P. 1
Clase Genoma Humano

Clase Genoma Humano

5.0

|Views: 4.609|Likes:
Publicado porapi-3839164
The correct one
The correct one

More info:

Published by: api-3839164 on Oct 18, 2008
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PPT, PDF, TXT or read online from Scribd
See more
See less

03/18/2014

pdf

text

original

EL GENOMA HUMANO

TAMAÑO, ESTRUCTURA Y ORGANIZACIÓN

 

 

GENOMA HUMANO

Genoma Nuclear 3300 Mb (30000 genes) 25% Genes y secuencias relacionadas 75% DNA extragénico

Genoma Mitocondrial 16,6 kb (37 genes)

Dos genes de rRNAs 60%

22 genes de rRNAs

13 proteínas

40%

10% DNA DNA Codificante Codificante

90% DNA No Codificante Unicas o bajo número de copias Moderada a altamente repetitiva

Seudo genes Seudo genes  

Fragmentos de genes

Intrones  

Repetidos agrupados o en tandem

Repetidos dispersos

 

 

La variabilidad en los seres vivos…
• La vida es extraordinariamente variada
Mientras archeabacterias sobreviven en chimeneas subterráneas a temperaturas elevadas en el fondo del océano … los osos polares con más de una tonelada de peso, vagan en las inmediaciones del circulo polar ártico.

 

 

… correlaciona con la variabilidad enlos genomas

Los tamaños genómicos (largo del DNA) varían desde los 5,000 pb del virus SV40 hasta los 3*109 pb de humanos o los 1011 pb de plantas superiores.

 

 

Tamaño de los Genomas Procariontes
Su relación con el número de genes
Procariontes Buchnera species Chlamydia pneumoniae Haemophilus influenzae Helicobacter pylori Mycobacterium tuberculosis Mycoplasma pneumoniae Neisseria meningitidis Staphylococcus aureus Streptococcus pneumoniae Xilella fastidiosa C DNA * 640.681 1.230.230 1.830.138 1.667.867 4.411.529 816.394 2.272.351 2.813.641 2.160.837 2.679.306 N de genes (estimados) 564 1.052 1.709 1.566 3.918 677 2.025 2.595 2.094 2.766

En procariontes existe una buena correlación tanto entre tamaño genómico y “complejidad” morfológica, como entre tamaño genómico y número de genes.
   

Organización de los Genomas Procariontes

Los genes no presentan intrones, son continuos. Una parte de sus genes está organizado en operones. - Comparten las regiones reguladoras y promotoras. Las regiones intergénicas son cortas.

 

 

Tamaño de los Genomas Eucariontes
Su relación con el número de genes
Eucariontes Saccharomyces cerevisiae Arabidopsis thaliana Plasmodium falciparum Caenorhabditis elegans Drosophila melanogaster Anopheles gambiae Danio rerio (zebrafish) Mus musculus Rattus norvegicus Homo sapiens C DNA * 12.000.000 115.000.000 23.000.000 97.000.000 116.000.000 278.000.000 1.560.000.000 2.490.000.000 2.570.000.000 2.693.000.000 N de genes (estimados) 5.800 25.498 5.300 19.099 13.601 14.653 20.000 24.948 21.276 30.000

En eucariontes no existe una buena correlación entre tamaño genómico, complejidad morfológica, y número de genes.
   

Organización del Genoma Eucarionte
Factores que contribuyen a un mayor tamaño genómico Estructura de los genes: - Los genes presentan intrones, son discontinuos. - Los genes tienen extensas regiones reguladoras 5´ y 3´. - Los mRNAs tienen extensas regiones no traducibles 5´ y 3´.

 

 

Organización del Genoma Eucarionte
Factores que contribuyen a un mayor tamaño genómico Gran cantidad de DNA espaciador: - Los genes se encuentran separados por una gran cantidad de DNA no codificante. Esta condición aumenta al pasar de unicelulares a pluricelulares.

 

 

Organización del Genoma, Resumen

Los genomas procariontes presentan poco DNA intergénico, genes sin intrones y frecuentemente agrupados en operones.

Los genomas eucariontes presentan mucho DNA intergénico, genes con intrones y     principalmente aislados.

Estructura de los genes codificantes
Genes continuos y discontinuos en eucariontes El número de exones de los genes es mayor en mamíferos que en otros eucariontes como D. melanogaster o S. cereviceae. El número de exones parece aumentar, al aumentar la “complejidad” de los eucariontes.

 

 

Estructura de los genes codificantes Tamaño de los Genes
El tamaño de los genes es mayor en mamíferos que en otros eucariontes como D. melanogaster o S. cereviceae. El tamaño parece aumentar, al aumentar la “complejidad” de los eucariontes.

 

 

Expresión de los genes codificantes

El uso de promotores alternativos, terminadores alternativos y splicing alternativo permite aumentar la cantidad de productos génicos que se obtienen a partir de los genes codificantes.

Más del 40% de los genes en humanos tienen procesamiento alternativo.
   

Nature, 15 febrero 2001

Science, 16 febrero 2001

 

 

Estrategias para la secuenciación del genoma

Consorcio Público
Eric Lander

Genoma completo se fragmenta Los fragmentos se clonan en BACs Los BACs se organizan Los BACs se fragmentan Los fragmentos se subclonan
GATACCATCGGACATAATTGCACCATCCATTAGG TCCATTAGGGATTAATTGCACCATCCAGGTTAGGGAT

se secuencian se ensambla

GATACCATCGGACATAATTGCACCATCCATTAGGGATTAATTGCACCATCCAGGTTAGGGAT

 

 

Estrategias para la secuenciación del genoma

Consorcio Privado Genoma completo se fragmenta en trozos pequeños
J. Craig Venter

Los fragmentos se clonan en BACs y otros vectores
CCATCCAGGTTAGGGAT CCATCCAGGTTAGGGAT CACCATCCATTAGGGATTAA AATTGCACCATCCATTA CACCATCCATTAGGGATTAA AATTGCACCATCCATTA GATACCATCGGACATAAT

se secuencian

GATACCATCGGACATAAT

GATACCATCGGACATAATTGCACCATCCATTAGGGATTAATTGCACCATCCAGGTTAGGGAT    

se alinean en base a un algoritmo computacional

S. cerevisae 12.1 mB 6,300 genes

D. melanogaster 137 mB 14,000 genes

 

A. thaliana 142 mB 26,000 genes

H. sapiens 3,200 mB   30,000 genes

F. Rubripes 365 mB 31,000 genes

Generalidades sobre genoma humano
Resultados del proyecto genoma Tamaño Secuencia publicada Feb. 2001 Contenido AT genoma repetido Genes identificados Genes totales (identif. + hipot.) Genes con función desconocida Genes con procesamiento alternativo 3.200 Mpb 2.910 Mpb 54 % 35 % 26.000 39.000 42 % 40 %

 

 

GENOMA HUMANO

Genoma Nuclear 3300 Mb (30000 genes) 25% Genes y secuencias relacionadas 75% DNA extragénico

Genoma Mitocondrial 16,6 kb (37 genes)

Dos genes de rRNAs 60%

22 genes de rRNAs

13 proteínas

40%

10% DNA DNA Codificante Codificante

90% DNA No Codificante Unicas o bajo número de copias Moderada a altamente repetitiva

Seudo genes Seudo genes  

Fragmentos de genes

Intrones  

Repetidos agrupados o en tandem

Repetidos dispersos

El cariotipo humano

 

No perdamos de vista que el genoma humano está dividido en cromosomas.  

Los genomas eucariontes se estructuran en cromosomas

 

 

Morfología cromosómica (bandas G)
Genes ribosomales

Constricción secundaria

satélite centrómero Banda G + Banda G ­ telómero

Brazo corto

Brazo largo

Banda G + Banda G ­
 

Regiones ricas en AT Regiones ricas en GC
 

Replican tardíamente Replican temprano

Pobres en genes Ricas en genes

Representación gráfica del genoma humano
Porcentaje 0 10 20 30 40 50 60 70 80 90 100

45% 53% 21% 34% 42% 48% 66%

92% 90% 100%

LINEs

SINEs

intrones Exones genes

Elementos retrovirales “fósiles” de transposones Segmentos duplicados Secuencias repetidas simples

25%
heterocromatina

REPETIDO    

UNICO

NO SECUENCIADO

La región del genoma que codifica
Genes (25%)

Intrones (23%)

Exones (2%)

  Sólo  algo menos del 2% del genoma humano corresponde a secuencias exónicas.

Contenido de GC en genes y genoma humano

La fracción del DNA que tiene entre un 45 y 55% de GC representa un 18% del genoma y contiene al 35% de los genes.
   

Las regiones del genoma con mayor contenido GC tienen mayor densidad génica.

Las bandas claras tienen un mayor contenido de GC.

GENOMA HUMANO

Genoma Nuclear 3300 Mb (30000 genes) 25% Genes y secuencias relacionadas 75% DNA extragénico

Genoma Mitocondrial 16,6 kb (37 genes)

Dos genes de rRNAs 60%

22 genes de rRNAs

13 proteínas

40%

10% DNA DNA Codificante Codificante

90% DNA No Codificante Unicas o bajo número de copias Moderada a altamente repetitiva

Seudo genes Seudo genes  

Fragmentos de genes

Intrones  

Repetidos agrupados o en tandem

Repetidos dispersos

Estructuras repetitivas en los genomas eucariotes
• Los genomas eucariotes contienen varios tipos de estructuras repetitivas: satelites, micro y mini-satelites, retrotransposones, retrovirus, etc. El tamaño de las regiones repetidas correlaciona con el tamaño genómico.

Heterocromatina (*109bp)

Gorrila gorilla Symphalangus syndactylus Pan troglodites Homo sapiens Hylobates muelleri

 

 

Tamaño genoma (*109bp)

La región del genoma que no codifica

DNA repetido agrupado
DNA repetitivo centromérico (Satélite)
Tamaño del repetido: 80 a 180 pb. Tamaño del conglomerado: 100 a 5.000 Kbp. Localización: Centrómeros

Otros repetidos agrupados. Agrupados únicos VNTRs STRs DNA repetitivo telomérico
 

Tamaño del repetido: 6 pb. Tamaño del conglomerado: 100pb a 20 Kbp.   Localización: Telómeros.

La región del genoma que no codifica

Los elementos repetidos dispersos
Largo Porcentaje del genoma

LINEs SINEs (Alu)

 

 

La región del genoma que no codifica

Los elementos repetidos dispersos

Tipos de DNA repetido disperso SINEs Familia más representativa Longitud del fragmento de repetición Cantidad de copias en el genoma (Mpb) Localización cromosómica preferencial Composición nucleotídica
 

LINEs Line-1 6 a 8 Kbp 850.000 (560) Bandas G+ AT

Alu 100 a 300 pb 1.500.0000 (360) Bandas GGC
 

Transposones y retrotransposones
Efectos sobre la estructura de los genes

F. rubripes 365 mB 31,000 genes Comparación de las secuencias genómicas del gen de la Hantingtonina humana y de Fugu. Ambos genes contienen 67 exones. El gen humano es 7,5 veces más grande que el de Fugu (180.000 v/s 24.000 pb). Esto se debe a la gran cantidad de retrotransposones presentes en los intrones del gen humano.
   

Distribución de los elementos repetidos dispersos en el genoma

LINEs SINEs

 

Las inserciones Alu son más frecuentes en las regiones ricas en GC. Los LINEs son más frecuentes en las regiones ricas en AT
 

Recapitulemos: un cromosoma eucarionte contiene

DNAs repetidos dispersos

Genes ribosomales

Genes codificantes DNAs repetidos agrupados

 

 

La real magnitud de nuestras diferencias
Identidad entre secuencias humanas
Entre un 99,98 y un 99,92% de identidad existe entre los humanos. Esto significa que dos individuos cualesquiera difieren entre ellos en 600.000 a 2.400.000 pb. Cerca de 2,1 millones de polimorfismos de nucleótido simple (SNPs) han sido descritos. Esto es 1 cada 1250 pb en promedio.
   

La real magnitud de nuestras diferencias
Identidad entre chimpancé y secuencias humanas

 

En promedio existen menos de 150 millones de pb de diferencia entre chimpancé y humano.
 

La totalidad de los clones de Chimpancé presentan más de un 95% de identidad con la secuencia humana.

GENOMA HUMANO

Genoma Nuclear 3300 Mb (30000 genes) 25% Genes y secuencias relacionadas 75% DNA extragénico

Genoma Mitocondrial 16,6 kb (37 genes)

Dos genes de rRNAs 60%

22 genes de rRNAs

13 proteínas

40%

10% DNA DNA Codificante Codificante

90% DNA No Codificante Unicas o bajo número de copias Moderada a altamente repetitiva

Seudo genes Seudo genes  

Fragmentos de genes

Intrones  

Repetidos agrupados o en tandem

Repetidos dispersos

El Genoma Mitocondrial

 

 

La Mitocondria

 

 

EL DNA mitocondrial

Euglena gracilis

 

 

Tamaño de genomas mitocondriales de diversos organismos vivos

 

 

Número y tipo de genes presentes en el DNA mitocondrial de algunos organismos vivos

 

 

Cantidad relativa de DNA organelar en algunas células y tejidos

 

 

Algunas diferencias entre el Código Genético “Universal” y el Mitocondrial

Codon UGA AUA CUA AGA

AGG

}
 

 

Hipótesis endosimbiótica

 

 

Organización del DNA mitocondrial humano

 

 

El mtDNA se transmite por vía materna

 

 

Componentes de la cadena respiratoria: aporte mitocondrial y nuclear

 

 

Características generales de las enfermedades mitocondriales
• • • • • • Baja eficiencia en la reducción del O2 a H2O Baja eficiencia en la recuperación del poder reductor: NADH y FADH2 Disminución marcada y progresiva en la producción de ATP Aumento en la producción de radicales libres Aumento de las mutaciones somáticas Presencia de formas normales y mutadas de mtDNA (heteroplasmía)

 

 

Tejidos afectados por mutaciones en el mtDNA

 

 

Clasificación de las enfermedades según su origen molecular
CLASE I: Mutaciones en el DNA nuclear •en los genes de las proteínas que forman la cadena de transporte de electrones •en genes relacionados con la replicación, transcripción y traducción del mtDNA •en genes relacionados con el importe de proteínas a mitocondria CLASE II: Mutaciones puntuales en el DNA mitocondrial •que afectan a los genes de las proteínas de la cadena de transporte de electrones codificadas en el mtDNA •que afectan los genes que codifican los tRNAs mitocondriales.
   

Clasificación de las enfermedades según su origen molecular

CLASE III: Deleciones y duplicaciones en el DNA mitocondrial •Deleciones de varias kilobases que involucran a varios genes en el mtDNA •Inserción de un fragmento duplicado del mtDNA CLASE IV: Defectos genéticos no definidos

 

 

Algunas mutaciones puntuales en el mtDNA asociadas a enfermedades

 

 

LHON (Neuropatía óptica hereditaria de Leber)

 

Un número importante de pacientes presentan mutaciones puntuales en: G3460A, G11768A, T14184C, A14495G.  

Mutaciones en el tRNA de leucina asociadas a enfermedades

 

 

MERRF (Epilepsia mioclónica y enfermedad de las fibras rojas rasgadas)

Succinato deshidrogenasa 90% de los pacientes presentan G8344A o T8356C en el gen mitocondrial tRNAlys    

Citocromo c oxidasa

Segregación replicativa de una mutación mitocondrial heteroplásmica

Umbral de expresión fenotípica

 

 

Modelo de evolución multiregional

Milford Wolpoff

 

 

Modelo “Out of Afríca”

Christopher Stringer

 

 

 

 

Evidencia mitocondrial para la existencia de una “EVA africana”

 

 

Modelo migracional propuesto en base a polimorfismos de mtDNA

 

 

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->