Está en la página 1de 5

Algunos conceptos centrales son:

GEN: secuencia de ADN que posee información para un producto celular con función
específica. Es la unidad informativa del ADN, responsable de una característica transmisible.
GENOMA: conjunto de genes de una especie.
EXPRESIÓN GENÉTICA: es el desciframiento o decodificación de la información contenida en
el ADN.

La expresión genética se da en dos etapas, representadas por el “Dogma central de la


biología”:

TRANSCRIPCIÓN: pasaje de la información contenida en el ADN al ARN.


TRADUCCIÓN: pasaje de una secuencia de nucleótidos, contenida en el ARN, a una
secuencia de aminoácidos (o se una proteína)
DUPLICACIÓN DEL ADN: cada molécula de ADN genera dos copias idénticas (este proceso
no tiene que ver directamente con la expresión genética sino que lo relacionamos como algo
necesariamente previo a la división celular ya que una célula duplicará su ADN para luego
repartirlo equitativamente entre las células hijas).
TRANSCRIPCION INVERSA: es el único paso “reversible” del dogma y solamente pueden
hacerlo cierto tipo de virus (retrovirus)

Es importante destacar el flujo de la información genética: del ADN hacia las proteínas (con la
excepción de la transcripción inversa).

TRANSCRIPCIÓN
Implica la síntesis de moléculas de ARN a partir de una molécula de ADN molde. Esta síntesis
la realiza la enzima ARN polimerasa, que “lee” los nucleótidos del ADN, busca ribonucleótidos
complementarios a éstos, y construye una cadena nueva en base a la información de una de
las hebras del ADN.
La ARN polimerasa se caracteriza porque:
- la hebra de ADN que toma como molde es la 3´ 5´, es decir que leerá esa cadena
molde en dirección 3´5´.
- Sintetiza la cadena de ARN en dirección 5´3´, que será por lo tanto antiparalela y
complementaria a la hebra molde de ADN.

Ejemplo:

5´ATTCGACCGAATTT 3´ Hebra antimolde, positiva o


3´TAAGCTGGCTTAAA 5´
Hebra molde, negativa o no
transcripción

5´AUUCGACCGAAUUU 3´ Molécula de ARN


PROCESO DE LA TRANSCRIPCIÓN

Es muy similar en eucariontes y procariontes. Por eso describimos el proceso en líneas


generales y luego vemos las diferencias entre eucariontes y procariontes.

1- La ARN polimerasa reconoce una


secuencia específica de nucleótidos de
ADN: el promotor. El promotor será
reconocido específicamente por la ARN
polimerasa y de algún modo marcará el
punto de inicio de la transcripción de un
gen.
2- La ARN polimerasa comienza a
avanzar separando las dos cadenas del
ADN (rompiendo los puentes de
hidrógeno entre ellas) y
simultáneamente va leyendo la hebra
molde y sintetizando la cadena de ARN
complementaria. Los sustratos de la
transcripción serán los ribonucleótidos
trifosfatados (al incorporarse al ARN
rompen 2 enlaces fosfatos y liberan la
energía necesaria para unirse al ARN en
crecimiento)
3- La ARN polimerasa avanza hasta que
reconoce secuencias específicas del
ADN: las secuencias de terminación,
que señalan el fin de la transcripción

Comparación de la transcripción en eucariontes y procariontes:

PROCARIONTES EUCARIONTES
Un solo tipo de ARN pol (con varias 3 tipos de ARN pol: ARN pol I, ARN pol II,
subunidades) ARN pol III (cada una transcribe cierto tipo de
ARN)
Promotor típico procarionte Promotor típico eucarionte
Sin factores de transcripción Con factores de transcripción
En el citoplasma En el núcleo
Secuencias de terminación procariontes Secuencias de terminación eucariontes
ARNm no maduran ni se procesan ARNm siempre se procesan

En ambos tipos celulares los ARNt y ARNr sufren un proceso de maduración, pero solamente
en eucariontes los ARNm son procesados. Otra diferencia entre ARNm euca y proca es que los
ARNm procariontes son policistrónicos (cada ARNm tiene información para más de una
proteína) mientras que los ARNm eucariontes son monocistrónicos ( cada ARNm tiene
información para solo una proteína)
El ARNm eucarionte recién transcripto se llama transcripto primario. Se caracteriza porque
contiene dos tipos de secuencias: los exones (secuencias codificantes, tienen información para
la síntesis proteica) y los intrones (secuencias no codificantes, es decir sin información y por
ello luego serán eliminadas).
Maduración de ARNm en eucariontes

Son 3 modificaciones que


ocurren en el núcleo:

1- capping: al extremo 5´se le


agrega un nucleótido modificado
o CAP (protege al extremo 5´ y
luego en la traducción permitirá
el reconocimiento del ribosoma)
2- Poliadenilación: agregado al
extremo 3´de una sucesión de
adeninas, la cola poli-A (protege
al extremo 3´)
3- Splicing: eliminación de
intrones y empalme de exones.
El resultado es un ARNm
maduro.

TRADUCCIÓN
Implica el desciframiento del ARNm a una secuencia de aminoácidos. ¿Por qué “traducción?
Porque entre ARN y proteína hay un evidente cambio de lenguaje: de los nucleótidos pasamos
a los aminoácidos. Debe haber entonces, como en toda traducción, un “diccionario” que
permita hacer equivalencias entre ambos lenguajes. Es decir, que establezca relaciones de
correspondencia entre los nucleótidos y los aminoácidos. Estamos hablando del Código
genético.

El código relaciona codones (secuencias de 3 nucleótidos consecutivos presentes en el ARNm)


con aminoácidos. El código genético tiene 3 características:
- es universal: el mismo código es aplicable a todos los seres vivos
- es degenerado: existen codones sinónimo, es decir que varios codones distintos
codifican el mismo aminoácido (ej: CCA – CCC – CCU – CCG codifican todos para
prolina, luego son codones sinónimo)
- no es ambiguo: a cada codón le corresponde un y solo un aminoácido.

De todos los codones que presenta el código nos interesan:


- AUG que codifica para metionina. Es el codón que marcará el inicio de la traducción.
- UAG, UGA, UAA que son los codones de terminación, señalan el fin de la traducción
Repasemos algunas características de los tres tipos de ARN:

ARNm
 lleva, en su secuencia de nucleótidos, la información para una secuencia de
aminoácidos.
 a cada conjunto de tres nucleótidos consecutivos se los llama codón o triplete. Un
codón codifica para un aminoácido.

ARNr
 Hay distintos tipos de ARNr que se distinguen fundamentalmente por su tamaño
 Se asocian con proteínas ribosomales y constituyen así los ribosomas.
 Los ribosomas están formados por dos subunidades, la mayor y la menor. Son el lugar
físico de la síntesis proteica.

ARNt
 Transporta los aminoácidos hacia el ribosoma
 Tiene bases modificadas químicamente
 Está plegado en forma de trébol
 Tiene un anticodón, que será complementario a algún codón del ARNm

¿En qué consiste la traducción? Dado un cierto ARNm, se comienza a leer desde el extremo
5´hacia el 3´buscando el primer codón AUG que aparezca: la traducción comienza allí. Se irán
leyendo progresivamente los codones y traduciendo a aminoácidos y hasta que aparezca un
codón de terminación. Veamos un ejemplo:

5´CCUAGAUGCCCUUUGCAGGCUAACCCU 3´ ARNm

traducción

Met- pro – fen –ala – gli – terminación. Proteína


PROCESO DE SÍNTESIS DE PROTEÍNAS

a- Aminoacilación: implica cargar a cada ARNt con el aminoácido específico que deberá
transportar. Esto se lleva a cabo por enzimas específicas que son las aminoacil ARNt
sintetasas que hacen esto con consumo de ATP.

b- Traducción: se divide en tres etapas: iniciación, elongación y terminación.

Iniciación: a la subunidad menor del


ribosoma se une el ARNm y el primer ARNt o
ARNt iniciador, que reconocerá al codón
inicio (lleva metionina). Luego se acopla la
subunidad mayor del ribosoma. Quedan así
definidos dos lugares contiguos en el
ribosoma: sitio P y sitio A. En el P queda
orientado el ARNt iniciador

Elongación: al sitio A ingresa un ARNt. El


aminoácido del sitio P se libera del ARNt y se
une al aminoácido que está en sitio A. La
enzima que cataliza esta unión es la peptidil
transferasa. El ARNt del sitio P está
“descargado” y sale del ribosoma. Luego se
produce un corrimiento del ribosoma hacia el
extremo 3´ del ARNm: la traslocación. Como
consecuencia lo que estaba en A pasa a
estar en P. Con lo cual ahora el sitio P vuelve
a estar ocupado y el A libre (igual a como
empezó esta etapa). Al sitio A llegará otro
ARNt, se formará otra unión peptídico,
traslocación, etc. Se repite hasta que al sitio
A ingresa un codón de terminación.

Terminación: el codón de terminación es


reconocido por factores de terminación. La
cadena de aminoácidos unidos se libera del
ARNt que la transporta, el ARNm ya leído
completamente se disocia del ribosoma y
finalmente las dos subunidades ribosomales
se desacoplan.

Diferencias en la traducción procariontes y eucarionte: en procariontes la traducción es co-


transcripcional. Esto significa que es simultánea con la transcripción debido a que ambos
procesos (transcripción y traducción) ocurren en el mismo lugar (el citoplasma) y a que los
ARNm no sufren maduración ni procesamientos.
En eucariontes la traducción es post-transcripcional, es decir que ocurre una vez que la
transcripción terminó porque en este caso transcripción y traducción ocurren en lugares
diferentes (núcleo y citoplasma respectivamente) y además porque los ARNm siempre sufren
modificaciones antes de traducirse.