Molecular and Biological Characterization

of Cucurbit Aphid-Borne Yellows Virus

(CABYV) Causing the Namamarako (NMK)
Syndrome in Ampalaya

LOLITA M.DOLORES
University Researcher , CSC-IPB, UPLB
College, Laguna

Funded by: UPLB-BASIC RESEARCH

Duration: July 1, 2006-June 30, 2008
 Significance
• Ampalaya – top money maker ( cash crop /
commercial crop)
– 7,000 ha (Golez and Caterno, 2002)
– Popular crop for its nutritive & medicinal value
– Good source of Vitamins A,B,C, iron, folic acid,
phosphorus and calcium

• Production Constraint
– NMK
- severely reduces yield
 Causal Pathogen
CABYV virus particles
- 25-30 nm in diameter
- hexagonal
- no envelope
- icosahedral symmetry

Transmitted efficiently by
-aphids in persistent manner
 Objectives
1. To collect and isolate different CABYV isolates
from major ampalaya production areas

2. To characterize the different isolates using

biological and molecular methods

3. To determine the genetic variation of CABYV,

the causal pathogen of NMK disease of
ampalaya in the Philippines.
 Expected Output
• Virus Isolates

• Pure virus isolate

• Optimized PCR protocol

• PCR products, Clones, DNA sequences

• Terminal Report, paper for publication

 METHODOLOGY: Virus Isolation, Transmission &
Biological Characterization

Purification of
isolates thru series RT-PCR
of inoculations from
Survey & NMK infected
Symptom
Collection ampalaya to
of virus healthy ampalaya Confirmed
isolates seedlings & vice
versa Transmission:
mechanical or
graft-inoculation ELISA

Host
Biological
range
characterization
Confirmed
Through aphid
transmission Vector
transmissibility
METHODOLOGY: Molecular identification and
characterization
RNA extraction using Trizol

RT-PCR and PCR amplification using specific primers

(CE-9 and CE-10)

F 5’ GAATACGGTCGCGGCTAGAAATC3’

R 5’ CTATTTGGGGTTCTGGACCTGGC3’

Cloning and NA sequencing using TOPO TA cloning kit

DNA sequencing and analysis

 RESULTS
Survey and Collection
c Symptoms of collected infected ampalaya

Biological Characterization
c Transmission and Host range

Molecular identification and characterization

 RESULTS
Luzon

Pangasinan

Tarlac

Pampanga

Bulacan

Laguna
Ilocos sur
 RESULTS
Table1. Survey and collection of NMK infected ampalaya:

Area/ Location Symptoms Virus Infection

(%)*
1 .Bulacan: Severe stunting, wrinkling, thickened veins,
San Ildefonso-1 plastic like appearance , shortened internodes 90

Baliwag thickened veins, vein banding 75

2. Laguna: yellowing, vein banding, thickened Veins, plastic like
Liliw -1 appearance 70

CES UPLB yellowing, vein banding 50

IPB- UPLB thickening of veins, vein banding 30

Liliw 2 mosaic, motlling, leaf distortion, little leaf 40

3. Pangasinan:

Urdaneta -1 Yellowing, thickened veins, short internodes, plastic like appearance 70

Urdaneta 2 wrinkling, thickened veins, short internodes 80

Asingan -1 yellowing, thickened veins 70

Asingan -2 thickened veins, plastic like appearance 80

Sta. Maria vein banding, thick veins, yellowing 60

Tayug wrinkled leaf, stunting, yellowing 60

4. Tarlac:
Bamban Yellowing thickened veins, vein banding 70
Moncada Yellowing thickened veins, vein banding 40
5.Pampan
Arayat Yellowing, thickened veins, short 60
internodes, plastic like appearance
 RESULTS
Table1. Survey and collection of NMK infected ampalaya:

Area/ Location Symptoms Virus Infection (%)*

1 .Bulacan: Severe stunting, wrinkling, thickened veins, plastic like appearance

San Ildefonso-1 , shortened internodes 90

Baliwag thickened veins, vein banding 75

2. Laguna: yellowing, vein banding, thickened

Liliw -1 Veins, plastic like appearance 70

CES UPLB yellowing, vein banding 50

IPB- UPLB thickening of veins, vein banding 30

Liliw 2 mosaic, motlling, leaf distortion, little leaf 40

3. Pangasinan:

Urdaneta -1 Yellowing, thickened veins, short internodes, plastic like appearance 70

Urdaneta 2 wrinkling, thickened veins, short internodes 80

Asingan -1 yellowing, thickened veins 70

Asingan -2 thickened veins, plastic like appearance 80

Sta. Maria vein banding, thick veins, yellowing 60

Tayug wrinkled leaf, stunting, yellowing 60

4. Tarlac:
 RESULTS
Table1. Survey and collection of NMK infected ampalaya:

Area/ Location Symptoms Virus Infection

(%)*
3. Pangasinan:

Urdaneta -1 Yellowing, thickened veins, short internodes, plastic 70

like appearance
Urdaneta 2 80
wrinkling, thickened veins, short internodes
Asingan -1 70
yellowing, thickened veins
Asingan -2 80
thickened veins, plastic like appearance
Sta. Maria 60
vein banding, thick veins, yellowing
Tayug 60
wrinkled leaf, stunting, yellowing
4. Tarlac:
Bamban Yellowing thickened veins, vein banding 70
Moncada Yellowing thickened veins, vein banding 40
5.Pampanga
Arayat Yellowing, thickened veins, short 60
internodes, plastic like appearance
 RESULTS
Table1. Survey and collection of NMK infected ampalaya:

Area/ Location Symptoms Virus Infection (%)*

3. Pangasinan:

Urdaneta -1 Yellowing, thickened veins, short internodes, plastic like 70

appearance
Urdaneta 2 80
wrinkling, thickened veins, short internodes
Asingan -1 70
yellowing, thickened veins
Asingan -2 80
thickened veins, plastic like appearance
Sta. Maria 60
vein banding, thick veins, yellowing
Tayug 60
wrinkled leaf, stunting, yellowing
4. Tarlac:
Bamban Yellowing thickened veins, vein banding 70
* Moncada Yellowing thickened veins, vein banding 40
5.Pampannga
Arayat Yellowing, thickened veins, short 60
internodes, plastic like appearance

* = wilted
 RESULTS
Table1. Survey and collection of NMK infected ampalaya:

Area/ Location Symptoms Virus Infection (%)*

3. Pangasinan:

Urdaneta -1 Yellowing, thickened veins, short internodes, plastic like 70

appearance
Urdaneta 2 80
wrinkling, thickened veins, short internodes
Asingan -1 70
yellowing, thickened veins
Asingan -2 80
thickened veins, plastic like appearance
Sta. Maria 60
vein banding, thick veins, yellowing
Tayug 60
wrinkled leaf, stunting, yellowing
4. Tarlac:
Bamban Yellowing thickened veins, vein banding 70
Moncada Yellowing thickened veins, vein banding 40
5.Pampanga
Arayat Yellowing, thickened veins, short 60
internodes, plastic like appearance
 RESULTS
Table1. Survey and collection of NMK infected ampalaya:

Area/ Location Symptoms Virus Infection (%)*

3. Pangasinan:

Urdaneta -1 Yellowing, thickened veins, short internodes, plastic like 70

appearance
Urdaneta 2 80
wrinkling, thickened veins, short internodes
Asingan -1 70
yellowing, thickened veins
Asingan -2 80
thickened veins, plastic like appearance
Sta. Maria 60
vein banding, thick veins, yellowing
Tayug 60
wrinkled leaf, stunting, yellowing
4. Tarlac:
Bamban Yellowing thickened veins, vein banding 70
Moncada Yellowing thickened veins, vein banding 40
5.Pampanga
Arayat Yellowing, thickened veins, short 60
internodes, plastic like appearance
6. Ilocos Sur
*Cabugao wrinkling, thickened veins, short internodes 20

* = wilted
 RESULTS

Fig 1. NMK infected ampalaya

from Bulacan (above) and
Pangasinan (picture below)
 RESULTS

Fig. 2. NMK infected ampalaya

sample from UPLB compound
with green vein banding and
thickened vein symptoms.c
 RESULTS

Fig. 3. NMK infected sample

from Tayug , Pangasinan
showing very prominent vein
banding and plastic like
appearance
Fig. 4. Ampalaya plant showing mosaic and mild to moderate curling
of leaves(left) and a close up of virus infected ampalaya leaf showing
mottling and leaf distortion (right).
 Results of transmission and ELISA tests for some NMK virus isolates.

Name of Isolate Place Collected (%) (%) ELISA

Transmission Positive

1. Bulacan 1 San Ildefonso, Bulacan 50 50

2. Bulacan 2 Baliwag 17 17

3. Pangasinan Tayug 33 50

4. Laguna Bay, Laguna 50 50

*5. Ilocos Sur Cabugao , Ilocos Sur 20 20

6. Tarlac *Moncada, Tarlac 40 40

% transmission = total no. of plants with symptoms x 100

total no of plants inoculated

% ELISA positive = total no. of samples positive to CABYV antiserum x 100

total no of samples assayed
* = wilted
View of NMK virus transmission inside an insect proof screen cage
 TRANSMISSION
Bulacan isolate- Aphid transmitted Laguna isolate- Aphid transmitted

Graft-inoculated (Bulacan isolate- 3 wks) 6 wks ( right) after grafting

 RESULTS ( Current)
Reaction of Host Plant Species to Two NMK virus isolates.

• Host plant No. of Symptomatic Plants Symptoms ELISA

• Bulacan Laguna Bulacan Laguna Bulacan Laguna
• ----------------------------------------------------------------------------------------------------------------------
• Chenopodiaceae:
• C. amaranticolor 0 0 N/A N/A - -
• C. quinoa 0 0 N/A N/A - -
• Cucurbitaceae
• C. pepo 3/5 2/5 yel yel + +
• C. moschata 0 0 N/A - -
• Luffa acutangula 4/5 4/5 vb vb + +
• L. siceraria 0 0 N/A N/A - -
• Solanceae
• Solanum melongena 0 0 N/A N/A - -
• N. tabaccum 0 0 N/A N/A - -
• Caricaceae
• Carica papaya 0 0 N/A N/A - -
• ----------------------------------------------------------------------------------------------------------------------
 RESULTS
• Host Range
Cucurbita pepo- Bulacan isolate Luffa acutangula (patola ridge) –Bulacan isolate

Cucurbita pepo- Laguna isolate Luffa acutangula (patola ridge) –Laguna isolate
 RNA extraction and RT PCR Optimization
1. Total RNA was extracted from 100 mg of symptomatic leaves of
infected ampalaya using Trizol (Gibco, BRL Life Technologies,
England).
2. Briefly, tissue was ground to a fine powder in liquid nitrogen and
homogenized in 1.0 ml of Trizol reagent and 20 µl mercaptoethanol.
3. After vortexing for 15-20 sec, the homogenate was incubated at
56 C for 5 min then centrifuged at 4,000 rpm for 10 min.
4. The aqueous phase was collected and incubated at room
temperature for 2-3 min then centrifuged at 4,000 rpm at 4 C for 15
min.
5. The aqueous phase was collected and added 750 µl isopropanol
and salt mixture (0.8 M sodium citrate, 1.2 M sodium chloride).
6. Total RNA was precipitated by centrifugation at 14,000 rpm at 4
C for 10 min.
7. The RNA pellet was washed with 1.0 ml of 75% ethanol and
dissolved in 50 µl of diethyl pyrocarbonate (DEPC) treated water
(Ambion, Austin, Texas).
RNA EXTRACTION ( Trizol)

Total RNA extracted from 2 NMK virus

isolates (Bulacan and Laguna).
 RT PCR amplification
PCR amplification was conducted with 0.8ul cDNA template using 2
different program conditions for PCR as follows;

Program 1: initial denaturation of template DNA at 95 C for 2 min,

denaturation at 94C for 30sec, then primer annealing at 55 C for 30
sec and extension at 60C for 1min, in 30 cycles before a final
extension at 60C for 10 min.

Program 2: consisted of initial denaturation at 95 C -2 min;

denaturation at 94 C 1 min ; annealing at 57C for 30 sec; and a 60 C
extension for 1min for 30 cycles before a final extension at 60C for
15 min.

The results of PCR showed the expected 600 bp for both NMK
samples 1 and 2 in a 1.5% agarose gel with good DNA fragments
obtained using an annealing temperature of 57C under the PCR
program profile number 2.
1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8

~600bp

~600bp

RT- PCR amplification of 2 NMK isolates with PCR Program profile -1

(left) and Program profile-2 (right).

1 – 1kb plus ladder 5 – NMK-Laguna – undilute

2 – NMK-Bulacan – undiluted 6—NMK– laguna ( 1:10)
3 – NMK- Bulacan – 1:10 7—NMK Laguna ( 1:50)
4 – NMK-Bulacan – 1:50 8 -- water
~600bp
 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8

~600bp 600bp

RTPCR amplification of Laguna isolates showing 600 bp DNA fragment

with CE9/CE10 primers .

1 – 1kb plus ladder 5 – NMK-Laguna 2 – undiluted

2 – NMK-Laguna 1 – undiluted 6—NMK Laguna 2- 1:10
3 – NMK- Laguna 1 – 1:10 7—NMK Laguna 2 – 1:50
4 – NMK-Laguna 1 – 1:50 8 --water
 Conclusion & Recommendations
• NMK disease syndrome consisting of yellowing, crinkling,
thickened veins, dark greening , plastic-like, and
shortened internodes caused by CABYV luteovirus
• NMK was transmitted by aphids ( persistently) (Aphis
gosyppii L.) and grafting
• NMK infection was higher in Bulacan than in Laguna
• NMK can be transmitted to other cucurbits ( can serve as
alternate hosts of the virus)
• Isolates maybe differentiated based on symptom severity
• NMK isolates used in this study can be amplified with
primers derived from CABYV luteovirus DNA sequence
• Studies on biological and molecular aspects can be very
important parameters for epidemiological studies and in
virus disease management
PUBLICATIONS:
1. Refereed journal
DOLORES, L.M., M LJ SISON and MG N. YEBRON, Jr. 2007. Host Range and
Virus vector relationship of luteoviruscausing the namamarako syndrome (
NMK) of ampalaya. Journal Of Tropical Plant Pathology, Volume 42 : 1&2, Jan-
Dec. 2006, pp51-62

2. Terminal Report
DOLORES, L.M. 2008. Molecular and Biological Characterization of Cucurbit
Aphidborne Yellows Virus (CABYV) causing the Namamarako Syndrome in
Ampalaya. Research Terminal Report funded by UPLB Basic Research,
UPLB, College Laguna.
Thank You!