Está en la página 1de 76

GENTICA

BASES MOLECULARES DE LA HERENCIA


UNIDAD IV DESARROLLO
Dr. DAVID TALLEDO

LA FUNCIN DE LOS GENES: EL ADN Y EL CDIGO DE LA VIDA


DESPUS QUE LA GENTICA SE ESTABLECIERA COMO CIENCIA Y SE ESCLARECIERAN LOS PATRONES DE LA HERENCIA A TRAVS DE LOS GENES, LAS PREGUNTAS MS IMPORTANTES PERMANECIERON SIN RESPUESTA DURANTE MS DE CINCUENTA AOS: CMO SE COPIAN LOS CROMOSOMAS Y SUS GENES DE UNA CLULA A OTRA, Y CMO DETERMINAN STOS LA ESTRUCTURA Y CONDUCTA DE LOS SERES VIVOS?

LOS GENES, LAS PROTENAS Y LOS CARACTERES


MENDEL: LA TRANSMISIN DE LA HERENCIA SE REPRESENTABA COMO: 1 GEN 1 CARCTER

A PARTIR DE 1941 SE COMPRENDE QUE ES MS CORRECTO DECIR QUE LA TRANSMISIN DE LA HERENCIA SE DEBE REPRESENTAR COMO: 1 GEN 1 PROTENA 1 CARCTER

NEUROSPORAS MEDIO MINIMO NO HAY CRECIMIENTO MEDIO COMPLETO HAY CRECIMIENTO

DEMOSTRACIN QUE LOS GENES CONDICIONAN LOS CARACTERES A TRAVS DE LAS PROTEINAS EXPERIMENTO REALIZADO POR BEADLE , G. Y TATUM, E.

X
Vit. . AA.

HAY CRECIMIENTO

AC. NUCLEICOS

HAY CRECIMIENTO POR LO TANTO ESTE MUTANTE TIENE INACTIVA ALGUNA ENZIMA QUE PERMITE LA SNTESIS DE ESTE AMINOCIDO.

EL MATERIAL GENTICO: ADN ?


HASTA ANTES DE 1940:

1. SE SABA QUE LOS FACTORES HEREDITARIOS DESCRITOS POR MENDEL ESTABAN ASOCIADOS A CARACTERES ESPECFICOS. SU NATURALEZA FSICA ERA DESCONOCIDA. 2. SE SABA QUE LOS GENES ESTABAN SITUADOS EN LOS CROMOSOMAS. 3. LA TEORA UN GEN-UNA ENZIMA POSTULABA QUE LOS GENES CONTROLABAN LA ESTRUCTURA DE LAS PROTENAS. 4. SE DESCUBRI QUE LOS CROMOSOMAS SE COMPONAN DE ADN Y PROTENAS. 5. NO SE CONOCA CUAL DE ESTAS DOS SUSTANCIAS DE LOS CROMOSOMAS ERA LA PORTADORA DE LA INFORMACIN GENTICA, AUNQUE SE SUPONA QUE DEBAN SER LAS PROTENAS.

EL MATERIAL GENTICO: ADN ?


FENMENO DE LA TRANSFORMACIN EXPERIMENTO DE FREDERICK GRIFFITH, 1928.

EN 1928, EN EL CURSO DE SUS EXPERIMENTOS CON RATONES DE LABORATORIO Y CON LA BACTERIA STREPTOCOCCUS PNEUMONIAE , EL BIOLGO INGLS FREDERICK GRIFFITH REALIZA LA PRIMERA DEMOSTRACIN DE LA TRANSFORMACIN BACTERIANA

TRATAMIENTO 1 (CONTROL)

FENMENO DE LA TRANSFORMACIN EXPERIMENTO DE FREDERICK GRIFFITH, 1928. CONCLUSIN: R ES NO VIRULENTO

NEUMOCOCOS

EL RATON VIVE

TRATAMIENTO 2 (CONTROL)

CONCLUSIN: S ES VIRULENTO
NEUMOCOCOS S EL RATON MUERE

TRATAMIENTO 3

CONCLUSIN: S ES NO VIRULENTO
NEUMOCOCOS S (INACTIVADOS POR EL CALOR) EL RATON VIVE

TRATAMIENTO 4

CONCLUSIN: LOS NEUMOCOCOS R BAJO LA INFLUENCIA DE SUSTANCIAS (?) OBTENIDAS DE LOS NEUMOCOCOS S INACTIVOS ADQUIEREN SUS PROPIEDADES VIRULENTAS

NEUMOCOCOS R + NEUMOCOCOS S (INACTIVADOS)

EL RATON MUERE

EL MATERIAL GENTICO: ADN ?


ROL DE LAS DIFERENTES SUSTANCIAS DE LA CLULA Y SU INFLUENCIA SOBRE LA TRANSFORMACIN. EXPERIMENTO DE AVERY,McCARTY y McLEOD, 1944 EL EXPERIMENTO DE ESTOS TRES INVESTIGADORES CONSISTA EN CONTINUAR EL TRABAJO DE GRIFFITH Y DETERMINAR QU SUSTANCIA TENA LA CAPACIDAD DE TRANSFORMAR LAS BACTERIAS DE NEUMOCOCOS NO VIRULENTAS EN VIRULENTAS.

OSWALD T.AVERY

COLIN McCARTY

MACLYN McLEOD

NEUMOCOCOS S INACTIVADOS

LPIDOS CARBOHIDRATOS

ROL DE LAS DIFERENTES SUSTANCIAS DE LA CLULA Y SU INFLUENCIA SOBRE LA TRANSFORMACIN. EXPERIMENTO DE AVERY,McCARTY y McLEOD, 1944
ADICIN DESOXIRIBONUCLEASAS

ADICIN PROTEINASAS

ADICIN RIBONUCLEASAS

MUESTRA NO CONTIENE

MUESTRA NO CONTIENE

MUESTRA NO CONTIENE

ADICIN NEUMOCOCO R

ADICIN NEUMOCOCO R

ADICIN NEUMOCOCO R

SE ACTIVAN NEUMOCOCOS S

SE ACTIVAN NEUMOCOCOS S

NO SE ACTIVAN NEUMOCOCOS S

OSWALD T.AVERY

COLIN McCARTY

MACLYN McLEOD

ESTOS TRES INVESTIGADORES DEMOSTRAN QUE EL ADN ES EL PORTADOR DE LA INFORMACIN HEREDITARIA


SIN EMBARGO, EL TRABAJO DE AVERY y COL. NO TUVO MUCHA ACEPTACIN, YA QUE SE PENSABA QUE SE TRATABA DE UN CASO ESPECFICO PARA NEUMOCOCOS.

EL MATERIAL GENTICO: ADN ?


EL ADN ES EL TRANSMISOR DE LA INFORMACIN GENTICA EXPERIMENTO DE ALFRED HERSHEY Y MARTHA CHASE, 1952

ESTOS DOS INVESTIGADORES DECIDIERON COMPROBAR LA HIPOTESIS DE AVERY y Col. UTILIZANDO COMO MATERIAL EXPERIMENTAL LOS BACTERIFAGOS.

EL FAGO ESTABA CONSTITUIDO POR DOS SUSTANCIAS FUNDAMENTALES: PROTENAS Y ADN.

HASTA ENTONCES LAS PROTENAS SE CONSIDERABAN COMO PORTADORAS DE LA INFORMACIN GENTICA SUPONIENDO QUE LA FUNCIN MS COMPLEJA DEBA ESTAR A CARGO DE LAS SUSTANCIAS MS COMPLEJAS.

HERHEY Y CHASE PARTEN DE LA HIPTESIS CONTRARIA SUPONIENDO QUE EL FACTOR IMPORTANTE ERA EL ADN.

ADEMS, POR QUE SE CREA QUE EL ADN ESTABA COMPUESTO POR UNA SECUENCIA REGULAR Y REPETITIVA DE BASES NITROGENADAS (ATGC, ATGC, ATGC).

BACTERIFAGO
CABEZA DEL FAGO

* SON VIRUS PARSITOS DE LAS BACTERIAS CON CAPACIDAD DE PRODUCIR LA DESTRUCCIN DE LAS MISMAS. * SU ESTRUCTURA CONSTA DE UNA CPSULA PROTICA QUE CONTIENE UNA MOLCULA DE ADN. * ACCIN: SE ADQUIEREN A LA MEMBRANA BACTERIAL Y DESPUS DE 20 MINUTOS LIBERAN APROX. 100 NUEVOS FAGOS.

CUELLO

FILAMENTO DEL CUELLO

CLULA BACTERIANA

ADN

HERSEY y CHASE,QUERIAN DEMOSTRAR QUE EL ADN LLEVABA LA INFORMACIN NECESARIA PARA LA FORMACIN DE NUEVOS FAGOS EL EXPERIMENTO CONSISTI EN OBTENER INICIALMENTE FAGOS MARCADOS CON ISTOPOS RADIACTIVOS DE AZFRE (S35) Y FOSFORO (P32)

FAGO T2 RADIOACTIVO (CPSULA)

CUERPO DEL FAGO

E. coli

LA MAYOR RADIOACTIVIDAD SE ENCONTR AQU

S35

CENTRIFUGACIN

EL ADN ES EL TRANSMISOR DE LA INFORMACIN GENTICA EXPERIMENTO DE ALFRED HERSHEY Y MARTHA CHASE, 1952

(ADN)

p32

E. coli

CUERPO DEL FAGO QUEDO DEMOSTRADO QUE EL ADN DEL FAGO SE INTRODUCE EN LA BACTERIA LLEVANDO LA INFORMACIN PARA LA FORMACIN DE NUEVOS FAGOS .

CENTRIFUGACIN

LA MAYOR RADIOACTIVIDAD SE ENCONTR AQU

EL MATERIAL GENTICO: ES EL ADN


POR TRATARSE DE UN FENMENO GENTICO, EL EXPERIMENTO DESCRITO POR HERSHEY Y CHASE PERMITI ESTABLECER QUE EL MATERIAL GENTICO ES EL ADN Y QUE LA INFORMACIN QUE GUARDA EN SU ESTRUCTURA ES UTILIZADA PARA LA SNTESIS DE DIFERENTES PROTENAS, QUE TIENEN PROPIEDADES ESPECFICAS.

LA ESTRUCTURA DEL ADN


SURGEN ALGUNAS INTERROGANTES: a) QU TIPO DE ESTRUCTURA, EN UNA MOLCULA TAN SIMPLE, PODRA ALMACENAR TODA LA INFORMACIN QUE SE REQUIERE PARA LA ENORME VARIEDAD DE ESTRUCTURAS PROTICAS,
b) COMO PODA TRANSMITIR TAL INFORMACIN DE UNA GENERACIN A OTRA.

LA ESTRUCTURA DEL ADN


LOS QUMICOS HABAN COMENZADO A ANALIZAR LA MOLCULA DE ADN QUE, COMPARADA CON OTRAS GRANDES MOLCULAS ORGNICAS, RESULTABA SER RELATIVAMENTE COMPLEJA.

LA ESTRUCTURA DEL ADN


ESTABA FORMADA POR:
BASE NITROGENADA

* AZCARES SENCILLOS (TIPO DESOXIRIBOSA), * * RADICALES FOSFATOS Y CIERTOS COMPUESTOS NITROGENADOS, * CUATRO BASES NITROGENADAS: ADENINA, TIMINA, GUANINA, CITOSINA.

RADICAL FOSFATO

AZCAR

SIN EMBARGO, NO SE HABA DETERMINADO CMO ESTABAN UNIDOS ENTRE S ESTOS COMPUESTOS.

LA ESTRUCTURA DEL ADN


DESPUS QUE EL PAPEL CENTRAL DEL ADN EN LA HERENCIA SE HIZO EVIDENTE, MUCHOS CIENTFICOS SE DISPUSIERON A DETERMINAR SU ESTRUCTURA CON EXACTITUD.

P H O E B U S L E V E N E

DETERMIN QUE EL ADN ESTA FORMADO POR 4 TIPOS DE NUCLETIDOS.

E R W I N C H A R G A F F

ANALIZ EL CONTENIDO MOLECULAR DE LAS BASES NITROGENADAS DEL ADN

ERWIN CHARGAFF
ESTUDIANDO UNA VARIADA GAMA DE ADN DE DIFERENTES ORGANISMOS ESTABLECI CIERTAS REGLAS EMPRICAS SOBRE LAS CANTIDADES DE CADA COMPONENTE DE ADN:

1. LA CANTIDAD TOTAL DE NUCLETIDOS PIRIMIDNICOS (T + C) ES SIEMPRE IGUAL A LA CANTIDAD TOTAL DE NUCLETIDOS PRICOS (A+G), 2. LA CANTIDAD DE T ES SIEMPRE IGUAL A LA DE A Y LA CANTIDAD DE C ES SIEMPRE IGUAL A LA DE G. PERO LA CANTIDAD DE A + T NO ES NECESARIAMENTE IGUAL A LA DE G + C.

PROPORCIONES MOLARES DE LAS BASES DE ADN EN DISTINTOS ORGENES (E. CHARGAFF, 1955)
O R G A N IS M O E S C H E R ICH IA C O L I D IP L O C O C C U S P N E U M O N IA E M Y C O B A C T E R IU M LEVADU RA E R IZ O D E M A R ARENQUE RATA H OM BRE H OM BRE H OM BRE T E JID O ESPERM A ESPERM A M DU LA T IM O H G A D O ESPERM A A 26.0 29.8 15.1 31.3 32.8 27.8 28.6 30.9 30.3 30.7 T G C 25.2 18.0 35.4 17.1 18.4 22.6 21.5 19.8 19.9 18.8 A+ T G+C 1.00 1.59 0.42 1.79 1.85 1.23 1.33 1.52 1.53 1.62

23.9 24.9 31.6 20.5 14.6 32.9 32.1 27.5 28.4 29.4 30.3 31.2 34.9 18.7 17.7 22.2 21.4 19.9 19.5 19.3

ANALIZA LA MOLCULA DE ADN UTILIZANDO ESTUDIOS CRISTALOGRFICOS CON RAYOS X

MAURICE WILKINS

JAMES D. WATSON (Bilogo Estadunidense)

FRANCIS H.C. CRICK (Fsico Ingls)

PROPONEN EL MODELO DE LA DOBLE HLICE

ADN: CIDO DEXOSIRIBONUCLICO


EL MODELO DE WATSON Y CRICK EN 1953 J. WATSON Y F. CRICK, BASNDOSE EN LOS DATOS DE WILKINS, PROPONEN UN MODELO DE ESTRUCTURA DEL ADN QUE SE HA PERPETUADO EN LA HISTORIA DE LA CIENCIA COMO LA MS FAMOSA ESTRUCTURA BIOLGICA MONTADA POR EL HOMBRE. POR ESTE DESCUBRIMIENTO ESTOS 3 INVESTIGADORES OBTUVIERON EL PREMIO NOBEL DE MEDICINA Y FISIOLOGA EN 1962.

ANECDOTA CON RESPECTO AL MODELO DE WATSON Y CRICK: EL MODELO DE WATSON Y CRICK ASEMEJA DOS ESCALERAS DE CARACOL QUE ASCIENDEN POR UN MISMO TUBO. POR RAZONES DIFCILES DE ENTENDER, UN ARTFICE DEL SIGLO XVIII TUVO LA IDEA DE HACER EN MADERA UN MODELO DECORATIVO DE TALES ESCALERAS.

PUENTE DE HIDRGENO ADENINA GUANINA

CITOCINA

TIMINA

EL MODELO DE WATSON Y CRICK

GRUPO FOSFATO DESOXIRIBOSA

EL MODELO DE WATSON Y CRICK

ADN
*LA MOLCULA DE ADN CONSTA DE 2 CADENAS ANTIPARALELAS ENVUELTAS EN ESPIRAL, NORMALMENTE DE IZQUIERDA A DERECHA, (DESTRGIRA) SIENDO LO MS IMPORTANTE LA COMPLEMENTACIN ENTRE LAS BASES NITROGENADAS.

LAS HEBRAS QUE LA CONFORMAN SON COMPLEMENTARIAS Y ANTIPARALELAS. COMPLEMENTARIAS PORQUE LAS BASES DE CADA CADENA SE APAREAN DE FORMA COMPLEMENTARIA ADENINA CON TIMINA (A-T) Y GUANINA CON CITOSINA (C-G). ANTIPARALELAS PORQUE UNA CADENA EST COLOCADA EN POSICIN 5'- 3' Y LA COMPLEMENTARIA EN POSICIN 3'- 5'.

34A

3.4A

36

20A

* CADA PAR DE NUCLETIDOS TIENE UNA INCLINACIN DE 36 CON RESPECTO AL PAR VECINO, POR LO TANTO 10 PARES DE NUCLETIDOS FORMAN UNA VUELTA COMPLETA EN LA DOBLE ESPIRAL. * EL DIMETRO DE LA MOLCULA DE ADN ES DE 20 A Y CADA CADENA COMPLETA UNA VUELTA CADA 34A. * LA DISTANCIA ENTRE 2 BASES NITROGENADAS VECINAS ES DE 3.4A.

COMPOSICIN QUIMICA DEL ADN

EL ADN ES UNA GRAN MOLCULA CUYA MEDIDA ES EL DALTON= 1.67 X 10-24 GRAMOS.

COMPOSICIN QUIMICA DEL ADN

LAS SUSTANCIAS QUE LO COMPONEN SON FOSFATOS, AZCARES (DESOXIRIBOSA) Y 4 BASES NITROGENADAS

BASE NITROGENADA

LA UNIDAD ESTRUCTURAL ES EL MONMERO O NUCLETIDO: UN AZCAR+ UN GRUPO FOSFATO + UNA BASE NITROGENADA

RADICAL 3 FOSFATO

(300 DALTONS).

AZCAR

LOS MONMEROS VECINOS SE UNEN MEDIANTE UN ENLACE STER ENTRE EL AZCAR DE UN MONMERO Y EL GRUPO FOSFATO DEL OTRO. CADA BASE NITROGENADA SE UNE AL AZCAR POR UN ENLACE GLUCOSDICO

BASES NITROGENADAS

CIDO FOSFRICO
2-DESOXIRIBOSA

PUENTES DE HIDRGENO

POLMERO (CONSTA DE 4 TIPOS DE MONMEROS)

POR LO TANTO: LA MOLCULA DE ADN CONSTA DE 2 CADENAS DE POLINUCLETIDOS, ENLAZADAS ENTRE S POR PUENTES DE HIDRGENO QUE SE FORMAN ENTRE LOS GRUPOS CETNICOS (C=O) Y LOS GRUPOS AMINOS (NH2) DE LAS BASES NITROGENADAS.

LAS BASES NITROGENADAS

LAS PURINAS

ADENINA

SE CARACTERIZAN POR ESTAR COMPUESTAS POR 2 ANILLOS BENZENICOS.

GUANINA

LAS BASES NITROGENADAS

LAS PIRIMIDINAS

TIMINA

CITOSINA

SE CARACTERIZAN POR ESTAR COMPUESTAS POR 1 ANILLO BENZENICO.

LAS BASES NITROGENADAS

LA CONFIGURACIN QUMICA DE LAS BASES NITROGENADAS ES IMPORTANTE PARA LA COMPLEMENTACIN DE BASES, YA QUE SLO SE PRODUCIR ENTRE UNA PURINA (FISICAMENTE MS GRANDE POR PRESENTAR 2 ANILLOS) Y UNA PIRIMIDINA (QUE PRESENTA SOLO UNO) MAS NUNCA ENTRE 2 PURINAS O 2 PIRIMIDINAS.

LAS BASES NITROGENADAS

LA GUANINA SE COMPLEMENTA CON LA CITOSINA, MEDIANTE 3 PUENTES DE HIDRGENO (G C), POR ELLO LA UNIN ENTRE ESTAS MOLCULAS ES MS FUERTE. LA ADENINA SE COMPLEMENTA CON LA TIMINA, MEDIANTE 2 PUENTES DE HIDRGENO (A = T).

LOS PUENTES DE HIDRGENO NO SLO GARANTIZAN LA UNIN ENTRE LAS DOS CADENAS ANTIPARALELAS DEL ADN, SINO TAMBIN UN CORRECTO APAREAMIENTO ENTRE LAS BASES NITROGENADAS. GRACIAS A ESTO LA MOLCULA DE ADN ES LA NICA CAPAZ DE AUTOREPLICARSE.

REPLICACIN DEL ADN


LUEGO QUE SE COMPROB QUE EL ADN ERA EL MATERIAL HEREDITARIO Y SE DESCIFR SU ESTRUCTURA, LO QUE QUEDABA ERA DETERMINAR COMO EL ADN COPIABA SU INFORMACIN Y COMO LA MISMA SE EXPRESABA EN EL FENOTIPO. MATTHEW MESELSON Y FRANKLIN W. STHAL DISEARON EL EXPERIMENTO PARA DETERMINAR EL MTODO DE REPLICACIN DEL ADN.

EL ADN TIENE TODA LA INFORMACIN NECESARIA PARA EL FUNCIONAMIENTO CELULAR Y DE LOS CARACTERES DE UNA ESPECIE O INDIVIDUO. POR ELLO, ES IMPRESCINDIBLE QUE PUEDA SER COPIADO CON FIDELIDAD PARA QUE SE REPARTA ENTRE LA PROGENIE, YA SEAN CLULAS QUE SE REGENERAN O NUEVOS INDIVIDUOS DE UNA ESPECIE.

ADN ORIGINAL

REPLICACIN CONSERVATIVA

REPLICACIN DURANTE LA CUAL SE PRODUCIR UN ADN COMPLETAMENTE NUEVO DURANTE LA REPLICACIN.

ADN ORIGINAL

REPLICACIN SEMICONSERVATIVA
SE ORIGINARN 2 MOLCULAS DE ADN, CADA UNA DE ELLAS COMPUESTA POR UNA HEBRA DE ADN ORIGINAL (HEBRA MATRIZ) Y POR UNA HEBRA COMPLEMENTARIA NUEVA (HEBRA NUEVA).

ADN ORIGINAL

REPLICACIN DISPERSIVA
IMPLICA LA RUPTURA DE LAS HEBRAS DE ORIGEN DURANTE LA REPLICACIN QUE, DE ALGUNA MANERA SE REORDENARN EN UNA MOLCULA CON UNA MEZCLA DE FRAGMENTOS NUEVOS Y VIEJOS EN CADA HEBRA DE ADN.

EXPERIMENTO DE MATTHEW MESELSON Y FRANKLIN W. STHAL

R E P L I A C D A N C I N

CONSERVATIVA

SEMI CONSERVATIVA

PARA QUE LA REPLICACIN SE DIERA ERA NECESARIO QUE EXISTIERA UN SISTEMA ENZIMTICO QUE ACTUARA SOBRE EL ADN MATRIZ, TANTO PARA SU SEPARACIN COMO PARA LA FORMACIN DE LAS CADENAS COMPLEMENTARIAS.

A R T H U R K O R B E R G

A FINES DE LOS AOS 50 CONSIGUI IDENTIFICAR Y PURIFICAR EN E. coli LA PRIMERA DE ESTAS ENZIMAS: LA ADNPOLIMERASA I.

ADN POLIMERASA I
LA ADN-POLIMERASA I ES UNA ENZIMA FORMADA POR 1000 AMINOCIDOS QUE ACTUA SOBRE LA REPARACIN Y REPLICACIN DEL ADN.
SU ACCIN ES LA DE JUNTAR (POLIMERIZAR) MONMEROS BASNDOSE EN UNA MATRIZ DE ADN (POR COMPLEMENTACIN DE BASES).

ADN ORIGINAL

ACCIN DE LA ADN POLIMERASA I


A) UNA ACIN POLIMERIZADORA QUE CATALIZA EL CRECIMIENTO DE LA CADENA EN DIRECCIN 5 - 3.
B) UNA ACTIVIDAD EXONUCLEASA 3 - 5 QUE ELIMINA LAS BASES MAL APAREADAS. C) UNA ACCIN EXONUCLEASA 5 - 3 QUE DEGRADA ADN DE DOBLE CADENA.
CADENA MATRIZ CADENA MATRIZ

CADENA MATRIZ 3 LA ADN POLIMERAZA SOLO PUEDE ADICIONAR NUCLEOTIDOS AL FINAL DE LA POSICIN 3

5 3 PARES DE BASES 3 5 CADENAS NUEVAS

DIRECCIN DE LA ACCIN POLIMERIZADORA

POSTERIORMENTE SE HAN IDENTIFICADO OTRAS DOS POLIMERASAS EN E. coli : POLIMEASA II: QUE POSIBLEMENTE INTERVENGA EN LA REPARACIN DEL ADN DAADO, POLIMERASA III: QUE JUNTO CON LA POLIMERASA I EST IMPLICADA EN LA REPLICACIN DEL ADN DE E. Coli.

ARN : CIDO RIBONUCLICO


LOS PRIMEROS INVESTIGADORES TENAN RAZONES SUFICIENTES PARA PENSAR QUE LA INFORMACIN NO FLUA DIRECTAMENTE DEL ADN A LAS PROTENAS. SABAN QUE EL ADN (DE UNA CLULA EUCARITICA) SE ALOJABA EN EL NCLEO, MIENTRAS QUE LAS PROTENAS SE FABRICABAN EN EL CITOPLASMA.

ARN

POR LO TANTO, ERA NECESARIO UN INTERMEDIARIO: OTRO CIDO NUCLICO, EL CIDO RIBONUCLICO (ARN)

ARN: CIDO RIBONUCLICO


CIDO RIBONUCLEICO QUE ACTA COMO INTERMEDIARIO ENTRE EL CDIGO GENTICO (DNA) Y LOS PROCESOS DE SNTESIS PROTICA.

AUNQUE EL ARN ES UNA LARGA MACROMOLCULA DE CIDO NUCLICO, TIENE PROPIEDADES ESTRUCTURALES, QUMICAS Y FUNCIONALES MUY DIFERENTES A LAS DEL ADN.

DIFERENCIAS ESTRUCTURALES ENTRE ADN Y ARN


LA ESTRUCTURA DEL ADN ES DE DOBLE CADENA, LO QUE CONFIERE UNA MAYOR PROTECCIN A LA INFORMACIN CONTENIDA EN L. LA ESTRUCTURA DEL ARN ES MONOCATENARIA : - LINEAL (ARNm), - PLEGADA (ARNr), - CRUCIFORME (ARNt).

ADN

ARNt

DIFERENCIAS QUMICAS ENTRE ADN Y ARN


DIFERENCIAS QUMICAS EN LA COMPOSICIN DE LA PENTOSA
EL ADN EST COMPUESTO POR DESOXIRRIBOSA EL ARN EST COMPUESTO POR RIBOSA

ADN

ARN

DIFERENCIAS QUIMICAS EN LA COMPOSICIN DE LAS BASES NITROGENADAS


EL ADN EST COMPUESTO POR ADENINA, TIMINA, GUANINA Y CITOSINA.
TIMINA

EL ARN EST COMPUESTO POR ADENINA, GUANINA Y CITOSINA. LA TIMINA CAMBIA POR URACILO.

URACILO

DIFERENCIAS FUNCIONALES ENTRE ADN Y ARN

ADN
CODN

ARN
EL ARN ARTICULA LOS PROCESOS DE EXPRESIN DE LA INFORMACIN GENTICA DEL ADN EN LA SNTESIS DE PROTENAS.

EL ADN ALMACENA, CONSERVA Y TRANSMITE LA INFORMACIN GENTICA DE LAS CLULAS PROGENITORAS A LAS CLULAS HIJAS.

ARN: CIDO RIBONUCLICO


EXISTEN TRES TIPOS CLARAMENTE DIFERENCIADOS DE ARN, TANTO EN SU ESTRUCTURA COMO EN SU FUNCIN:

TIPOS DE ARN: ARNm (ARN MENSAJERO) ARNr (ARN RIBOSMICO) ARNt (ARN DE TRANSFERENCIA)
ESTAS TRES CLASES DE ARN SE PRESENTAN EN MLTIPLES FORMAS MOLECULARES; AS, EL RNAr EN CUALQUIER ESPECIE BIOLGICA EXISTE POR LO MENOS EN TRES FORMAS PRINCIPALES, EL RNAt PRESENTA HASTA 60 FORMAS DIFERENTES, Y EL RNAm APARECE EN CENTENARES E INCLUSO MILLARES DE FORMAS DIFERENTES.

ARN MENSAJERO
SU SNTESIS EST CATALIZADA POR LA POLIMERASA II DEL ARN. ES CONSIDERADO LA COPIA COMPLEMENTARIA DEL FRAGMENTO DEL CDIGO GENTICO DEL ADN. LA MAYOR PARTE DE LA MOLCULA ES UN FILAMENTO SIN ENROLLAR MUY INESTABLE, QUE SE DEGRADA EN CUESTIN DE HORAS.

ARN RIBOSMICO
EL ARN RIBOSMICO ES UN COMPLEJO MACROMOLECULAR UBICADO EN LOS RIBOSOMAS QUE ACTUA COMO GUIA, COORDINANDO EL ENSAMBLAJE DE LOS AMINOCIDOS DE UNA PROTENA. SU SNTESIS EST CATALIZADA POR LA POLIMERASA I DEL RNA. EST FORMADO POR MOLCULAS MUY LARGAS Y PLEGADAS.

ARN TRANSFERENCIA
SU SNTESIS EST CATALIZADA POR LA POLIMERASA III DEL RNA. SE HALLA DISPERSO POR TODO EL CITOPLASMA, ES EL MS PEQUEO DE LOS TRES Y SU ESTRUCTURA TIENE FORMA DE HOJA DE TRBOL. SE CONOCEN UNOS 50 TIPOS DE RNAt, Y TODOS ELLOS TIENEN UNA CONFIGURACIN SIMILAR: A) EL LUGAR DE UNIN DEL AMINOCIDO QUE PRESENTA UNA SECUENCIA DE BASES CCA Y

B) EL ANTICODN, QUE SE UBICA FRENTE AL CODN RESPECTIVO DE LA MOLCULA DE ARNm.

TRANSCRIPCIN y TRANSDUCCIN DEL MENSAJE


EL ADN ES EL MATERIAL GENTICO; SIN EMBARGO, EL ARN ES EL RESPONSABLE - JUNTO CON UNA SERIE DE PROCESOS ENZIMTICOS - DE LA TRANSDUCCIN Y TRANSCRIPCIN DE LA INFORMACIN HEREDITARIA. LA TRASNCRIPCIN Y LA TRANSDUCCIN DEL MENSAJE TIENEN COMO PRINCIPIO BSICO LAS RELACIONES: 3' 5'

5'

3'

ANTICODON

1 GEN

1 ENZIMA

1 CARACTER

TRANSCRIPCIN DEL MENSAJE

LA BIOSNTESIS DE LAS PROTENAS SE INICIA CUANDO UNA MOLCULA DE ARN CON LA AYUDA DE CIERTAS ENZIMAS - ENTRE ELLAS LAS POLIMERASAS I, II, III Y LAS LIGASAS - SE FORMA POR COMPLEMENTACIN DE BASES FRENTE A UNA DE LAS CADENAS DE LA MOLCULA DE ADN

UNA VEZ EN EL CITOPLASMA, LA MOLCULA DE ARNm TRASNFIERE CON LA AYUDA DEL ARNr SU INFORMACIN A LOS RIBOSOMAS EN TRIPLETES (3 BASES NITROGENADAS). ESTOS TRIPLETES RECIBEN TAMBIN EL NOMBRE DE CODONES.

TRANSDUCCIN DEL MENSAJE


LA TRANSDUCCIN SE INICIA CUANDO EL ANTICODN DEL ARNt RECONOCE LA INFORMACIN DE UNO DE LOS TRIPLETES DE BASES NITROGENADAS Y SE UNE A L. EL EXTREMO CCA CAPTURA UN AMINOCIDO QUE SE UNE POR UNOS MINUTOS AL PRIMER CODN, LUEGO OTRO ANTICODN ATRAE UN SEGUNDO AMINOCIDO, QUE SE UNE AL SEGUNDO CODN, ESTE MECANISMO SE REPITE EN CADA CODN, HASTA LLEGAR A UN CODN TERMINAL, AL QUE SE UNE UN ARNt QUE NO LLEVA NINGN AMINOCIDO, POR LO QUE EL POLIPPTIDO SINTETIZADO SE LIBERA .

TRANSCRIPCIN y TRANSDUCCIN DEL MENSAJE


POLIMERAS A

NCLEO

ADN ARNm

ATGCCGTTAGACGTTAGCGACCTGACT TACGGCAATCTGCAATCGCTGGACTGA

UACGGCAAUCUGCAAUCGCUGGACUG A
------------------------------------

CITOPLASMA

----------------------------------------ARNr

UAC/ GGC/ AAU/ CUG/ CAA/ UCG/ CUG/ GAC/ UGA

ARNt

TRANSCRIPCIN y TRANSDUCCIN DEL MENSAJE ADN

CADENA CODIFICADA

CADENA MOLDE TRANSCRIPCIN MEMBRANA


EL ARNm SALE DEL NCLEO A TRAVS DE UN PORO DE LA MEMEBRANA NUCLEAR

NUCLEAR

ARNm ARNr ARNt


CADENA POLIPPTIDA TRANSDUCCIN

EL CDIGO GENTICO
DESDE QUE SE DEMOSTR QUE LAS PROTENAS ERAN PRODUCTO DE LOS GENES Y QUE CADA GEN ESTABA FORMADO POR FRACCIONES DE CADENAS DE ADN, LOS CIENTFICOS LLEGARON A LA CONCLUSIN QUE DEBA HABER UN CDIGO GENTICO MEDIANTE EL CUAL EL ORDEN DE LAS CUATRO BASES NITROGENADAS EN EL ADN PODRA DETERMINAR LA SECUENCIA DE AMINOCIDOS EN LA FORMACIN DE POLIPPTIDOS; EN OTRAS PALABRAS, DEBA HABER UN PROCESO MEDIANTE EL CUAL LAS BASES NITROGENADAS TRANSMITIERAN LA INFORMACIN QUE DICTABA LA SNTESIS DE PROTENAS.

EL CDIGO GENTICO
ES LA UNIDAD DE LECTURA QUE PERMITE DETERMINAR LOS DIFERENTES AMINOCIDOS CODIFICADOS POR EL ARNm (TRIPLETES); ES DECIR, CADA TRES LETRAS ES UN MENSAJE EJEMPLO: TENEMOS LAS BASES A,S,I,N. TRIPLETES: ASI ANA ASA SIN ASA

G O B I N D K H O R A M A

JUNTO CON R. HOLLEY Y M.W. NIRENBERG DECIFRAN EL CDIGO GENTICO PARA DIFERENTES AMINOCIDOS A PARTIR DE ARNm SINTTICOS.

SLO EXISTE UN CDIGO GENTICO PARA TODOS LOS ORGANISMOS VIVOS . EL CDIGO ES LA EXPLICACIN FUNDAMENTAL DE LAS LEYES DE LA HERENCIA MENDELIANA Y SE HALLA EN LA SECUENCIA DE PARES DE BASES DEL ADN. CADA INDIVIDUO, CADA ORGANISMO, ES POSEEDOR DE UNA SECUENCIA DIFERENTE DE ESTAS BASES, AUNQUE TODOS TIENEN EL MISMO TIPO DE MOLCULA EN EL NCLEO DEL SISTEMA REPRODUCTOR.

JAMES TREFIL LO COMPAR CON EL CDIGO MORSE:

MEDIANTE UNA SIMPLE SECUENCIA DE PUNTOS Y RAYAS PUEDE ENVIARSE UN NMERO INFINITO DE MENSAJES.
EN EL CASO DE LA DOBLE HLICE: LOS NUCLETIDOS REPRESENTAN LAS LETRAS DEL CDIGO GENTICO Y FORMAN UN MENSAJE CODIFICADO QUE INDICA A LA CLULA CMO HA DE MANUFACTURAR LAS MOLCULAS PROTICAS.

EL CDIGO GENTICO
Http://fai.unne.edu.ar

SEGUNDA LETRA

PRIMERA LETRA