 12 h.
Los estudios fueron realizados en concordancia con la regulación española para el uso y cuidados
de los animales de experimentación y según las directrices de la Unión Europea relacionadas con la
investigación animal (Real Decreto 223/1988 del 14 de Marzo).

2.18.2 Inducción de tumores

A los ratones se les inyectó subcutáneamente en el flanco derecho, 0,2 ml de medio completo con
2 x 10
6
células PC-3. Aproximadamente a las 4 semanas el tumor alcanzó un tamaño de 70 mm
3
. Los
ratones fueron divididos en 3 grupos experimentales con 8 animales cada uno, los cuales recibieron los
siguientes tratamientos diariamente con inyecciones subcutáneas: grupo A, salino (control); grupo B, 1.5
mg/kg b.w (peso corporal) de JWH015; grupo C, 1.5 mg/kg b.w de JWH015 y 1.5 mg/kg b.w de SR2. Para
preparar la solución de inyección, los compuestos fueron inicialmente disueltos en etanol a una
concentración de 25 mM de JWH015 y 17.2 mM de SR2, y posteriormente disueltos en suero salino hasta
la concentración deseada. La concentración final de etanol inyectada a los animales fue del 5%. Los
67


Materiales y Métodos

68

controles fueron tratados con suero salino al 5% de etanol. La inyección fue repetida diariamente en un
tratamiento continuado durante 15 días y el peso de los ratones fue medido cada día. El volumen del
tumor se midió con un calibrador y fue calculado con la formula
4n
3
× [
w
2
2
¸ × (
L
2
2
) , siendo W el ancho
del tumor y L la longitud del mismo.

2.18.3 Tratamiento de las muestras

Al final de los diferentes tratamientos, los animales fueron sacrificados, se extrajeron los tumores y
se obtuvo el suero.

2.19.-Análisis estadístico

El análisis estadístico de todos los datos se realizó con el programa informático GraphPad Prism de
GraphPad Software Inc. Los valores están indicados como la media ± error estandar. El análisis
estadístico se realizó mediante la t de Student, al comparar dos valores entre los que sólo varía un
parámetro y el resultado se consideró significativo cuando p< 0.05 ó p< 0.01 dependiendo de los
ensayos.


Resultados

































RESULTADOS








Resultados

1.- EFECTO DE MET Y JWH015 SOBRE EL CRECIMIENTO
Y MUERTE CELULAR


Para conocer el efecto in vitro de los cannabinoides sobre las células tumorales de próstata, se
analizó el efecto de MET, un análogo de AEA y agonista tanto del receptor de cannabinoides CB1
como del receptor CB2 y de JWH015, un agonista selectivo de CB2, sobre el crecimiento de la línea
PC-3. En primer lugar se determinó el posible efecto de MET y JWH015 sobre la viabilidad celular. Para
ello se trataron las células PC-3 durante distintos tiempos con ambos cannabinoides a concentración
10 μM y se valoró la viabilidad celular por ensayo MTT. El MTT es un ensayo colorimétrico que
determina la actividad metabólica de las células valorando su capacidad para reducir la sal de tetrazolio
MTT a un compuesto de color azul oscuro denominado formazán, por las deshidrogenasas
mitocondriales en las células vivas (Slater et al., 1963). Así pues, este ensayo permite valorar la
viabilidad celular. En la figura 17 vemos la cinética del tratamiento, que muestra una disminución de la
viabilidad celular a partir de las 12 h, aunque el efecto máximo se da a las 48-72 h. MET induce una
disminución acusada de la viabilidad celular, llegando a disminuir hasta un 20% a la dosis y el tiempo
más elevado. JWH015 no sobrepasó el 50% de inhibición de la viabilidad al máximo tiempo de estudio.
A la vista de estos datos se continuó el estudio usando 48 h como tiempo óptimo de tratamiento.
71

Figura 17. Efecto de MET y JWH sobre la viabilidad celular en el tiempo. A) Las células PC-3 fueron incubadas con 10
μM MET a diferentes tiempos, y la viabilidad celular fue medida por MTT tal y como se describe en Materiales y Métodos. B)
Las células PC-3 fueron incubadas con 10 μM JWH015 a diferentes tiempos, y la viabilidad celular fue medida por MTT. Los
resultados se expresan como porcentaje frente al control, que se consideró el 100 %. Los datos son medias + E.S. de tres
ensayos diferentes realizados por triplicado, ** p< 0.01 comparando frente al control mediante la t de Student.


Horas
0 20 40 60
%

V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r
0
40
60
80
100
JWH015
** **
Horas
0
20
40
60
80
100
0 20 40 60
%

V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r
MET
**
**
A) B)
JWH015

Resultados

Una vez establecido el tiempo al cuál los cannabinoides inhibían la viabilidad celular, se pasó a
estudiar el efecto de la dosis. Para ello se trató a las células con dosis crecientes de MET o JWH015
durante 48h y se midió la viabilidad celular por ensayo MTT. Como se observa en la figura 18, existe
una respuesta dependiente de la dosis de cannabinoides, disminuyendo la viabilidad celular de forma
significativa a dosis del orden micromolar, de nuevo de forma más acusada con la MET. En el caso del
72

Figura 18. Efecto dosis-dependiente de MET y JWH015 sobre la v
incubadas con distintas concentraciones de MET durante 48 h y la viabilidad ce
iabilidad celular. A) Las células PC-3 fueron
lular fue medida por MTT tal y como se
describe en Materiales y Métodos. B) Las células PC-3 fueron incubadas con distintas concentraciones de JWH015
dur
que
ante 48 h, y la viabilidad celular fue medida por MTT. Los resultados se expresan como porcentaje frente al control,
se consideró el 100 %. Los datos son medias + E.S. de tres ensayos diferentes realizados por triplicado, * p< 0.05
y ** p< 0.01 comparando frente al control con la t de Student.
JWH015 el efecto máximo no sobrepasó el 50 % de inhibición.
na
efe
ba
tenía un efecto citoestático sobre las células de próstata.
0
20
40
60
80
100
120

Para determinar si también se producía un efecto sobre la proliferación celular, se valoró la
incorporación al DNA de [
3
H]-timidina. Para ello se incubaron las células durante 48 h con MET 10 μM
ó JWH015 10 μM y 16 h antes de parar el ensayo (tiempo suficiente para que se dé una replicación
celular) se añadió 1μCi/pocillo de [
3
H]-timidina. Una vez finalizado el ensayo se procedió a medir la
cantidad de tritio incorporado en las células. En la figura 19 vemos que los cannabinoides inducen un
efecto sobre la proliferación celular dependiente de la dosis, aumentando ésta a dosis del orden
bien documentado (Pacher et al., 2006; Pisanti et al., 2009b). A partir de la dosis 10 μM, sin embargo,
se observó una inhibición total del crecimiento. El hecho de que JWH015 sólo inhibiera el 50% de la
viabilidad celular, mientras que bloqueaba totalmente la síntesis de DNA, hacía suponer que JWH015
nomolar y ocurriendo una fuerte disminución con dosis más elevadas, del rango micromolar. Este
cto bifásico sobre el crecimiento celular según la dosis empleada, induciendo crecimiento celular a
jas dosis e inhibiéndolo a dosis más elevadas, es un comportamiento típico de los cannabinoides
JWH-015, μM
0 5 10 15 20 25
%

V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r
0
40
60
80
100
120
*
**
**
MET, μM
%

V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r
**
**
**
A) B)
0 5 10 15 20 25

Resultados

0
100x10
3
200x10
3
300x10
3
400x10
3
500x10
3
600x10
3
73

Figura 19. Efecto dosis-dependiente de MET y JWH sobre la división celular. A) Las células PC-3 fueron
incubadas con distintas concentraciones de MET durante 48 h y la viabilidad celular fue medida por incorporación de
[
3
H]-timidina al DNA, tal y como se describe en Materiales y Métodos. B) Las células PC-3 fueron incubadas con
distintas concentraciones de JWH015 durante 48 h y la viabilidad celular fue medida por incorporación de [
3
H]-timidina.
Los datos son medias + E.S. de tres ensayos diferentes realizados por triplicado, ** p< 0.01 comparando frente al
control con la t de Student.


Para caracterizar este efecto citostático de los cannabinoides se tiñó el DNA de las células
jo. Este estudio permite valorar los cambios
ocurridos en la distribución de las células en las distintas fases del ciclo celular: G
0/
G
1
, en la cual las
célula
emás una inducción simultánea de apoptosis. Ambos mecanismos
estarían participando en la inhibición del crecimiento celular inducida por los cannabinoides en las
célula

con IP y se estudió el ciclo celular por citometría de flu
s presentan dos copias de DNA, S, en la cual las células están amplificando su DNA y G
2/M
, en
la que la células han replicado su contenido en DNA y presentan cuatro copias del mismo.
Simultáneamente también permite cuantificar las células no viables, que habrán sufrido daños en
su DNA y tendrán un contenido de DNA hipodiploide (sub G
o
/G
1
). Para llevar a cabo este análisis,
las células se incubaron con dosis crecientes de MET o JWH015 durante 48 h y posteriormente se
analizó el ciclo celular por citometría de flujo. De este modo se observó que ambos cannabinoides
producían un pequeño pero significativo aumento de células en sub G
0/1
a partir de la dosis de 10
μM, así como una disminución de células en fase G1, un aumento en fase de síntesis y un
incremento de G
2/
M (figura 20).

Estos datos confirmaban el efecto citoestático de los cannabinoides, dándose una parada de
ciclo en fase G
2/
M y revelaban ad
s PC-3.

MET, μM
0 5 10 15 20
I
n
c
o
r
p
o
r
a
c
i
ó
n

d
e

3
H
-
T
i
m
i
d
i
n
a
,

d
p
m
**
**
**
**
**
JWH015, μM
0
100x10
3
200x10
3
300x10
3
400x10
3
500x10
3
600x10
3
I
n
c
o
r
p
o
r
a
c
i
ó
n

d
e

3
H
-
T
i
m
i
d
i
n
a
,

d
p
m
**
**
**
**
A) B)
0 5 10 15 20

Resultados

Control MET 1 μM MET 5 μM MET 10 μM MET 20μM
A)
Apoptosis
1.08±0.43 1.36±1.03 6.21±3.52 14.26±4.51* 22.78±20.50
G0/G1
78.72±4.31 79.18±1.14 70.42±2.89 59.49±4.52* 63.13±0.82*
S
3.11±1.73 3.63±1.70 5.973±1.03 6.79±0.52* 7.99±0.66
G2/M
15.01±0.08 16.74±0.03 17.41±8.46 21.27±4.26 26.45±19*
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
IP IP IP IP IP
Control JWH015 1 μM JWH015 5 μM JWH015 10 μM JWH015 20 μM
Apoptosis
1.68±0.58 2.54±0.68 6.46±1.66* 9.63±1.00** 11.66±4.18**
G0/G1
79.664±3.66 76.38±1.44 71.82±1.79 64.94±1.44** 59.85±2.43**
S
2.48±0.57 3.09±0.40 4.20±0.87 6.01±0.25** 6.41±0.22**
G2/M
14.87±0.71 17.09±0.37 17.36±2.01 21.29±1.11** 23.05±2.69*
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
IP IP IP IP IP
B)
74


uni
tem os en la distribución lipídica de
las células, aumentando la fosfatidilserina en la cara externa de la membrana plasmática. La anexina-
V-FITC
Figura 20. Efecto de MET y JWH sobre el ciclo celular. A) Las células PC-3 fueron incubadas con distintas
concentraciones de MET durante 48 h y se analizó el ciclo celular por citometría de flujo tal y como se describe en
Materiales y Métodos. B) Las células PC-3 fueron incubadas con distintas concentraciones de JWH015 durante 48 h y
se analizó el ciclo celular por citometría de flujo. Los datos son medias + E.S de tres ensayos diferentes realizados por
duplicado, * p< 0.05 y * p< 0.01 comparando frente al control con la t de Student.
Con el fin de confirmar la inducción de apoptosis por MET y JWH015, se realizó un análisis de
ón a anexina-V-FITC. La pérdida de la asimetría de la membrana plasmática es uno de los eventos
pranos del proceso apoptótico. Cuando ocurre, se producen cambi
es una proteína marcada con un fluoróforo, que presenta afinidad por la fosfatidil serina,
permitiendo la cuantificación de células apoptóticas. Las células que han perdido la integridad de
membrana también se tiñen con IP, pudiendo discriminar así entre células en proceso de apoptosis
temprana, cuando únicamente unen anexina y células en apoptosis tardía, cuando unen tanto anexina
como IP. Tras incubar las células con distintas dosis de MET o JWH015, se procedió al análisis de la
apoptosis. En la figura 21 observamos que sólo se obtuvieron cambios significativos en la apoptosis
tardía (cuadrante superior derecho), a partir de la dosis 10 μM.

Resultados

Control  MET 1 μM MET 5 μM
MET 10 μM MET 20μΜ
Control  JWH015 1 μM JWH015 5 μM
JWH 015 10 μM JWH 015 20μΜ
5.17±0.4 4.65±0.8 6.87±1.5 8.87±0.4** 14.85±2.9**
5.60±0.3 10.30±0.9 14.15±2.0 12.90±1.7* 13.80±0.7**
I
P
I
P
Anexina V-FITC
Anexina V-FITC
A)
B)
75


Para corroborar la inducción de apoptosis, se realizó una tinción de las células con DAPI,
sonda fluorescente que se intercala en el DNA y permite observar los cambios morfológicos que se
producen en la cromatina. Cuando las células entran en apoptosis suele ocurrir una condensación
del DNA y posteriormente éste se fragmenta de forma controlada formando los llamados cuerpos
apoptóticos (Robertson et al., 2000). Como vemos en la figura 22, al tratar las células con MET 10
μM o JWH015 10 μM se observaron cambios en la morfología y tamaño nuclear, existiendo mayor
condensación de la cromatina, así como núcleos de mayor tamaño que en las células no tratadas
con cannabinoides, pero no se llegó a detectar la presencia de cuerpos apoptóticos, ni a las 48h ni a
las 72 h de tratamiento.

Figura 21. Estudio de la apoptosis por tinción con anexina-V-FITC/IP. A) Las células PC-3 fueron incubadas con
distintas concentraciones de MET (panel A) o de JWH015 (panel B) durante 48 h analizándose la apoptosis por unión
anexina-V-FITC y IP mediante citometría de flujo, tal y como se describe en Materiales y Métodos. Los datos son medias
+ E.S. de tres ensayos diferentes realizados por duplicado, * p< 0.05 y * p< 0.01 comparando frente al control con la t de
Student.

Resultados

76


a vez conocido el efecto de MET y JWH015 sobre las células PC-3, nos planteamos si éste
sería generalizado sobre otras células tumorales de próstata. Se usaron otras dos líneas de cáncer de
próstata, la línea celular andrógeno independiente DU 145 y la andrógeno dependiente LNCaP. Las
células fueron incubadas con distintas dosis de JWH015 o MET durante 48 h y la viabilidad celular se
midió por MTT. En la figura 23 vemos que ambos cannabinoides inhiben el crecimiento de todas las
líneas, pero el efecto es menos pronunciado en la línea LNCaP, que representa un cáncer de próstata
menos agresivo. Con ambos cannabinoides la disminución de la viabilidad es más acusada en las dos
líneas más agresivas, PC-3 y DU-145.




Control  JWH015 MET
48h
72h


Un
Figura 22. Efecto de MET y JWH015 sobre la morfología nuclear en células PC-3. Las células fueron incubadas con 10
μM de MET o JWH015 durante 48 h (panel superior) o 72 h (panel inferior), y transcurrido estos tiempos se tiñeron con
DAPI tal y como se describe en Material y Métodos y se observaron por microscopio de fluorescencia. La imagen es
representativa de dos experimentos independientes realizados por triplicado.

Resultados

77

2.- PAPEL DEL RECEPTOR CB2 EN EL EFECTO
ANTIPROLIFERATIVO DE LOS CANNABINOIDES


Una vez definido el efecto antiproliferativo de los cannabinoides en la línea PC-3, nos
planteamos estudiar la implicación de diversos receptores del sistema endocannabinoide en este
efecto. La MET puede unirse a tres de los receptores del sistema endocannabinoide: a los dos
receptores de cannabinoides, CB1

y CB2
,
y al receptor de vanilloides TRPV1. Para estudiar si alguno
e ellos estaba implicado en la disminución de la viabilidad celular producida por MET, se seleccionó la
dosis 10 μM de MET, y se pretrataron las células con los antagonistas de estos tres receptores: SR1
d
(antagonista de CB1), SR2 (antagonista de CB2) y CPZ (antagonista de TRPV1). Como se observa en
la figura 24, sólo se obtuvo una inhibición parcial de la disminución de la viabilidad celular al pretratar
las células con SR2.




Figura 23. Efecto antiproliferativo de MET y JWH en distintas líneas de próstata. A) Las céulas PC-3 fueron incubadas
con 10 μM MET (panel A) o JWH015 (panel B) durante 48 h y transcurrido este tiempo la viabilidad celular fue medida por
MTT tal y como se describe en Materiales y Métodos. Los resultados se expresan como porcentaje frente al control, que se
consideró el 100 %. Los datos son medias + E.S. de tres ensayos diferentes realizados por triplicado, * p< 0.05 y ** p< 0.01
comparando frente al control con la t de Student.
JWH015 (μM)
0 5 10 15 20 25
V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r

(
%
)
0
20
40
60
80
100
120
140
PC-3
DU-145
LNCap
*
**
*
** **
**
*
**
**
MET
0
20
80
00
20
40
(μM)
0 5 10
40
60
1
1
1
PC-3
DU-145
LNCap
**
**
**
*
*
**
V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r

(
%
)
15 20 25

Resultados

78


Posteriormente evaluamos la implicación del receptor CB2 en el efecto sobre la viabilidad
celular producido por JWH015. Al ser este cannabinoide agonista selectivo del receptor de
cannabinoides CB2, estudiamos únicamente la posible implicación de este receptor. Para ello se
seleccionó la dosis 10 μM de JWH015 durante 48 h y se pretrataron las células con el antagonista
Figura 24. Papel de los receptores de cannabinoides y del receptor TRPV1 en la muerte celular producida por
MET. Las células se preincubaron 30 min con los antagonistas SR1 1 μM , SR2 2 μM y capsazepina (CPZ) 1 μM, y 48
horas con MET 10μM. Transcurrido este tiempo la viabilidad celular se midió por MTT tal y como se describe en Materiales
y Métodos. Los resultados se expresan como porcentaje frente al control, que se consideró el 100 %. Los datos son
medias +
SR2. SR2 inhibió de forma significativa la disminución de la viabilidad celular producida por JWH015
(figura 25).
E.S. de dos ensayos realizados por triplicado, * p < 0.01 respecto al control y # p < de 0.01 respecto a MET con
la t de Student.
Figura 25. Implicación del receptor de
cannabinoides CB2 en la muerte celular
lar
en
Materiales y Métodos. Los resultados se
expresan como porcentaje frente al control,
que se consideró el 100 %. Los datos son
medias +
producida por JWH015. Las células se
preincubaron 30 min con el antagonista
SR2 2 μM, y 48 horas con JWH015 10μM.
Transcurrido este tiempo la viabilidad celu
se midió por MTT tal y como se describe
E.S. de dos ensayos realizados
por triplicado, * p < 0.01 respecto al control y
# p < de 0.05 respecto a JWH015 con la t de
Student.
0
20
40
60
80
C MET MET +
CPZ
CPZ
V
i
a
b
i
l
i
d
a
d

c
e
l
u
*
100
120
l
a
r

(
%
)
*
0
20
40
60
C MET MET +
SR2
SR2
V
i
a
b
i
l
i
*
80
100
120
d
a
d

c
e
l
u
l
a
r

(
%
)
*#
0
20
40
C MET MET +
SR1
SR1
V
i
a
b
i
l
i
d
60
80
100
120
a
d

c
e
l
u
l
a
r

(
%
)
*
*
20
40
120
140
V
i
a
b
i
l
i
d
)
#
60
80
100
a
d

c
e
l
u
l
a
r

(
%
*
0
C JWH
015
JWH
015 +
SR2
SR2

Resultados

79

ra 26 se obtuvo una reversión de la apoptosis producida por los cannabinoides
únicamente con el antagonista del receptor CB2.
Para confirmar el papel de los receptores de cannabinoides se llevó a cabo un análisis por
citometría de flujo de la apoptosis y del ciclo celular en las células pretratadas con los antagonistas. La
apoptosis se analizó mediante tinción con anexina-V-FITC/IP y el ciclo celular por tinción con IP. Como
se observa en la figu
Figura 26. Inhibición por SR2 de la apoptosis inducida por cannabinoides. A) Las células se preincubaron 30 min con
los antagonistas SR1 1 μM, SR2 2 μM y 48 h con MET 10μM y se analizó la apoptosis por unión anexina-V-FITC e IP y el
ciclo celular mediante citometría de flujo tal y como se describe en Materiales y Métodos. B) Las células se preincubaron 30
min con el antagonista SR2 2 μM y 48 h con JWH015 10μM y se analizó la apoptosis por unión anexina-V-FITC e IP y el
ciclo celular mediante citometría de flujo. Los datos son medias + E.S. de tres ensayos diferentes realizados por duplicado, *
p< 0.05 y ** p< 0.01 comparando frente al control y # p< 0.05 y ## p< 0.05 comparado frente al tratamiento con la t de
Student.

 
 
 

 
 
 
4.77 ± 0.5 9.21 ± 0.1* 14.04 ± 2.3 6.55 ± 0.1##
I
P
Control MET MET+SR1 MET+SR2
Control JWH015 JWH+SR2
A
B
Anexina V-FITC
Anexina V-FITC
Control  MET 10 MET10+SR1 MET10+SR2
N
ú
m
e
r
o
d
e

c
é
l
u
l
a
s
IP IP IP IP
Apoptosis
1.47±0.19 9.78±0.64** 13.09±0.12 1.75±0.25#
G0/G1
78.72±0.52 59.49±4.79* 52.28±6.89 59.61±10.74
S
3.11±1.22 6.79±0.52* 6.08±2.45 5.435±0.95
G2/M
17.03±2.01 20.83±3.85 27.88±5.87 33.94±5.91
6.28±0.1 12.02±1.5** 6.4±1.2#
I
P
Control JWH015 JWH015+SR2
Apoptosis
0.46±0.21 8.84±0.07** 6.46±0.45
G0/G1
91.365±2.79 69.72±4.03* 70.99±13.18
S
1.21±0.60 5.60±0.63* 3.82±1.67
G2/M
7.23±2.61 22.49±3.10 18.93±14.35
IP IP
IP
N
ú
m
e
r
o
d
e

c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e

c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e

c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e

c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
a
N
ú
m
e
r
o
d
e

c
é
l
u
l
a
s

c
é
l
u
l
s

Resultados

80

P
μM durante 48 h, y se valoró el efecto sobre la apoptosis y el ciclo celular mediante
citometría de flujo. Como se puede observar en la figura 24, al silenciar CB2 se consiguió revertir la
apoptosis inducida por el tratamiento con JWH015, lo que confirmaba el que el efecto antiproliferativo
de JWH015 se producía a través de CB2.

ara corroborar el papel del recetor CB2 en el efecto inducido por los cannabinoides, se silenció
su expresión en las células PC-3. Para ello se transfectaron las células con un siRNA selectivo del
receptor de cannabinoides CB2 o con una secuencia de RNA con pares de bases desordenada que no
hibrida con ninguna secuencia del genoma (scrambled), durante 72 h, consiguiendo inhibir
notablemente la expresión del receptor CB2

(figura 27). Posteriormente las células fueron tratadas con
JWH015 10
scrambled siRNA 
CB2
CB2
Tubulina
scrambled
Control JWH015
siRNACB2
Control JWH015
I
P
Anexina V-FITC
5.99 ± 0.7 10.91 ± 1.8∗ 5.262 ± 1.0 5.464 ± 2.7
scrambled siRNA CB2
Control JWH015 Control JWH015
Figura 27. Relevancia del receptor de cannabinoides CB2 en el efecto producido por los cannabinoides en
células PC-3. Las células PC-3 fueron transfectadas con un siRNA específico del receptor de cannabinoides CB2 o con
una secuencia scrambled y transcurridas 72 h fueron tratadas con JWH 10 μM durante 48 h. La apoptosis se analizó por
unión anexina-V-FITC e IP, así como el ciclo celular mediante citometría de flujo tal y como se describe en Materiales y
Métodos. Los datos son medias + E.S.de tres ensayos diferentes realizados por duplicado, * p< 0.01 comparando frente
al control y # p< 0.01 comparado frente al tratamiento con JWH015 con la t de Student.

Apoptosis
2.36±0.76 8.93±1.59* 1.28±0.045 4.24±1.03
G0/G1
66.82±5.99 67.18±6.07 70.66±4.14 69.56±3.76
S
7.21±2.35 5.56±1.83 6.88±1.57 5.08±0.83
G2/M
20.64±2.18 19.52±1.62 20.39±2.20 22.35±2.58
C
e
l
l
s

n
u
m
b
e
r
C
e
l
l
s

n
u
m
b
e
r
C
e
l
l
s

n
u
m
b
e
r
C
e
l
l
s

n
u
m
b
e
r
IP IP IP
IP
#
#
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s
N
ú
m
e
r
o
d
e
 
c
é
l
u
l
a
s

Resultados

81

3.-
tivo de los cannabinoides sobre las células PC-3 se
pasó a analizar los mecanismos de señalización implicados en este efecto, centrándonos en la
producción de ceramida y en las cascadas intracelulares de fosforilación.

3.1.-Síntesis de ceramida


La ceramida es un lípido que puede participar en la señalización celular, regulando distintos
procesos, entre ellos la inducción de apoptosis. Con el fin de estudiar si este segundo mensajero
estaba implicado en el efecto antiproliferativo de los cannabinoides, en primer lugar se trataron las
células durante 48 h con distintas dosis de MET o JWH015 y se cuantificaron los niveles de ceramida
intracelular. Para ello se empleó un ensayo enzimático en el cuál la DAG quinasa fosforila la ceramida
empleando ATP radiactivo como sustrato (Van Veldhoven et al., 1992). El tratamiento con MET y
JWH015 produjo un incremento significativo de los niveles de ceramidas intracelulares (figura 28).

ESTUDIO DE LA SEÑALIZACIÓN CELULAR ACTIVADA
POR CANNABINOIDES

Una vez comprobado el efecto antiprolifera
MET, μM
0 2 4 6 8 10
0
100
200
300
400
0
200
400
600
800
1000
p
m
o
l
/
m
g

p
r
o
t
e
í
n
a

(
%
)
**
*
JWH015, μM
p
m
o
l
/
m
g

p
r
o
t
e
í
n
a

(
%
) *
**
A) B)
0 2 4 6 8 10
Figura 28. Efecto de MET y JWH015 sobre la síntesis de ceramida. A) Las células PC-3 fueron incubadas con MET 10 μM
a diferentes tiempos, y los niveles de ceramida fueron medidos por el método de DAG quinasa tal y como se describe en
Materiales y Métodos. B) Las células PC-3 fueron incubadas con JWH015 10 μM a diferentes tiempo y los niveles de ceramida
fueron medidos por el método de DAG quinasa tal y como se describe en Materiales y Métodos. Los resultados se expresan
como porcentaje frente al control, que se consideró el 100 %. Los datos son medias + E.S de tres ensayos diferente
realizados por triplicado, ** p< 0.05 y * p< 0.01 comparando frente al control con la t de Student.
s

Resultados

82


as se incubaron con MET 10 μM o JWH015 10 μM durante
48 h, y posteriormente se valoraron los niveles de ceramidas intracelulares. Sólo la fumonisina B1 fue
capaz de revertir totalmente el aumento de ceramida provocado tanto por MET como por JWH015. Con
D609 se obtuvo una ligera reversión, pero no fue estadísticamente significativa (figura 29). Por lo tanto,
el aumento de ceramida se producía fundamentalmente por síntesis de novo, aunque la degradación
de esfingomielina de la membrana plasmática también podría participar en este aumento.

La ceramida puede generarse a través de dos rutas: por síntesis de novo a partir de la
condensación de palmitoil coenzima A y serina del retículo endoplasmático, formando esfinganina, que
es convertida en ceramida por la enzima ceramida sintasa, o bien por degradación de esfingolmielina
de la membrana plasmática por diferentes esfingomielinasas (Malagarie-Cazenave et al., 2002). Para
estudiar cuál de las dos rutas estaba implicada en el aumento de ceramidas inducido por los
cannabinoides, se pretrataron las células con dos inhibidores de ambas rutas: D609, que inhibe la
degradación de esfingomielina y fumonisina B1 (Fumo), que inhibe la ceramida sintasa. Tras el
pretratamiento con los inhibidores, las célul
0
100
200
300
400
500
600
700
p
m
o
l
/
m
g

p
r
o
t
e
í
n
a

(
%
)
#
*
0
50
100
150
200
250
300
p
m
o
l
/
m
g

p
r
o
t
e
í
n
a

(
%
)
*
#
A) B)
Figura 29. La síntesis de ceramidas se produce a través de la ruta de novo. A) Las células se preincubaron 30 min
con los inhibidores Fumo 50μM y D609 5 μM, y 48 h con MET 10 μM. Transcurrido este tiempo se midieron los niveles de
ceramidas intracelulares por el método de DAG quinasa tal y como se describe en Materiales y Métodos. B) Las células se
preincubaron 30 min con los inhibidores Fumo 50μM y D609 5 μM, y 48 h con JWH015 10 μM. Transcurrido este tiempo
o se midieron los niveles de ceramidas intracelulares por el método de DAG quinasa. Los resultados se expresan com
porcentaje frente al control, que se consideró el 100 %. Los datos son medias + E.S. de tres ensayos diferentes realizad
por triplicado, * p< 0.01 comparando frente al control y # p < de 0.05 respecto al tratamiento con el cannabinoide median
la t de Student.
os
te

Resultados

83

los antagonistas SR1, SR2 y CPZ en el caso de MET,
omo se observa en la figura 27 el aumento de la
producción de ceramida fue inhibido en ambos casos al incubar las células con SR2, lo que indica
qu
anilloides TRPV1, pero esta
inhibición no llegó a ser significativa (figura 30).
Hasta ahora habíamos observado que los cannabinoides inducían un efecto antiproliferativo y
pro-apoptótico en las células PC-3 y que también eran capaces de provocar un aumento en la
síntesis de novo de ceramida. Con el fin de investigar si la ceramida estaba involucrada en el efecto
omo por JWH015. Por
lo tanto, la síntesis de ceramida estaba implicada en la disminución de la viabilidad inducida por los
cannabinoides.
Para estudiar la implicación de los receptores de cannabinoides en la síntesis de ceramida,
medimos los niveles de ésta en presencia de
o sólo con SR2 en el caso de JWH015. C
e le receptor CB2 era el responsable del aumento de ceramida producido por los cannabinoides.
Con MET también se obtuvo una disminución de los niveles de ceramida al preincubar con los
antagonistas del receptor de cannabinoides CB1 y del receptor de v
antiproliferativo y pro-apoptótico de los cannabinoides, se llevó a cabo un estudio de la viabilidad
celular pretratando a las células con fumonisina B1. En la figura 31 se puede observar que el
pretratamiento con fumonisina B1, inhibidor de la síntesis de novo de ceramida, bloqueó
parcialmente la disminución de la viabilidad celular producida tanto por MET c
0
100
200
300
400
500
p
m
o
l
/
m
g

p
r
o
t
e
i
n
a

(
%
)
*
#
0
50
100
150
200
250
p
m
o
l
/
m
g

p
r
o
t
e
í
n
a

(
%
)
#
*
B)
A)
Figura 30. Implicación del receptor CB2 en la síntesis de ceramida. A) Las células se preincubaron 30 min con los
antagonistas SR1, SR2 y CPZ y 48 h con MET 10μM. Transcurrido este tiempo se midieron los niveles de ceramida
por el método de DAG quinasa tal y como de describe en Materiales y Métodos. B) Las células se preincubaron 30
min con el antagonista SR2 y 48 h con JWH015 10μM. Transcurrido este tiempo se midieron los niveles de ceramida
por el método de DAG quinasa. Los resultados se expresan como porcentaje frente al control, que se consideró el 100
%. Los datos son medias + E.S. de tres ensayos diferentes realizados por triplicado, * p< 0.01 y # p< 0.01
comparando frente al tratamiento con el cannabinoide con la t de Student.


Resultados

84

Se continuó estudiando el efecto de la ceramida sobre los cambios producidos por los
cannabinoides en el ciclo celular. Para ello se preincubaron las células con fumonisina B1 durante 30
min y posteriormente con JWH015 10 μM durante 48 h. En la figura 32 vemos que la fumonisina B1
revierte el aumento de células apoptóticas producido por JWH015 sin afectar a las distintas fases del
ciclo celular, por tanto la ceramida participaba en el efecto pro-apoptótico de los cannabinoides en las
células PC-3.
Figura 31. Papel de la síntesis de ceramida sobre el efecto antiproliferativo producido por los cannabinoides. A)
Las células se preincubaron 30 min con el inhibidor de la síntesis de novo de ceramida, Fumo 50 μM y 48 h con MET
10μM. Transcurrido este tiempo la viabilidad celular se midió por MTT tal y como se describe en Materiales y Métodos. B)
Las células se preincubaron 30 min con el inhibidor de la síntesis de novo de ceramida, Fumo 50 μM y 48 h con JWH015
10μM. Transcurrido este tiempo la viabilidad celular se midió por MTT. Los resultados se expresan como porcentaje frente
al control, que se consideró el 100 %. Los datos son medias + E.S. de dos ensayos realizados por triplicado, * p < 0.01
respecto el control y # p < de 0.01 respecto del tratamiento con la t de Student.


Figura 32. Papel de la síntesis de ceramidas en la apoptosis producida por JWH015 en las células PC-3. Las células se
pretrataron con Fumo 50 μM durante 30 min y posteriormente con 10 μM de JWH durante 48 h. El ciclo celular se analizó
mediante citometría de flujo tal y como se describe en Materiales y Métodos. Los datos son medias + E.S. tres ensayos
diferentes realizados por duplicado, * p< 0.05 y ** p< 0.01 comparando frente al control y # p < de 0.01 respecto JWH015 con
la t de Student.
0
20
40
60
80
100
120
V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r

(
%
)
*
#
0
20
40
60
80
100
120
V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r

(
%
)
*
*
#
B)
) A
Control JWH JWH+Fumo
Apoptosis
1.74±1.4 9.27±1.88** 3.85±0.09#
G0/G1
63.97±11.06 57.27±14.63 62.90±8.67
S
4.83±0.95 5.3±0.94 3.965±0.64
G2/M
27.84±13.45 28.865±12.33 23.92±14.08
N
ú
m
e
N
ú
m
e
N
ú
m
e
c
IP IP
IP
r
o
d
e
 
c
é
l
u
l
a
s
r
o
d
e
 
c
é
l
u
l
a
s
r
o
d
e
 
c
é
l
u
l
a
s

Resultados

85

3.2.- C
tra
ella
pro
de
se ión de dos de las MAPKs implicadas en la muerte
celular, p38 y JNK. Así se vio que el tratamiento con JWH015 producía una disminución tanto en la
fosforilación de p38 como en los niveles totales de p38 (figura 33). Por otro lado, JWH015 indujo
activación de JNK tal y como indica el aumento en los niveles de JNK fosforilada que se detecta a partir
de los 30 min de tratamiento (figura 33).

Se ha descubierto recientemente que los cannabinoides pueden inducir muerte por autofagia en
las células de glioma (Salazar et al., 2009). Además, datos aún no publicados de nuestro laboratorio
indican que JWH015 puede inducir autofagia en células de carcinoma hepatocelular. Entre las vías de
señalización que regulan el proceso de de autofagia destaca la inhibición de la proteína mTOR,
sustrato de la vía PI3K/Akt. Esta vía se activa en respuesta a multitud de factores de crecimiento. La
activación de PI3K c
mTO
su c
dete
trata s e inhibición a partir de las 24 h
(figura 3
res
cel
tra
act
Co
la fosforilación de eIF2α, indicativa de su inhibición, observándose un aumento a partir de las 6 h de
tratamiento (figura 33).
ascadas de señalización intracelulares

Los cannabinoides pueden regular el crecimiento y la muerte celular a través de una
nsducción de señales que implica rutas de señalización muy diversas y conectadas entre sí. Entre
s se encuentra la vía de las MAPKs. Esta tiene una gran relevancia en la regulación de distintos
cesos relacionados con el crecimiento tumoral y está implicada en la tumorogénesis de varios tipos
cáncer, entre ellos el cáncer de próstata (Grant, 2008; Kinkade et al., 2008). Por ello, en primer lugar
midieron por Western blot los niveles de activac
onduce a activación de Akt por fosforilación, que a su vez induce la activación de
R. En las células PC-3, esta vía está constitutivamente activada, pudiendo estar relacionada con
recimiento incontrolado. Con el fin de analizar si JWH015 regulaba esta vía en las células PC-3, se
rminó la fosforilación de Akt en su residuo ser473, indicativa de la activación total de la enzima. El
miento con JWH015 indujo activación de Akt a tiempos corto
3).

Por otro lado, cuando la célula se somete a condiciones adversas, se desencadena una
puesta de estrés en el retículo endoplasmático que en algunos casos puede inducir la muerte
ular. Entre las proteínas que se inhiben en esta respuesta se encuentra el factor de iniciación de la
nscripción eIF2α, que inicia la síntesis de proteínas clásica, dependiente de CAP. En su lugar se
iva la transcripción dependiente de IRES, encargada de intentar contrarrestar la situación de estrés.
n el fin de confirmar si los cannabinoides inducían esta respuesta de estrés de retículo, se determinó

Resultados

86

Estos resultados indicaban que JWH015 inducía estrés de retículo en las células PC-3
probablemente con la mediación de la ruta de JNK. Actualmente en nuestro grupo de investigación se
está profundizando en el mecanismo de estrés de retículo inducido por los cannabinoides, siendo
objeto de investigación de otra Tesis doctoral, por lo que en este trabajo no se siguió investigando en
este efecto.

Para determinar la vía de apoptosis activada en las células PC-3 se analizaron los niveles de
procaspasa 8, partícipe de la vía extrínseca, y de procaspasa 9, implicada en la ruta intrínseca. El
tratamiento con JWH015 produjo activación de caspasa 9 sin inducir cambios en la caspasa 8, por
tanto JWH015 inducía apoptosis a través de la vía intrínseca. Para confirmar la activación la ruta
intrínseca, se midieron los niveles citosólicos de citocromo c, proteína mitocondrial que es liberada al
citosol cuando existe un estimulo apoptótico y activación de caspasa 9. Se observó un aumento de
estos niveles, confirmando así la activación de la ruta intrínseca (figura 33).

p-
-

P38
P38
p JNK
Figura 33. Mecanismos de
señalización celular
activados por JWH015 en
células PC-3. A) Las céulas
PC-3 fueron incubadas con


JWH015 10 μM durante
distintos tiempos y los niveles
de fosforilación de p38, JNK,
Akt y eIF2α fueron medidos
por Western blot, tal y como
se describe en Materiales y
Métodos. B) Las células PC-3
fueron incubadas con
JWH015 10 μM durante
distintos tiempos, y los
niveles de procaspasa 8, 9 y
citocromo c citosólico fueron
medidos por Western blot, tal
y como se describe en
Materiales y Métodos. La
imagen es representativa de
tres experimentos
independientes. Los niveles
de tubulina fueron medidos
como control.
p-eIF2α
Caspasa 8
Caspasa 9
Citocromo c
Tubulina
Tubulina
JNK
C 10’ 30’ 1h 6h 24h 48h
B
p-Akt
C 10’ 30’ 6h 24h 48h
A

Resultados

87

CTO ANTITUMORAL IN VIVO DE JWH015
na vez establecido el efecto de los cannabinoides sobre las células PC-3 y su mecanismo de
acción
15 días, registrando cada día el tamaño del tumor y el peso
del ratón. Al final del tratamiento, los tumores fueron extirpados y se midió el peso de los mismos.
tanto, JWH015 parecía no tener efectos tóxicos en este modelo.

4.- EFE

U
, pasamos a estudiar su posible efecto antitumoral en un modelo in vivo. Para ello se escogieron
ratones atímicos desnudos (nu/nu) a los que se les inyectó subcutáneamente 2x10
6
de células PC-3.
Tras aproximadamente tres semanas, cuando el tumor alcanzó un tamaño de 80 mm
2
, los ratones se
dividieron en tres grupos y se comenzaron los siguientes tratamientos:

- grupo A, suero salino (control)
- grupo B, 1.5 mg/kg b.w (peso corporal) de JWH015
- grupo C, 1.5 mg/kg b.w de JWH015 y 1.5 mg/kg b.w de SR2

El tratamiento se prolongó durante

Como se muestra en las curvas del crecimiento tumoral en la figura 34, en el grupo control se
produjo un crecimiento descontrolado del tamaño tumoral, mientras que el tratamiento con JWH015
causó una reducción significativa del tamaño del tumor. El tratamiento combinado de JWH015 + SR2
originó una curva de crecimiento tumoral similar a la del grupo control. El peso del tumor al finalizar el
tratamiento también fue significativamente menor en el grupo tratado con JWH015, no existiendo
diferencias entre el control y el grupo tratado con JWH015+SR2 (tabla 3). Además, se valoró por
observación macroscópica la presencia de metástasis en el pulmón, no existiendo ninguna alteración.
También se midió el peso corporal de los ratones cada día, no observando ninguna reducción de peso
que podría estar relacionada con un efecto tóxico generalizado de los cannabinoides en ninguno de los
grupos. Por
Estos datos confirmaban el efecto antitumoral de JWH015 en un modelo in vivo. El hecho de que
el tratamiento combinado con JWH015 más el antagonista SR2 revirtiera el efecto antitumoral del
JWH015, demostraba además que el receptor CB2 estaba participando en este efecto antitumoral.



Resultados

CONTROL JW 015 JWH015+SR2 H
0
200
400
600
800
1000
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
V
o
l
u
m
e
n
t
u
m
o
r
 
(
%
)
Tiempo (días)
C
JWH015
JWH015+SR2
**
*
* *
#
#
#
#
Figura 34. Efecto antitumoral del cannabinoide JWH015. Se inyectaron ratones atímicos nu/nu subcutáneamente con
2x10
6
de

células PC-3 y cuatro semanas más tarde se iniciaron los tratamientos con vehículo (control), 1.5 mg/kg de
JWH-015 ó 1.5 mg/kg de JWH-015 más 1.5 mg/kg de SR2. Los tratamientos se administraron por inyección peritumoral
cada día y se prolongaron durante 15 días. Se registró diariamente el volumen del tumor. A) Foto representativa del
tamaño tumoral en un ratón de cada grupo tratado, así como del tumor disecado al finalizar los tratamientos. B) Curva del
crecimiento tumoral tras el inicio del tratamiento con vehículo, JWH015 o JWH015+SR2. Los resultados se expresan
como porcentaje tamaño tumoral inicial, que se consideró el 100 %. Los resultados son medias ± E.S. del volumen
tumoral de cada ratón en dos experimentos independientes. * p< 0.01 frente al control y # p<0.01 frente a JWH-015,
comparado mediante t de student.
88



Resultados

Volumen tumor 
inicial (mm
3
)
Volumen 
tumor final (mm
3
)
% Crecimiento 
tumoral
Peso del tumor 
(µg)
CONTROL
81.62±12.90 447.75 ±45.65 663.27±68.09 263.77±20.68
JWH015
84.15±11.049 344.76 ±37.741 426.40±40.65 203.72±21.90
JWH015+SR2
78.88±7.31 428.07 ±50.19 623.38±72.11 283.78±28.32
89


Tabla 3. Efecto antitumoral del cannabinoide JWH015.

5.- ESTUDIO DE LA SECRECCIÓN DE IL-6

Además de sus efectos sobre el crecimiento y la muerte celular, el pap
sobre el sistema inmune cada vez cobra más relevancia. Ambos efectos pue
siendo la secreción de citoquinas uno de los posibles reguladores, ya que
respuestas inflamatorias, sino que también pueden regular el crecimiento
diferenciación. En próstata una de las citoquinas con mayor relevancia es IL-
crecimiento celular y la resistencia a drogas (Culig et al., 2005; Pu et al., 200
estudiar la secreción de esta citoquina por las células de próstata en presen
Para ello, primero valoramos la secreción de IL-6 en las células PC-3 y en las células no tumorales,
RWPE-1, mediante ensayo ELISA tras tratar a las células con dosis crecientes de cannabinoides. En la
gura 35 se observa que ambos cannabinoides produjeron un aumento dosis dependiente de la
iaciones en la
secreción de IL-6 a ninguna de las dosis estudiadas, lo que implicaba una regulación diferencial de la
secreción de IL-6 en células tumorales y células no tumorales.
el de los cannabinoides
den estar relacionados,
éstas no sólo modulan
, la supervivencia y la
6, por su efecto sobre el
4). Así pues, decidimos
cia de MET y JWH015.
fi
secreción de IL-6 en las células PC-3. En la línea RWPE-1 no se observaron var
Figura 35. MET y JWH015 producen
un incremento en la secreción de IL-
6 en células PC-3. Las células PC-3 y
RWPE-1 fueron incubadas con distintas
dosis de MET o JWH015 durante 48 h,
y los
ensa
niveles de IL-6 fueron medidos por
yo ELISA tal y como se describe
en Materiales y Métodos. Los
resultados se expresan como
porcentaje frente al control, que se
consideró el 100 %.Los datos son
medias + E. S. de tres ensayos
realizados por duplicado, *p<
< 0.01 comparando frente al
control con la t de Student.

diferentes
0.05 y ** p 0
100
200
300
2 4 6 8 10
p
g
/
m
l

I
L
-
6

(

%
)
Canabinoide (μM)
400
500
600
700
JWH015 en PC-3
MET en PC-3
JWH015 en RWPE1
MET en RWPE1
**
*
**
**
*
*
0

Resultados

90

s lo
niveles de IL-6. Como se observa en la figura 36, MET aumentó la síntesis a partir de las 6 h y JWH015
lo hizo
oligonucleótidos específicos del RNA de esta citoquina y valoramos su expresión a distintos tiempos de
incubación con JWH015 10 μM. Así observamos que a tiempos cortos había una disminución en los
niveles de RNA mensajero, pero a partir de las 6h prácticamente se duplicaba su expresión (figura 37).



Posteriormente nos propusimos estudiar la secreción de IL-6 a lo largo del tiempo. Para ello
incubamos las células PC-3 con MET 10 μM o JWH015 10 μM durante distintos tiempos y medimo
a partir de las 48 h (figura 36).


También quisimos comprobar si el aumento en la secreción de IL-6 era debido a un aumento
en la expresión a nivel de mRNA. Para ello llevamos a cabo una PCR a tiempo real (qPCR) con
Figura 36. Respuesta en el tiempo de
la secreción de IL-6 a los
cannabinoides. Las células PC-3
fueron incubadas con MET 10 μM o
JWH015 10 μM durante distintos
tiempos, y los niveles de IL-6 fueron
medidos en los sobrenadantes
celulares por ensayo ELISA tal y como
se describe en Materiales y Métodos.
Los resultados se expresan como
porcentaje frente al control, que se
consideró el 100
medias +
0
100
200
300
400
500
600
700
p
g
/
m
l

I
L
-
6

(
%
)
C 10' 30' 1h 6h 24h 48h
Tiempo
MET
JWH015
%. Los datos son
E. S. de tres ensayos
diferentes realizados por duplicado, *p<
0.05 y ** p< 0.01 comparando frente al
control con la t de Student.
Figura 37. Respuesta en el tiempo de
la expresión de mRNA de IL-6 al
JWH015. Las células PC-3 fueron
incubadas con JWH015 10 μM durante
distintos tiempos, y los niveles de IL-6
fueron medidos mediante qPCR tal y
como se describe en Materiales y
Métodos. Los resultados se expresan
referidos al control, que se consideró 1.
Los datos son medias +
0
0.5
1
1.5
2
2.5
C 10' 30' 1h 6h 24h 48h
N
i
v
e
l
e
s

r
e
l
a
t
i
v
o
s

d
e

m
R
N
A
Tiempo
*
**
**
E. S. de dos
ensayos diferentes realizados por
duplicado, *p< 0.01 comparando frente
al control con la t de Student.


Resultados

91


5.1.- Papel del receptor CB2


Para estudiar la posible participación de los diferentes receptores en la secreción de IL-6
mediada por los cannabinoides se pretrataron las células con los antagonistas SR1, SR2 y CPZ, y
posteriormente se incubaron en presencia de MET 10 μM. Tras 48 h se midieron los niveles de IL-6
mediante ELISA. Sólo se obtuvo un bloqueo parcial de la secreción de IL-6 al pretratar las células con
SR2 (figura 38), por tanto el receptor CB2 parecía estar implicado en la inducción de la secreción de IL-
6.

Con el fin de corroborar la implicación de CB2 se pasó a valorar el efecto del antagonista de este
receptor en la secreción de IL-6 inducida por JWH015. De este modo se observó que SR2 inhibía
totalmente el aumento de la secreción de IL-6 provocada por JWH015 (figura 39), indicando una vez
más que la inducción de la secreción de IL-6 se realizaba a través de CB2.




0
50
100
150
200
250
300
350
400
450
C MET MET +
SR1
SR1
p
g
/
m
l

I
L
-
6

(
%
)
*
*
0
50
100
150
200
250
300
350
400
450
500
C MET MET +
CPZ
CPZ
P
g
/
m
l

I
L
-
6

(
%
)
*
*
0
50
100
150
200
250
300
350
400
450
C MET MET +
SR2
SR2
p
g
/
m
l

I
L
-
6

(
%
)
*
*
#
A)
B) C)
Figura 38. Papel de los receptores de cannabinoides y del receptor TRPV1 en la secreción de IL-6 inducida por MET.
Las células se preincubaron 30 min con los antagonistas SR1, SR2 y CPZ, y 48 horas con MET 10μM. Transcurrido este
tiempo se midieron los niveles de IL-6 por ELISA tal y como se describe en Materiales y Métodos. Los resultados se
expresan como porcentaje frente al control, que se consideró el 100 %. Los datos son medias + E.S. de dos ensayos
realizados por triplicado, * p < 0.01 respecto el control y # p < de 0.01 respecto MET con la t de Student.

Resultados

92



Para confirmar el papel del recetor CB2 en el efecto inducido por los cannabinoides, se silenció
su expresión en las células PC-3. Para ello se transfectaron las células con un siRNA selectivo del
receptor de cannabinoides CB2 o con una secuencia de RNA con pares de bases desordenada que no
hibrida con ninguna secuencia del genoma (scrambled), durante 72 h. Posteriormente las células
fueron tratadas con JWH015 10 μM durante 48 h y se midieron los niveles de IL-6. Como se puede
observar en la figura 40, al silenciar CB2 se consiguió revertir totalmente el aumento de secreción de
IL-6 inducida por el tratamiento con JWH015, lo que ratificaba la implicación del receptor CB2

en este
efecto.


0
20
40
60
80
100
120
140
Scrambled siRNA CB2
p
g
/
m
l

I
L
-
6

(
%
)
160
180
Control
JWH015
Figura 39. Inhibición de la secreción de IL-
6 inducida por JWH015 por el antagonista
del receptor de cannabinoides CB2. Las
células se preincubaron 30 min con el
antagonista SR2 0.5 μM, y 48 h con JWH015
10μM. Transcurrido este tiempo los niveles
de IL-6 fueron medidos por ELISA tal y como
se describe en Materiales y Métodos. Los
resultados se expresan como porcentaje
frente al control, que se consideró el 100 %.
Los datos son medias + E.S. de dos ensayos
realizados por triplicado, * p < 0.01 respecto
el control y # p < de 0.01 respecto JWH015
con la t de Student.
Figura 40. Papel del receptor de
cannabinoides CB2 sobre la secreción de
IL-6. Las
con siR
cannabin
scramble
con 10
niveles d
resultado
al contro
datos so
céulas PC-3 fueron transfectadas
NA específico del receptor de
oides CB2 o con una secuencia
d y transcurridas 72 h fueron tratadas
μM de JWH015 durante 48 h. Los
e IL-6 se valoraron por ELISA. Los
s se expresan como porcentaje frente
l, que se consideró el 100 %. Los
n medias + E.S. de tres ensayos
s realizados por triplicado. diferente
.

0
C JWH015 JWH015 SR2
20
40
80
100
120
140
160
180
200
+ SR2
g
/
m
l

I
L
-
6

(
%
)
*
#
*
#
60
p

Resultados

93

5.2.-
umentaban la síntesis de ceramida a través del receptor CB2 y
ya que este receptor también participaba en la secreción de IL-6, quisimos investigar si el aumento en
la producción de ceramida estaba implicado en la secreción de IL-6 n
de esta interleuquina en presencia de MET 10 μM o JWH015 10 μ
con el inhibidor de la síntesis de novo de ceramida, fumonisina B1. C
se produjo ninguna variación al pretratar las células con fumonisina
no estaba implicada en la secreción de IL-6.

Puesto que la síntesis de novo de ceramida parecía no esta
nos preguntamos si algún metabolito derivado de la ceramida pod en
la introducción, ceramida es el precursor de la síntesis de muchos esfingolípidos complejos, entre ellos
C1P. La ceramida puede fosforilarse por medio de la enzima abolito que
participa en la regulación del crecimiento celular.
Papel de la síntesis de ceramida en la secreción de IL-6


Puesto que los cannabinoides a
. Se valoró con este fin la secreció
M, previo tratamiento de las células
omo se observa en la figura 41, no
B1, lo que sugería que la ceramida
r involucrada en la secreción de IL-6,
ría regularla. Tal y como se señala
CERK dando C1P, met
0
50
100
150
C MET MET +
Fumo
Fumo
200
250
300
350
p
g
/
m
l

I
L
-
6

(
%
)
*
*
0
50
100
150
C JWH015 JWH015 +
Fumo
Fumo
* *
200
250
300
350
p
g
/
m
l

I
L
-
6

(
%
)
A) B)
Figura 41. La síntesis de ceramida intracelular no está involucrada en la secreción de IL-6. A) Las células se
preincubaron 30 min con el inhibidor de la síntesis de novo de ceramidas, Fumo 50 μM y 48 h con MET 10μM. Transcurrido
este tiempo la viabilidad celular se midió por MTT tal y como se describe en Materiales y Métodos. B) Las células se
preincubaron 30 min con el inhibidor de la síntesis de novo de ceramidas, Fumo 50 μM y 48 h con JWH015 10μM.
Transcurrido este tiempo la viabilidad celular se midió por MTT. Los resultados se expresan como porcentaje frente al control,
que se consideró el 100 %. Los datos son medias + E.S. de dos ensayos realiza ente
al control mediante la t de Student.

dos por triplicado, * p < 0.01 comparado fr

Resultados

94

Con el fin de estudiar la participación de C1P en la regulación de la secreción de IL-6 por
CERK mediante un siRNA selectivo. Una vez silenciada
ERK, las células fueron tratadas con MET 10μM durante 48 h, y se midieron los niveles de IL-6 por
nsayo ELISA. Como se observa en la figura 42, aunque el silenciamiento de CERK no fue completo,
se con

5.3.- Señalización celular implicada en la secreción de IL-6

5.3.1 Ruta de señalización de NFκB
FκB es un factor de transcripción pleiotrópico que desempeña una función central en la
respue
onal (Shimizu et al., 1990;
Gruss t al., 1992; Matsusaka et al., 1993). Para dilucidar si este factor de transcripción participaba en
la inducción de la secreción de IL-6 por cannabinoides se pretrataron las células con el inhibidor
BAY1 μM, inhibidor de IKKβ, una de las quinasas implicadas en la activación de NFκB.
Posteriormente se incubaron con MET 10μM y JWH015 10μM y se midieron los niveles de IL-6. Como
se observa en la figura 43, la síntesis de IL-6 inducida por los cannabinoides fue inhibida parcialmente
cannabinoides, se silenció la expresión de
C
e
siguió revertir totalmente el aumento de secreción de IL-6 inducida por el tratamiento con MET.

N
sta inmune innata y adquirida, induciendo la expresión de genes implicados en la respuesta
inmune y el crecimiento celular, algunos de ellos codificantes para citoquinas proinflamatorias. Además,
NFκB es uno de los factores de transcripción que regulan comúnmente la expresión de IL-6, existiendo
en el promotor de esta citoquina un sitio de unión a este factor transcripci
e
1-7082 2.5
en el caso de MET y totalmente en el caso de JWH015 al preincubar las células con BAY11-7082.
CERK
Tubulina
Figura 42. CERK está involucrada en la
secreción de IL-6. Las céulas PC-3
fueron transfectadas con un siRNA
0
20
40
60
80
100
120
140
160
Scrambled siRNA CERK
p
g
/
m
l

I
L
-
6
(
%
)
Control
específico de CERK o con una secuencia
scrambled, y transcurridas 72 h fueron
tratadas con JWH015 10 μM durante 48 h.
Los niveles de IL-6 se valoraron por
ELISA. Los resultados se expresan como
porcentaje frente al control, que se
consideró el 100 %. Los datos son medias
+
MET
*
#
E.S. de tres ensayos diferentes
realizados por triplicado., * p < 0.01
respecto el control y # p < de 0.01
respecto MET con la t de Student


Resultados

95

consiguió revertir totalmente el aumento de secreción de IL-6 inducida por el tratamiento con
JWH015, existiendo también una disminución de los niveles basales de IL-6.
Figura 43. Inhibición de la secreción de IL-6 por BAY. Las células fueron incubadas con BAY11-7082 2.5 μM durante
30 min, y posteriormente se trataron con MET 10 μM o JWH015 10 μM durante 48 h. Los niveles de IL-6 fueron medidos
por ensayo ELISA. Los resultados se expresan como porcentaje frente al control, que se consideró el 100 %. Los datos
son medias +
Con el fin de confirmar la implicación del NFκB en la secreción de IL-6, se silenció la expresión
de IKKβ en las células PC-3. Para ello se transfectaron las células durante 72 h con un siRNA selectivo
de IKKβ o con una secuencia de RNA con pares de bases desordenada que no hibrida con ninguna
secuencia del genoma (scrambled). Posteriormente las células fueron tratadas con JWH015 10μM
durante 48 h, y se midieron los niveles de IL-6. Como se puede observar en la figura 44, al silenciar
IKKβ se


E.S. de dos experimentos realizados por triplicado. *p<0.01 respecto del control, y #p<0.01 respecto del
tratamiento con cannabinoide comparando con la t de Student.

Figu
sec
fuer
esp
scra
trata
48 h
ELIS
porc
con
+
ra 44. Papel del IKKβ sobre la
reción de IL-6. Las células PC-3
on transfectadas con un siRNA
ecífico de IKKβ o con una secuencia
mbled, y transcurridas 72 h fueron
das con 10 μM de JWH015 durante
. Los niveles de IL-6 se valoraron por
A. Los resultados se expresan como
entaje frente al control, que se
sideró el 100 %. Los datos son medias

reali
.

E.S. de tres ensayos diferentes
zados por triplicado.
0
100
200
300
400
500
600
700
800
900
C MET MET+BAY BAY
p
g
/
m
l

I
L
-
6

(
%
)
*
#
0
25
50
75
100
125
150
175
200
C JWH015 JWH015+BAY BAY
*
#
225
p
g
/
m
l

I
L
-
6

(
%
)
0
20
40
60
80
100
120
140
160
180
Scrambled siRNA IKKb
p
g
/
m
l

I
L
-
6

(
%
)
Control
JWH015
*
#
*

Resultados

96

lizamos la
participación de diferentes componentes de la vía clásica y no clásica de su activación. Las células PC-
3 fueron tratadas con JWH015 10 μM a diferentes tiempos, valorándose la fosforilación de las quinasas
e inhib
(figura 45), lo que indicaba que NFκB p65 se estaba
activando y translocándose al núcleo para ejercer su papel en la regulación transcripcional.
.
Para estudiar los mecanismos que podrían regular la activación de NFκB ana
idores que participan en la vía de regulación de NFκB. Comprobamos de esta forma que existía
activación de las quinasas IKKα e IKKβ, así como del inhibidor de NFκB, IκBα (figura 45).
Posteriormente valoramos directamente la activación de NFκB, estudiando su translocación al
núcleo, que se da cuando este factor de transcripción se activa. Para ello llevamos a cabo una
extracción núcleo/citosol y medimos los niveles de la subunidad de NFκB p65 en ambos
compartimentos celulares. Observamos una disminución de los niveles citosólicos de p65
paralelamente a un incremento en el núcleo
Figura
1 2.6±0.4** 4.3±0.0** 3.7±2.1 3.8±2.6 1.9±0.7 0.6±0.0
1 1.2±0.3** 4.4±2.6 12.9±1.3** 2.6±0.4** 1.6±0.4** 1.1±0.5
1 1±0.05 0.9±0.04* 0.7±0.03** 0.9±0.02* 0.7±0.1* 0.4±0.1**
C 10’ 30’ 1h 6h 24h 48h
p65
Nucleo Nucleoporina
A)
B)
pIKKα/ β
IKKβ
pIκBα
IκBα
1 1.7±0.3 2.2±0.7* 2.1±0.8 1.5±0.2* 1.8±0.3* 0.4±0.1*
p65
Citoplasma
Tubulina
Nucleoporina
Tubulina
45. Activación de la vía clásica de NFκB por JWH015. A) Las células fueron incubadas con JWH015 10 μM
durante distintos tiempos y se valoró la activación de IKKα/β y de IκBα mediante Western blot. B) Las células fueron
incubadas con JWH015 10 μM durante distintos tiempos, se llevó a cabo una separación núcleo/citosol y se valoraron los
niveles de p65 en ambos compartimentos celulares mediante Western blot. La figura es representativa de tres ensayos
independientes. Se detectó nucleoporina como marcador de extracto nuclear y α tubulina como marcador de citosol. La
cuantificación de las bandas correspondiente a la proteína fosforilada respecto de la proteína total o a p65 respecto del
correspondiente marcador se muestra debajo del carril.

Resultados

97

5.3.2 Ruta de señalización PI3K/Akt

Datos previos de nuestro laboratorio indicaban la vía
PI3K/Akt (Sanchez et al., 2003a), y esta vía había sido re ción
constitutiva de NFκB en las células PC-3 (Dan et al., 2008). Así pues, nos propusimos descubrir si la
ruta PI3K/Akt estaba implicada en el aumento de la secreción de IL-6 inducido por los cannabinoides.
Para ello se incubaron las células PC-3 con LY294002 1 μM, un inhibidor específico de la
e observa en
figura 47.
Estudiamos también los niveles de otra de las subunidades que pueden formar el complejo
NFκB, la subunidad p52, así como de su precursor p100. Esta subunidad está implicada en la vía no
clásica del NFκB. Como se puede observar en la figura 46 no se detectaron cambios en los niveles de
ninguna de estas proteínas, lo que indica que NFκB no se activaba por esta vía.
proteína PI3K. Posteriormente se trataron con MET 10 μM o JWH015 10 μM y transcurridas 48 h se
Figura 46. Western blot de
p100/p52 Las células fueron
incubadas con JWH015 10
μM durante distintos tiempos
y se valoró los cambios en la
y


e

p52
p100
Actina
C 10’ 30’ 1h 6h 16h 24h 48h
activación de p100/p52
mediante Western blot tal
como se describe en
Materiales y Métodos. La
figura es representativa d
tres ensayos independientes.
que los cannabinoides activaban
cientemente relacionada con la activa
midieron los niveles de IL-6 por ensayo ELISA. Al pretratar las células con el inhibidor de PI3K se
observó una reversión del aumento de secreción producido por los cannabinoides, como s
la
0
100
200
300
400
500
600
C MET MET+LY LY
p
g
/
m
l

I
L
-
6

(
%
)



#
*
700
0
50
100
150
200
250
300
350
C JWH015+LY
p
g
/
m
l

I
L
-
6

(
%
)



#
400
*
A) B)
Figura 47. Inhibición de la secreción de IL-6 por LY. Las células fueron incubadas con LY294002 1 μM durante 30 min,
y posteriormente se trataron con MET 10 μM o JWH015 10 μM durante 48 h. Los niveles de IL-6 fueron medidos por
ELISA tal y como se describe en Materiales y Métodos. Los resultados se expresan como porcentaje frente al control, que
se consideró el 100 %. Los datos son medias + E.S. de dos experimentos por triplicado. *p<0.05 y **p<0.01 respecto del
control, y #p<0.01 respecto del tratamiento con cannabinoide comparando mediante la t de Student.

Resultados

Con el fin de seguir profundizando en la ruta de señalización de PI3K/Akt, se llevó a cabo
98

con mayor profundidad el estudio de la fosforilación de Akt, determinando la fosforilación mediante
Western blot en el residuo thr308, indicativa de una activación parcial de la encima. La activación de
PI3K conduce a la activación de Akt, que a su vez está implicada en multitud de repuestas celulares. Al
incubar las células durante distintos tiempos con MET 10 μM o JWH015 10 μM se observó un
incremento en la fosforilación a tiempos cortos de Akt, indicativa de la activación de esta quinasa así
como una disminución a partir de las 48h, lo que concordaba con la inhibición de la fosforilación en el
residuo ser473 observada al estudiar la apoptosis (figura 48A).

Posteriormente se valoró la participación de la proteína PI3K y del receptor de cannabinoides
CB2 en la activación de Akt. Para ello se pretrataron las células con LY294002 y con SR2 y
p
c
i

Una vez caracterizadas tanto la vía de activaci terminada
la participación de ambas en la secreción de IL-6, pas tre ambas
vías, así como la contribución del receptor de cannabinoides CB2. Para ello incubamos las células con
el antagonista SR2 o con el inhibidor LY294002 y poste os la activación de NFκB.
En la figura 49 se muestra que tanto SR2 como LY294002 fueron capaces de inhibir la activación de
osteriormente se trataron con JWH015 10 μM. Como se observa en la figura 48B, la preincubación
on SR2 bloqueó parcialmente la activación de Akt, mientras que el pretratamiento con LY294002
nhibió totalmente su activación, como era de esperar.
ón de NFκB como la de PI3K/Akt y de
amos a estudiar la posible relación en
riormente determinam
Figura 48. Activación de Akt por MET y JWH015. A) Las células fueron incubadas con MET 10 μM o JWH015 10 μM
durante distintos tiempo y se valoró la activación de Akt mediante as con SR2
o LY294002 durante 30 min y posteriormente fueron incubadas c activación
de Akt mediante Western blot. La figura es representativa de dos e
MET
A)
C 10’ 30’ 1h 6h 24h 48h
pAkt
Tubulina
C 10’ 30 1h 6h 24h 48h
pAkt
Tubulina
JWH015
C JWH015 +SR2 +LY
pAkt
Tubulina
B)
Western blot. B) Las células fueron pretratad
on JWH015 10 μM durante 24 h. Se valoró la
nsayos diferentes realizados por duplicado.

Resultados

99

p65 inducida por JWH015, lo que sugería que la activación de NFκB por parte de los cannabinoides se
llevab

5.4.- NFκB controla la expresión de IL-6

Una vez comprobada la activación por parte de los cannabinoides del factor de transcripción
NFκB, con mediación de la vía PI3K/Akt, nos propusimos comprobar si efectivamente NFκB se unía al
promotor de IL-6 en respuesta al tratamiento con cannabinoides. Previamente se había descrito que en
el promotor de IL-6 existía un sitio de unión a este factor transcripcional (Shimizu et al., 1990; Gruss et
al., 1992), y se comprobó mediante el uso de bases de datos de secuencias de DNA
(http://www.genomatix.de/cgi-bin/matinspector_prof/mat_fam.pl
a a cabo a través de CB2, con mediación de la vía PI3K/Akt.
1 1.6±0.5* 1.0±0.1# 0.9±0.1# 1.0±0.3 1.1±0.4
Nucleo

) que esta secuencia era un posible sitio
de unión NFκB. Así pues, empleamos esta secuencia para comprobar la unión de NFκB al promotor de
IL-6. Para ello se llevó a cabo un ensayo de coinmunoprecipitación de la cromatina (ChIP). Se trataron
las células con MET 10 μM o JWH015 10 μM, pretratándolas previamente con el antagonista del
receptor CB2, SR2, y con el inhibidor de PI3K, LY294002. Posteriormente se inmunoprecipitó la
subunidad p65 de NFκB y se valoró la unión de NFκB al promotor de IL-6 mediante qPCR usando
o
l
I
n
ligonucleótidos específicos de la secuencia de unión a NFκB. De este modo se observó que al tratar
as células con los cannabinoides existía un aumento significativo en la unión de NFκB al promotor de
L-6. El pretratamiento con SR2 y LY294002 disminuyó la unión de NFκB al promotor de IL-6, aunque
o de forma significativa (figura 50).
Figura 49. Papel de CB2 y PI3K en la activación de p65 Las células fueron incubadas con JWH015 10 μM 24 h,
pretratándolas con el antagonista de CB2, SR2, y con el inhibidor de PI3K, LY294002. Se llevó a cabo posteriormente una
separación núcleo/citosol y se valoraron los cambios en la los niveles de p65 en ambos compartimentos celulares mediante
Western blot tal y como se describe en Materiales y Métodos. La figura es representativa de tres ensayos independientes.
1 0.7±0.1** 1.7±0.4# 1.3±0.1# 0.9±0.3 0.5±0.1*
p65
Nucleoporina
C JWH JWH J WH SR2 LY
+SR2 +LY
p65
Tubulina
Citoplasma

Resultados

0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
v
o
s

d
e

m
R
N
A
* *
C MET MET+SR2 MET+LY JWH JWH+S
N
i
v
e
l
e
s

r
e
l
a
t
i
R2 JWH+LY

100


C
Algunos autores han descrito que IL-6 es una citoquina implicada en el crecimiento celular en el
cáncer de próstata (Steiner et al., 2003). Tal y como se describe en esta Tesis doctoral, los
cannabinoides ejercen un claro efecto antiproliferativo en las células PC-3, a la par que inducen un
aumento de la secreción de IL-6. Esta aparente disyuntiva nos llevó a cuestionarnos el papel biológico
de la citoquina secretada por las células PC-3, por lo que decidimos estudiar su funcionalidad.

Uno de los principales efectores de IL-6 es el factor transcripcional STAT3, que se activa por
medio de tirosina quinasas de la familia Jak cuando IL-6 se une a su receptor, por lo que decidimos
estudiar su activación. Para ello llevamos a cabo un ensayo en el cuál, tras tratar las células PC-3 con



6.- PAPEL DE IL-6 EN EL CRECIMIENTO Y MUERTE
Figura 50. Los cannabinoides activan la expresión de IL-6 por medio de la uni . Las
ormente con MET 10 μM o JWH015 10 μM durante 24h. La
tal y como se describe en Materiales y Métodos. Los resultados
se expresan referidos al control, que se consideró 1. Los datos son medias +
ón de NFκB a su promotor
células fueron incubadas con SR2 y LY294002 y posteri
activación de la expresión de IL-6 se valoró mediante ChIP
ELULAR

6.1.- Funcionalidad de la IL-6 secretada por las células PC-3

MET10 μM, cannabinoide que producía el mayor aumento en la secreción de IL-6, se transfirieron los
sobrenadantes celulares a células HepG2 y LNCaP, líneas donde está descrito que STAT3 se activa en
presencia de IL-6. Paralelamente se incubaron las células HepG2 y LNCaP con IL-6 exógena, usándola
E.S. de dos experimentos realizados por
duplicado

. *p<0.01 respecto del control comparando mediante la t de Student.

Resultados

101

Se estudió por Western blot la activación de STAT3. La
figura es representativa de dos ensayos independientes.
Figura 52. Especificidad de la activación de STAT3 en presencia de IL-6. Las células PC-3 fueron incubadas durante
48 h con MET 10 μM y los sobrenadantes celulares fueron transferidos a células LNCaP. Estas células se incubaron
durante 30 min con los sobrenadantes o con IL-6 recombinante 100 ng/ml en presencia y ausencia de un anticuerpo
específico contra IL-6 a 5 mM. La activación de STAT3 se midió por Western blot. La figura es representativa de dos
ensayos independientes.

como contro

Para confirmar que la fosforilación de STAT3 se debía únicamente a la IL-6 secretada por las
células PC-3 y no a otros posibles elementos presentes en el sobrenadante celular, se llevó a cabo el
mismo ensayo de activación de STAT3 en la línea LNCaP, pero esta vez en presencia de un anticuerpo
específico contra IL-6. Como vemos en la figura 52, la activación de STAT3, tanto en el caso de IL-6
exógena como en el de IL-6 secretada por la células PC-3, fue revertida al incubar los sobrenadantes
con el anticuerpo anti-IL-6.
l positivo. Se analizó la fosforilación de STAT3 por Western blot en ambas líneas celulares.
De este modo se observó que STAT3 se activaba tanto al incubar las células con IL-6 exógena como
con el sobrenadante de las células PC-3 tratadas con cannabinoides, que debería contener la IL-6
secretada por estas células (figura 51).
HepG2 LNCap
Figura 51. Funcionalidad de IL-6 secretada por las células PC-3. Las células PC-3 fueron incubadas durante 48 h con
MET 10 μM y se transfirieron los sobrenadantes a células HepG2 y LNCaP. Ambas líneas celulares se incubaron durante
30 min con los sobrenadantes o con IL-6 recombinante 100 ng/ml.
pSTAT3
STAT3
pSTAT3
STAT3
IL‐6 recombinant IL‐6 PC‐3

Resultados

102


E

Posteriormente nos propusimos determinar de forma directa el efecto de IL-6 sobre la viabilidad
celular de la línea PC-3. Con este fin se incubaron las células con dosis crecientes de IL-6 exógena
6.3.- Expresión
stos resultados indican que la activación de STAT3 se debe a la IL-6 secretada por las células
PC-3 y por tanto la IL-6 secretada por las células PC-3 en presencia de cannabinoides era
funcionalmente activa.


6.2.- Efecto de IL-6 sobre la viabilidad celular.
durante 24 h y se valoró la viabilidad celular por MTT. No se obtuvieron cambios a ninguna de las dosis
de IL-6 estudiadas (figura 53), lo que indicaba que IL-6 no poseía ningún efecto sobre la viabilidad en
las células PC-3.

y actividad de STAT3

Pese a la demostración de la falta de efecto de la IL-6 sobre la viabilidad celular en la línea
PC-3, esta citoquina podría regular alguna otra función biológica mediante un bucle autocrino en estas
células. Para comprobar esta hipótesis, analizamos la activación de STAT3 en las células PC-3, ya que
esta activación se induce por la unión de IL-6 a su receptor, usando como control positivo células de
hepatoma HepG2. Como se observa en la figura 51, en las células HepG2 se detectó tanto la forma
total como la forma fosforilada de STAT3. Como era de esperar, cuando se trataron estas células con
IL-6, la forma fosforilada aumentó notablemente. Sin embargo, en células PC-3 no se apreció señal de
Figura 53. Efecto de IL-6 sobre
viabilidad celular. Las células se
incubaron con diferentes dosis de IL-6
recombinante durante 24 h, y la viabilidad
ce
de
lular se valoró por MTT tal y como se
scribe en Materiales y Métodos. Los
datos son medias + E.S. de dos
experimentos por triplicado.con la t de
Student.

0
20
0 1 2.5 5 10 25 50 100
V
i
a
b
i
l
i
d
a
d

c
e
l
u
l
a
r
(

%
)
60
80
100
120
40
IL-6 recombinante (ng/ml)

Resultados

103

F
n
M mRNA de las células PC-3 y LNCaP, y se
llevó a cabo una RT-PCR con oligonucleótidos específicos de STAT3. La figura es representativa de tres ensayos.

mediante RT-PCR. A nivel transcripcional tampoco detectamos
expresión del mRNA de STAT3 en las células PC-3, aunque sí se detectó en la línea LNCaP, como se
observa en la figura 54B.
ado que la IL-6 secretada por las células PC-3 no tenía ningún efecto sobre el crecimiento
ulas PC-3,
ino sobre alguno de los componentes de Sistema Inmune. En este sentido, se ha descrito que IL-6
puede
adantes
celulares de las células PC-3 tratadas fueron transferidos a los linfocitos aislados de sangre periférica
cultivándose durante 72 h. También se cultivaron estos linfocitos con IL-6 recombinante y con un
la forma fosforilada de STAT3, así como tampoco de la forma inactiva, ni en estado basal ni en
presencia de IL-6 (figura 54A).
Estos resultados indicaban que STAT3 no se expresaba en las células PC-3, y esto podría
explicar la falta de efecto de IL-6 en estas células. Para corroborar la ausencia de expresión de STAT3,
se analizó la presencia de mRNA
igura 54. Expresión de STAT3 en células PC-3. A) Las células PC-3 y HepG2 se incubaron con IL-6 recombinante 100
g/ml durante 30 min y se valoró la activación y presencia de STAT3 mediante Western blot tal y como se describe en
ateriales y Métodos. La figura es representativa de tres ensayos. B) Se aisló el

7.- ACTIVACIÓN DE LA RESPUESTA Th17

D
celular, nos planteamos si esta citoquina podría estar ejerciendo su efecto no sobre las cél
s
regular, junto a otras citoquinas, la diferenciación de linfocitos T nativos a linfocitos Th17 y en los
últimos tiempos se ha descubierto que estos linfocitos pueden ejercer respuestas antitumorales. Por
todo ello, nos propusimos estudiar la respuesta Th17 en nuestro modelo. Para ello se extrajeron células
de sangre periférica de individuos sanos y se aisló la línea blanca. Paralelamente se trataron células
PC-3 con MET 10 μM y JWH 10 μM durante 48 h, preincubando o no con SR2. Los sobren
pSTAT3
STAT3
PC-3 HepG2
500 pb
100 pb
LNCap PC-3
A) B)
STAT3

Resultados

1
tratam
como control y la IL-6 exógena.
ciación hacia Th17, induciendo la secreción de IL-17, lo
que podría tener un efecto antitumoral in vivo.


iento combinado de Ionomicina 1 μg/ml más forbol miristato acetato (PMA) 50 ng/ml como
control de activación linfocitaria (Maek et al., 2007). Transcurridas 72 h se valoró la producción de IL-
17. Como vemos en la figura 55 el tratamiento de las células PC-3 con JWH015 produjo un aumento
significativo de los niveles de IL-17 secretada, así como el tratamiento de PMA más Ionomicina usado

04



Estos datos sugieren que la IL-6 secretada por las células PC-3 tratadas con cannabinoides
podría producir activación de linfocitos y diferen
C JWH JWH+SR2 MET MET+SR2 SR2 Iono+PMA IL-6
p
g
/
m
l

I
L
-
1
7

(
%
)
0
200
1400
1600
*
**
Figura 55. Secreción de IL-17. Se aislaron linfocitos de sangre periférica que fueron incubados con IL-6 recombinante o
con los sobrenadantes provenientes de células PC-3 tratadas con MET 10 μM o JWH015 10 μM durante 48 h, en presencia
y ausencia de SR2. Se usó el tratamiento combinado de Ionomicina 1 μg/ml más PMA 50 ng/ml como control. Transcurridas
72 h, los niveles de IL-6 fueron medidos por ensayo ELISA. Los resultados se expresan como porcentaje frente al control,
que se consideró el 100 %. Los datos son medias + ES de dos experimentos realizados por triplicado. *p<0.05 y **p<0.01
respecto del control comparando con la t de Student.


Discusión

































DISCUSIÓN







Discusión

107



se
inv
el tratamiento con diferentes agentes farmacológicos. En este sentido, los cannabinoides son capaces de
producir muerte celular en diversos tipos celulares así como regresión tumoral en modelos in vivo,
incluyendo células de cáncer de próstata. Con estos antecedentes nos propusimos estudiar el efecto de
los cannabinoides en las células tumorales de próstata PC-3, que representan la fase más avanzada del
cáncer de próstata.

1.- EFECTO ANTIPROLIFERATIVO DE LOS
CANNABINOIDES

En trabajos anteriores de nuestro laboratorio se había demostrado que tanto el receptor CB1 (Ruiz
et al., 1999), como el CB2 (Sanchez et al., 2003a) y el TRPV1 (Sanchez et al., 2005) se expresaban en la
línea celular PC-3. Para estudiar el efecto de los cannabinoides sobre las células PC-3, se escogieron dos
cannabinoides sintéticos, MET y JWH015. MET fue seleccionada por ser análogo de uno de los
endocannabinoides más importantes en el organismo, la AEA, además de por su afinidad tanto a los
receptores de cannabinoides como al receptor de vanilloides TRPV1, lo que nos permitía un estudio de
efe
ba
lab
ind 9), lo que nos indujo a analizar el papel del receptor CB2
como responsable de los efectos apoptóticos de los cannabinoides en estas células.

Al
és
que JWH015, produciendo una disminución mayor de la viabilidad. Sin embargo, el efecto sobre la
inhibición de la proliferación fue de la misma magnitud con ambos cannabinoides y mucho más acusado
que el efecto sobre la viabilidad, llegándose a bloquear totalmente la proliferación. Por tanto, los
En la actualidad no existe tratamiento para la fase avanzada del cáncer de próstata, en la que las
lulas se vuelven insensibles a la terapia antiandrogénica y parecen perder la capacidad de responder a
ñales de inhibición del crecimiento e inducción de muerte celular. Una de las posibles vías de
estigación en el tratamiento del cáncer es el estudio de mecanismos antitumorales inducidos mediante
l
cto de los cannabinoides sobre varios receptores al mismo tiempo. La selección de JWH015 fue en
se a su propiedad de unirse específicamente al receptor CB2, ya que datos previos de nuestro
oratorio demostraban que el efecto apoptótico del THC sobre las células de cáncer de próstata era
ependiente del receptor CB1 (Ruiz et al., 199
estudiar el efecto de los cannabinoides sobre la viabilidad observamos una fuerte reducción de
ta ya a las 12 h de tratamiento, aunque el efecto máximo se producía a las 48 h. MET resultó más eficaz

Discusión

108

cannabinoides tenían un efecto principalmente citostático, aunque simultáneamente también presentaban
cierto efecto citotóxico.

En las células PC-3 otros autores (Mimeault et al., 2003b) habían descrito que AEA inhibía la
proliferación celular inducida por EGF a través del receptor CB1. Al prolongar este tratamiento en el tiempo
(5-6 días) se llegó a producir muerte celular, estando esta vez implicados los dos receptores de
cannabinoides. Así pues, dado que MET es un análogo más estable de AEA, puede que el hecho de que
en este trabajo se observe muerte a partir de las 24 h se deba a una mayor disponibilidad de MET. Las
diferencias observadas con el grupo de Mimeault respecto a la participación de CB1 pueden deberse a la
interacción de CB1 con receptores tirosina quinasa, ya que este grupo analiza el efecto de AEA en
respuesta a EGF. También se ha observado que los cannabinoides inhiben el crecimiento inducido por
factores de crecimiento, en la línea DU 145, en la que la AEA y 2-AG inhiben la proliferación inducida por
prolactina a través del receptor CB1 (Melck et al., 2000). Además, paralelamente a nuestros estudios
Sarfaraz y colaboradores han descrito que WIN-55,212-2, agonista sintético de CB1 y CB2, induce
apoptosis en la línea dependiente de andrógenos LNCaP, mediante parada de ciclo celular (Sarfaraz et al.,
2006). Otro efecto antitumoral de los cannabinoides observado en células de cáncer de próstata, es la
inhibición de la capacidad invasiva. Nithipatikom y colaboradores describieron este efecto al tratar las
células PC-3 y DU 145 con 2-AG (Nithipatikom et al., 2004). Así pues, nuestros datos están en
concordancia con los efectos antitumorales producidos por los cannabinoides en las células tumorales de
próstata observados por otros autores.

Al profundizar en el efecto antiproliferativo producido por MET y JWH015 mediante el estudio del
ciclo celular, se observó un aumento discreto pero significativo de la población de células apoptóticas a
partir de la dosis de 10 μM (fase subG
0/1
) y un incremento en la población celular tanto en fase S como en
fase G
2/
as se confirmó por ensayo de unión a anexina, obteniéndose
valores similares a los del estudio del ciclo celular. Sin embargo, al analizar la morfología nuclear no se
identificó la presencia de cuerpos apoptóticos, aunque sí se observó hipercromasia y aumento del tamaño
nuclear. Esto apoya la idea del efecto citostático de los cannabinoides, que podrían inhibir la proliferación
celular a través de dos mecanismos: inducción de apoptosis y parada de ciclo celular en fase G
2/M
. La
r el aumento de tamaño nuclear, pero no otros cambios relacionados con
aopotosis. Por otra parte, en algunos casos se ha descrito la ausencia de fragmentación de la cromatina
durante el proceso apoptótico (Zierler et al., 2006), lo que podría estar ocurriendo en nuestro caso.
M
. El aumento de células apoptótic
tinción con DAPI permitió aprecia

Discusión

109

Además, el hecho de que en los estudios de ciclo celular se aprecie cierto aumento en la población S,
te bloqueada, puede deberse a que en éste
3
H-timidina en las últimas 16 h, cuando
probablemente ya se haya producido la parada de ciclo celular.

El efecto de MET y JWH015 sobre la viabilidad celular también se observó en la línea celular
andrógeno dependiente LNCaP y la andrógeno independiente DU 145, representativa de los distintos
estados del cáncer de próstata. En todas estas líneas los cannabinoides indujeron una disminución de la
viabilidad celular. Por tanto, el efecto de los cannabinoides no se limitaba sólo a las células PC-3, si no que
se producía en todas las líneas tumorales de próstata estudiadas. Esto implicaría que el tratamiento con
cannabinoides podría ser efectivo no sólo en la fase más avanzada del cáncer, controlando su desarrollo,
sino también en sus inicios, frenando la patogénesis.

En cuanto el estudio del papel de los distintos receptores, tan sólo el antagonista de CB2, SR2, fue
capaz de bloquear parcialmente el efecto producido por MET sobre la viabilidad celular. Sin embargo, con
JWH015 se observó una clara inhibición de la disminución de la viabilidad, lo que reforzaba la implicación
de CB2 en este efecto. En el estudio de la apoptosis también se observó una reversión significativa del
aumento de las células apoptóticas inducido por los cannabinoides al pretratar las células con SR2. Todo
ello apuntaba a que la disminución de la viabilidad producida por los cannabinoides se llevaba a cabo por
mediación de CB2. Para confirmarlo, ya que el uso de antagonistas puede producir otros efectos no
específicos, se llevó a cabo el silenciamiento del receptor CB2 en las células PC-3, volviéndose a repetir la
inhibición de la apoptosis obtenida con el antagonista CB2, lo que confirmaba claramente la implicación de
CB2 en la inducción de apoptosis.

El efecto antiproliferativo y pro-apoptótico de los cannabinoides en las células PC-3 alentaba a
estudiar su posible papel antitumoral en otros modelos más próximos a la enfermedad. Con este fin, se
investigó el efecto de JWH015 en un modelo in vivo. Se generaron para ello tumores subcutáneos en
ratones atímicos mediante inyección de células PC-3 y posteriormente se trató a los ratones con tres
tratamientos: JWH015, JWH015 más el antagonista de CB2, SR2, y suero salino como control. El
tratamiento con JWH015 logró reducir significativamente tanto el tamaño tumoral como el peso del tumor,
mientras que en los ratones tratados con JWH015 más SR2 y en los controles, el crecimiento tumoral
ocurrió de forma descontrolada y de igual modo en ambos grupos. Estos datos confirmaban que JWH015
mientras que la incorporación de
3
H-timidina se vea totalmen
último ensayo se mide únicamente la incorporación de

Discusión

110

resentaba, además de un efecto antiproliferativo in vitro en las células PC-3, un efecto antitumoral en un
mode
estos modelos aislados muchas veces no se reproduzcan al pasar a un modelo in
vivo. En las pautas generales para la metodología de investigación y evaluación de la medicina tradicional
de la Organización Mundial de la Salud (OMS) (http://apps.who.int/medicinedocs/en/d/Js4930s/
p
lo in vivo, mediado a través del receptor CB2. Además, no se observó ninguna reducción del peso
corporal en los ratones, que podría estar relacionada con un efecto tóxico generalizado (Faure et al., 2010)
de los cannabinoides. Por tanto, JWH015, además de tener un efecto antitumoral, parecía no tener efectos
tóxicos en este modelo, siendo así un tratamiento seguro.

El uso de los modelos in vivo es clave para trasladar los efectos obtenidos en ensayos in vitro a un
posible uso terapéutico en el estudio de un agente farmacológico de estructura química conocida. La
idiosincrasia de los estudios in vitro, mucho menos compleja que la de un organismo vivo, hace que los
efectos obtenidos en
) se recoge
mar los datos obtenidos en ensayos in vivo, que pueden tomarse
como marcadores de inocuidad y desvelan de forma más confidente la eficacia terapéutica. Aún así las
difere


que, aunque los ensayos in vitro sirven para desvelar los mecanismos de acción del fármaco y son
indicadores de toxicidad, se deben confir
ncias existentes entre especies, así como las limitaciones en el diseño de modelos capaces de
reproducir la enfermedad, hacen que los ensayos in vivo no tengan los mismos resultados en el siguiente
paso hacia la aprobación del agente farmacológico, el estudio clínico, pero representan un paso más en la
concreción del uso terapéutico del fármaco sometido a estudio, además de ser la aproximación más
cercana. Por todo ello, el hecho de que JWH015 fuera capaz de controlar el crecimiento tumoral no sólo en
las células PC-3, sino también en este modelo in vivo, tiene una gran relevancia en el posible uso de los
cannabinoides como agentes antitumorales en el tratamiento del cáncer de próstata.






Discusión

111


mida podría estar relacionado con el efecto antiproliferativo de los
cannabinoides. De hecho, en las células PC-3 se había descrito anteriormente por otros autores así como
por nu
ejerce un papel clave en la resistencia a drogas y a radiación (Pchejetski et al., 2008; Mahdy et al., 2009).
2.- MECANISMO DE ACCIÓN DE LOS CANNABINOIDES
SOBRE LAS CÉLULAS PC-3
El estudio del mecanismo de acción de los cannabinoides sobre las células PC-3 se centró en el
análisis de la producción de ceramida y activación de diferentes cascadas intracelulares de señalización.

Tanto MET como JWH015 indujeron un aumento en la síntesis de ceramida, que se debía a la
síntesis de novo, ya que el inhibidor de la ceramida sintasa inhibía totalmente el incremento de ceramida
provocado por los cannabinoides. La degradación de esfingomielina de la membrana plasmática también
podría participar débilmente en este aumento, puesto que cuando se usaba el inhibidor de
esfingomielinasa se obtenía una pequeña disminución del incremento de ceramida inducido por los
cannabinoides, pero no llegó a ser significativo.

La función biológica de la ceramida está relacionada con el origen de la misma, de manera que un
aumento discreto de sus niveles, como el que se da a través de la hidrólisis de esfingomielina, suele
regular procesos metabólicos. Cuando el incremento de ceramida se produce de forma sostenida, a través
de la síntesis de novo o por regulación de distintas enzimas implicadas en su metabolismo, ésta suele
participar en procesos de muerte celular (Velasco et al., 2005). Por tanto, en nuestro sistema al producirse
por síntesis de novo, el aumento de cera
estro grupo de investigación, que la administración exógena de ceramida producía muerte celular
(Ruiz et al., 1999; Gewies et al., 2000). Esta relación se confirmó al usar el inhibidor de la síntesis de novo
para valorar tanto la disminución de la viabilidad celular, como la inducción de apoptosis, demostrándose
así que el incremento en la síntesis de ceramida participaba en la disminución del crecimiento celular y en
la apoptosis inducidas por los cannabinoides en las células PC-3.

La implicación de ceramida en el efecto antitumoral de los cannabinoides se ha descrito también en
otras líneas tumorales, entre ellas glioma (Carracedo et al., 2006b), linfoma (Gustafsson et al., 2009) y
cáncer de colon (Cianchi et al., 2008). Además, en las células tumorales de próstata este esfingolípido
está implicado en la inducción de apoptosis por varios agentes antitumorales (Mimeault et al., 2007;
Sanchez et al., 2007). Por otra parte, la alteración del metabolismo de ceramida en el cáncer de próstata

Discusión

112

abinoides en el aumento de ceramida
encontramos que sólo el antagonista de CB2 era capaz de bloquear significativamente el incremento en
los n
stá implicado el receptor CB2, aunque quedaría por
estudiar si otros receptores diferentes a CB1 y TRPV1, podrían participar también en el incremento de
ceram
emás, en otras líneas de cáncer de próstata se ha descrito que p38
posee un papel proliferativo, e incluso se encuentra sobre-expresada (Godoy-Tundidor et al., 2005). La
implic
Por tanto, los datos obtenidos en este trabajo están de acuerdo tanto con el papel de ceramida como
regulador de apoptosis, como con el efecto de los cannabinoides en otras líneas celulares.

Al estudiar la participación de los receptores de cann
iveles de ceramida producidos por los cannabinoides. Recientemente se ha descrito que los
cannabinoides pueden incrementar los niveles de ceramida en varios tipos celulares a través de otros
receptores como CB1 o el receptor activado por proliferadores de peroxisomas tipo gamma (γPPAR)
(Eichele et al., 2009; Gustafsson et al., 2009). Sin embargo, cada vez son más las evidencias que
demuestran una mayor eficiencia de CB2 en la regulación de la síntesis de ceramida inducida por los
cannabinoides (Carracedo et al., 2006a; Blazquez et al., 2008a; Blazquez et al., 2008b; Cianchi et al.,
2008). En nuestro modelo experimental únicamente e
ida.

Posteriormente estudiamos dos de las vías MAPKs, p38 y JNK, que responden a estímulos que
generan estrés celular inhibiendo generalmente señales promotoras del crecimiento celular, como las
activadas por ERK (Junttila et al., 2008). El tratamiento con JWH015 produjo una disminución tanto en la
fosforilación como en los niveles totales de p38 y al mismo tiempo una activación de JNK a tiempos cortos.
Este efecto contrario en la activación de ambas MAPKs resulta un tanto sorprendente, puesto que pueden
ser activadas por las mismas MAP3K (Kim et al., 2010) y suelen tener efectos sinérgicos. Aún así, también
hay datos de antagonismo entre ambas MAPKs (Perdiguero et al., 2007), pudiendo incluso inhibirse entre
sí (Heinrichsdorff et al., 2008). Ad
ación de JNK en la inducción de apoptosis se ha demostrado en líneas celulares derivadas de
distintos tipos de cáncer, como pulmón, colon, mama, ovario, riñón e hígado (Zou et al., 2008; Wei et al.,
2010). Por otra parte, en la línea de próstata DU 145 se había descrito que la activación de JNK producía
muerte celular a través del bloqueo del ciclo celular en la fase G
2/M,
sin mediación de otras MAPKs como
p38 y ERK (Cho et al., 2005). Así pues nuestros datos, aunque implican una regulación no convencional
de las MAPKs JNK/p38, concuerdan con el papel antiproliferativo de los cannabinoides en las células PC-
3, donde además de inducirse la apoptosis, también se observaba un bloqueo del ciclo celular en G
2/M
.


Discusión

113

ción celular activando entre otros sustratos a
mTOR, serina/treonina quinasa que regula la expresión de genes implicados en crecimiento, y a proteínas
pro-ap
nnabinoides pueden
roducir muerte celular por autofagia a través de la respuesta de estrés de retículo (Salazar et al., 2009).
or ello, nos planteamos si esto también ocurría en las células PC-3. Para descubrirlo analizamos la
sforilación de una de las proteínas implicadas en esta respuesta, el factor de iniciación de la
anscripción eIF2α. Cuando se activa la respuesta a estrés de retículo, este factor se fosforila e inactiva
or una de las proteínas del retículo endoplasmático que funcionan como sensores de estrés, la quinasa
ERK, bloqueándose la transcripción CAP-dependiente (Healy et al., 2009). Cuando tratamos a las células
C-3 con JWH015, se observó un aumento en la fosforilación de eIF2α, sugiriendo este dato que la
respuesta a estrés de retículo podría estar participando en el efecto sobre la muerte celular llevado a cabo
por los cannabinoides.

Siguiendo con el estudio de los mecanismos de señalización, pasamos a analizar otras vías
relacionadas con el estrés y el crecimiento celular. La vía PI3K/Akt es una de las más importantes en la
regulación del crecimiento celular. Además esta cascada está constitutivamente activada en las células
PC-3 (Nakatani et al., 1999), al perder el gen supresor de tumores PTEN, fosfatasa que desfosforila a PIP
3

(Davies et al., 1999). Esta vía puede promover la prolifera
optóticas como Bad (Lee et al., 2008). Por otra parte, la vía de PI3K/Akt puede cooperar con
distintas MAPKs en la inducción de la proliferación. En nuestro grupo de investigación se ha descrito
recientemente que Akt puede disminuir los niveles de ceramida en las células LNCaP, induciendo así
crecimiento de estas células (Malagarie-Cazenave et al., 2009). Por todo ello, analizamos la fosforilación
de Akt, indicativa de su activación. Vimos que JWH015 producía una estimulación a tiempos cortos y una
inhibición a tiempos más largos, bloqueándola totalmente a las 48 h de tratamiento.

Estos datos están en concordancia con los obtenidos por otros autores en la línea celular de
próstata 22RV1, extraída de un tumor xenógrafo de células CWR22, que mostraban un sinergismo entre
Akt y p38 (Godoy-Tundidor et al., 2005). Esto podría indicar que en las células de próstata p38 tendría un
papel de supervivencia, actuando de forma sinérgica con Akt, lo cual explicaría nuestros resultados sobre
la inhibición de p38 y Akt inducida por JWH015 a largo plazo. El papel de p38 en la supervivencia de
células de próstata se ha descrito también en respuesta a otros inductores como TNFRα (Royuela et al.,
2008) o a PDK (Chen et al., 2008a).

Recientemente se ha descrito en células tumorales de glioma que los ca
p
P
fo
tr
p
P
P

Discusión

114

las distintas vías de apoptosis en presencia de
ación de caspasa 9 sin producir cambios en la
aspasa 8. La activación de la ruta intrínseca produce alteraciones en la mitocondria que se pueden
detec
e
midieron los niveles citosólicos de citocromo c, que además participa en la formación del apoptosoma. Se
obser
as de respuesta a estrés que se han estudiado en este
trabajo con la vía intrínseca de la apoptosis, observando esta conexión también en varias líneas tumorales
de pró
or lo tanto, relacionando todo este acervo de datos, se podría concluir que los cannabinoides
induci
Por último, puesto que se había demostrado en este trabajo que los cannabinoides producían
apoptosis, se pasó a estudiar la posible activación de
JWH015. El tratamiento con JWH015 indujo una activ
c
tar por un aumento citosólico de proteínas mitocondriales liberadas al dañarse la membrana
mitocondrial, como el citocromo c (Russo et al., 2010). Para confirmar la activación de la vía intrínseca, s
vó un incremento en los niveles de esta proteína en el citosol, confirmándose por tanto que la ruta
que conducía a la apoptosis inducida por JWH015 era la vía intrínseca.

Sería necesario un estudio más amplio para demostrar la conexión de todas estas complejas vías de
señalización en el efecto producido por los cannabinoides. Sin embargo, en la literatura existen multitud de
datos sobre la interconexión de diversas proteín
stata al usar distintos agentes con propiedades antitumorales. Así, se ha descrito que el α−tocoferol
provoca apoptosis a través de la vía intrínseca por medio de la activación de JNK en células PC-3 (Zu et
al., 2005), el ácido urólico por activación de JNK e inhibición de Akt en las mismas células (Zhang et al.) y
el γ-tocoferol por aumento de la síntesis de novo de ceramida en la línea LNCaP (Jiang et al., 2004). De
igual modo se ha demostrado que la administración de ceramida exógena induce muerte celular en PC-3 y
DU 145 (Ruiz et al., 1999; Gewies et al., 2000) y que análogos de ceramida promueven apoptosis a través
de la inhibición de Akt en PC-3 (Oh et al., 2006). Por otro lado, los cannabinoides pueden también inducir
apoptosis en distintos modelos celulares como en células de hepatoma mediante la activación de JNK,
(Giuliano et al., 2009), en células de leucemia por inhibición de p38 (McKallip et al., 2006), en glioma y en
células tumorales de páncreas mediante estrés de retículo (Herrera et al., 2006; Salazar et al., 2009) y en
células de glioma por aumento de ceramida (Blazquez et al., 2008b).

P
rían una respuesta a estrés de retículo y un aumento en la síntesis de novo de ceramida en las
células PC-3, al activar JNK e inhibir tanto p38 como Akt, lo que conduciría en último término a la
inducción de apoptosis a través de la vía intrínseca (figura 53).



Discusión

115

, puesto que ya se ha comentado el papel que esta citoquina cumple en la regulación de
múltiples procesos en el cáncer de próstata. Así pues, al estar regulada de distinto modo por los
canna
por
cannabinoides, aunque no se puede descartar una posible colaboración de otros mecanismos
independientes de receptor en este efecto, ya que la incubación con el antagonista del receptor CB2 no
3.- SECRECIÓN DE IL-6 INDUCIDA POR LOS
DES CANNABINOI

Además del indudable papel de IL-6 como una de las principales citoquinas moduladoras del
sistema inmune, esta citoquina es capaz de regular diversas funciones biológicas en el cáncer de próstata,
entre ellas la expresión del AR (Culig et al., 2002; Neuwirt et al., 2007), la neurodiferenciación (Wang et al.,
2004a; Wang et al., 2004b) y la resistencia a drogas (Pu et al., 2004). A la vista de este preeminente papel,
nos propusimos estudiar su secreción en las células PC-3 y RWPE-1 en respuesta a los cannabinoides.
MET y JWH015 producían un sorpresivo incremento en los niveles de secreción de IL-6 en las células PC-
3, mayor en el caso de MET, siendo esta secreción dependiente de la dosis. Sin embargo en las células
RWPE-1, aunque éstas secretaban IL-6 de forma basal al igual que las PC-3, la incubación con los
cannabinoides no produjo ninguna variación. Esta respuesta diferente en ambas células es muy
interesante
binoides en células tumorales PC-3 y en células no tumorales RWPE-1, esta citoquina podría estar
cumpliendo un papel fisiológico diferente, de tal manera que en células neoplásicas el aumento de IL-6
podría suponer un intento de evasión de la inducción de muerte celular producida por los cannabinoides,
que no se daría en las células normales al ser éstas menos agresivas y por tanto carecer de mecanismos
antiapoptóticos de rescate. Al estudiar la secreción de IL-6 a lo largo del tiempo, observamos que MET era
capaz de incrementar la secreción ya a las 6 h, pero en el caso de JWH015 no se producía hasta las 48 h.
Estas diferencias temporales se suman al efecto superior de MET sobre la secreción. Estos datos hacen
pensar en una regulación diferencial de la secreción de IL-6 por parte de los dos cannabinoides,
probablemente debida a un distinto mecanismo de acción. Para analizar esto, pasamos a estudiar el papel
de los diferentes receptores en este efecto. Al emplear los antagonistas de los receptores de
cannabinoides y del receptor TRPV1 en presencia de MET, sólo se obtuvo una leve aunque significativa
reversión del incremento en la secreción de IL-6 inducido por MET con el antagonista de CB2. En el caso
de JWH015, el uso del antagonista de CB2 bloqueó totalmente el aumento en la secreción producido por
JWH015. Para confirmar el papel de CB2, se silenció su expresión y se valoraron los niveles de IL-6 en
presencia de JWH015, inhibiéndose de esta forma totalmente la secreción inducida por JWH015. Por
tanto, podemos afirmar que el receptor CB2 está regulando la secreción de IL-6 inducida

Discusión

116

bloqu

ulación del crecimiento celular, presentando efectos contrapuestos a
ésta (Gomez-Munoz, 2006). Además C1P puede modular también respuestas del sistema inmune, como la
fagoc
eaba totalmente la secreción inducida por MET. Esto concuerda con los datos obtenidos sobre la
proliferación celular. Aunque el efecto de MET era de mayor magnitud, sólo fue parcialmente revertido por
SR2 o por el silenciamiento de CB2. Esto indica que MET está actuando a través de varios mecanismos,
unos dependientes de CB2 y otros independientes, probablemente a través de interacciones inespecíficas
en la membrana plasmática o a través de otros receptores aún por identificar o no estudiados en este
trabajo. Sin embargo, el efecto del JWH105 era de menor magnitud, tanto en la inhibición del crecimiento
como en la inducción de secreción de IL-6, pero con este cannabinoide ambos efectos fueron totalmente
revertidos tanto por el antagonista como por el silenciamiento de CB2. Esto indica que JWH015 actúa
únicamente a través de CB2, lo que le convierte en un mejor candidato para su aplicación terapéutica, ya
que al ser su efecto más específico probablemente genere menos efectos secundarios no deseados.
Efectivamente esto se comprueba en los estudios in vivo, en los que JWH015 frenó el crecimiento del
tumor sin efectos secundarios aparentes y de forma totalmente dependiente de CB2.

Posteriormente nos planteamos si existía alguna relación entre el incremento de los niveles de
ceramida y la secreción de IL-6 en las células PC-3, ya que los cannabinoides inducían ambas respuestas.
Para ello usamos el inhibidor de la síntesis de novo de ceramida, encontrando que esta inhibición no
modificaba el efecto en la secreción de IL-6 producida por los cannabinoides. Por tanto la ceramida no
parecía estar implicada la regulación de la secreción de IL-6. Sin embargo, ceramida es el precursor de la
síntesis de muchos esfingolípidos complejos, entre ellos C1P (Saddoughi et al., 2008). C1P comparte
protagonismo con ceramida en la reg
itosis (Hinkovska-Galcheva et al., 2005; Kihara et al., 2007) y respuestas inflamatorias (Arana et al.,
2010). De hecho, C1P es el mayor regulador de la síntesis de eicosanoides, mediadores clave de
respuesta inflamatorias (Lamour et al., 2007). Estudiamos por todo ello su implicación en la secreción de
IL-6. Con este fin silenciamos la enzima encargada de fosforilar la ceramida, CERK y medimos los niveles
de IL-6 en presencia de MET. Al silenciar esta enzima se bloqueó totalmente el aumento en la secreción
de IL-6. Estos datos sugieren que los cannabinoides incrementarían la producción de IL-6 a través de
CERK y de forma independiente de la síntesis de novo. Pudiera ser que la ceramida que participa en la
regulación de la síntesis de IL-6 procediera de la hidrólisis de SM de la membrana plasmática, pero serían
necesarios más estudios para comprobar esta hipótesis.


Discusión

117

se observaron cambios en la
subunidad p52, implicada en la vía no canónica. Al estudiar la vía clásica, vimos que la incubación con
JWH0
ción de NFκB llevada a cabo por el
tratamiento con los cannabinoides, lo que era indicativo de que la vía de PI3K/Akt podía estar implicada en
la act
icativa de la participación de CB2 en este
proceso. Al valorar la activación de Akt en presencia del inhibidor de PI3K, pudimos observar una
inhibición de la fosforilación de Akt inducida por JWH015, por lo que podemos confirmar que la activación
Posteriormente quisimos valorar los mecanismos de señalización celular que podrían regular la
secreción de IL-6. El factor de transcripción NFκB regula comúnmente la expresión de genes implicados
en diversas respuestas del sistema inmune, entre los que se encuentran muchas citoquinas. De hecho, en
el promotor de la IL-6 existe al menos un sitio de unión para este factor transcripcional (Shimizu et al.,
1990; Gruss et al., 1992; Matsusaka et al., 1993). Se había descrito que en las células PC-3 la depleción
de Zinc podía inducir secreción de IL-6 a través de la activación del NFκB (Golovine et al., 2008). Así
pues, decidimos investigar si este factor de transcripción estaba implicado en la secreción de IL-6 inducida
por los cannabinoides. Para ello analizamos la activación de distintos componentes de la vía clásica de
activación de NFκB, centrándonos en la subunidad p65, ya que no
15 activaba distintos componentes de la misma, entre ellos IKKβ, quinasa del inhibidor de NFκB
IκBα, que se fosforilaba a tiempos muy tempranos de incubación (10-30 min). También observamos
fosforilación del propio inhibidor IκBα, así como disminución de sus niveles totales, indicativos ambos
efectos de su activación y degradación, respectivamente. Esta degradación es necesaria para la liberación
y activación del NFκB, permitiendo su translocación del citosol al núcleo, donde ejerce su función. Por ello,
analizamos la translocación del NFκB, viendo que existía un aumento de los niveles nucleares, a la par de
una disminución en los niveles citosólicos. Así pues, NFκB se activaba al incubar las células PC-3 con
cannabinoides a través de la vía clásica o canónica. El pretratamiento con SR2 inhibía la activación de
NFκB, lo que indicaba la participación del receptor CB2. Al mismo tiempo quisimos valorar si la vía de
PI3K/Akt estaba implicada en la regulación del NFκB por los cannabinoides. Tanto la vía de NFκB
(Lindholm et al., 2000) como la de PI3K/Akt (Nakatani et al., 1999) están constitutivamente activadas en
las células PC-3 y datos previos de nuestro laboratorio indicaban que los cannabinoides activaban la ruta
de PI3K/Akt (Sanchez et al., 2003a). Por todo ello, estudiamos la activación de NFκB en presencia del
inhibidor de PI3K, LY294002. Este inhibidor consiguió revertir la activa
ivación de NFκB. Para confirmar la activación Akt por los cannabinoides, valoramos su fosforilación
en presencia de MET y JWH015, observando un aumento de la fosforilación a tiempos cortos. Para ver la
posible implicación del receptor CB2 en esta activación, usamos el antagonista SR2 en presencia de
JWH015, obteniendo una inhibición de la activación de Akt ind

Discusión

118

escriben que Akt participa en la activación constitutiva de NFκB
cual se lleva a cabo incluye activación de la subunidad p65, al igual
que ocurre en nuestro modelo experimental.
de Akt se estaba llevando a cabo por PI3K. Estos resultados concuerdan con datos publicados
recientemente por otros autores que d
(Dan et al., 2008). El mecanismo por el

Una vez definida la vía de activación de NFκB y la implicación de PI3K/Akt en la misma, pasamos a
estudiar la posible contribución de ambas en la secreción de IL-6. Para ello se usó por un lado el inhibidor
de PI3K y por otro el de IKKβ en presencia de MET y JWH015 y se midieron así los niveles de IL-6. Los
dos inhibidores consiguieron revertir la inducción de la secreción provocada por los cannabinoides. Con el
fin de confirmar la importancia de NFκB en la secreción de IL-6, también se llevó a cabo el silenciamiento
de IKKβ y se analizó la secreción de IL-6, obteniendo una inhibición de la misma. Por último se estudió
directamente la unión de la subunidad p65 al promotor de la IL-6 mediante ensayo de inmunoprecipitación
de la cromatina, observando un aumento en la unión de este factor transcripcional al promotor de IL-6 al
tratar las células con JWH015. Este dato demostraba que los cannabinoides inducían la secreción de IL-6
al aumentar la expresión de esta citoquina por mediación de la subunidad p65 de NFκB. Por tanto, los
cannabinoides aumentarían la secreción de IL-6 a través de CB2, activando PI3K, que a su vez activaría
Akt, lo que induciría activación de NFκB y su desplazamiento al núcleo para regular la transcripción de IL-
6 (figura 56).

4.- PAPEL DE IL-6 SOBRE EL CRECIMIENTO Y MUERTE
CELULAR

Visto el papel antiproliferativo y pro-apoptótico de los cannabinoides y a su vez su implicación en la
secreción de IL-6 en las células PC-3, quedaba por resolver si los dos efectos estaban relacionados o si
eran activados de forma independiente. El efecto de IL-6 sobre el crecimiento y muerte celular en las
células tumorales de próstata no ha sido hasta ahora esclarecido, existiendo gran controversia en los
trabajos publicados. Algunos autores apuntan que IL-6 puede tener efecto anti-apoptótico en las células
PC-3 (Pu et al., 2004) y en otras líneas de cáncer de próstata (Steiner et al., 2003; Cavarretta et al., 2008).
Sin embargo, existen otros datos que indican que IL-6 no posee ningún efecto en el crecimiento de las
células de cáncer de próstata (Xing et al., 2001; Pierce et al., 2009), o incluso inhibe la proliferación de
células LNCaP (Wang et al., 2004a). También se ha demostrado la implicación de IL-6 en la reducción de

Discusión

119

oral podría sugerir o
bien que la secreción de IL-6 tenía algún efecto sobre la muerte celular o bien que se producía en
respu
lular empleada como control positivo. También se
analiz la expresión del mRNA de STAT3, encontrando que a nivel transcripcional tampoco había
expresión de STAT3. Estos resultados indican que STAT3 no se expresaba en las células PC-3, como
tumores xenógrafos (Wang et al., 2004b). Esto nos llevó a cuestionarnos el efecto de la IL-6 secretada por
las células PC-3. La incubación de las células LNCaP y HepG2 con los sobrenadantes de las células PC-3
tratadas con cannabinoides producía activación de STAT3. Con el fin de comprobar si esta activación era
debida a la IL-6 secretada por las células PC-3, se repitió el experimento tratando a los sobrenadantes con
un anticuerpo anti-IL-6. De este modo pudimos ver que al incubar los sobrenadantes con el anticuerpo
anti-IL-6, los niveles de activación de STAT3 disminuían. Por lo tanto, podríamos decir que la IL-6
secretada por las células PC- 3 era capaz de activar STAT3, y esto indicaba que esta IL-6 era
funcionalmente activa.

En este punto hemos de recordar que al estudiar la secreción de IL-6 a lo largo del tiempo en
respuesta a los cannabinoides, observábamos que esta secreción coincidía temporalmente con los efectos
antiproliferativos de los cannabinoides en las células PC-3. Esta concurrencia temp
esta a la misma. Sin embargo, al incubar las células PC-3 con la IL-6 recombinante no se obtuvo
ningún cambio en la viabilidad celular, lo que indicaba por tanto que IL-6 no tenía ningún efecto sobre la
muerte celular en la línea PC-3. Así pues, pudiera ser que la IL-6 secretada por las células PC-3 en
presencia de los cannabinoides se produjera como respuesta a la muerte celular provocada por éstos. Si
esto fuera así, la IL-6 podría estar regulando alguna otra función biológica mediante un bucle autocrino en
las células PC-3. Para comprobar esta hipótesis, nos centramos en el estudio de la activación de STAT3
en las células PC-3, puesto que este factor de transcripción es uno de los principales efectores de la IL-6 y
además existían datos sorprendentemente contradictorios sobre su expresión y actividad en las células
PC-3; algunos autores relacionaban una activación constitutiva del mismo como responsable de la
resistencia a drogas y los efectos antiapoptóticos en esta línea celular (Ni et al., 2000; Mora et al., 2002) y
otros sin embargo demostraban la ausencia de expresión de STAT3 en estas células (Spiotto et al., 2000;
Clark et al., 2003; Nadiminty et al., 2006). Esta controversia puede estar debida a la conocida inestabilidad
genética que caracteriza a las células tumorales, que también se da en las células de cáncer de próstata,
siendo mayor cuanto más agresivas son éstas (Duesberg et al., 1998; Beheshti et al., 2000). Al valorar la
activación de STAT3 por los cannabinoides no se detectó ni la forma fosforilada de esta proteína ni la
forma total en las células PC-3, lo que sugería que estas células no expresaban STAT3, ya que en el
mismo ensayo se comprobó la activación en otra línea ce
ó

Discusión

120

algun
debido probablemente a la falta de expresión de STAT3.
os autores habían descrito previamente. Este dato podría explicar la falta de efecto de IL-6 sobre el
crecimiento y muerte celular en la línea PC-3, ya que STAT3 modula la transcripción de diversos genes
que promueven supervivencia y proliferación celular (Bowman et al., 2001; Garcia et al., 2001).

En lo relativo al efecto de la IL-6 en la muerte y el crecimiento celular existen hoy en día demasiadas
incógnitas. Así, aunque esta citoquina se ha visto correlacionada con la progresión del cáncer de próstata
(Bouraoui et al., 2008), hasta ahora su papel en la patogénesis de éste cáncer no ha sido definido. Es
más, a pesar de que algunos estudios in vitro e in vivo parecían apoyar el papel de IL-6 en la patogénesis
del cáncer de próstata, otros muchos estudios in vitro y preclínicos han revelado resultados contradictorias
con el uso de anticuerpos anti-IL6 o con la propia IL-6 (Santer et al., 2010). Estudios epidemiológicos
recientes desmienten también la influencia de esta citoquina como factor de riesgo del cáncer de próstata
(Pierce et al., 2009). Además, existen otros estudios que demuestran que IL-6 participa en el efecto
antiproliferativo de otras citoquinas al regular la interacción entre fibroblastos y LNCaP in vitro (Kawada et
al., 1999). Así pues, la IL-6 secretada por las células PC-3 podría quizá ejercer su acción de forma
paracrina, regulando interacciones célula-célula, sin tener ningún efecto autocrino sobre las propias PC-3,
















Discusión

121

cción de los linfocitos T citotóxicos contra el tumor (Martin-
Orozc et al., 2009) y son capaces de inducir regresión tumoral in vivo e in vitro (Kryczek et al., 2009b). La
IL-6 e
sentido sobre estudios in vivo de tumorogénesis que indican que tan sólo los tumores con
una alta expresión de receptores de cannabinoides son susceptibles de ser tratados con cannabinoides,
lanzando la hipótesis de que cuando el tumor es capaz de responder a los cannabinoides, tanto el tumor
o et al., 2008; Pisanti et al., 2009a). Así, la capacidad intrínseca del tumor de
responder a los cannabinoides resultaría crítica para resolver el balance entre tolerancia al tumor y
respu
5.- ACTIVACIÓN DE LA RESPUESTA TH17

Recientemente se ha descubierto un tipo de linfocitos T que median en la respuesta antitumoral.
Son los linfocitos Th17, que promueven la a
o
s una de las citoquinas implicadas en la diferenciación de los linfocitos Th17 (O'Garra et al., 2008;
Awasthi et al., 2009). En próstata se ha demostrado que IL-6 media en la autoinmunidad de los linfocitos
Th17 contra la próstata (Kottke et al., 2007). Nuestros datos mostraban que el tratamiento con JWH015
producía un aumento discreto pero significativo de los niveles de IL-17 secretados por linfocitos humanos,
así como el tratamiento con PMA más Ionomicina y con IL-6 exógena, usados como controles positivos. El
antagonista de CB2 conseguía revertir parcialmente el efecto de JWH015, pero no de forma significativa.
Estos datos apuntan a que la IL-6 secretada por las células PC-3 podría inducir la diferenciación de los
linfocitos Th17, generando tal vez una posible respuesta antitumoral.

Aunque estos datos son preliminares y se debería estudiar más a fondo el papel de los Th17 en las
respuestas antitumorales generadas por los cannabinoides, son muy prometedores y podrían implicar una
ventaja adicional a una posible aproximación terapéutica basada en el uso de los cannabinoides. Existen
datos en este
como las células inmunes son dianas de los cannabinoides, produciéndose una regresión tumoral.
(Flygare et al., 2005; Bifulc
esta antitumoral y, en consecuencia, entre progresión y regresión del cáncer. De este modo, podría
darse un sinergismo entre el efecto de los cannabinoides sobre el tumor, y el efecto de los cannabinoides
sobre el sistema inmune, resultando por tanto el uso de los cannabinoides como antitumorales una terapia
de efecto combinado, dirigida contra el propio tumor, pero potenciando al mismo tiempo el efecto
antitumoral del sistema inmune.





Discusión

122

de atravesar la barrera hematoencefálica, al mismo tiempo que se persigue
favorecer la selectividad hacia CB2 a fin de evitar los efectos secundarios adversos mediados por CB1
(Worm
pero no de CB1 (Sanchez et al., 2001), y también un aumento en la expresión de CB2 en glioblastoma
6.- PAPEL DEL RECEPTOR CB2

Además de ser eficaz, un fármaco ha de ser seguro, disminuyendo al máximo los efectos adversos
derivados de su uso terapéutico. Uno de los principales problemas que limitan el uso de cannabinoides
son los efectos psicotrópicos que éstos presentan. Estos efectos están mediados a través del receptor
CB1, distribuido ampliamente por el sistema nervioso central (Anand et al., 2009; Worm et al., 2009; Patel
et al., 2010). En este sentido, se intenta limitar la accesibilidad al sistema nervioso central desarrollando
compuesto incapaces
et al., 2009). De hecho, las compañías farmacéuticas están dirigiendo sus esfuerzos hacia el
desarrollo de nuevos agonistas selectivos de CB2. Así pues, el hecho de que el efecto antitumoral de los
cannabinoides estudiado en esta Tesis doctoral se ejerza a través del receptor CB2, presenta una gran
ventaja, reduciendo los posibles efectos secundarios. Además en el estudio in vivo no se apreciaron
alteraciones asociadas a un efecto tóxico relacionado con el uso de los cannabinoides, manteniendo los
ratones su peso corporal a lo largo de los tratamientos sin presentar daños conspicuos en la fisionomía
interna o externa de los animales. Por lo tanto, el uso de agonistas de CB2 como antitumorales en el
cáncer de próstata parece un tratamiento seguro y eficaz.

Por otro lado existen varios datos que apuntan a la existencia de alteraciones del sistema
endocannabinoide en el cáncer de próstata. Sarfaraz y colaboradores observaron una mayor expresión de
los dos receptores de cannabinoides en las células tumorales de próstata, comparando con células
epiteliales no tumorales (Sarfaraz et al., 2005), y Endsley y colaboradores una sobre-expresión en los
niveles de FAAH comparándola con tejido normal (Endsley et al., 2008). Esta expresión diferencial podría
suponer una ventaja para el tratamiento del cáncer de próstata con cannabinoides, ya que respondería de
forma más eficaz a los cannabinoides por poseer mayor número de receptores. Así, un aumento en la
expresión de los receptores podría incrementar la señalización a través de vías de transducción
relacionadas con apoptosis o inhibir las de crecimiento celular, influyendo de esta forma en la regresión
tumoral. Todo ello hace pensar que los cannabinoides podrían ser empleados para controlar el crecimiento
tumoral en éste tipo de cáncer.

El papel del receptor CB2 en el efecto antitumoral de los cannabinoides está cobrando una gran
relevancia en los últimos años. Así, se ha descrito inhibición in vivo de gliomas con la participación de CB2

Discusión

123

uciéndose
una marcada supresión de CB1.

or otra parte también se ha demostrado en este trabajo que los cannabinoides son capaces de
incrementar la secreción de IL-6 por las células PC-3 y la liberación de IL-17 por células mononucleares,
todo ello con la participación de CB2. Además, este receptor se expresa altamente en las células del
sistema inmune, habiéndose demostrado que regula su migración e influye así en el reclutamiento de
estas células (Miller et al., 2008), lo que hace que haya sido considerado un elemento de unión clave en la
respuesta inmune al tumor (Cabral et al., 2009; Tanasescu et al., 2010). Así, los efectos de los
cannabinoides podrían tener una especial relevancia sobre la respuesta del sistema inmune al tumor, ya
que la secreción de citoquinas es el principal elemento regulador de las respuestas celulares del sistema
inmune y la quimioatracción de las células del sistema inmune hacia el tumor es una de las principales
estrategias perseguidas en inmunoterapia. La implicación del receptor CB2 en todos estos efectos subraya
la utilidad de los agonistas de este receptor. Este posible papel del receptor CB2 sobre el sistema inmune,
unido a los efectos anti-proliferativos y pro-apoptóticos de MET y JWH015 sobre las células PC-3 y a la
acción antitumoral de JWH015 en tumores xenógrafos descritos en esta Tesis, proporciona las bases para
el estudio clínico de agonistas de CB2 en el tratamiento del cáncer de próstata, ya que estos compuestos
podrían actuar mediante un mecanismo dual sobre el tumor y sobre el sistema inmune con un efecto
multiforme y astrocitoma (De Jesus et al., 2010). En carcinoma endometrial también se produce aumento
de la expresión de CB2 y del endocannabinoide 2-AG (Guida et al., 2010). En cáncer de mama se ha
descrito una expresión diferencial de los receptores de cannabinoides, aumentando CB2 y prod

En muchos casos el efecto antitumoral de los cannabinoides está mediado a través del receptor
CB2. Por ejemplo, los cannabinoides pueden inducir apoptosis a través de CB2 en sebocitos por
activación de JNK y en células de leucemia a través de un aumento en los niveles de ceramida (Herrera et
al., 2006). También la capacidad invasiva de las células tumorales se ha visto inhibida a través de CB2. En
glioma y en adenocarcinoma cervicouterino MET y THC inducen la expresión de metaloproteasas y
amento de su inhibidor TIMP a través de CB2, afectando así a la capacidad invasiva de las células
malignas (Blazquez et al., 2008a; Ramer et al., 2010). Todos estos datos están de acuerdo con el papel
antitumoral de los cannabinoides estudiado en esta Tesis, demostrando que los cannabinoides ejercen un
efecto antitumoral tanto in vitro como in vivo en células tumorales de próstata PC-3, por mediación del
receptor CB2, incrementando los niveles de ceramida y activando varias cascadas de señalización
intracelular.
P

Discusión

124

rse en un potente sinergismo
ltamente eficaz en la lucha contra el cáncer de próstata.








común antitumoral. La combinación de ambas respuestas podría concreta
a


Los datos presentados en esta Tesis doctoral apuntan a nuevas evidencias sobre el papel del
receptor CB2 en la acción antitumoral de los cannabinoides y proporcionan una base razonable para la
aplicación terapéutica de agonistas de CB2 en el tratamiento del cáncer de próstata.

























Discusión




Figura 56. Posible mecanismo de acción de los cannabinoides en las células PC-3
125







Conclusiones





























CONCLUSIONES










Conclusiones

129




1 - MET y JWH015 inhiben el crecimiento de las células PC-3 e inducen muerte celular.
Estos efectos están mediados a través del receptor CB2, ya que la inhibición farmacológica de éste
receptor, así como su silenciamiento génico, lo revierten. La muerte celular se produce por un
mecanismo de apoptosis que se activa a través de la vía intrínseca, ya que aumenta la liberación de
citocromo c al citosol y la proteólisis de la caspasa 9.

2 - MET y JWH015 provocan un aumento de la síntesis de novo de ceramida a través del
receptor CB2. Este incremento está involucrado en la disminución de la viabilidad celular provocada por
MET y JWH015, ya que al bloquear la síntesis de ceramida se inhibe este efecto.

3 - En las células de próstata PC-3, JWH015 activa Akt y JNK e inhibe p38 y eIF2.

4 - JWH015 frena el crecimiento de tumores xenógrafos en ratones atímicos nu/nu y
produce una disminución en el peso tumoral al final del tratamiento. En este efecto está implicado el
receptor de cannabinoides CB2, ya que el tratamiento con JWH015+SR2 resulta en un crecimiento
descontrolado del tumor, similar al grupo control, lo que implica que le receptor CB2 es el responsable
de la regresión tumoral inducida por JWH015.

5 - MET y JWH015 inducen un aumento en la síntesis y secreción de IL-6 por las células
PC-3, sin ejercer ningún efecto sobre la secreción de IL-6 por las células no tumorales RWPE-1. El
aumento en la secreción de IL-6 en las células PC-3 es llevado a cabo a través del receptor CB2, como
prueba la reversión del mismo tanto en presencia de su antagonista como con el silenciamiento del
receptor. Aunque la síntesis de ceramida no está implicada en el aumento de la secreción de IL-6
inducida por los cannabinoides, el silenciamiento génico de CERK lo bloquea totalmente, lo que indica
la mediación de C1P.









Conclusiones

130


6 - La activación del factor de transcripción NFκB está implicada en la síntesis de IL-6
inducida por JWH015, ya que el inhibidor de la quinasa IKKβ bloquea el aumento en la secreción de
IL-6. Esta activación se lleva a cabo por la vía clásica, ya que JWH015 provoca una activación de la
quinasa IKKβ, una inhibición del inhibidor IκBα y un aumento de los niveles nucleares de la subunidad
p65 de NFκB. La incubación con JWH015 sin embargo no afecta a los niveles de la subunidad p52,
implicada en la vía no clásica de activación de NFκB. La activación de NFκB hace que éste se una al
promotor de IL-6, aumentando así la expresión de esta citoquina

7 - La vía de PI3K/Akt se activa en presencia de cannabinoides y además está implicada
en la activación de NFκB por JWH015, como demuestra la reversión de la activación de NFκB al
emplear el inhibidor de PI3K. Por tanto, en las células PC-3 los cannabinoides MET y JWH015
aumentan la secreción de IL-6 través de un mecanismo que implica la activación secuencial de CB2,
vía PI3K/Akt, y NFκB, que al unirse al promotor de IL-6, induciría su expresión.

8 - El tratamiento de las células PC-3 con JWH015, así como la incubación con IL-6
exógena, inducen un incremento en los niveles de IL-17 secretados por células humanas
mononucleares, que es atenuado por el pretratamiento con el antagonista del receptor CB2.



Bibliografía



































BIBLIOGRAFÍA









Bibliografía

133


A
binoids in the treatment of
cancer. Cancer Lett, 285, 6-12.
AMARNATH, ., DONG, L., LI, J., WU, Y. & CHEN, W. (2007). Endogenous TGF-beta activation by
Lett, 291, 1-
13.
ANTONARAK , E.S. & DRAKE, C.G. (2010b). Current status of immunological therapies for

CERWENKA, A., BENHARROCH, D., SION-VARDY, N., PORGADOR, A. & MANDELBOIM, O.
(2008). Harnessing soluble NK cell killer receptors for the generation of novel cancer
immune therapy. PLoS One, 3, e2150.
AWASTHI, A. & KUCHROO, V.K. (2009). Th17 cells: from precursors to players in inflammation
and infection. Int Immunol, 21, 489-98.
AWASTHI, A., MURUGAIYAN, G. & KUCHROO, V.K. (2008). Interplay between effector Th17 and
regulatory T cells. J Clin Immunol, 28, 660-70.
BARTON, B.E., MURPHY, T.F., ADEM, P., WATSON, R.A., IRWIN, R.J. & HUANG, H.F. (2001). IL-6
signaling by STAT3 participates in the change from hyperplasia to neoplasia in NRP-
152 and NRP-154 rat prostatic epithelial cells. BMC Cancer, 1, 19.
BASSO, A.S., CHEROUTRE, H. & MUCIDA, D. (2009). More stories on Th17 cells. Cell Res, 19,
399-411.
BEGLEY, L.A., KASINA, S., MACDONALD, J. & MACOSKA, J.A. (2008). The inflammatory
microenvironment of the aging prostate facilitates cellular proliferation and
hypertrophy. Cytokine, 43, 194-9.
BEHESHTI, B., KARASKOVA, J., PARK, P.C., SQUIRE, J.A. & BEATTY, B.G. (2000). Identification of
a high frequency of chromosomal rearrangements in the centromeric regions of
prostate cancer cell lines by sequential giemsa banding and spectral karyotyping. Mol
Diagn, 5, 23-32.
BETTELLI, E., CARRIER, Y., GAO, W., KORN, T., STROM, T.B., OUKKA, M., WEINER, H.L. &
KUCHROO, V.K. (2006). Reciprocal developmental pathways for the generation of
pathogenic effector TH17 and regulatory T cells. Nature, 441, 235-8.
BIFULCO, M., MALFITANO, A.M., PISANTI, S. & LAEZZA, C. (2008). Endocannabinoids in endocrine
and related tumours. Endocr Relat Cancer, 15, 391-408.
BADJI, V., LIN, S., TAHA, G., GRIFFIN, G., STEVENSON, L.A., PERTWEE, R.G. & MAKRIYANNIS, A.
(1994). (R)-methanandamide: a chiral novel anandamide possessing higher potency
and metabolic stability. J Med Chem, 37, 1889-93.
AHLSTRAND, C., CARLSSON, P. & JONSSON, B. (1996). An estimate of the life-time cost of
surgical treatment of patients with benign prostatic hyperplasia in Sweden. Scand J
Urol Nephrol, 30, 37-43.
ALCARAZ, A., HAMMERER, P., TUBARO, A., SCHRODER, F.H. & CASTRO, R. (2009). Is there
evidence of a relationship between benign prostatic hyperplasia and prostate cancer?
Findings of a literature review. Eur Urol, 55, 864-73.
ALEXANDER, A., SMITH, P.F. & ROSENGREN, R.J. (2009). Canna
S
reactive oxygen species is key to Foxp3 induction in TCR-stimulated and HIV-1-
infected human CD4+CD25- T cells. Retrovirology, 4, 57.
ANAND, P., WHITESIDE, G., FOWLER, C.J. & HOHMANN, A.G. (2009). Targeting CB2 receptors
and the endocannabinoid system for the treatment of pain. Brain Res Rev, 60, 255-
66.
ANTONARAKIS, E.S., CARDUCCI, M.A. & EISENBERGER, M.A. (2010a). Novel targeted
therapeutics for metastatic castration-resistant prostate cancer. Cancer
IS
prostate cancer. Curr Opin Urol, 20, 241-6.
ARANA, L., GANGOITI, P., OURO, A., TRUEBA, M. & GOMEZ-MUNOZ, A. (2010). Ceramide and
ceramide 1-phosphate in health and disease. Lipids Health Dis, 9, 15.
ARNON, T.I., MARKEL, G., BAR-ILAN, A., HANNA, J., FIMA, E., BENCHETRIT, F., GALILI, R.,

Bibliografía

134

ISPO DE JESUS, M., ZAMBUZZI, W.F., RUELA DE SOUSA, R.R., ARECHE, C., SANTOS DE SOUZA,
A.C., AOYAMA, H., SCHMEDA-HIRSCHMANN, G., RODRIGUEZ, J.A., MONTEIRO DE SOUZA
BRITO, A.R., PEPPELENBOSCH, M.P., DEN HERTOG, J., DE PAULA, E. & FERREIRA, C.V.
(2008). Ferruginol suppresses survival signaling pathways in androgen-independent
human prostate cancer cells. Biochimie, 90, 843-54.
BLAZQUEZ, C., CARRACEDO, A., SALAZAR, M., LORENTE, M., EGIA, A., GONZALEZ-FERIA, L., HARO,
A., VELASCO, G. & GUZMAN, M. (2008a). Down-regulation of tissue inhibitor of
metalloproteinases-1 in gliomas: a new marker of cannabinoid antitumoral activity?
Neuropharmacology, 54, 235-43.
BLAZQUEZ, C., SALAZAR, M., CARRACEDO, A., LORENTE, M., EGIA, A., GONZALEZ-FERIA, L., HARO,
A., VELASCO, G. & GUZMAN, M. (2008b). Cannabinoids inhibit glioma cell invasion by
down-regulating matrix metalloproteinase-2 expression. Cancer Res, 68, 1945-52.
BOSIER, B., MUCCIOLI, G.G., HERMANS, E. & LAMBERT, D.M. (2010). Functionally selective
cannabinoid receptor signalling: therapeutic implications and opportunities. Biochem
Pharmacol, 80, 1-12.
BOURAOUI, Y., RICOTE, M., GARCIA-TUNON, I., RODRIGUEZ-BERRIGUETE, G., TOUFFEHI, M., RAIS,
N.B., FRAILE, B., PANIAGUA, R., OUESLATI, R. & ROYUELA, M. (2008). Pro-inflammatory
cytokines and prostate-specific antigen in hyperplasia and human prostate cancer.
Cancer Detect Prev, 32, 23-32.
BOWMAN, T., BROOME, M.A., SINIBALDI, D., WHARTON, W., PLEDGER, W.J., SEDIVY, J.M., IRBY, R.,
YEATMAN, T., COURTNEIDGE, S.A. & JOVE, R. (2001). Stat3-mediated Myc expression is
required for Src transformation and PDGF-induced mitogenesis. Proc Natl Acad Sci U
S A, 98, 7319-24.
BRADFORD, M.M. (1976). A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72,
248-54
B
RIGANTI
, A., C
APITANIO
, U., S
UARDI
, N., G
ALLINA
, A., S
ALONIA
, A., B
IANCHI
, M., T
UTOLO
, A., D
I GIROLAMO
,
V.& G
UAZZONI
, G. (2009) Benign Prostatic Hyperplasia and Its Aetiologies. European
Urology Suplements, 8, 856-871
BROMBERG, J. (2002). Stat proteins and oncogenesis. J Clin Invest, 109, 1139-42.
BROWN, A.J. & ROBIN HILEY, C. (2009). Is GPR55 an anandamide receptor? Vitam Horm, 81,
111-37.
BURSTEIN, S.H. & ZURIER, R.B. (2009). Cannabinoids, endocannabinoids, and related analogs
in inflammation. AAPS J, 11, 109-19.
CABRAL, G.A. & GRIFFIN-THOMAS, L. (2009). Emerging role of the cannabinoid receptor CB2 in
immune regulation: therapeutic prospects for neuroinflammation. Expert Rev Mol
Med, 11, e3.
CABRESPINE, A., BAY, J.O., VERRELLE, P. & MOREL, L. (2007). [Interleukin-6 implication in
prostate cancer]. Bull Cancer, 94, F29-34.
CARLSSON, B., FORSBERG, O., BENGTSSON, M., TOTTERMAN, T.H. & ESSAND, M. (2007).
Characterization of human prostate and breast cancer cell lines for experimental T
cell-based immunotherapy. Prostate, 67, 389-95.
CARRACEDO, A., GIRONELLA, M., LORENTE, M., GARCIA, S., GUZMAN, M., VELASCO, G. & IOVANNA,
J.L. (2006a). Cannabinoids induce apoptosis of pancreatic tumor cells via
endoplasmic reticulum stress-related genes. Cancer Res, 66, 6748-55.
CARRACEDO, A., LORENTE, M., EGIA, A., BLAZQUEZ, C., GARCIA, S., GIROUX, V., MALICET, C.,
VILLUENDAS, R., GIRONELLA, M., GONZALEZ-FERIA, L., PIR
GUZMAN, M. & VELASCO, G. (2006b). The stress-regula
cannabinoid-induced apoptosis of tumor cells. Cancer Cell, 9, 301-12.
B
IS, M.A., IOVANNA, J.L.,
ted protein p8 mediates

Bibliografía

135

CAVARRETTA, I.T., NEUWIRT, H., ZAKI, M.H., STEINER, H., HOBISCH, A., NEMETH, J.A. & CULIG, Z.
(2008). Mcl-1 is regulated by IL-6 and mediates the survival activity of the cytokine in
a model of late stage prostate carcinoma. Adv Exp Med Biol, 617, 547-55.
CIANCHI, F., PAPUCCI, L., SCHIAVONE, N., LULLI, M., MAGNELLI, L., VINCI, M.C., MESSERINI, L.,
MANERA, C., RONCONI, E., ROMAGNANI, P., DONNINI, M., PERIGLI, G., TRALLORI, G.,
TANGANELLI, E., CAPACCIOLI, S. & MASINI, E. (2008). Cannabinoid receptor activation
induces apoptosis through tumor necrosis factor alpha-mediated ceramide de novo
synthesis in colon cancer cells. Clin Cancer Res, 14, 7691-700.
CLARK, J., EDWARDS, S., FEBER, A., FLOHR, P., JOHN, M., GIDDINGS, I., CROSSLAND, S.,
STRATTON, M.R., WOOSTER, R., CAMPBELL, C. & COOPER, C.S. (2003). Genome-wide
screening for complete genetic loss in prostate cancer by comparative hybridization
onto cDNA microarrays. Oncogene, 22, 1247-52.
CRAWFORD, E.D., ANDRIOLE, G.L., MARBERGER, M. & RITTMASTER, R.S. (2009). Reduction in the
Risk of Prostate Cancer: Future Directions After the Prostate Cancer Prevention Trial.
Urology.
CULIG, Z. (2005). Interleukin-6 polymorphism: expression and pleiotropic regulation in human
prostate cancer. J Urol, 174, 417.
CULIG, Z., BARTSCH, G. & HOBISCH, A. (2002). Interleukin-6 regulates androgen receptor
activity and prostate cancer cell growth. Mol Cell Endocrinol, 197, 231-8.
CUNHA, G.R. (2008). Mesenchymal-epithelial interactions: past, present, and future.
Differentiation, 76, 578-86.
CHEN, J., DENG, F., SINGH, S.V. & WANG, Q.J. (2008a). Protein kinase D3 (PKD3) contributes
to prostate cancer cell growth and survival through a PKCepsilon/PKD3 pathway
downstream of Akt and ERK 1/2. Cancer Res, 68, 3844-53.
CHEN, W., WANG, X., BAI, L., LIANG, X., ZHUANG, J. & LIN, Y. (2008b). Blockage of NF-kappaB
by IKKbeta- or RelA-siRNA rather than the NF-kappaB super-suppressor
IkappaBalpha mutant potentiates adriamycin-induced cytotoxicity in lung cancer cells.
J Cell Biochem, 105, 554-61.
CHESNOKOV, V., SUN, C. & ITAKURA, K. (2009). Glucosamine suppresses proliferation of human
prostate carcinoma DU145 cells through inhibition of STAT3 signaling. Cancer Cell
Int, 9, 25.
CHO, S.D., LI, G., HU, H., JIANG, C., KANG, K.S., LEE, Y.S., KIM, S.H. & LU, J. (2005).
Involvement of c-Jun N-terminal kinase in G2/M arrest and caspase-mediated
apoptosis induced by sulforaphane in DU145 prostate cancer cells. Nutr Cancer, 52,
213-24.
DALTON, G.D., BASS, C.E., VAN HORN, C.G. & HOWLETT, A.C. (2009). Signal transduction via
cannabinoid receptors. CNS Neurol Disord Drug Targets, 8, 422-31.
DAN, H.C., COOPER, M.J., COGSWELL, P.C., DUNCAN, J.A., TING, J.P. & BALDWIN, A.S. (2008).
Akt-dependent regulation of NF-{kappa}B is controlled by mTOR and Raptor in
association with IKK. Genes Dev, 22, 1490-500.
DAVIES, M.A., KOUL, D., DHESI, H., BERMAN, R., MCDONNELL, T.J., MCCONKEY, D., YUNG, W.K. &
STECK, P.A. (1999). Regulation of Akt/PKB activity, cellular growth, and apoptosis in
prostate carcinoma cells by MMAC/PTEN. Cancer Res, 59, 2551-6.
DE BACKER, B., DEBRUS, B., LEBRUN, P., THEUNIS, L., DUBOIS, N., DECOCK, L., VERSTRAETE, A.,
HUBERT, P. & CHARLIER, C. (2009). Innovative development and validation of an
HPLC/DAD method for the qualitative and quantitative determination of major
cannabinoids in cannabis plant material. J Chromatogr B Analyt Technol Biomed Life
Sci, 877, 4115-24.

Bibliografía

136

E JESUS, M.L., HOSTALOT, C., GARIBI, J.M., SALLES, J., MEANA, J.J. & CALLADO, L.F. (2010).
DE MAR
DE PE
DEVANE
i
DEVLIN,
DOZMOR
D
Opposite changes in cannabinoid CB1 and CB2 receptor expression in human
gliomas. Neurochem Int, 56, 829-33.
ZO, A.M., PLATZ, E.A., SUTCLIFFE, S., XU, J., GRONBERG, H., DRAKE, C.G., NAKAI, Y.,
I .B. & N SAACS, W ELSON, W.G. (2007). Inflammation in prostate carcinogenesis. Nat
Rev Cancer, 7, 256-69.
TROCELLIS, L. & DI MARZO, V. (2010). Non-CB1, non-CB2 receptors for
endocannabinoids, plant cannabinoids, and synthetic cannabimimetics: focus on G-
protein-coupled receptors and transient receptor potential channels. J Neuroimmune
Pharmacol, 5, 103-21.
OC ., ME ALMISANO DE PETR ELLIS, L LCK, D., P , A., BISOGNO, T., LAEZZA, C., BIFULCO, M. & DI
MARZO, V. (1998). The endogenous cannabinoid anandamide inhibits human breast
ca ell p o ncer c roliferation. Pr c Natl Acad Sci U S A, 95, 8375-80.
DELONGCHAMPS, N.B., DE LA ROZA, G., CHANDAN, V., JONES, R., SUNHEIMER, R., THREATTE, G.,
JUMBELIC, M. & HAAS, G.P. (2008). Evaluation of prostatitis in autopsied prostates--is
ic inflam more with ben chron mation associated ign prostatic hyperplasia or cancer? J
Urol, 179, 1736-40.
, W.A., DYSARZ, F.A., 3RD, JOHNSON, M.R., MELVIN, L.S. & HOWLETT, A.C. (1988).
Determination and characterization of a cannab noid receptor in rat brain. Mol
Pharmacol, 34, 605-13.
H.L. & MUDRYJ, M. (2009). Progression of prostate cancer: multiple pathways to
androgen independence. Cancer Lett, 274, 177-86.
DI MARZO, V. (2009). The endocannabinoid system: its general strategy of action, tools for its
pharmacological manipulation and potential therapeutic exploitation. Pharmacol Res,
60, 77-84.
& R , L. ). Si n ns u activated DIAZ-LAVIADA, I. UIZ-LLORENTE (2005 g al tra d ction by cannabinoid
receptors. Mini Rev Med Chem, 5, 619-30.
OV, M.G., HURST, R.E., CULKIN, D.J., KROPP, B.P., FRANK, M.B., OSBAN, J., PENNING,
T.M. & LIN, H.K. (2009). Unique patterns of molecular profiling between human
prostate cancer LNCaP and PC-3 cells. Prostate, 69, 1077-90.
DUESBERG, P., RAUSCH, C., RASNICK, D. & HEHLMANN, R. (1998). Genetic instability of cancer
cells is proportional to their degree of aneuploidy. Proc Natl Acad Sci U S A, 95,
13692-7.
V L , S. DUNCAN, J.S., TUROWEC, J.P., ILK, G., I S., GLOOR, G.B. & LITCHFIELD, D.W. (2010).
Regulation of cell proliferation and survival: convergence of protein kinases and
caspases. Biochim Biophys Acta, 1804, 505-10.
MER, R. & H EICHELE, K., RA INZ, B. (2009). R(+)-methanandamide-induced apoptosis of human
cervical carcinoma cells involves a cyclooxygenase-2-dependent pathway. Pharm
Res, 26, 346-55.
EMBERTON, M., CORNEL, E.B., BASSI, P.F., FOURCADE, R.O., GOMEZ, J.M. & CASTRO, R. (2008).
Benign prostatic hyperplasia as a progressive disease: a guide to the risk factors and
o for medic ag ptions al man ement. Int J Clin Pract, 62, 1076-86.
ENDSLEY, M.P., THILL, R., CHOUDHRY, I., WILLIAMS, C.L., KAJDACSY-BALLA, A., CAMPBELL, W.B. &
NITHIPATIKOM, K. (2008). Expression and function of fatty acid amide hydrolase in
prostate cancer. Int J Cancer, 123, 1318-26.
ISHER, D EVANS, S.S., F .T., SKITZKI, J.J. & CHEN, Q. (2008). Targeted regulation of a
lymphocyte-endothelial-interleukin-6 axis by thermal stress. Int J Hyperthermia, 24,
67-78.
N M M.M. FAHY, B. ., SCHLIEMAN, M.G., ORTENSON, , VIRUDACHALAM, S. & BOLD, R.J. (2005).
Targeting BCL-2 overexpression in various human malignancies through NF-kappaB

Bibliografía

137

FAURE,
FENG, Y -activated protein kinase and
FIRE, A.
articipates in growth regulation of human breast carcinoma cells.
GE, K.,
P., MALKOWICZ, S.B., TOMASZEWSKI, J. & PRENDERGAST, G.C. (2000). Loss of
GERAMO ENIS, P., THANOU, V., LIAGKA, D., SIAMBLIS, D. &
pelvic pain
GERRA, OVIC, A., GERRA, M.L., CICCOCIOPPO, R., CIPPITELLI, A., SERPELLONI, G. &
t CNS Drug Discov, 5, 46-52.
apoptosis. Lab Invest, 80, 671-6.
is induced in HepG2 cells by the synthetic
GLOIRE, ppaB activation by reactive oxygen
GODLEW
diat, 89, 105-
GODOY-
the signaling
inhibition by the proteasome inhibitor bortezomib. Cancer Chemother Pharmacol, 56,
46-54.
F., DA SILVA, S.V., JAKOB, I., PASQUIS, B. & SICARD, G. (2010). Peripheral olfactory
sensitivity in rodents after treatment with docetaxel. Laryngoscope, 120, 690-7.
., WEN, J. & CHANG, C.C. (2009). p38 Mitogen
hematologic malignancies. Arch Pathol Lab Med, 133, 1850-6.
, XU, S., MONTGOMERY, M.K., KOSTAS, S.A., DRIVER, S.E. & MELLO, C.C. (1998). Potent
and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature, 391, 806-11.
FLYGARE, J., GUSTAFSSON, K., KIMBY, E., CHRISTENSSON, B. & SANDER, B. (2005). Cannabinoid
receptor ligands mediate growth inhibition and cell death in mantle cell lymphoma.
FEBS Lett, 579, 6885-9.
FRESNO VARA, J.A., CASADO, E., DE CASTRO, J., CEJAS, P., BELDA-INIESTA, C. & GONZALEZ-
BARON, M. (2004). PI3K/Akt signalling pathway and cancer. Cancer Treat Rev, 30,
193-204.
GANGOITI, P., CAMACHO, L., ARANA, L., OURO, A., GRANADO, M.H., BRIZUELA, L., CASAS, J.,
FABRIAS, G., ABAD, J.L., DELGADO, A. & GOMEZ-MUNOZ, A. (2010). Control of
metabolism and signaling of simple bioactive sphingolipids: Implications in disease.
Prog Lipid Res.
GARCIA, R., BOWMAN, T.L., NIU, G., YU, H., MINTON, S., MURO-CACHO, C.A., COX, C.E.,
FALCONE, R., FAIRCLOUGH, R., PARSONS, S., LAUDANO, A., GAZIT, A., LEVITZKI, A.,
KRAKER, A. & JOVE, R. (2001). Constitutive activation of Stat3 by the Src and JAK
tyrosine kinases p
Oncogene, 20, 2499-513.
MINHAS, F., DUHADAWAY, J., MAO, N.C., WILSON, D., BUCCAFUSCA, R., SAKAMURO, D.,
NELSON,
heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Int J
Cancer, 86, 155-61.
UTSOS, I., GYFTOPOULOS, K., PERIM
BARBALIAS, G. (2004). Clinical correlation of prostatic lithiasis with chronic
syndromes in young adults. Eur Urol, 45, 333-7; discussion 337-8.
G., ZAIM
SOMAINI, L. (2010). Pharmacology and toxicology of Cannabis derivatives and
endocannabinoid agonists. Recent Pa
GEWIES, A., ROKHLIN, O.W. & COHEN, M.B. (2000). Ceramide induces cell death in the human
prostatic carcinoma cell lines PC3 and DU145 but does not seem to be involved in
Fas-mediated
GIULIANO, M., PELLERITO, O., PORTANOVA, P., CALVARUSO, G., SANTULLI, A., DE BLASIO, A.,
VENTO, R. & TESORIERE, G. (2009). Apoptos
cannabinoid WIN: involvement of the transcription factor PPARgamma. Biochimie, 91,
457-65.
G., LEGRAND-POELS, S. & PIETTE, J. (2006). NF-ka
species: fifteen years later. Biochem Pharmacol, 72, 1493-505.
SKI, G., OFFERTALER, L., WAGNER, J.A. & KUNOS, G. (2009). Receptors for
acylethanolamides-GPR55 and GPR119. Prostaglandins Other Lipid Me
11.
TUNDIDOR, S., CAVARRETTA, I.T., FUCHS, D., FIECHTL, M., STEINER, H., FRIEDBICHLER, K.,
BARTSCH, G., HOBISCH, A. & CULIG, Z. (2005). Interleukin-6 and oncostatin M
stimulation of proliferation of prostate cancer 22Rv1 cells through

Bibliografía

138

GOLOVIN .M. (2008).
GOMEZ-
GOUTOP cannabis to cannabinergics: new
GRANT,
abinoid receptor agonists and antagonists. Int
GRIFFIN, UFFMAN,
J
tors on peripheral nerve terminals. Eur J Pharmacol, 339,
GRUSS,
or. Blood, 80, 2563-70.
ted in endometrial carcinoma. Endocrinology, 151, 921-
GUSTAF
poptosis induced by R(+)-methanandamide and Win55,212-2 is associated
GUSTAF
oid-induced cytotoxicity in mantle cell lymphoma through modulation of
GUZMAN ERH, I., SANCHEZ,
HAHM, E rleukin-6-induced
HARRING
HART, S ULLRICH, A. (2004). Cannabinoids induce cancer cell proliferation
via tumor necrosis factor alpha-converting enzyme (TACE/ADAM17)-mediated
transactivation of the epidermal growth factor receptor. Cancer Res, 64, 1943-50.
pathways of p38 mitogen-activated protein kinase and phosphatidylinositol 3-kinase.
Prostate, 64, 209-16.
E, K., UZZO, R.G., MAKHOV, P., CRISPEN, P.L., KUNKLE, D. & KOLENKO, V
Depletion of intracellular zinc increases expression of tumorigenic cytokines VEGF,
IL-6 and IL-8 in prostate cancer cells via NF-kappaB-dependent pathway. Prostate,
68, 1443-9.
MUNOZ, A. (2006). Ceramide 1-phosphate/ceramide, a switch between life and death.
Biochim Biophys Acta, 1758, 2049-56.
GOUTOPOULOS, A., FAN, P., KHANOLKAR, A.D., XIE, X.Q., LIN, S. & MAKRIYANNIS, A. (2001).
Stereochemical selectivity of methanandamides for the CB1 and CB2 cannabinoid
receptors and their metabolic stability. Bioorg Med Chem, 9, 1673-84.
OULOS, A. & MAKRIYANNIS, A. (2002). From
therapeutic opportunities. Pharmacol Ther, 95, 103-17.
S. (2008). Cotargeting survival signaling pathways in cancer. J Clin Invest, 118, 3003-
6.
GREINEISEN, W.E. & TURNER, H. (2010). Immunoactive effects of cannabinoids: considerations
for the therapeutic use of cann
Immunopharmacol, 10, 547-55.
G., FERNANDO, S.R., ROSS, R.A., MCKAY, N.G., ASHFORD, M.L., SHIRE, D., H
.W., YU, S., LAINTON, J.A. & PERTWEE, R.G. (1997). Evidence for the presence of
CB2-like cannabinoid recep
53-61.
H.J., BRACH, M.A. & HERRMANN, F. (1992). Involvement of nuclear factor-kappa B in
induction of the interleukin-6 gene by leukemia inhibitory fact
GUIDA, M., LIGRESTI, A., DE FILIPPIS, D., D'AMICO, A., PETROSINO, S., CIPRIANO, M., BIFULCO, G.,
SIMONETTI, S., ORLANDO, P., INSABATO, L., NAPPI, C., SARDO, A.D., DI MARZO, V. &
IUVONE, T. (2010). The levels of the endocannabinoid receptor CB2 and its ligand 2-
arachidonoylglycerol are eleva
8.
SSON, K., CHRISTENSSON, B., SANDER, B. & FLYGARE, J. (2006). Cannabinoid receptor-
mediated a
with ceramide accumulation and p38 activation in mantle cell lymphoma. Mol
Pharmacol, 70, 1612-20.
SSON, K., SANDER, B., BIELAWSKI, J., HANNUN, Y.A. & FLYGARE, J. (2009). Potentiation of
cannabin
ceramide metabolism. Mol Cancer Res, 7, 1086-98.
, M., DUARTE, M.J., BLAZQUEZ, C., RAVINA, J., ROSA, M.C., GALVE-ROP
C., VELASCO, G. & GONZALEZ-FERIA, L. (2006). A pilot clinical study of Delta9-
tetrahydrocannabinol in patients with recurrent glioblastoma multiforme. Br J Cancer,
95, 197-203.
HAGEMANN, T., BALKWILL, F. & LAWRENCE, T. (2007). Inflammation and cancer: a double-edged
sword. Cancer Cell, 12, 300-1.
.R. & SINGH, S.V. (2010). Sulforaphane inhibits constitutive and inte
activation of signal transducer and activator of transcription 3 in prostate cancer cells.
Cancer Prev Res (Phila Pa), 3, 484-94.
TON, L.E., MANGAN, P.R. & WEAVER, C.T. (2006). Expanding the effector CD4 T-cell
repertoire: the Th17 lineage. Curr Opin Immunol, 18, 349-56.
., FISCHER, O.M. &

Bibliografía

139

HAYDEN inciples in NF-kappaB signaling. Cell, 132, 344-
HEALY, S
tress response as an anticancer strategy. Eur J Pharmacol,
HEATH-E
HEINRIC PERDIGUERO, E., NEBREDA, A.R. & PASPARAKIS, M. (2008). p38
HERRER ZMAN, M. & VELASCO,
HINKOVS
HAYMAN, J.A. (2005). Ceramide 1-phosphate, a mediator
HODGE,
r, 41, 2502-12.
HUFFMA 0). The search for selective ligands for the CB2 receptor. Curr Pharm Des,
JEAN-GI . (2010). Interaction between cytokines,
JIANG, Q
ostate cancer cells by
JOSHUA,
A. (2008). Prostatic preneoplasia and beyond. Biochim Biophys Acta, 1785,
JUNTTILA
survival. FASEB J, 22, 954-65.
KAWADA
KHANDR KUMAR, B., KOUL, S., MARONI, P. & KOUL, H.K. (2009). Oxidative stress in
HARZSTARK, A.L. & SMALL, E.J. (2009). Immunotherapeutics in development for prostate
cancer. Oncologist, 14, 391-8.
, M.S. & GHOSH, S. (2008). Shared pr
62.
.J., GORMAN, A.M., MOUSAVI-SHAFAEI, P., GUPTA, S. & SAMALI, A. (2009). Targeting the
endoplasmic reticulum-s
625, 234-46.
NGEL, H.M., CHANG, N.C. & SHORE, G.C. (2008). The endoplasmic reticulum in
apoptosis and autophagy: role of the BCL-2 protein family. Oncogene, 27, 6419-33.
HSDORFF, J., LUEDDE, T.,
alpha MAPK inhibits JNK activation and collaborates with IkappaB kinase 2 to prevent
endotoxin-induced liver failure. EMBO Rep, 9, 1048-54.
A, B., CARRACEDO, A., DIEZ-ZAERA, M., GOMEZ DEL PULGAR, T., GU
G. (2006). The CB2 cannabinoid receptor signals apoptosis via ceramide-dependent
activation of the mitochondrial intrinsic pathway. Exp Cell Res, 312, 2121-31.
KA-GALCHEVA, V., BOXER, L.A., KINDZELSKII, A., HIRAOKA, M., ABE, A., GOPARJU, S.,
SPIEGEL, S., PETTY, H.R. & S
of phagocytosis. J Biol Chem, 280, 26612-21.
D.R., HURT, E.M. & FARRAR, W.L. (2005). The role of IL-6 and STAT3 in inflammation
and cancer. Eur J Cance
HORVATH, C.M. (2000). STAT proteins and transcriptional responses to extracellular signals.
Trends Biochem Sci, 25, 496-502.
HUANG, G., SHI, L.Z. & CHI, H. (2009). Regulation of JNK and p38 MAPK in the immune
system: signal integration, propagation and termination. Cytokine, 48, 161-9.
N, J.W. (200
6, 1323-37.
LLES, L., GRAN, B. & CONSTANTINESCU, C.S
cannabinoids and the nervous system. Immunobiology.
., WONG, J., FYRST, H., SABA, J.D. & AMES, B.N. (2004). gamma-Tocopherol or
combinations of vitamin E forms induce cell death in human pr
interrupting sphingolipid synthesis. Proc Natl Acad Sci U S A, 101, 17825-30.
A.M., EVANS, A., VAN DER KWAST, T., ZIELENSKA, M., MEEKER, A.K., CHINNAIYAN, A. &
SQUIRE, J.
156-81.
, M.R., LI, S.P. & WESTERMARCK, J. (2008). Phosphatase-mediated crosstalk between
MAPK signaling pathways in the regulation of cell
KAIGHN, M.E., NARAYAN, K.S., OHNUKI, Y., LECHNER, J.F. & JONES, L.W. (1979). Establishment
and characterization of a human prostatic carcinoma cell line (PC-3). Invest Urol, 17,
16-23.
KARAN, D., HOLZBEIERLEIN, J. & THRASHER, J.B. (2009). Macrophage inhibitory cytokine-1:
possible bridge molecule of inflammation and prostate cancer. Cancer Res, 69, 2-5.
, M., ISHIZUKA, M. & TAKEUCHI, T. (1999). Enhancement of antiproliferative effects of
interleukin-1beta and tumor necrosis factor-alpha on human prostate cancer LNCaP
cells by coculture with normal fibroblasts through secreted interleukin-6. Jpn J Cancer
Res, 90, 546-54.
KELLY, K. & YIN, J.J. (2008). Prostate cancer and metastasis initiating stem cells. Cell Res, 18,
528-37.
IKA, L.,
prostate cancer. Cancer Lett, 282, 125-36.

Bibliografía

140

KIHARA,
s of two phosphorylated sphingolipids, sphingosine 1-phosphate and
KIM, E.K uman
KIM, H.J therapeutic targets in
KINKADE
W.L., CORDON-CARDO, C. & ABATE-SHEN, C. (2008). Targeting
KITAGAW ABARA, K., SASAKI, T., TANAKA, S., MABUCHI, T., SUGIURA, S.,
in rats. Neurosci Lett, 333, 187-90.
KLEIN, T
oid receptors and T helper cells. J Neuroimmunol, 147, 91-4.
KOTTKE,
70-mediated Th17 autoimmunity can be exploited as
KRIEGER
KRYCZE ., WU, K., SHU, X., SZELIGA, W., VATAN, L., FINLAYSON, E., HUANG,
KUBLER, alignancies and
KUMAR,
9, 897-903.
LAMOUR
A.H., JR., CHO, W. & CHALFANT, C.E. (2007). Ceramide kinase uses ceramide
LAWSON . & WITTE, O.N. (2007). Stem cells in prostate cancer initiation and progression. J
LEE, J.T
signal transduction and cell cycle pathways. Cell Cycle, 7, 1745-62.
A., MITSUTAKE, S., MIZUTANI, Y. & IGARASHI, Y. (2007). Metabolism and biological
function
ceramide 1-phosphate. Prog Lipid Res, 46, 126-44.
. & CHOI, E.J. (2010). Pathological roles of MAPK signaling pathways in h
diseases. Biochim Biophys Acta, 1802, 396-405.
., HAWKE, N. & BALDWIN, A.S. (2006). NF-kappaB and IKK as
cancer. Cell Death Differ, 13, 738-47.
, C.W., CASTILLO-MARTIN, M., PUZIO-KUTER, A., YAN, J., FOSTER, T.H., GAO, H., SUN, Y.,
OUYANG, X., GERALD,
AKT/mTOR and ERK MAPK signaling inhibits hormone-refractory prostate cancer in a
preclinical mouse model. J Clin Invest, 118, 3051-64.
A, K., TAKASAWA, K., KUW
OMURA-MATSUOKA, E., MATSUMOTO, M. & HORI, M. (2002). Differential Akt
phosphorylation at Ser473 and Thr308 in cultured neurons after exposure to
glutamate
KLEIN, T.W. (2005). Cannabinoid-based drugs as anti-inflammatory therapeutics. Nat Rev
Immunol, 5, 400-11.
.W., NEWTON, C., LARSEN, K., CHOU, J., PERKINS, I., LU, L., NONG, L. & FRIEDMAN, H.
(2004). Cannabin
KOGAN, N.M. & MECHOULAM, R. (2006). The chemistry of endocannabinoids. J Endocrinol
Invest, 29, 3-14.
T., SANCHEZ-PEREZ, L., DIAZ, R.M., THOMPSON, J., CHONG, H., HARRINGTON, K.,
CALDERWOOD, S.K., PULIDO, J., GEORGOPOULOS, N., SELBY, P., MELCHER, A. & VILE, R.
(2007). Induction of hsp
immunotherapy for metastatic prostate cancer. Cancer Res, 67, 11970-9.
, J.N., LEE, S.W., JEON, J., CHEAH, P.Y., LIONG, M.L. & RILEY, D.E. (2008).
Epidemiology of prostatitis. Int J Antimicrob Agents, 31 Suppl 1, S85-90.
K, I., LIU, R., WANG, G
E., SIMEONE, D., REDMAN, B., WELLING, T.H., CHANG, A. & ZOU, W. (2009a). FOXP3
defines regulatory T cells in human tumor and autoimmune disease. Cancer Res, 69,
3995-4000.
KRYCZEK, I., WEI, S., SZELIGA, W., VATAN, L. & ZOU, W. (2009b). Endogenous IL-17 contributes
to reduced tumor growth and metastasis. Blood, 114, 357-9.
H. & GSCHWEND, J.E. (2008). [Active immunotherapy of urologic m
tumor-mediated immunosuppression]. Urologe A, 47, 1122-7.
S. (2009). Caspase 2 in apoptosis, the DNA damage response and tumour
suppression: enigma no more? Nat Rev Cancer,
LAMKANFI, M. & KANNEGANTI, T.D. (2010). Caspase-7: a protease involved in apoptosis and
inflammation. Int J Biochem Cell Biol, 42, 21-4.
, N.F., STAHELIN, R.V., WIJESINGHE, D.S., MACEYKA, M., WANG, E., ALLEGOOD, J.C.,
MERRILL,
provided by ceramide transport protein: localization to organelles of eicosanoid
synthesis. J Lipid Res, 48, 1293-304.
LANG, S.H., FRAME, F.M. & COLLINS, A.T. (2009). Prostate cancer stem cells. J Pathol, 217,
299-306.
, D.A
Clin Invest, 117, 2044-50.
., LEHMANN, B.D., TERRIAN, D.M., CHAPPELL, W.H., STIVALA, F., LIBRA, M., MARTELLI,
A.M., STEELMAN, L.S. & MCCUBREY, J.A. (2008). Targeting prostate cancer based on

Bibliografía

141

LEVI, M
ges for natural ceramide-1-phosphate (C1P) and for phospho-
LEVY, D
LI, X., MANNUCCI, R., KINSEY, B., ANDRIANI, F., NICOLETTI, I., DENNER, L. &
optosis in PC-3 cells. Cancer Res, 61, 1699-
LI, Y.N.
o fibroblasts to
LIAO, Y. chemosensitization of breast
LIN, S., NOLKAR, A.D., FAN, P., GOUTOPOULOS, A., QIN, C., PAPAHADJIS, D. & MAKRIYANNIS,
LIU, A., , GARDNER, W.A., DENG, C.X. & MAN, Y.G. (2009). Correlated alterations in
MAEK, ).
MAHAJA
TI, S.M., EARP, H.S. & MAHAJAN, N.P. (2010). Ack1 mediated AKT/PKB tyrosine
MAHDY,
., KEANE, T.E., TAHA, M.I., HAMMOUDA, H.M., NORRIS, J.S. &
MAHMOO or cancer therapy. Exp Cell Res,
MALAGA
eath. Expert Rev Mol Med, 4, 1-15.
receptor via PI3K and
MAO, C
-1-phosphate. Biochim Biophys Acta, 1781,
MARTIN- KI, T., LU, S., HWU, P.,
., MEIJLER, M.M., GOMEZ-MUNOZ, A. & ZOR, T. (2010). Distinct receptor-mediated
activities in macropha
ceramide analogue-1 (PCERA-1). Mol Cell Endocrinol, 314, 248-55.
.E. & INGHIRAMI, G. (2006). STAT3: a multifaceted oncogene. Proc Natl Acad Sci U S
A, 103, 10151-2.
MARANI, M.,
MARCELLI, M. (2001). Overexpression of BCL-X(L) underlies the molecular basis for
resistance to staurosporine-induced ap
706.
, LIU, X.L., HUANG, F., ZHOU, H., HUANG, Y.J. & FANG, F. (2010). CD4(+)CD25(+)
regulatory T cells suppress the immune responses of mouse embry
murine cytomegalovirus infection. Immunol Lett.
, YU, D. & HUNG, M.C. (2007). Novel approaches for
cancer cells: the E1A story. Adv Exp Med Biol, 608, 144-69.
KHA
A. (1998). Novel analogues of arachidonylethanolamide (anandamide): affinities for
the CB1 and CB2 cannabinoid receptors and metabolic stability. J Med Chem, 41,
5353-61.
LINDHOLM, P.F., BUB, J., KAUL, S., SHIDHAM, V.B. & KAJDACSY-BALLA, A. (2000). The role of
constitutive NF-kappaB activity in PC-3 human prostate cancer cell invasive behavior.
Clin Exp Metastasis, 18, 471-9.
WEI, L.
prostate basal cell layer and basement membrane. Int J Biol Sci, 5, 276-85.
A.N.W., BURANAPRADITKUN, S., KLAEWSONGKRAM, J. & RUXRUNGTHAM, K. (2007
Increased interleukin-17 production both in helper T cell subset Th17 and CD4-
negative T cells in human immunodeficiency virus infection. Viral Immunol, 20, 66-75.
N, K., COPPOLA, D., CHALLA, S., FANG, B., CHEN, Y.A., ZHU, W., LOPEZ, A.S., KOOMEN,
J., ENGELMAN, R.W., RIVERA, C., MURAOKA-COOK, R.S., CHENG, J.Q., SCHONBRUNN, E.,
SEB
176 phosphorylation regulates its activation. PLoS One, 5, e9646.
A.E., CHENG, J.C., LI, J., ELOJEIMY, S., MEACHAM, W.D., TURNER, L.S., BAI, A., GAULT,
C.R., MCPHERSON, A.S., GARCIA, N., BECKHAM, T.H., SAAD, A., BIELAWSKA, A.,
BIELAWSKI, J., HANNUN, Y.A
LIU, X. (2009). Acid ceramidase upregulation in prostate cancer cells confers
resistance to radiation: AC inhibition, a potential radiosensitizer. Mol Ther, 17, 430-8.
D, Z. & SHUKLA, Y. (2010). Death receptors: targets f
316, 887-99.
RIE-CAZENAVE, S., ANDRIEU-ABADIE, N., SEGUI, B., GOUAZE, V., TARDY, C., CUVILLIER, O.
& LEVADE, T. (2002). Sphingolipid signalling: molecular basis and role in TNF-alpha-
induced cell d
MALAGARIE-CAZENAVE, S., OLEA-HERRERO, N., VARA, D. & DIAZ-LAVIADA, I. (2009). Capsaicin, a
component of red peppers, induces expression of androgen
MAPK pathways in prostate LNCaP cells. FEBS Lett, 583, 141-7.
. & OBEID, L.M. (2008). Ceramidases: regulators of cellular responses mediated by
ceramide, sphingosine, and sphingosine
424-34.
OROZCO, N., MURANSKI, P., CHUNG, Y., YANG, X.O., YAMAZA
RESTIFO, N.P., OVERWIJK, W.W. & DONG, C. (2009). T helper 17 cells promote
cytotoxic T cell activation in tumor immunity. Immunity, 31, 787-98.

Bibliografía

142

rs NF-IL6 and NF-kappa B synergistically activate
Sci U S A, 90, 10193-7.
MCFARL ARKER, E.L. (2004). Anandamide transport. Pharmacol Ther, 104, 117-
MCKALL
MELCK, NO, T., LAEZZA, C., BIFULCO, M. & DI
to inhibition of human breast and prostate
MILLER, ptor-mediated migration of immune cells: it can go
MIMEAUL tive and
uman prostatic cancer cell lines. Int J Cancer, 106, 116-24.
an prostatic cancer cell lines:
MIMEAUL EUX, P.,
, 120, 160-9.
OVE, R. (2002). Constitutive activation of Stat3 in human prostate tumors
NADIMIN
0 processing involves CBP/p300-mediated acetylation. Proc Natl
NAHAS, Y, D.J., SUTIN, K., TURNDORF, H. & CANCRO, R. (2002). A molecular basis of
armacol Biol Psychiatry, 26, 721-30.
MATSUSAKA, T., FUJIKAWA, K., NISHIO, Y., MUKAIDA, N., MATSUSHIMA, K., KISHIMOTO, T. & AKIRA,
S. (1993). Transcription facto
transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc Natl
Acad
MCALLISTER, S.D. & GLASS, M. (2002). CB(1) and CB(2) receptor-mediated signalling: a focus
on endocannabinoids. Prostaglandins Leukot Essent Fatty Acids, 66, 161-71.
AND, M.J. & B
35.
IP, R.J., JIA, W., SCHLOMER, J., WARREN, J.W., NAGARKATTI, P.S. & NAGARKATTI, M.
(2006). Cannabidiol-induced apoptosis in human leukemia cells: A novel role of
cannabidiol in the regulation of p22phox and Nox4 expression. Mol Pharmacol, 70,
897-908.
MCKALLIP, R.J., LOMBARD, C., FISHER, M., MARTIN, B.R., RYU, S., GRANT, S., NAGARKATTI, P.S.
& NAGARKATTI, M. (2002). Targeting CB2 cannabinoid receptors as a novel therapy to
treat malignant lymphoblastic disease. Blood, 100, 627-34.
MCNEAL, J.E. (1968). Regional morphology and pathology of the prostate. Am J Clin Pathol,
49, 347-57.
D., DE PETROCELLIS, L., ORLANDO, P., BISOG
MARZO, V. (2000). Suppression of nerve growth factor Trk receptors and prolactin
receptors by endocannabinoids leads
cancer cell proliferation. Endocrinology, 141, 118-26.
A.M. & STELLA, N. (2008). CB2 rece
either way. Br J Pharmacol, 153, 299-308.
T, M., POMMERY, N. & HENICHART, J.P. (2003a). Synergistic antiprolifera
apoptotic effects induced by epidermal growth factor receptor and protein kinase a
inhibitors in h
MIMEAULT, M., POMMERY, N., WATTEZ, N., BAILLY, C. & HENICHART, J.P. (2003b). Anti-
proliferative and apoptotic effects of anandamide in hum
implication of epidermal growth factor receptor down-regulation and ceramide
production. Prostate, 56, 1-12.
T, M., VENKATRAMAN, G., JOHANSSON, S.L., MOORE, E., HENICHART, J.P., DEPR
LIN, M.F. & BATRA, S.K. (2007). Novel combination therapy against metastatic and
androgen-independent prostate cancer by using gefitinib, tamoxifen and etoposide. Int
J Cancer
MOHAMED, M.R. & MCFADDEN, G. (2009). NFkB inhibitors: strategies from poxviruses. Cell
Cycle, 8, 3125-32.
MORA, L.B., BUETTNER, R., SEIGNE, J., DIAZ, J., AHMAD, N., GARCIA, R., BOWMAN, T., FALCONE,
R., FAIRCLOUGH, R., CANTOR, A., MURO-CACHO, C., LIVINGSTON, S., KARRAS, J., POW-
SANG, J. & J
and cell lines: direct inhibition of Stat3 signaling induces apoptosis of prostate cancer
cells. Cancer Res, 62, 6659-66.
MUNRO, S., THOMAS, K.L. & ABU-SHAAR, M. (1993). Molecular characterization of a peripheral
receptor for cannabinoids. Nature, 365, 61-5.
TY, N., LOU, W., LEE, S.O., LIN, X., TRUMP, D.L. & GAO, A.C. (2006). Stat3 activation of
NF-{kappa}B p10
Acad Sci U S A, 103, 7264-9.
G., HARVE
the therapeutic and psychoactive properties of cannabis (delta9-
tetrahydrocannabinol). Prog Neuropsychoph

Bibliografía

143

ptor-deficient breast cancers and
NAVONE GOODROW, T.L., PALMER, J.L., NICHOLS, W.W.,
NEUWIR HOBISCH, A. & CULIG, Z. (2007).
NI, Z., L ibition of constitutively activated Stat3
(2004). 2-arachidonoylglycerol: a novel inhibitor of androgen-
O'GARR
OH, J.E. a ceramide
OKAMOT . Molecular
ORUC, M
liver transplantation: University of Pittsburgh's experience and review of
PACHER system as an emerging
PALAYOO & PRICE, B.D. (1999).
PATEL, Y, K.A. (2010). Cannabinoid CB(2)
PCHEJET
animal models. Mol Cancer Ther, 7, 1836-45.
, C., MAGGI, M. & ADORINI, L. (2009). Human benign prostatic hyperplasia
NAKASHIMA, J., TACHIBANA, M., HORIGUCHI, Y., OYA, M., OHIGASHI, T., ASAKURA, H. & MURAI, M.
(2000). Serum interleukin 6 as a prognostic factor in patients with prostate cancer.
Clin Cancer Res, 6, 2702-6.
NAKATANI, K., THOMPSON, D.A., BARTHEL, A., SAKAUE, H., LIU, W., WEIGEL, R.J. & ROTH, R.A.
(1999). Up-regulation of Akt3 in estrogen rece
androgen-independent prostate cancer lines. J Biol Chem, 274, 21528-32.
, N.M., TRONCOSO, P., PISTERS, L.L.,
VON ESCHENBACH, A.C. & CONTI, C.J. (1993). p53 protein accumulation and gene
mutation in the progression of human prostate carcinoma. J Natl Cancer Inst, 85,
1657-69.
T, H., PUHR, M., CAVARRETTA, I.T., MITTERBERGER, M.,
Suppressor of cytokine signalling-3 is up-regulated by androgen in prostate cancer
cell lines and inhibits androgen-mediated proliferation and secretion. Endocr Relat
Cancer, 14, 1007-19.
OU, W., LEMAN, E.S. & GAO, A.C. (2000). Inh
signaling pathway suppresses growth of prostate cancer cells. Cancer Res, 60, 1225-
8.
NIETO, M., FINN, S., LODA, M. & HAHN, W.C. (2007). Prostate cancer: Re-focusing on androgen
receptor signaling. Int J Biochem Cell Biol, 39, 1562-8.
NITHIPATIKOM, K., ENDSLEY, M.P., ISBELL, M.A., FALCK, J.R., IWAMOTO, Y., HILLARD, C.J. &
CAMPBELL, W.B.
independent prostate cancer cell invasion. Cancer Res, 64, 8826-30.
A, A., STOCKINGER, B. & VELDHOEN, M. (2008). Differentiation of human T(H)-17 cells
does require TGF-beta! Nat Immunol, 9, 588-90.
, SO, K.S., LIM, S.J. & KIM, M.Y. (2006). Induction of apoptotic cell death by
analog in PC-3 prostate cancer cells. Arch Pharm Res, 29, 1140-6.
O, Y., MORISHITA, J., TSUBOI, K., TONAI, T. & UEDA, N. (2004)
characterization of a phospholipase D generating anandamide and its congeners. J
Biol Chem, 279, 5298-305.
.T., SORAN, A., JAIN, A.K., WILSON, J.W. & FUNG, J. (2004). De novo breast cancer in
patients with
the literature. Liver Transpl, 10, 1-6.
, P., BATKAI, S. & KUNOS, G. (2006). The endocannabinoid
target of pharmacotherapy. Pharmacol Rev, 58, 389-462.
R, S.T., YOUMELL, M.Y., CALDERWOOD, S.K., COLEMAN, C.N.
Constitutive activation of IkappaB kinase alpha and NF-kappaB in prostate cancer
cells is inhibited by ibuprofen. Oncogene, 18, 7389-94.
PANTELOURIS, E.M. (1968). Absence of thymus in a mouse mutant. Nature, 217, 370-1.
K.D., DAVISON, J.S., PITTMAN, Q.J. & SHARKE
receptors in health and disease. Curr Med Chem, 17, 1393-410.
SKI, D., DOUMERC, N., GOLZIO, M., NAYMARK, M., TEISSIE, J., KOHAMA, T., WAXMAN, J.,
MALAVAUD, B. & CUVILLIER, O. (2008). Chemosensitizing effects of sphingosine kinase-
1 inhibition in prostate cancer cell and
PENNA, G., FIBBI, B., AMUCHASTEGUI, S., COSSETTI, C., AQUILANO, F., LAVERNY, G., GACCI, M.,
CRESCIOLI
stromal cells as inducers and targets of chronic immuno-mediated inflammation. J
Immunol, 182, 4056-64.
PERDIGUERO, E., RUIZ-BONILLA, V., SERRANO, A.L. & MUNOZ-CANOVES, P. (2007). Genetic
deficiency of p38alpha reveals its critical role in myoblast cell cycle exit: the p38alpha-
JNK connection. Cell Cycle, 6, 1298-303.

Bibliografía

144

PERTWE ptor agonists as
PETROS & DI MARZO, V. (2009). Endocannabinoid chemical biology: a tool
PIERCE,
r risk in men aged 65 years and older. Cancer Causes Control, 20, 1193-203.
PISANTI, GAZZERRO, P., LAEZZA, C. & BIFULCO,
7-31.
PU, Y.S
e for drug resistance and anti-apoptotic effects in prostatic cancer cells.
QIAO, M
Inst, 100,
RAMER,
RAMSAY
REBBEC KER, K., SPANGLER,
REITER,
REPICKY S. & MILATA, V. (2008). [Signal pathways of cell proliferation and death
RIBEIRO
n increases cell-mediated immunity
RIJNDER
rcinoma cell lines.
ROBERT
.M. & JACOBSEN, S.J. (2004a). Androgen receptor gene polymorphisms and
PERKINS, N.D. & GILMORE, T.D. (2006). Good cop, bad cop: the different faces of NF-kappaB.
Cell Death Differ, 13, 759-72.
E, R.G. (2009). Emerging strategies for exploiting cannabinoid rece
medicines. Br J Pharmacol, 156, 397-411.
INO, S., LIGRESTI, A.
for the development of novel therapies. Curr Opin Chem Biol, 13, 309-20.
B.L., BIGGS, M.L., DECAMBRE, M., REINER, A.P., LI, C., FITZPATRICK, A., CARLSON, C.S.,
STANFORD, J.L. & AUSTIN, M.A. (2009). C-reactive protein, interleukin-6, and prostate
cance
PISANTI, S. & BIFULCO, M. (2009a). Endocannabinoid system modulation in cancer biology and
therapy. Pharmacol Res, 60, 107-16.
S., MALFITANO, A.M., GRIMALDI, C., SANTORO, A.,
M. (2009b). Use of cannabinoid receptor agonists in cancer therapy as palliative and
curative agents. Best Pract Res Clin Endocrinol Metab, 23, 11
PRINS, G.S. & KORACH, K.S. (2008). The role of estrogens and estrogen receptors in normal
prostate growth and disease. Steroids, 73, 233-44.
., HOUR, T.C., CHUANG, S.E., CHENG, A.L., LAI, M.K. & KUO, M.L. (2004). Interleukin-6 is
responsibl
Prostate, 60, 120-9.
., SHENG, S. & PARDEE, A.B. (2008). Metastasis and AKT activation. Cell Cycle, 7,
2991-6.
RAMER, R. & HINZ, B. (2008). Inhibition of cancer cell invasion by cannabinoids via increased
expression of tissue inhibitor of matrix metalloproteinases-1. J Natl Cancer
59-69.
R., MERKORD, J., ROHDE, H. & HINZ, B. (2010). Cannabidiol inhibits cancer cell invasion
via upregulation of tissue inhibitor of matrix metalloproteinases-1. Biochem
Pharmacol, 79, 955-66.
, A.K. & LEUNG, H.Y. (2009). Signalling pathways in prostate carcinogenesis: potentials
for molecular-targeted therapy. Clin Sci (Lond), 117, 209-28.
K, T.R., RENNERT, H., WALKER, A.H., PANOSSIAN, S., TRAN, T., WAL
E., PATACSIL-COOMES, M., SACHDEVA, R., WEIN, A.J., MALKOWICZ, S.B. & ZEIGLER-
JOHNSON, C. (2008). Joint effects of inflammation and androgen metabolism on
prostate cancer severity. Int J Cancer, 123, 1385-9.
M.A., PFITZENMAIER, J., HOHENFELLNER, M. & HAFERKAMP, A. (2009).
[Immunomodulatory treatment approaches for prostate cancer]. Urologe A, 48, 755-
63.
, A., JANTOVA,
as targets of potential chemotherapeutics]. Ceska Slov Farm, 57, 4-10.
, A., FERRAZ-DE-PAULA, V., PINHEIRO, M.L., SAKAI, M., COSTA-PINTO, F.A. & PALERMO-
NETO, J. (2010). Anandamide prior to sensitizatio
in mice. Int Immunopharmacol, 10, 431-9.
S, A.W., VAN DER KORPUT, J.A., VAN STEENBRUGGE, G.J., ROMIJN, J.C. & TRAPMAN, J.
(1985). Expression of cellular oncogenes in human prostatic ca
Biochem Biophys Res Commun, 132, 548-54.
S, R.O., BERGSTRALH, E.J., CUNNINGHAM, J.M., HEBBRING, S.J., THIBODEAU, S.N.,
LIEBER, M
increased risk of urologic measures of benign prostatic hyperplasia. Am J Epidemiol,
159, 269-76.

Bibliografía

145

ROBERT HIVOTOVSKY, B. (2000). Review: nuclear events in
ROSS, R 156-
ROYUEL , RODRIGUEZ-BERRIGUETE, G., FRAILE, B. & PANIAGUA, R. (2008). TNF-alpha/IL-
RUIZ-LLO
Z, C., RAMOS, J.A., HILLARD, C., LASUNCION, M.A., LOPEZ-RODRIGUEZ, M.L. &
. & DIAZ-LAVIADA, I. (2003). Expression of functionally active cannabinoid
RUIZ, L.
apy. Biochem Pharmacol.
SADEGH Urol Rep, 7,
SAGAR,
& VELASCO, G. (2009). Cannabinoid action induces autophagy-
2.
SANCHE
, J.W., RAMON Y CAJAL, S. & GUZMAN, M. (2001).
ls. Involvement in Raf-1 stimulation and NGF induction.
SANCHE
ROBERTS, R.O., JACOBSON, D.J., RHODES, T., KLEE, G.G., LEIBER, M.M. & JACOBSEN, S.J.
(2004b). Serum sex hormones and measures of benign prostatic hyperplasia.
Prostate, 61, 124-31.
SON, J.D., ORRENIUS, S. & Z
apoptosis. J Struct Biol, 129, 346-58.
.A. (2009). The enigmatic pharmacology of GPR55. Trends Pharmacol Sci, 30,
63.
A, M.
1/NF-kappaB transduction pathway in human cancer prostate. Histol Histopathol, 23,
1279-90.
RENTE, L., ORTEGA-GUTIERREZ, S., VISO, A., SANCHEZ, M.G., SANCHEZ, A.M.,
FERNANDE
DIAZ-LAVIADA, I. (2004). Characterization of an anandamide degradation system in
prostate epithelial PC-3 cells: synthesis of new transporter inhibitors as tools for this
study. Br J Pharmacol, 141, 457-67.
RUIZ-LLORENTE, L., SANCHEZ, M.G., CARMENA, M.J., PRIETO, J.C., SANCHEZ-CHAPADO, M.,
IZQUIERDO, A
receptor CB1 in the human prostate gland. Prostate, 54, 95-102.
, MIGUEL, A. & DIAZ-LAVIADA, I. (1999). Delta9-tetrahydrocannabinol induces apoptosis
in human prostate PC-3 cells via a receptor-independent mechanism. FEBS Lett, 458,
400-4.
RUSSO, M., MUPO, A., SPAGNUOLO, C. & RUSSO, G.L. (2010). Exploring death receptor
pathways as selective targets in cancer ther
SADDOUGHI, S.A., SONG, P. & OGRETMEN, B. (2008). Roles of bioactive sphingolipids in cancer
biology and therapeutics. Subcell Biochem, 49, 413-40.
I-NEJAD, H. & SEFTEL, A. (2006). Sexual dysfunction and prostatitis. Curr
479-84.
D.R., GAW, A.G., OKINE, B.N., WOODHAMS, S.G., WONG, A., KENDALL, D.A. & CHAPMAN,
V. (2009). Dynamic regulation of the endocannabinoid system: implications for
analgesia. Mol Pain, 5, 59.
SALAZAR, M., CARRACEDO, A., SALANUEVA, I.J., HERNANDEZ-TIEDRA, S., LORENTE, M., EGIA, A.,
VAZQUEZ, P., BLAZQUEZ, C., TORRES, S., GARCIA, S., NOWAK, J., FIMIA, G.M.,
PIACENTINI, M., CECCONI, F., PANDOLFI, P.P., GONZALEZ-FERIA, L., IOVANNA, J.L.,
GUZMAN, M., BOYA, P.
mediated cell death through stimulation of ER stress in human glioma cells. J Clin
Invest, 119, 1359-7
SANCHEZ, A.M., MALAGARIE-CAZENAVE, S., OLEA, N., VARA, D., CHILOECHES, A. & DIAZ-LAVIADA,
I. (2007). Apoptosis induced by capsaicin in prostate PC-3 cells involves ceramide
accumulation, neutral sphingomyelinase, and JNK activation. Apoptosis, 12, 2013-24.
Z, C., DE CEBALLOS, M.L., GOMEZ DEL PULGAR, T., RUEDA, D., CORBACHO, C., VELASCO,
G., GALVE-ROPERH, I., HUFFMAN
Inhibition of glioma growth in vivo by selective activation of the CB(2) cannabinoid
receptor. Cancer Res, 61, 5784-9.
SANCHEZ, M.G., RUIZ-LLORENTE, L., SANCHEZ, A.M. & DIAZ-LAVIADA, I. (2003a). Activation of
phosphoinositide 3-kinase/PKB pathway by CB(1) and CB(2) cannabinoid receptors
expressed in prostate PC-3 cel
Cell Signal, 15, 851-9.
Z, M.G., SANCHEZ, A.M., COLLADO, B., MALAGARIE-CAZENAVE, S., OLEA, N., CARMENA,
M.J., PRIETO, J.C. & DIAZ-LAVIADA, I.I. (2005). Expression of the transient receptor

Bibliografía

146

SANCHE LORENTE, L. & DIAZ-LAVIADA, I. (2003b). Enhancement of
SANCHE RRETT, A.,
SANTER LINOWSKA, K., CULIG, Z. & CAVARRETTA, I.T. (2010). Interleukin-6 trans-
SARFAR
ress and promise. Cancer Res, 68, 339-42.
tained activation of ERK1/2 leading to G1 cell cycle arrest. J Biol Chem, 281,
SARFAR nnabinoid receptor as a novel
SCIARRA
k? Eur Urol, 52,
SCHWAR T, D.T. & KYPRIANOU, N. (2008).
SFANOS .H., XU, L., THOBURN, C.J., DEMARZO, A.M., MEEKER, A.K.,
SHAFER NE, A. & HURWITZ, A.A. (2007). T cell tolerance to
SHIELDS Z, M.A. (2010). Induction of
SHIMIZU O, K. (1990). Involvement of a
ne by
SHOWAL valuation of binding
SLOVIN, r triumphs in prostate cancer immunotherapy: on the road to
SORENS
rt Rev Mol Diagn, 10, 49-64.
potential vanilloid 1 (TRPV1) in LNCaP and PC-3 prostate cancer cells and in human
prostate tissue. Eur J Pharmacol, 515, 20-7.
Z, M.G., SANCHEZ, A.M., RUIZ-L
androgen receptor expression induced by (R)-methanandamide in prostate LNCaP
cells. FEBS Lett, 555, 561-6.
Z, P., HERNANDEZ, A.M., STECCA, B., KAHLER, A.J., DEGUEME, A.M., BA
BEYNA, M., DATTA, M.W., DATTA, S. & RUIZ I ALTABA, A. (2004). Inhibition of prostate
cancer proliferation by interference with SONIC HEDGEHOG-GLI1 signaling. Proc
Natl Acad Sci U S A, 101, 12561-6.
, F.R., MA
signalling differentially regulates proliferation, migration, adhesion and maspin
expression in human prostate cancer cells. Endocr Relat Cancer, 17, 241-53.
AZ, S., ADHAMI, V.M., SYED, D.N., AFAQ, F. & MUKHTAR, H. (2008). Cannabinoids for
cancer treatment: prog
SARFARAZ, S., AFAQ, F., ADHAMI, V.M., MALIK, A. & MUKHTAR, H. (2006). Cannabinoid receptor
agonist-induced apoptosis of human prostate cancer cells LNCaP proceeds through
sus
39480-91.
AZ, S., AFAQ, F., ADHAMI, V.M. & MUKHTAR, H. (2005). Ca
target for the treatment of prostate cancer. Cancer Res, 65, 1635-41.
, A., DI SILVERIO, F., SALCICCIA, S., AUTRAN GOMEZ, A.M., GENTILUCCI, A. & GENTILE, V.
(2007). Inflammation and chronic prostatic diseases: evidence for a lin
964-72.
ZE, S.R., LIN, E.W., CHRISTIAN, P.A., GAYHEAR
Intracellular death platform steps-in: targeting prostate tumors via endoplasmic
reticulum (ER) apoptosis. Prostate, 68, 1615-23.
SEPAH, S.C. & BOWER, J.E. (2009). Positive affect and inflammation during radiation treatment
for breast and prostate cancer. Brain Behav Immun, 23, 1068-72.
, K.S., BRUNO, T.C., MARIS, C
ISAACS, W.B. & DRAKE, C.G. (2008). Phenotypic analysis of prostate-infiltrating
lymphocytes reveals TH17 and Treg skewing. Clin Cancer Res, 14, 3254-61.
-WEAVER, K., ANDERSON, M., MALYGUI
tumors and cancer immunotherapy. Adv Exp Med Biol, 601, 357-68.
, J.D., KOURTIS, I.C., TOMEI, A.A., ROBERTS, J.M. & SWART
Lymphoidlike Stroma and Immune Escape by Tumors That Express the Chemokine
CCL21. Science.
, H., MITOMO, K., WATANABE, T., OKAMOTO, S. & YAMAMOT
NF-kappa B-like transcription factor in the activation of the interleukin-6 ge
inflammatory lymphokines. Mol Cell Biol, 10, 561-8.
TER, V.M., COMPTON, D.R., MARTIN, B.R. & ABOOD, M.E. (1996). E
in a transfected cell line expressing a peripheral cannabinoid receptor (CB2):
identification of cannabinoid receptor subtype selective ligands. J Pharmacol Exp
Ther, 278, 989-99.
SLATER, T.F., SAWYER, B. & STRAEULI, U. (1963). Studies on Succinate-Tetrazolium Reductase
Systems. Iii. Points of Coupling of Four Different Tetrazolium Salts. Biochim Biophys
Acta, 77, 383-93.
S.F. (2008). Tribulations o
victory? Expert Rev Anticancer Ther, 8, 465-74.
EN, K.D. & ORNTOFT, T.F. (2010). Discovery of prostate cancer biomarkers by
microarray gene expression profiling. Expe

Bibliografía

147

r cells. Prostate, 42, 186-95.
3). Accelerated in vivo growth of prostate
e pathway.
STOCKIN
opathol, 22, 1387-98.
SZEGEZD of endoplasmic
TANASES oids and the immune system: An
THEYER
Role of the MDR-1-encoded multiple drug resistance phenotype
TURKSO OVE, R. (2000). STAT proteins: novel molecular targets for cancer drug
TURU, G
nol, 44, 75-85.
80, 1259-68.
state, 47, 36-51.
VAN VE BELL, R.M. (1992). Changes in
g
VELASCO , GALVE-ROPERH, I., SANCHEZ, C., BLAZQUEZ, C., HARO, A. & GUZMAN, M. (2005).
VIDINSKY tion between
VINDRIE
lating human T(H)-17 responses. Nat
WANG, Q
WANG, D. & PINSKI, J. (2004b). Interleukin-6 inhibits the growth of prostate
cancer xenografts in mice by the process of neuroendocrine differentiation. Int J
Cancer, 111, 508-13.
SPIOTTO, M.T. & CHUNG, T.D. (2000). STAT3 mediates IL-6-induced neuroendocrine
differentiation in prostate cance
STEINER, H., GODOY-TUNDIDOR, S., ROGATSCH, H., BERGER, A.P., FUCHS, D., COMUZZI, B.,
BARTSCH, G., HOBISCH, A. & CULIG, Z. (200
tumors that up-regulate interleukin-6 is associated with reduced retinoblastoma
protein expression and activation of the mitogen-activated protein kinas
Am J Pathol, 162, 655-63.
GER, B., VELDHOEN, M. & MARTIN, B. (2007). Th17 T cells: linking innate and adaptive
immunity. Semin Immunol, 19, 353-61.
SUN, X.F. & ZHANG, H. (2007). NFKB and NFKBI polymorphisms in relation to susceptibility of
tumour and other diseases. Histol Hist
SUN, Y., NIU, J. & HUANG, J. (2009). Neuroendocrine differentiation in prostate cancer. Am J
Transl Res, 1, 148-62.
I, E., LOGUE, S.E., GORMAN, A.M. & SAMALI, A. (2006). Mediators
reticulum stress-induced apoptosis. EMBO Rep, 7, 880-5.
CU, R. & CONSTANTINESCU, C.S. (2010). Cannabin
overview. Immunobiology.
, G., SCHIRMBOCK, M., THALHAMMER, T., SHERWOOD, E.R., BAUMGARTNER, G. &
HAMILTON, G. (1993).
in prostate cancer cell lines. J Urol, 150, 1544-7.
N, J. & J
discovery. Oncogene, 19, 6613-26.
. & HUNYADY, L. (2010). Signal transduction of the CB1 cannabinoid receptor. J Mol
Endocri
VAARALA, M.H., PORVARI, K., KYLLONEN, A. & VIHKO, P. (2000). Differentially expressed genes
in two LNCaP prostate cancer cell lines reflecting changes during prostate cancer
progression. Lab Invest,
VAN BOKHOVEN, A., VARELLA-GARCIA, M., KORCH, C., HESSELS, D. & MILLER, G.J. (2001). Widely
used prostate carcinoma cell lines share common origins. Pro
VAN BOKHOVEN, A., VARELLA-GARCIA, M., KORCH, C., JOHANNES, W.U., SMITH, E.E., MILLER,
H.L., NORDEEN, S.K., MILLER, G.J. & LUCIA, M.S. (2003). Molecular characterization of
human prostate carcinoma cell lines. Prostate, 57, 205-25.
LDHOVEN, P.P., MATTHEWS, T.J., BOLOGNESI, D.P. &
bioactive lipids, alkylacyl lycerol and ceramide, occur in HIV-infected cells. Biochem
Biophys Res Commun, 187, 209-16.
, G.
Cannabinoids and ceramide: two lipids acting hand-by-hand. Life Sci, 77, 1723-31.
, B., GAL, P. & MOJZIS, J. (2006). [Different views on the associa
cannabinoids and cancer]. Cas Lek Cesk, 145, 453-7; discussion 458-9.
UX, D., ESCOBAR, P. & LAZENNEC, G. (2009). Emerging roles of chemokines in prostate
cancer. Endocr Relat Cancer, 16, 663-73.
VOLPE, E., SERVANT, N., ZOLLINGER, R., BOGIATZI, S.I., HUPE, P., BARILLOT, E. & SOUMELIS, V.
(2008). A critical function for transforming growth factor-beta, interleukin 23 and
proinflammatory cytokines in driving and modu
Immunol, 9, 650-7.
., HORIATIS, D. & PINSKI, J. (2004a). Inhibitory effect of IL-6-induced neuroendocrine
cells on prostate cancer cell proliferation. Prostate, 61, 253-9.
Q., HORIATIS,

Bibliografía

148

WITTE, cancer genomics: towards a new understanding. Nat Rev
WONG, uction of proinflammatory response in prostate
WORM, DOLLE, R.E. (2009). Simultaneous optimization of potency, selectivity and
XING, Y. ZHANG, Q. & LU, G. (2001). The effect of interleukin-6 on the proliferation of
XU, X.,
Cancer Genet
YAMAZA
chim Biophys Acta,
YANG, L
3). Interleukin-6 differentially regulates androgen receptor transactivation via
s, 58, 3732-5.
etrahydrocannabinol regulates Th1/Th2 cytokine balance in activated human
ZHANG,
s via activation of JNK and inhibition of Akt pathways in
ZIERLER
ZOU, Y., N, J., WU, T. & CHEN, X. (2008). The JNK signaling pathway is
ZU, K., H


WEI, X., GUO, W., WU, S., WANG, L., HUANG, P., LIU, J. & FANG, B. (2010). Oxidative stress in
NSC-741909-induced apoptosis of cancer cells. J Transl Med, 8, 37.
J.S. (2009). Prostate
Genet, 10, 77-82
C.P., BRAY, T.M. & HO, E. (2009). Ind
cancer epithelial cells by activated macrophages. Cancer Lett, 276, 38-46.
K. &
physicochemical properties for cannabinoid CB(2) ligands. Curr Pharm Des, 15, 3345-
66.
, XIAO, Y.,
prostate cancer cells in vitro and the modulation of this procedure. J Tongji Med Univ,
21, 225-7.
LIU, Y., HUANG, S., LIU, G., XIE, C., ZHOU, J., FAN, W., LI, Q., WANG, Q., ZHONG, D. &
MIAO, X. (2006). Overexpression of cannabinoid receptors CB1 and CB2 correlates
with improved prognosis of patients with hepatocellular carcinoma.
Cytogenet, 171, 31-8.
KI, H., SCHNEIDER, E., MYERS, C.E. & SINHA, B.K. (1994). Oncogene overexpression
and de novo drug-resistance in human prostate cancer cells. Bio
1226, 89-96.
., WANG, L., LIN, H.K., KAN, P.Y., XIE, S., TSAI, M.Y., WANG, P.H., CHEN, Y.T. & CHANG,
C. (200
PI3K-Akt, STAT3, and MAPK, three distinct signal pathways in prostate cancer cells.
Biochem Biophys Res Commun, 305, 462-9.
YANG, M., LODA, M. & SYTKOWSKI, A.J. (1998). Identification of genes expressed differentially
by LNCaP or PC-3 prostate cancer cell lines. Cancer Re
YUAN, M., KIERTSCHER, S.M., CHENG, Q., ZOUMALAN, R., TASHKIN, D.P. & ROTH, M.D. (2002).
Delta 9-T
T cells. J Neuroimmunol, 133, 124-31.
Y., KONG, C., ZENG, Y., WANG, L., LI, Z., WANG, H., XU, C. & SUN, Y. Ursolic acid
induces PC-3 cell apoptosi
vitro. Mol Carcinog, 49, 374-85.
, S., KLEIN, B., FURTNER, T., BRESGEN, N., LUTZ-MEINDL, U. & KERSCHBAUM, H.H.
(2006). Ultraviolet irradiation-induced apoptosis does not trigger nuclear
fragmentation but translocation of chromatin from nucleus into cytoplasm in the
microglial cell-line, BV-2. Brain Res, 1121, 12-21.
NIU, P., YANG, J., YUA
involved in sodium-selenite-induced apoptosis mediated by reactive oxygen in HepG2
cells. Cancer Biol Ther, 7, 689-96.
AWTHORN, L. & IP, C. (2005). Up-regulation of c-Jun-NH2-kinase pathway contributes
to the induction of mitochondria-mediated apoptosis by alpha-tocopheryl succinate in
human prostate cancer cells. Mol Cancer Ther, 4, 43-50.


Summary



















ANEXO I: SUMMARY




















Summary

151

1.- IN

TRODUCTION
Prostate cancer is the most common malignancy in males and the most frequently diagnoses
ca lops to ncer in Western countries. Although it initially response to androgen ablation therapy it often deve
an hormon d, it can e-refractory state in which androgen deprivation is ineffective. While the tumor is locate
be is more treated by surgical removal of the prostate or by radiation therapy, but when the tumor
advanced l is very and it is capable of metastasis there is no effective treatment and the patients’ surviva
re ncrease duced. Current treatment for these patients is chemotherapy with cytotoxic agents, but this just i
its surviva eath in l a few months, being in fact prostate cancer metastasis the second leading cause of d
men. The onducted to develop new drugs able to stop tumor refore, continuous research is being c
de ssary. It velopment and hence the use of new approaches in the treatment of prostate cancer is nece
has recen ects many cellular processes involved in tumor tly being shown that cannabinoids aff
de system,
including c ., 2005)
velopment. In addition, prostate cancer express several components of the endocannabinoid
annabinoid receptors (Ruiz-Llorente et al., 2003), the TRPV1 receptor (Sanchez et al
an ugs that d the enzyme FAAH ( Ruiz-Llorente et al., 2004) making it susceptible to the treatment with dr
affect som analyze the effect of e of these components. Therefore, the aim of this study was to
ca

2.- EX
To a of [
3
H]-
th ell cycle
were perfo eramide
lev ells and
by the stud
The mice, which were
injected subcutaneously with 2 x 10
6
PC-3 cells. Two weeks after transplantation, tumors were grown to an
average volume of 80 mm
3
. Mice were then divided into three experimental groups which received the
following treatments as s.c. injections: group A, saline (control); group B, 0.15 mg/kg b.w. JWH015; group
C, 0.15 mg/kg b.w. JWH015 plus 0.15 mg/kg b.w SR2. The injection was repeated every day and
nnabinoids on prostate cancer cells proliferation and to study the mechanism involved.
PERIMENTAL PROCEDURES

nalyze the effect of cannabinoids in prostate cancer cells MTT assay, measurement
ymidine incorporation into DNA, flow cytometry to detect apoptotic cells and the distribution of c
rmed. The mechanisms involved in this effect were analyzed by measurement of c
els with the method described by Bielawska et al., 2001 for ceramide quantification in cultured c
y of the activation of different proteins involved in the stress response.
in vivo antitumor activity of JWH015 was studied in athymic nude (nu/nu)

Summary

152

treatment was continued for 14 days. Tumor volumes were monitored every day using calliper
measurements and were calculated by the formula: (4π/3) x (w/2)
2
x (l/2), where w = width and l = length.
The body weight of the animals was recorded daily.
The effect of cannabinoid on IL-6 secretion was measured by ELISA assay, and the activity of this
cytokine was corroborated by Western blot. Also, the effect of IL-6 on the PC-3 cell line viability was
analyzed by MTT assay, and the expression of STAT3 was studied by RT-PCR and Western blot. Finally,
Chromatin Immunoprecipitation assay was realized to study the binding of p65 subunit of NFκB to IL-6
promoter.
The levels of IL-17 secreted by human mononuclear cells when these were incubated with the
supernatant of PC-3 treated with cannabinoid were measured by ELISA assay.
The statistical analysis was performed by comparisons among groups with a Student’s t test and the
differences were considered to be statistically significant when the P value was < 0.05. Data are
presented as the mean ±.S. E of the number of experiments indicated.

3.- RESULTS AND CONCLUSION

The cannabinoids MET and JWH015 inhibited the growth of PC-3 cells and induced cell death
through apoptosis. These effects were mediated by the CB2 receptor.
The molecular mechanism involved in cannabinoid-induced cell death included an increase de novo
synthesis of ceramide and the regulation of different stress-related cellular signaling cascades.
Cannabinoids MET and JWH015 induced JNK activation and p38 inhibition. Moreover, they also regulated
the activity of Akt, a ser/thr protein which has been involved in the inhibition of autophagy, which was
activated at short incubation times but was totally inhibited at longer times. Cannabinoid treatment also
inhibited the translator factor eIF2α, which is related to the reticulum stress response. Finally,
cannabinoids activated the mitochondrial pathway of apoptosis, enhancing the release of cytochrome c
into the cytosol and the proteolysis of caspase 9.
The in vivo effect of cannabinoids was analyzed by the induction of PC-3 tumor xenografts in nude
mice. JWH015 treatment resulted in a tumor growth curve significantly lower than that of the control group
and a decrease in the tumor weight at the endpoint. The treatment with JWH015 + SR2, a CB2 antagonist,
produced an uncontrolled tumor growth, similar to that of the control group. These results indicated that
CB2 receptor is responsible for the tumor regression induced by JWH015.

Summary

153

Moreover, MET and JWH015 induced an increase in the IL-6 secretion by PC-3 cells, but they did
not exert any effect on the secretion of IL-6 by the non-tumor RWPE-1 cells. This increase was mediated
by the CB2 receptor, as evidenced its reversion in the presence of the CB2 receptor antagonist, or by
receptor gene silencing. The increase on IL-6 secretion was mediated by CERK, which phospohorilated
ceramide to C1P, as CERK gene silencing completely blocked the increase of the IL-6 secretion.
The pathways which participate in the IL-6 secretion include PI3K/Akt pathway and the classic
pathway of NFκB. This transcription factor was activated downstream of PI3K/Akt, and regulated the
transcription of IL-6 by binding to its promoter, as determinate by ChIP assay. Pharmacological inhibition
of CB2 prevented the JWH015-induced Akt phosphorylation and the NFκB activation.
Although the IL-6 secreted by cells PC-3 was functionally active, as evidenced by the fact that it was
capable of activating STAT3 in other cells, it did not cause any effect on PC-3 cell line viability, probably
because PC-3 cell line does not express STAT3.
Incubation of human mononuclear cells with cannabinoid-treated PC-3 supernatants induced an
increase in the secretion of IL-17 by mononuclear cells. This finding indicates that the IL-6 secreted by
JWH015-treated PC-3 cells could induce lymphocyte differentiation into the Th17 cells. Therefore, results
showed in this study are very promising since they indicate that cannabinoids inhibit PC-3 tumor cells in
vitro and in vivo and induce lymphocyte differentiation which could be use in the therapeutic treatment for
prostate cancer.





Publicaciones












































ANEXO II: PUBLICACIONES





























You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->