P. 1
CP Bases cromosomicas de la herencia 2010

CP Bases cromosomicas de la herencia 2010

|Views: 71|Likes:
Publicado porAlexander Hernandez

More info:

Published by: Alexander Hernandez on Jan 25, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

10/10/2012

pdf

text

original

UNIVERSIDAD CATOLICA AGROPECUARIA DEL TROPICO SECO (UCATSE) FACULTAD DE CIENCIAS MÉDICAS (FMC) CARRERA DE MEDICINA GENÉTICA MÉDICA

ACTIVIDAD METODOLOGICA: Trabajo de estudio independiente TEMA: Bases cromosómicas. DESARROLLO: 1. ¿Qué es el código genético? 2. Indique ¿qué es un codón y señale en cuál de las moléculas de RNA contiene los codones? 3. Indique ¿qué es un anticodón y señale en cuál de las moléculas de arna contiene los anticodones? 4. Enumere todos los elementos implicados en la traducción. 5. ¿Qué es la activación de los aa?, ¿Qué enzima realiza la activación de aa? 6. Mencione ¿cuál es el azúcar pentosa del nucleótido de: DNA: RNA: 7. Menciones cuales son las 4 bases nitrogenadas que pueden contener el nucleótido de: DNA: RNA: 8. Señale diferencias estructurales entre las moléculas de DNA y RNA, en cuanto a los indicado en el siguiente cuadro: Molécula de DNA Molécula de RNA Numero de cadena polinucleotidas Dirección de las cadenas Empaquetamiento de las bases Propiedad: Replicación, transcripción ó traducción 9. Mencione los tipos de RNA y describa cual es su función: 10. Señale semejanzas y diferencias entre la síntesis del DNA y del RNA, en cuanto a lo indicado en el siguiente cuadro. DNA RNA Propiedades o mecanismos por el cual se sintetiza

Lic. María José Moreira Espinoza/sporseia@hotmail.com

María José Moreira Espinoza/sporseia@hotmail. Mencione cuales son las otras proteínas o enzimas que requiere la replicación de DNA.com . ¿CUÁL sería la cadena polinucléotida del DNA complementaria a ella. ¿Cuál sería la cadena polinucléotida de RNA que originaria esta secuencia después de realizada la transcripción? Lic. b. 12. Porque la replicación del DNA es semiconservativa.UNIVERSIDAD CATOLICA AGROPECUARIA DEL TROPICO SECO (UCATSE) FACULTAD DE CIENCIAS MÉDICAS (FMC) CARRERA DE MEDICINA GENÉTICA MÉDICA Molécula molde que utiliza Nucleotidos trifosfatos que necesitan Dirección de la síntesis Enzimas de polemización que utiliza Número de moléculas que origina 11. Señale para la siguiente secuencia de DNA: 3´agggccaatagctttccgatagac5´ a. 13.

Citar 3 ejemplos de aplicaciones de la PCR en medicina. Enumere y describa las técnicas de genética molecular más importantes para el estudio de enfermedades hereditarias. ¿Cuáles son las características que debe tener un cebador? 3. 4. 5. Explicar el mecanismo y uso de los Microarrays. DESARROLLO 1. 2. Explique la técnica del PCR. María José Moreira Espinoza/sporseia@hotmail. Definir marcador molecular de ADN 6. Lic. Explicar el mecanismo y los usos de los microarrays. Describir las características que debe tener un cebador Mencionar cual es la importancia de la aplicación de la Reacción en cadena de la polimerasa en la genética médica.com . Describir las técnicas avanzadas en l Definir los marcadores moleculares de DNA.UNIVERSIDAD CATOLICA AGROPECUARIA DEL TROPICO SECO (UCATSE) FACULTAD DE CIENCIAS MÉDICAS (FMC) CARRERA DE MEDICINA GENÉTICA MÉDICA ACTIVIDAD METODOLOGICA: Seminario TEMA: TÉCNICAS DE GENETICA MOLECULAR APLICADAS A MEDICINA OBJETIVOS: Explicar la técnica de la reacción en cadena de la polimerasa.

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->