P. 1
Biomédica Instituto Nacional de Salud, CHAGAS

Biomédica Instituto Nacional de Salud, CHAGAS

4.0

|Views: 2.553|Likes:

More info:

Published by: Leidy Yudith Angarita Bautista on Jun 10, 2008
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

06/04/2013

pdf

text

original

Portada: Vivienda ubicada en el valle de Ubaque-Fómeque, Cundinamarca a una altura de 1850 metros sobre el nivel del mar

. La región a una distancia de 30 kilómetros de Bogotá, fue un área de alta infestación domiciliar (mayor al 45%) durante la década de los años 90 antes de que se adelantaran programas de control vectorial y por ende de transmisión de Trypanosoma cruzi. Los datos de serología positiva para T. cruzi en escolares de la zona alcanzaron un promedio de 18%. Este rancho representa una típica vivienda propicia para la infestación con triatominos, construída en bahareque y techos de hojas de palma que ofrecen refugio a los insectos transmisores de la enfermedad de Chagas. Foto: Felipe Guhl, CIMPAT, Universidad de los Andes.

1

Biomédica Instituto Nacional de Salud
Volumen 27, Suplemento No. 1, Enfermedad de Chagas - Bogotá, D.C., Colombia - Enero, 2007 COMITÉ EDITORIAL
ELIZABETH CASTAÑEDA, editora jefe Instituto Nacional de Salud Bogotá, D.C., Colombia RUBÉN SANTIAGO NICHOLLS, coeditor Instituto Nacional de Salud Bogotá, D.C., Colombia CARLOS ARTURO HERNÁNDEZ, editor ejecutivo Bogotá, D.C., Colombia

EDITORES ASOCIADOS

LEONARD MUNSTERMANN Yale University School of Medicine New Haven, CN, Estados Unidos LUIS ALBERTO GÓMEZ Instituto Nacional de Salud Bogotá, D.C., Colombia MARÍA CRISTINA FERRO Bogotá, D.C., Colombia MIGUEL A. GUZMÁN Bogotá, D.C., Colombia

ÁNGELA RESTREPO Corporación para Investigaciones Biológicas Medellín, Colombia RICARDO SÁNCHEZ Universidad Nacional de Colombia Bogotá, D.C., Colombia OMAR SEGURA Instituto Nacional de Salud Bogotá, D.C., Colombia

SECRETARIA DEL COMITÉ LINDA GRACE MOLANO C OMITÉ CIENTÍFICO
JUAN MANUEL ANAYA Corporación para Investigaciones Biológicas Medellín, Colombia ARNOLDO BARBOSA RAMÍREZ Hospital Clínic, Universidad de Barcelona, Barcelona, España Centro de Investigação Em Saude Da Manhiça, Manhiça, Mozambique ANTONIO BERMÚDEZ Instituto Nacional de Salud Bogotá, D.C., Colombia JORGE H. BOTERO Universidad de Antioquia Medellín, Colombia VÍCTOR CÁRDENAS University of Texas El Paso, TX, Estados Unidos ALBERTO CONCHA-EASTMAN Organización Panamericana de la Salud Washington, D.C., Estados Unidos ZOILO CUÉLLAR Academia Nacional de Medicina Bogotá, D.C., Colombia LUIS GABRIEL C UERVO Organización Panamericana de la Salud Washington, D.C., Estados Unidos PATRICIA DEL PORTILLO Corpogén Bogotá, D.C., Colombia ANDRÉS DE FRANCISCO Foro Global para la Investigación en Salud Ginebra, Suiza FERNANDO DE LA HOZ Universidad Nacional de Colombia Bogotá, D.C., Colombia JOSÉ LUIS DI FABIO Organización Panamericana de la Salud Washington, D.C., Estados Unidos JORGE HERNANDO DONADO Universidad Pontificia Bolivariana Medellín, Colombia JOSÉ FIGUEROA World Health Organization Ginebra, Suiza LUIS FERNANDO GARCÍA Universidad de Antioquia Medelín, Colombia ALBERTO GÓMEZ Pontificia Universidad Javeriana Bogotá, D.C., Colombia ENRIQUE GONZÁLEZ University of Texas Health Science Center at San Antonio San Antonio, TX, Estados Unidos JOHN MARIO GONZÁLEZ Universidad de los Andes Bogotá, D.C., Colombia FELIPE GUHL Universidad de los Andes Bogotá, D.C., Colombia ANTONIO IGLESIAS Universidad Nacional de Colombia Bogotá, D.C., Colombia JORGE JARA BID/Secretaría de Salud Tegucigalpa, Honduras ERNESTO JARAMILLO Organización Mundial de la Salud Ginebra, Suiza MARCELO LABRUNA Universidade de São Paulo São Paulo, Brasil

1

JAIRO LIZARAZO Hospital Universitario Erasmo Meoz Cúcuta, Colombia JUAN GUILLERMO MCEWEN Corporación para Investigaciones Biológicas Medellín, Colombia ROBERTO MENDOZA The Hospital for Sick Children Toronto, Ontario, Canada ALVARO MONCAYO Universidad de los Andes Bogotá, D.C., Colombia RICARDO NEGRONI Hospital de Infecciosas Francisco Javier Muñiz Buenos Aires, Argentina MARÍA TERESA OCHOA University of California Los Ángeles Los Ángeles, CA, Estados Unidos JUAN P. OLANO University of Texas Medical Branch Galveston, TX, Estados Unidos BLANCA RESTREPO University of Texas San Antonio, TX, Estados Unidos

VÍCTOR E. REYES University of Texas Medical Branch Galveston, TX, Estados Unidos GERZAÍN RODRÍGUEZ Universidad de la Sabana Bogotá, D.C., Colombia GUSTAVO ROMÁN University of Texas Houston, TX, Estados Unidos PEDRO ROMERO Ludwig Institute for Cancer Research, Lausanne branch Lausana, Suiza ÁLVARO RUIZ Pontificia Universidad Javeriana Bogotá, D.C., Colombia GIOCONDA SAN BLAS Instituto Venezolano de Investigaciones Científicas Caracas, Venezuela ÁLVARO SANABRIA Pontificia Universidad Javeriana Bogotá, D.C., Colombia

NANCY GORE SARAVIA CIDEIM Cali, Colombia ROBERT TESH University of Texas Galveston, TX, Estados Unidos ORLANDO TORRES-FERNÁNDEZ Instituto Nacional de Salud Bogotá, D.C., Colombia BRUNO TRAVI University of Texas San Antonio, TX, Estados Unidos GUSTAVO VALBUENA University of Texas Galveston, TX, Estados Unidos JUAN MIGUEL VILLALOBOS Universidade Federal de Rondônia Porto Velho, Brasil JOHN WALKER Cideim Cali, Colombia MOISÉS WASSERMAN Universidad Nacional de Colombia Bogotá, D.C., Colombia

© Instituto Nacional de Salud La revista Biomédica del Instituto Nacional de Salud es una publicación trimestral, eminentemente científica. Está amparada por la resolución número 003768 de 1981, emanada del Ministerio de Gobierno, y con tarifa postal reducida según resolución número 1128 del 5 de mayo de 1982. Ninguna publicación, nacional o extranjera, podrá reproducir ni traducir sus artículos ni sus resúmenes sin previa autorización escrita del editor. Ni la revista, ni el Instituto asumen responsabilidad alguna por los puntos de vista expresados por los autores. La revista no publicará ningún tipo de propaganda comercial. Los nombres de equipos, materiales y productos manufacturados que eventualmente puedan mencionarse, no implican recomendación ni propaganda para su uso y sólo se mencionan como identificación genérica. La revista Biomédica aparece reseñada en Index Medicus/Medline de la National Library of Medicine, en el índice de la Literatura Latinoamericana en Ciencias de la Salud (LILACS), en el Sistema de Información Bibliográfica Regional Andina (SIBRA), en CAB Abstracts, Review of Medical and Veterinary Entomology, y forma parte del Índice Nacional de Publicaciones Seriadas Científicas y Tecnológicas Colombianas de Colciencias y del Índice Latinoamericano de Revistas Científicas y Tecnológicas (LATINDEX). INSTITUTO NACIONAL DE SALUD Avenida Calle 26 No. 51-60 Apartado aéreo 80334 y 80080 Bogotá, D.C., Colombia, S.A. URL: http://www.ins.gov.co biomedica@ins.gov.co

2

Contenido
Editorial La enfermedad de Chagas en 1909 y en 2006 Álvaro Moncayo Medina ................................................... 5 Presentación de caso Enfermedad de Chagas aguda en Colombia, una entidad poco sospechada. Informe de 10 casos presentados en el periodo 2002 a 2005 Rubén Santiago Nicholls, Zulma Milena Cucunubá, Angélica Knudson, Astrid Carolina Flórez, Marleny Montilla, Concepción Judith Puerta, Paula Ximena Pavía .............. 8 Artículos originales Expresión de marcadores en células dendríticas de pacientes chagásicos crónicos estimuladas con la proteína KMP-11 y el péptido K1 de Trypanosoma cruzi Sandra Paola Santander, Adriana Cuéllar, María del Carmen Thomas, Fanny Guzmán, Alberto Gómez, Manuel Carlos López, Concepción Puerta .......................................................... 18 Estructura poblacional y variabilidad genética de Rhodnius prolixus (Hemiptera: Reduviidae) procedente de diferentes áreas geográficas de Colombia Diana Carolina López, Carlos Jaramillo, Felipe Guhl ....................................................................... 28 Lesión celular del miocardio y actividad de la ATPsintasa mitocondrial en ratas infectadas con una cepa colombiana de Trypanosoma cruzi Dairo Alonso Rendón, Carlos M. Genes, Omar Triana ..................................................................... 40 Análisis de polimorfismos en los genes tripanotión reductasa y cruzipaína en cepas colombianas de Trypanosoma cruzi Winston Rojas, Maria Antonieta Caro, Juan Guillermo Lopera, Omar Triana, Juan Carlos Dib, Gabriel Bedoya ................................................................ 50 Caracterización biológica y genética de dos clones pertenecientes a los grupos I y II de Trypanosoma cruzi de Colombia Luz Adriana Botero, Ana María Mejía, Omar Triana ...... 64 Efecto tóxico de β-cipermetrina, deltametrina y fenitrotión en cepas de Triatoma dimidiata (Latreille, 1811) y Triatoma maculata (Erichson, 1848) (Hemiptera, Reduviidae) Marlene Reyes, Víctor Manuel Angulo, Claudia Magaly Sandoval ........................................................................... 75 Comparación de una prueba de PCR basada en los genes codificantes para la histona H2A/SIRE con pruebas serológicas convencionales para el diagnóstico de la enfermedad de Chagas crónica en pacientes colombianos Juliana Gil, Paula Pavía, Marleny Montilla,

Astrid C. Flórez, Claudia Quintero, Marcela Mercado, Miguel Vacca, Santiago Nicholls, Concepción Puerta .. 83
Variación del fenotipo antenal de poblaciones del domicilio, peridomicilio y silvestre de Triatoma dimidiata (Hemiptera: Reduviidae) en Santander, Colombia. Corina María Arroyo, Lyda Esteban, Silvia Catalá, Víctor Manuel Angulo ....................................................... 92 Comparación de los patrones de alimentación y defecación de Rhodnius colombiensis y Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) en condiciones de laboratorio Andrea Arévalo, Julio César Carranza, Felipe Guhl, Jairo A. Clavijo, Gustavo Adolfo Vallejo ........................ 101 Interacción tripanosoma-vector-vertebrado y su relación con la sistemática y la epidemiología de la tripanosomiasis americana Gustavo Adolfo Vallejo,Felipe Guhl, Julio César Carranza, Omar Triana, Gerardo Pérez, Paola Andrea Ortiz, Dairo Humberto Marín, Lina Marcela Villa, Jazmín Suárez, Isaura Pilar Sánchez, Ximena Pulido, Ingrid Bibiana Rodríguez, Leyder Elena Lozano, Daniel Alfonso Urrea, Fredy Arvey Rivera, César Cuba-Cuba, Jairo Alfonso Clavijo ...................... 110 Comparación del ciclo de vida de Rhodnius colombiensis Moreno, Jurberg & Galvão, 1999 y Rhodnius prolixus Stal, 1872 (Hemiptera, Reduviidae, Triatominae) en condiciones de laboratorio Andrea Arévalo, Julio César Carranza, Felipe Guhl, Jairo Alfonso Clavijo, Gustavo Adolfo Vallejo ............... 119 Comunicación breve Seroprevalencia de la enfermedad de Chagas y factores de riesgo asociados en una población de Morroa, Sucre. Richard Hoyos, Lisandro Pacheco, Luz Adriana Agudelo, German Zafra, Pedro Blanco, Omar Triana ................. 130 Patrones electroforéticos de hemoproteínas salivares (nitroforinas) de Rhodnius colombiensis y Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) Andrea Arévalo, Julio César Carranza, Felipe Guhl, Gustavo Adolfo Vallejo ................................................... 137 Revisión de tema Actualización de la distribución geográfica y ecoepidemiología de la fauna de triatominos (Reduviidae: Triatominae) en Colombia Felipe Guhl, Germán Aguilera, Néstor Pinto, Daniela Vergara ............................................................. 143 Instrucciones para los autores

3

Contents
Editorial Chagas disease in 1909 and in 2006 Álvaro Moncayo Medina ................................................... 5 Case presentation Acute Chagas disease in Colombia: a rarely suspected disease. Report of 10 cases presented during the 2002-2005 period Rubén Santiago Nicholls, Zulma Milena Cucunubá, Angélica Knudson, Astrid Carolina Flórez, Marleny Montilla, Concepción Judith Puerta, Paula Ximena Pavía .............. 8 Original articles Expression of markers on dendritic cells from chronic chagasic patients stimulated with the KMP1 protein and the K1 peptide from Trypanosoma cruzi Sandra Paola Santander, Adriana Cuéllar, María del Carmen Thomas, Fanny Guzmán, Alberto Gómez, Manuel Carlos López, Concepción Puerta .......................................................... 18 Population structure and genetic variability of Rhodnius prolixus (Hemiptera: Reduviidae) from different geographic areas of Colombia Diana Carolina López, Carlos Jaramillo, Felipe Guhl ..... 28 Myocardial cellular damage and the activity of the mitochondrial ATPsynthase in rats infected with a Colombian strain of Trypanosoma cruzi Dairo Alonso Rendón, Carlos M. Genes, Omar Triana ..................................................................... 40 Analysis of polymorphisms on trypanothione reductase and cruzipain genes in Colombian strains of Trypanosoma cruzi Winston Rojas, Maria Antonieta Caro, Juan Guillermo Lopera, Omar Triana, Juan Carlos Dib, Gabriel Bedoya ................................................................ 50 Biological and genetic characterization of two Colombian clones of Trypanosoma cruzi groups I and II Luz Adriana Botero, Ana María Mejía, Omar Triana ...... 64 Toxic effect of β-cipermethrin, deltamethrin and fenitrothion in colonies of Triatoma dimidiata (Latreille, 1811) and Triatoma maculata (Erichson, 1848) (Hemiptera, Reduviidae) Marlene Reyes, Víctor Manuel Angulo, Claudia Magaly Sandoval ........................................................................... 75 Comparison of a PCR-based on the histone H2A/SIRE genes with classical serological tests for the diagnosis of chronic chagasic disease in Colombian patients Juliana Gil, Paula Pavía, Marleny Montilla,

Astrid C. Flórez, Claudia Quintero, Marcela Mercado, Miguel Vacca, Santiago Nicholls, Concepción Puerta .... 83
Antenal phenotype variation in sylvatic, peridomestic and domestic populations of Triatoma dimidiata (Hemiptera: Reduviidae) from Santander, Colombia Corina María Arroyo, Lyda Esteban, Silvia Catalá, Víctor Manuel Angulo ....................................................... 92 Comparison on the feeding and defecation patterns of Rhodnius colombiensis and Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) under laboratory conditions Andrea Arévalo, Julio César Carranza, Felipe Guhl, Jairo A. Clavijo, Gustavo Adolfo Vallejo ........................ 101

Trypanosoma rangeli parasite-vector-vertebrate interactions and their relationship to the systematics and epidemiology of American trypanosomiasis Gustavo Adolfo Vallejo,Felipe Guhl, Julio César Carranza, Omar Triana, Gerardo Pérez, Paola Andrea Ortiz, Dairo Humberto Marín, Lina Marcela Villa, Jazmín Suárez, Isaura Pilar Sánchez, Ximena Pulido, Ingrid Bibiana Rodríguez, Leyder Elena Lozano, Daniel Alfonso Urrea, Fredy Arvey Rivera, César Cuba-Cuba, Jairo Alfonso Clavijo ...................... 110
Comparison of the cycle life of Rhodnius colombiensis Moreno, Jurberg & Galvão, 1999 and R. prolixus Stal, 1872 (Hemiptera, Reduviidae, Triatominae) under laboratory conditions Andrea Arévalo, Julio César Carranza, Felipe Guhl, Jairo Alfonso Clavijo, Gustavo Adolfo Vallejo ............... 119 Brief communication Seroprevalence of Chagas disease and associated risk factors in a population of Morroa, Sucre Richard Hoyos, Lisandro Pacheco, Luz Adriana Agudelo, German Zafra, Pedro Blanco, Omar Triana ................. 130 Electrophoretic patterns of salivary hemeproteins (nitrophorines) of Rhodnius colombiensis and Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) Andrea Arévalo, Julio César Carranza, Felipe Guhl, Gustavo Adolfo Vallejo .............................. 137 Topic review Present geographical distribution and ecoepidemiology of the triatomine fauna (Reduviidae: Triatominae) in Colombia Felipe Guhl, Germán Aguilera, Néstor Pinto, Daniela Vergara ............................................................. 143 Instructions for authors

4

Biomédica Instituto Nacional de Salud
Volumen 27, Suplemento No. 1, Enfermedad de Chagas - Bogotá, D.C., Colombia - Enero, 2007

Editorial La enfermedad de Chagas en 1909 y en 2006 Cuando Carlos Chagas fue comisionado por Oswaldo Cruz en 1907 para que viajara a Lassance en el Estado de Minas Gerais a investigar y controlar una epidemia de paludismo, no podía imaginar que iba a realizar un trabajo que lo inmortalizaría. En efecto, al leer el informe científico de sus hallazgos, redactado magistralmente en un estilo claro y elegante, el lector percibe que está ante las observaciones y las deducciones precisas de un grande de la Medicina (1). Chagas era en ese momento, a los 28 años, asistente de investigación en el Instituto Soroterápico de Manguinhos dirigido por Oswaldo Cruz desde 1902, en donde estaba estudiando experimentalmente en primates, un parásito flagelado al que inicialmente llamó Trypanosoma minasense, aislado de un insecto reduvídeo proveniente del norte del Estado de Minas Gerias (2). Cuando Chagas llegó a Lassance constató que estos mismos insectos habitaban en las hendiduras de las paredes de barro de las habitaciones de los campesinos, a quienes picaban por las noches en la cara y que, por ello, se conocían localmente como barbeiros. Por otra parte, se enteró de que en esa área era frecuente una afección que aparecía en el hombre y que atacaba principalmente a los niños. Consistía en un cuadro sintomático característico con episodios febriles, anemia importante, esplenomegalia, edema palpebral y adenopatías ganglionares que, en la gran mayoría de los casos, evolucionaba silenciosamente pero en una cierta proporción progresaba hacia el desarrollo de lesiones cardíacas graves. La descripción completa de este cuadro clínico la hace en una niña de dos años, Berenice, de cuya sangre aisló los mismos tripanosomas que pudo inocular en los animales de laboratorio en los que, posteriormente, describió las diferentes fases del ciclo evolutivo del parásito. Al describirlo en su primera comunicación científica ya mencionada, lo denomina para siempre Trypanosoma cruzi, en homenaje a su maestro. Las alteraciones cardíacas, la forma más grave de las lesiones crónicas de esta enfermedad, ya las había observado y las describe así: “En la sintomatología verificada entonces, lo que más hondo me impresionó fue la frecuencia de las alteraciones del ritmo cardíaco en extrasístoles en los habitantes de la región, especialmente en aquellos de casas infestadas por el triatoma.” El vínculo entre el agente causal, el insecto transmisor y el cuadro clínico estaba completo. Estos notables descubrimientos los hizo Chagas en veinte meses, viviendo en un vagón del ferrocarril central de Brasil donde había instalado su vivienda y su laboratorio de campo en Lassance. A los 33 años, Carlos Chagas había completado sus descubrimientos y había publicado sus trabajos científicos, por lo que entraría, con reconocimiento mundial, en la Historia de la Medicina. En una secuencia que no tiene paralelo, Chagas descubre el agente etiológico, el insecto transmisor y la enfermedad que lleva su nombre y la comunica en su artículo publicado en 1909 en el primer número de las Memorias del Instituto Oswaldo Cruz.

-

5

Después de esta publicación y de las que siguieron, los homenajes y los reconocimientos mundiales se suceden. Es nombrado director del Instituto de Manguinhos, director del Departamento Nacional de Salud Pública y académico de la Academia Nacional de Medicina de Brasil y de otras Academias de Medicina del continente, entre ellas la de Colombia, donde fue elegido en votación secreta y por unanimidad como Miembro Correspondiente en la sesión del 27 de septiembre de 1918 (3). En 1910, en la conferencia que presentó en la Academia Nacional de Medicina de Brasil, Carlos Chagas dijo: “Como veis, señores, el estudio de esta molestia presenta de curioso el hecho de que hemos partido aquí del conocimiento previo del germen, de haberlo estudiado minuciosamente en su biología, para, más tarde llegar, basado de alguna forma en esa misma biología, a demostrar que es el factor etiológico de una especie mórbida humana. En el esclarecimiento etiológico de las otras especies mórbidas nada de similar encontramos; en todas ellas, después de profundamente estudiada la molestia, en su sintomatología, en sus condiciones epidemiológicas, se ha llegado a la verificación del agente mórbido” (4). Más adelante, previendo la necesidad y la factibilidad del control de la enfermedad con campañas de salud pública, de fumigación y de mejoramiento de la vivienda rural, nos dice: “¿Se podrá encontrar en la higiene pública medios eficaces de atenuación del mal? Creemos que sí, si tal problema, seguramente problema de Estado y de humanidad, se convierte en preocupación de un estadista científicamente bien orientado. En verdad, el hombre de Estado que haga de la campaña contra ese mal un programa de administración y que obtenga éxito, habrá conquistado de mis compatriotas, de las generaciones futuras de Minas, la mayor prenda de reconocimiento” (4). Los notables adelantos en investigación sobre la enfermedad de Chagas deben acreditarse a los investigadores de América Latina que han profundizado en el conocimiento de los componentes biológicos y sociales de esta enfermedad. Las publicaciones indexadas en bases de datos internacionales evidencian el alto nivel de los trabajos científicos de los investigadores del continente. Como ejemplo, analicemos los datos bibliométricos de la base de datos de la National Library of Medicine de Washington, D.C. (www.nih.nlm.gov, 2005.). En 56 años, entre 1949 y 2005 se han publicado 8.976 artículos científicos sobre esta enfermedad que se reparten, según los temas, como aparece en el siguiente cuadro: Tema Artículos 7.408 (83%) 665 (7%) 617 (7%) 286 (3%) 8.976 (100%) Años de la publicación 1949-2005 1950-2004 1950-2004 1966-2005 1949-2005

Trypanosoma cruzi, investigación básica Triatoma infestans, investigación básica Rhodnius prolixus, investigación básica
Tratamiento de la enfermedad de Chagas Total

El 97% del total de artículos indexados ha versado sobre temas de investigación básica sobre T. cruzi y sobre dos de los más importantes de sus vectores, Triatoma infestans y Rhodnius prolixus. Es muy contrastante esta proporción cuando se ve que solamente el 3% de los trabajos se refiere al tratamiento y no se registran trabajos sobre el control de la enfermedad.

6

Sin embargo, los logros que se han obtenido para interrumpir la transmisión del parásito causante de la enfermedad, T. cruzi, por medio de la eliminación del vector domiciliado, T. infestans, mediante programas de fumigación con insecticidas de efecto residual, se deben a los compromisos políticos y financieros de los gobiernos de los países endémicos, en particular, de los países que constituyen la Iniciativa del Cono Sur, es decir, los ministerios de Salud de Brasil, Chile y Uruguay, donde la transmisión se ha interrumpido. El pasado 8 de julio de 2006 se celebró en el Ministerio de Salud de Brasil, en Brasilia, el acto de declaración de la interrupción de la transmisión vectorial de la enfermedad de Chagas por T. infestans en toda el área endémica de Brasil, certificada por una Comisión Internacional de Expertos convocada por la Organización Panamericana de la Salud. Este es un triunfo de la salud pública brasilera y continental, que honra al ministerio de Salud y a las instituciones de investigación biomédica de Brasil. Por fortuna, este deseo de Carlos Chagas expresado –como vimos- en 1910 se ha cumplido en su país y en otros del continente. En Colombia, la investigación clínica y de laboratorio, particularmente en diagnóstico serológico, bioquímica y caracterización del parásito y en estudios sobre genética de poblaciones vectoriales – como lo demuestra este número de Biomédica–, han tenido importantes avances. Sin embargo, no existe un programa de control vectorial a nivel nacional que marque las pautas de acción, las implemente y las evalúe sistemáticamente. Creo que el gobierno nacional está en deuda con las poblaciones de colombianos que están viviendo en zonas endémicas para controlar los vectores y evitar la infección con el parásito causante de la enfermedad de Chagas. Álvaro Moncayo Medina Investigador asociado, CIMPAT, Universidad de los Andes, Bogotá, D. C., Colombia. Académico, Academia Nacional de Medicina, Bogotá, D. C., Colombia. Referencias 1. Chagas C. Nova tripanozomiase humana. Estudos sobre a morfolojía e o ciclo evolutivo de Schizotrypanum cruzi n.gen., n.sp., ajente etiolójico de nova entidade morbida do homen. Mem Inst Oswaldo Cruz 1909;1:159-218. 2. Brener Z. A descoberta: homenagem aos 80 anos da descoberta da doença de Chagas. Mem Inst Oswaldo Cruz 1989;84(Suppl. II):1-6. 3. Academia Nacional de Medicina de Colombia. Libro de actas, 1914-1918. Bogotá: Archivos de la Academia; 1919. p.156. 4. Chagas C. Nova entidade morbida do homem. Brazil Medico 1910;XXIV:443-7.

7

Nicholls R.S., Cucunubá1):8-17 Knudson A. et al Biomédica 2007;27(supl. Z.M.,

Biomédica 2007;27(supl. 1):8-17

PRESENTACIÓN DE CASO

Enfermedad de Chagas aguda en Colombia, una entidad poco sospechada. Informe de 10 casos presentados en el periodo 2002 a 2005
Rubén Santiago Nicholls 1, Zulma Milena Cucunubá 2, Angélica Knudson 1, Astrid Carolina Flórez 1, Marleny Montilla 1, Concepción Judith Puerta 3, Paula Ximena Pavía
1 2 2

3

Grupo Parasitología, Instituto Nacional de Salud, Bogotá, D.C., Colombia Escuela de Medicina, Universidad Pedagógica y Tecnológica de Colombia, Tunja, Boyacá, Colombia Laboratorio Parasitología Molecular, Pontificia Universidad Javeriana, Bogotá, D.C., Colombia

Introducción. Los casos de enfermedad de Chagas aguda informados en Colombia son esporádicos. Objetivo. Describir 10 casos notificados al Grupo de Parasitología del Instituto Nacional de Salud entre 2002 y 2005. Materiales y métodos. Utilizando información de historias clínicas, fichas epidemiológicas, informes de resultados de exámenes de laboratorio y análisis de sangre, se tabularon variables demográficas, hallazgos clínicos, paraclínicos y de laboratorio. Se realizaron extendidos de sangre periférica, identificación serológica para IgG mediante inmunofluorescencia indirecta, aislamiento en cultivo e inoculación en ratones, pruebas de reacción en cadena de la polimerasa y análisis isoenzimático. Resultados. El 100% de los casos procedían de zonas endémicas; tres se informaron en Putumayo, dos en cada uno de los departamentos de Arauca, Casanare, Norte de Santander y uno en Santander. La presunta vía de transmisión fue vectorial; en el 30% había convivencia con el vector. El 70% fueron adultos entre los 18 y los 50 años y el 30% niños entre los seis meses y los dos años. El síntoma predominante fue fiebre en el 90%. Los signos de puerta de entrada fueron infrecuentes; solamente un paciente presentó un probable signo de Romaña. Tres pacientes presentaron miocarditis, dos desarrollaron falla cardiaca, y uno taponamiento cardíaco. La parasitemia fue evidente en nueve casos; las pruebas serológicas fueron reactivas en cinco casos y también en cinco casos se logró aislamiento del parásito. El análisis isoenzimático identificó Trypanosoma cruzi grupo I. Conclusiones. La variabilidad clínica predominó. Ningún caso se sospechó clínicamente. Es importante incluir esta enfermedad como diagnóstico diferencial del síndrome febril en regiones endémicas debido a su buena respuesta al tratamiento etiológico el cual previene la fase crónica. Palabras clave: Colombia, enfermedad de Chagas, Trypanosoma cruzi , fase aguda, miocarditis, serología, reacción en cadena de la polimerasa. Acute Chagas disease in Colombia: a rarely suspected disease. Report of 10 cases presented during the 2002-2005 period Introduction. In Colombia, reported cases of acute Chagas disease are sporadic. Objective. Ten cases were described that had been reported to the Parasitology Laboratory of the Colombian National Health Institute between December 2002 and November 2005. Materials and methods. Information from clinical records, epidemiological report forms, laboratory and blood tests was collated. In addition the following data were compiled: demographic variables, clinical findings, results of laboratory tests and other exams (such as peripheral blood smears), IFAT for IgG antibodies, isolation in culture medium, inoculation in mice, polymerase chain reaction tests and isoenzyme eletrophoresis. Results. All the cases presented in known endemic areas for Chagas disease transmission in Colombia. Three cases were from Putumayo Province, two each from the provinces of Arauca,

8

Biomédica 2007;27(supl. 1):8-17

Chagas agudo en Colombia 2002-2005

Casanare, Norte de Santander and one from Santander Province. The probable mode of transmission was vector-borne. Seven cases presented in adults aged 18 to 50, three in children aged 6 months to 2 years. Seven were male and three were female. The most frequent symptom was fever in nine cases. Signs of portal of entry were rare; only one patient presented a possible Romaña´s sign. Three patients presented myocarditis, two acute cardiac failure and one cardiac tamponade. Parasitemia was evident in nine cases; five had positive IgG serological tests; five cases were confirmed through parasite isolation; isoenzyme electrophoresis showed Trypanosoma cruzi group I. Conclusions. Clinical variability prevailed. In none of the cases was a clinical diagnosis suspected. The diagnosis was made and confirmed through laboratory tests alone. The results highlight the importance of including this disease in the differential diagnosis of febrile syndrome in endemic regions due to its good response to etiological treatment and thereby preventing its progression to the chronic phase. Key words: Colombia, Chagas disease, Trypanosoma cruzi, acute phase, myocarditis, serology, polymerase chain reaction.

La enfermedad de Chagas constituye un importante problema de salud pública en Centro y Sur América. Afecta aproximadamente a 20 millones de personas, y 100 millones se encuentran en riesgo de infección. Cada año se presentan aproximadamente 500.000 casos nuevos de infección, de los cuales 300.000 son niños (1). La enfermedad está directamente relacionada con las dificultades socioeconómicas de las comunidades, sus condiciones de vivienda, el acceso a la educación y los movimientos migratorios (2-7). En Colombia, se calcula que el 7% de la población está infectada y que el 23% se encuentra en riesgo de contraer la infección (8). Se ha descrito la presentación clínica en tres fases. La primera, fase aguda, ocurre más o menos dos a cuatro semanas después a la infección, es sintomática sólo en 1% a 2% de los casos (1,4,9), se caracteriza por alta parasitemia y en ausencia de tratamiento, los síntomas persisten por dos a cuatro meses (10). En la segunda, fase indeterminada, disminuye la parasitemia y con ella desaparecen las manifestaciones clínicas; ésta se detecta por métodos serológicos (4,7). Finalmente, la fase crónica puede manifestarse al cabo de 10 o más años después de la infección
Correspondencia: Rubén Santiago Nicholls, Grupo de Parasitología, Instituto Nacional de Salud Avenida Calle 26 No. 51-60, Bogotá, D.C., Colombia Tel.: +571 2207700, ext. 423 rnichols@ins.gov.co Recibido: 20/09/05; aceptado: 17/02/06

como cardiopatía o enfermedad digestiva, entre otras. Sin embargo, sólo de 20% a 40% de la población infectada llega a esta fase; el resto permanece asintomático y probablemente muera por una causa ajena a la enfermedad de Chagas (2,4,11). La fase aguda clínicamente evidente se presenta por lo general en niños menores de 10 años y en formas benignas, con una tasa de mortalidad entre 2% y 8% (4,9). Sin embargo, el diagnóstico de esta fase a cualquier edad se dificulta debido a la heterogeneidad de los hallazgos clínicos, lo cual sugiere que la mayoría de los casos agudos de enfermedad de Chagas no son diagnosticados (9). El último informe publicado sobre casos de Chagas agudo en Colombia fue el de un brote en 1999 en Guamal, Magdalena, zona sin antecedentes de transmisión de enfermedad de Chagas, en donde se describieron 13 casos de síndrome febril asociado a miocarditis aguda, cinco de ellos fatales (12). En el presente trabajo se describen las características epidemiológicas y los hallazgos clínicos y de laboratorio de diez casos de Chagas agudo, que fueron notificados al Grupo de Parasitología del Instituto Nacional de Salud (INS) Colombia, durante el periodo comprendido entre diciembre de 2002 y noviembre de 2005. Materiales y Métodos Se utilizó la información correspondiente a historias clínicas, fichas epidemiológicas, informes

9

Nicholls R.S., Cucunubá Z.M., Knudson A. et al

Biomédica 2007;27(supl. 1):8-17

de resultados de laboratorios y análisis de sangre de los diez pacientes, y se tabularon las variables demográficas y epidemiológicas, y los principales hallazgos clínicos, paraclínicos y de laboratorio. Hubo limitantes metodológicas, pues los casos se reportaron de distintas maneras y procedían de diferentes fuentes, por lo que la información suministrada no guardaba uniformidad. En los casos en que se remitieron muestras de sangre al Grupo de Parasitología del INS, se realizaron extendidos de sangre periférica utilizando coloraciones de Giemsa y gota gruesa, aislamiento en cultivos con medio de NNN modificado y REI modificado al 2% con suero bovino fetal y antibiótico gentamicina 100 µg/ml (13), inoculación en ratones Balb c (14), manteniendo durante un mes en una sala de alta seguridad del bioterio del Instituto Nacional de Salud, análisis electroforético para identificación de zimodemas en acetato de celulosa con las enzimas malato deshidrogenasa, glucosa fosfato isomerasa, isocitrato deshidrogenasa y enzima málica (15), y reacción en cadena de la polimerasa (PCR) con los iniciadores TcH2AF/R (16) y S35/S36 (17), el primero es una secuencia que se mantiene a lo largo de todos los tripanosomatidos, y el segundo es específico de Trypanosoma cruzi. Los métodos serológicos para identificación de anticuerpos IgG fueron el ensayo inmuno-enzimático (Elisa) y la inmunofluorescencia indirecta (IFI) (8), con puntos de corte en 0,4 y 1:32, respectivamente. El tratamiento, benzonidazol (Rochagán R), fue suministrado por el INS a todos los pacientes. Resultados Todos los casos se presentaron en zonas endémicas conocidas por su infestación con triatominos; 30% de ello se informó en Putumayo, dos en cada uno de los departamentos de Arauca, Casanare y Norte de Santander, y uno en Santander, todos en residentes en zonas rurales, incluidos dos soldados en ejercicio. La presunta vía de transmisión fue vectorial, pero sólo en el 30% de los casos los pacientes manifestaron convivir con el vector. Setenta por ciento de los pacientes era adulto, con edades entre los 18 y los 50 años, y 30% niños con edades entre los seis meses y los dos

años; la distribución por sexos correspondió a siete casos en hombres y tres en mujeres. El síntoma predominante en 90% de los casos fue la fiebre. Otros síntomas importantes fueron cefalea, astenia y adinamia en el 40%. Los signos de puerta de entrada no fueron frecuentes, sólo un paciente presentó posible signo de Romaña, que no se pudo confirmar, y otro, un posible chagoma. El 30% de los pacientes presentó miocarditis y el 20% desarrolló falla cardiaca, uno de ellos con taponamiento cardiaco que requirió cirugía (ventana pericárdica) y manejo en cuidados intensivos. La parasitemia fue evidente con examen en fresco en el 90% de los casos, en los cuales se identificaron tripomastigotes circulantes; ésta fue la principal herramienta diagnóstica. Las pruebas serológicas anti - IgG fueron reactivas en el 50% de los casos aún en la fase aguda. En el 50% se logró aislamiento del parásito por medio de inoculación en ratones, cultivo y confirmación del parásito con PCR. El análisis isoenzimático identificó T. cruzi grupo I. En ninguno de los casos hubo sospecha clínica inicial de tripanosomiasis. A continuación se presenta una breve descripción de cada uno de los casos siguiendo el orden cronológico de la notificación.

Caso 1
Niña de seis meses, natural y procedente de zona rural del municipio de Puerto Guzmán, Putumayo, llevada a consulta por una lesión supurante en cuello presente desde el nacimiento, la cual no cedió con antibióticos. En el examen físico se encontró una lesión que sugería una fístula, según lo referido en la historia clínica. Con este diagnóstico se programó para cirugía. En exámenes prequirúrgicos se reportó la presencia de tripomastigotes de T. cruzi en extendido de sangre periférica. Se prescribió tratamiento etiológico con benzonidazol por 60 días. El diagnóstico fue confirmado mediante aislamiento, cultivo, isoenzimas, inoculación en ratón y PCR.

Caso 2
Mujer de 50 años, procedente de zona rural del municipio de Saravena, Arauca. Presentó un

10

Biomédica 2007;27(supl. 1):8-17

Chagas agudo en Colombia 2002-2005

cuadro clínico de 15 días de evolución consistente en fiebre, deposiciones diarréicas y, posteriormente, disnea, el cual la obligó a consultar en varias ocasiones. La sintomatología, especialmente la disnea, empeoró, por lo cual consultó nuevamente, encontrándose en el examen físico signos claros de insuficiencia cardiaca. En la radiografía de tórax se evidenció cardiomegalia y derrame pleural, y el ecocardiograma reportó taponamiento cardiaco. Se la programó para cirugía, se le realizó ventana pericárdica, y en el líquido pericárdico obtenido se encontraron tripomastigotes de T. cruzi según lo reportado por el Laboratorio Clínico del Hospital Erasmo Meoz. Luego de un mes de hospitalización y tratamiento médico en cuidados intensivos, la paciente evolucionó hacia la mejoría y se inició tratamiento etiológico con benzonidazol en dosis de 350 mg/ día por 60 días. Se logró aislamiento del parásito, cultivo, e identificación por isoenzimas y PCR.

se envió suero para confirmación en el INS, como tampoco información más detallada acerca de la historia clínica. Se prescribió tratamiento con benzonidazol a dosis de 300 mg/día por 60 días.

Caso 5
Hombre de 26 años, procedente de zona rural del municipio de Tibú, Norte de Santander. Consultó por cuadro de cinco días de fiebre, escalofríos, dolores musculares, cefalea, artralgias, astenia y adinamia. Se realizó estudio para hemoparásitos, encontrándose ocasionales tripomastigotes, según el reporte del Laboratorio Clínico del Hospital Erasmo Meoz. El ecocardiograma mostró leve derrame pericárdico y leve dilatación ventricular izquierda. Además, se encontró franca leucopenia (3.200 leucocitos/µl) y plaquetopenia (69.000 plaquetas/µl). Se administró tratamiento etiológico con benzonidazol en dosis de 350 mg/día por 60 días. El diagnóstico se confirmó por lectura de lámina de extendido de sangre periférica en el INS.

Caso 3
Hombre de 35 años, proveniente de zona rural del municipio de Támara, Casanare. En la historia clínica se registró un cuadro de doce días de evolución, cuya única manifestación fue la fiebre, y examen físico normal. Se realizó gota gruesa encontrándose formas de T. cruzi, según el reporte del Laboratorio Departamental de Salud Pública de Casanare. En el mismo laboratorio se realizó determinación de anticuerpos específicos tipo IgG mediante Elisa e IFI con resultados positivos. Se administró tratamiento etiológico con benzonidazol a dosis de 300 mg/día por 60 días. El diagnóstico fue confirmado por extendido de sangre periférica e IFI reactivo 1:128, en el INS.

Caso 6
Hombre de 16 años, procedente de zona rural del municipio El Peñón, Santander. Consultó por cuadro de cinco días de evolución consistente en eritema y edema palpebral izquierdo progresivo asociado a secreción ocular purulenta. En el examen físico se encontró edema palpebral y conjuntiva izquierda hiperémica sin secreciones. Se hizo diagnóstico de celulitis periorbitaria y se inició manejo antibiótico ambulatorio. Un año después consultó por cuadro de tres días consistente en debilidad, fiebre subjetiva, disnea, cefalea, malestar general y dolor faríngeo. En la ficha epidemiológica se consignó signo de Romaña positivo (probablemente en retrospectiva). Se realizaron pruebas serológicas, reportadas como Elisa positivo e IFI reactivo con título de 1:32, por parte del Laboratorio Departamental de Salud Pública de Santander. Se administró tratamiento etiológico con benzonidazol a una dosis de 250 mg/día durante 60 días. El diagnóstico fue confirmado mediante serología por IFI reactiva 1:64 en el INS. No se envió muestra de sangre para cultivo.

Caso 4
Hombre de 31 años, soldado, procedente del municipio de Girón, Santander. Consultó en repetidas ocasiones, por cuadro de astenia, adinamia y fiebre esporádica. Luego de cuatro meses de esta sintomatología y múltiples manejos médicos, se realizó gota gruesa encontrándose formas de T. cruzi según el reporte del Laboratorio Clínico del Hospital San Juan de Dios de Girón, confirmado por el Laboratorio Departamental de Salud Pública de Santander. Según este último, las pruebas serológicas IgG fueron negativas. No

Caso 7
Soldado de 18 años, natural de Ibagué y procedente de Putumayo. Consultó por cuadro de

11

Nicholls R.S., Cucunubá Z.M., Knudson A. et al

Biomédica 2007;27(supl. 1):8-17

ocho días consistente en mareo, fiebre intermitente de predominio nocturno y cefalea frontal intensa; además informó caída desde su propia altura con pérdida de la conciencia. Se realizó extendido de sangre periférica encontrándose dos formas de tripomastigotes de T. cruzi, según el Laboratorio del Establecimiento de Sanidad Militar “Simona de Luz Duque de Alzate”. Se prescribió tratamiento con benzonidazol por 60 días. El diagnóstico se comprobó por medio de lectura de lámina (Figura 1), aislamiento, cultivo, isoenzimas, inoculación en ratón y PCR, a pesar de lo cual el paciente presentó pruebas serológicas para anticuerpos IgG persistentemente negativas (una prueba Elisa a los 12 días de enfermedad en el Laboratorio Departamental de Salud Pública y dos pruebas IFI en el INS con intervalo de un mes durante un periodo de dos meses).

Figura 1. Tripomastigote en sangre periférica de un paciente con enfermedad de Chagas en fase aguda.

Caso 8
Niño de dos años procedente del área rural de Casanare. Fue llevado a consulta por presentar fiebre de un mes de evolución y síntomas de faringitis, por lo que recibió manejo antibiótico en dos oportunidades. Sin presentar mejoría, consultó nuevamente por persistencia de fiebre y aparición de edemas. Le fue realizada radiografía de tórax que evidenció cardiomegalia. El ecocardiograma reportó miocardiopatía y derrame pericárdico y pleural, por lo cual fue remitido a Bogotá donde se inició manejo médico. Se realizó serología para Chagas con resultado positivo, confirmado con IFI reactivo 1:32, por el Laboratorio del Hospital de La Misericordia. El paciente presentó evolución favorable. Se administró tratamiento etiológico con benzonidazol en dosis de 100 mg/día por 60 días. El diagnóstico fue comprobado en el INS por medio de aislamiento, cultivo, isoenzimas, inoculación en ratón y PCR.

antibióticos. Sin embargo, la paciente persistió sintomática con picos febriles repetidos; se realizó estudio para hemoparásitos encontrándose tripomastigotes de T. cruzi, según informe del Laboratorio Clínico del Hospital Erazmo Meoz. Se administró tratamiento etiológico con benzonidazol en dosis de 300 mg/día por 60 días. El diagnóstico fue confirmado en el INS por lámina de extendido de sangre periférica, y serología reactiva por IFI 1:64. El cultivo fue negativo cuatro meses después de tomado. Posteriormente, el Laboratorio Departamental de Salud Pública de Norte de Santander informó Western blot positivo para VIH.

Caso 10
Niño de dos años y medio de edad, procedente de zona rural del municipio de Puerto Leguízamo, Putumayo. Fue llevado al Hospital de María Angelines por presentar un cuadro de 15 días consistente en fiebre alta e intermitente, astenia y adinamia. El examen físico reveló fiebre, adenopatías múltiples y leve hepatoesplenomegalia. Se realizó gota gruesa lográndose identificar tripomastigotes de T. cruzi. La radiografía de tórax y el electrocardiograma fueron normales. El cuadro cedió rápidamente, se inició tratamiento etiológico con benzonidazol en dosis de 100 mg/día por 60 días. El diagnóstico fue confirmado en el INS por lámina de extendido de sangre periférica y cultivo positivo un mes depués de tomado. La serología inicial con técnica de IFI a los cinco días de sintomatología fue negativa,

Caso 9
Mujer de 38 años, procedente de zona rural de Durania, Norte de Santander. Consultó por cuadro de 15 días consistente en fiebre, escalofrío, osteomialgias y malestar general. Los paraclínicos diagnosticaron infección de vías urinarias y se inició manejo antibiótico. Sin presentar mejoría consultó nuevamente; se diagnosticó enfermedad pélvica inflamatoria, la cual se manejó con

12

Biomédica 2007;27(supl. 1):8-17

Chagas agudo en Colombia 2002-2005

pero una segunda, a las dos semanas, fue positiva con resultado 1:64. En estudio de campo no se identificaron vectores ni otros pacientes infectados cuyas muestras fueron sometidas a extendido de sangre periférica y serología. Se logró aislar en cultivo hasta luego de seis meses. La PCR fue reactiva. Discusión

interpretación en retrospectiva de la fase aguda ocurrida un año atrás (caso siete). Adicionalmente, en el caso uno, la fístula en el cuello pudo haber tenido su origen en un chagoma. A pesar de que en otras publicaciones se ha encontrado una incidencia alta, en esta serie de diez casos, no fue común encontrar los signos de puerta de entrada (19,20). La manifestación más frecuente es la fiebre (18) presentándose en esta serie en el 90% de los casos (Cuadro 1). Esta no tiene una característica específica, puede ser intermitente ó incluso manifestarse como síndrome febril prolongado sin otra sintomatología (4). En cuanto a síntomas neurológicos, en un caso se registró cefalea intensa, asociada con caída desde su propia altura y pérdida de conciencia, pero el paciente se recuperó rápidamente. La meningoencefalitis chagásica aguda es una manifestación especialmente frecuente en lactantes (4, 22), pero no se evidenció en ninguno de los dos niños de esta serie. La evolución de la enfermedad chagásica aguda es generalmente benigna, a pesar de lo cual 20% de los casos presentó manifestaciones graves de compromiso cardiaco. En la Guyana Francesa, se reportaron seis casos entre 1994 y 1999, todos en adultos, con miocarditis aguda, pericarditis, falla cardiaca grave, disfunción sistólica y derrame pericárdico (19). En Brasil, de cuatro casos reportados recientemente, tres pacientes
Cuadro 1. Distribución de signos y síntomas en los casos de Chagas agudo 2002 a 2005. Signos y síntomas Fiebre Astenia/adinamia Cefalea Cardiomegalia Falla cardiaca Edemas Hepatomegalia Signos entrada Derrame pleural Diarrea Esplenomegalia Adenopatías Frecuencia n/N 9/10 4/10 3/10 3/10 2/10 2/10 2/10 2/10 2/10 2/10 1/10 1/10

Hallazgos epidemiológicos y demográficos
En todos los casos descritos, el principal antecedente epidemiológico fue la residencia en una zona endémica para transmisión de T. cruzi por triatominos (8). Se ha descrito que la mayoría de pacientes con manifestaciones agudas de la enfermedad de Chagas son niños (9) pero la mayoría de los casos aquí descritos ocurrieron en adultos, al igual que en otras series (18-20). La vía de transmisión probablemente fue vectorial. Solamente tres pacientes conocían los triatominos y convivían con estos, pero únicamente se realizó estudio de convivientes en uno de los casos y no se hallaron otras personas afectadas. Debido a esto, y a la actividad predominante en regiones selváticas, es probable que la infección en los soldados y en algunos pacientes se adquiriera a través de vectores selváticos. No hubo nexo de tipo espacial ni temporal entre los casos. Por estudios previos sobre distribución geográfica de triatominos en Colombia se sabe que en todos los sitios de procedencia de los casos hay presencia de triatominos (2,8).

Variabilidad clínica
La variabilidad en las manifestaciones clínicas y los hallazgos paraclínicos fue predominante, tal como lo describieron otros autores (18-20), especialmente en un estudio realizado en Venezuela entre los años 1988 y 1996, el cual describió 59 casos de Chagas agudo con 19 patrones sintomáticos (18). Los signos de puerta de entrada aparente más frecuentemente reportados son el complejo oftalmo-ganglionar o signo de Romaña (20,21) y el chagoma de inoculación (4,9), pero en este informe solo se describió un caso con un posible signo de Romaña, probablemente como una

13

Nicholls R.S., Cucunubá Z.M., Knudson A. et al

Biomédica 2007;27(supl. 1):8-17

presentaron franco taponamiento cardiaco, que requirió tratamiento en unidad de cuidados intensivos, y finalmente fallecieron (20). En la serie que presentamos, el 30% de los pacientes presentaron miocarditis chagásica aguda; dos de ellos, un adulto y un niño, con manifestaciones graves, a saber, falla cardiaca con cardiomegalia, edemas, hepatomegalia y dificultad respiratoria. En uno de estos casos se presentó taponamiento cardiaco que requirió cirugía (ventana pericárdica) y manejo en unidad de cuidado intensivo; el electrocardiograma evidenció voltaje disminuido y cambios de repolarización, tal como se ha descrito en otros informes (9,19). El otro paciente presentó cardiomegalia y derrame pericárdico leve sin evidenciar manifestaciones clínicas. Así, a pesar de no evidenciarse clínicamente, la miocarditis puede presentarse con una frecuencia importante, tal como se informó en el reporte venezolano (18). Las reactivaciones en el contexto del sida, se acompañan de manifestaciones neurológicas en 75% a 90% de los casos, e incluso hacen parte de las patologías definitorias del sida (23,24). Se prevé que estas reactivaciones sean cada vez más frecuentes por el aumento del sida en el mundo. El caso nueve presentó prueba confirmatoria para VIH, lo cual sugiere que podría corresponder a una reactivación de una infección latente por T. cruzi adquirida previamente. Sin embargo, no presentó características clínicas propias de una reactivación, por lo cual concluimos que más probablemente corresponde a una primoinfección.

presentó plaquetopenia y leucopenia importantes, que corrigieron sin otras complicaciones. Se ha propuesto la medición de algunos reactantes de fase aguda, tales como la velocidad de sedimentación globular y la proteína C reactiva, como marcadores de enfermedad aguda, pero hasta el momento no se ha encontrado una clara correlación (26,27). Un estudio realizado en una zona endémica de Bolivia encontró un importante incremento de alfa-2-microglobulina en niños con Chagas agudo (26, 28). En el actual informe, solo tres casos de los diez descritos tenían medición de reactantes de fase aguda, y presentaban aumento en los valores de velocidad de sedimentación globular y, en el caso de mayor gravedad, de la proteína C reactiva.

Métodos diagnósticos
La parasitemia evidente es prácticamente exclusiva de la fase aguda y confirma el diagnóstico, incluso sin necesidad de otros exámenes (29). Los métodos de concentración como el Strout y el microhematocrito también se han utilizado, este último especialmente en recién nacidos para diagnóstico de Chagas congénito, pues al parecer aumenta la sensibilidad en la visualización del parásito (4,30, Luquetti A. El diagnóstico de la enfermedad de Chagas. Diagnóstico serológico, xenodiagnóstico, hemocultivo, PCR y examen directo”. P 227-30. En: Guhl F. Editor. Memorias. Primer Taller Internacional sobre Control de la Enfermedad de Chagas.Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. Sexta Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas. Bogotá D.C.: Ediciones Uniandes; 2005). El hemocultivo y el xenodiagnóstico, se usan generalmente en el contexto de investigaciones (18). La PCR ha mostrado alta sensibilidad pero, por su naturaleza, suele estar disponible sólo en los laboratorios de referencia (31,32, Luquetti A. El diagnóstico de la enfermedad de Chagas. Diagnóstico serológico, xenodiagnóstico, hemocultivo, PCR y examen directo”. P 227-30. En: Guhl F. Editor. Memorias. Primer Taller Internacional sobre Control de la Enfermedad de Chagas.Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de

Hallazgos paraclínicos
En este estudio sólo se logró obtener el electrocardiograma en cinco casos; tres de ellos fueron anormales; uno mostró bajo voltaje con trastornos de repolarización, otro signos de hipertrofia ventricular izquierda y el último inversión de la onda T en V4 a V6 ,aunque se trataba de un niño y este cambio no es necesariamente patológico en ellos. En el cuadro hemático se ha descrito la presencia de trombocitopenia leve en los casos de Chagas agudo (25). En este reporte, solo uno de los casos

14

Biomédica 2007;27(supl. 1):8-17

Chagas agudo en Colombia 2002-2005

Chagas. Sexta Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas. Bogotá D.C.: Ediciones Uniandes; 2005). En el 80% de los casos se realizó el diagnóstico por extendido de sangre periférica, observándose tripomastigotes de T. cruzi; inclusive en uno de ellos se llegó al diagnóstico por examen en fresco de líquido pericárdico. Llama la atención que en un caso se encontró parasitemia por gota gruesa luego de cuatro meses de sintomatología. En el laboratorio se logró aislar y comprobar la presencia de la cepa de T. cruzi por medio de cultivo, inoculación en ratón, isoenzimas y PCR en seis casos. Las pruebas serológicas son útiles especialmente en las fases indeterminada y crónica, en las cuales se requieren dos pruebas positivas mediante técnicas de diferente principio para hacer el diagnóstico (33,Luquetti A. El diagnóstico de la enfermedad de Chagas. Diagnóstico serológico, xenodiagnóstico, hemocultivo, PCR y examen directo”. P 227-30. En: Guhl F. Editor. Memorias. Primer Taller Internacional sobre Control de la Enfermedad de Chagas.Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. Sexta Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas. Bogotá D.C.: Ediciones Uniandes; 2005). Las más frecuentemente utilizadas son Elisa, IFI y hemaglutinación indirecta (8,33). La determinación de IgM por IFI se ha utilizado para definir la fase aguda de la enfermedad de Chagas; su nivel detectable en sangre aparece a partir de los días 10 a 15 de sintomatología (4,30), con un pico entre los días 17 a 45 (34). Sin embargo, se sabe que la IgG detectada por IFI puede positivizarse desde la fase aguda incluso en el primer mes, mientras que por Elisa en general sólo se positivizan luego de 30 días de sintomatología (4). Esto coincide con los hallazgos en algunos de los casos informados, pues se encontraron pruebas positivas de IFI para IgG en cinco de los pacientes. Este dato es de gran utilidad en nuestro medio, pues generalmente los Laboratorios Departamentales de Salud Pública cuentan con la técnica de IFI para IgG más no para IgM. Como hallazgo llamativo, y para el cual todavía no se

tiene una explicación, vale señalar que uno de los pacientes en quien se comprobó el diagnóstico de Chagas agudo por medio de extendido de sangre periférica, cultivo, isoenzimas y PCR, paradójicamente nunca presentó pruebas serológicas positivas aún con tres mediciones realizadas con un mes de intervalo entre cada una de ellas. En los cinco casos en que se obtuvo cultivo del parásito, su caracterización molecular mediante PCR permitió confirmar los aislamientos como T. cruzi y el análisis izoenzimático mostró que correspondieron al grupo I, hallazgo esperado puesto que este es el grupo predominante en Colombia (15,34). La enfermedad de Chagas aguda es un indicador indirecto de la intensidad de transmisión en una zona. Teniendo en cuenta que el pronóstico y la respuesta al tratamiento mejoran con un diagnóstico oportuno, la detección de casos agudos es una estrategia para prevenir la fase crónica. Por esto, es de vital importancia la búsqueda de casos en todas sus presentaciones tanto sintomáticas como asintomáticas. Por tal razón, siempre debe realizarse una búsqueda activa de casos de infección en los familiares o convivientes con el caso índice. Finalmente, es fundamental enfatizar en la calidad de historias clínicas y las muestras que son enviadas al INS para confirmación diagnóstica, ya que esta es una fuente de información muy importante que permite tomar decisiones en cuanto al manejo y seguimiento clínico de los pacientes, y constituye un elemento esencial para la vigilancia en salud pública de este evento en Colombia.

Adendo
En el período 1 de enero a 10 de octubre de 2006, se informaron cinco casos de enfermedad de Chagas aguda en los departamentos de Vaupés (2), Casanare (2), y Putumayo. El primero fue una niña de dos años procedente de Mitú, Vaupés, quien presentó fiebre y signo de Romaña. El segundo, un soldado de 25 años procedente también de Mitú, quien presentó fiebre, astenia y esplenomegalia. El tercero y cuarto casos se

15

Nicholls R.S., Cucunubá Z.M., Knudson A. et al

Biomédica 2007;27(supl. 1):8-17

presentaron en dos hermanas de dos y cuatro años procedentes de Paz de Ariporo, Casanare, ambas presentaron mal estado nutricional, fiebre y miocarditis con falla cardiaca grave. El quinto caso en una niña de 13 años procedente de zona rural del municipio Puerto Asís, Putumayo, quien presentó fiebre asociada con anemia. Todos los casos recibieron benzonidazol, evolucionando satisfactoriamente. El diagnóstico se realizó en todos los casos por visualización del parásito en sangre y las pruebas serológicas para IgG fueron positivas. Los estudios de PCR fueron positivos para T. cruzi en los primeros cuatro casos. Hasta el momento no se ha logrado aislar ninguna de estas cepas. Se realizó estudio de campo en los casos de los niños, encontrando vectores en los hogares. Conflicto de intereses Los autores manifestamos expresamente que durante la realización del presente trabajo no existió conflicto de interés alguno que pudiera afectar los resultados obtenidos. Financiación Este trabajo fue financiado por el Instituto Nacional de Salud. Referencias
1. UNDP/ UNDP/World Bank/WHO Special Program for Research and Training in Tropical Disease, 1997. Tropical Disease Research (TDR), Thirteenth Program Report. Geneve:WHO;1997.p.113-23. 2. Guhl F, Restrepo M, Angulo VM, Antunes CM, Campbell-Lendrum D, Davies CR. Lessons from a national survey of Chagas disease transmission risk in Colombia. Trends Parasitol 2005;21:259-62. 3. Dias JC, Silveira AC, Schofield CJ. The impact of Chagas disease control in Latin America: a review. Mem Inst Oswaldo Cruz 2002;97:603-12. 4. Rassi A, Rassi AJ, Rassi G. Fase aguda. En: Brener Z, Andrade ZA, Barral-Neto M, editors. Trypanosoma cruzi e doenca de Chagas. Second Edition. Rio de Janeiro:Guanabara Koogan;2000.p.231-45. 5. Gurtler RE, Chuit R, Cecere MC, Castanera MB, Cohen JE, Segura EL. Household prevalence of seropositivity for Trypanosoma cruzi in three rural villages in northwest Argentina: environmental, demographic, and entomologic associations. Am J Trop Med Hyg 1998;59:741-9.

6. Guhl F, Vallejo GA. Interruption of Chagas disease transmission in the Andean Countries: Colombia. Mem Inst Oswaldo Cruz 1999;94 (Suppl. 1):413-5. 7. Rosas F, Guhl F, Velasco V, Jumbo L, Jaramillo C, Rodríguez D et al. Morbilidad de la enfermedad de Chagas en fase crónica en Colombia. Detección de pacientes chagásicos con cardiopatía en un área endémica del departamento de Boyacá. Rev Col Cardiol 2002;9:349-58. 8. Guhl F, Nicholls RS. Manual de procedimientos para el diagnóstico de la enfermedad de Chagas. Bogotá D.C.: Quebecor Impresores;2001.p.12-58. 9. Sociedad Argentina de Cardiología. Consenso de enfermedad de Chagas. Rev Argent Cardiol 2002;70 (Suppl. 1):13-39. 10. Rodriques Coura J, de Castro SL. A critical review on Chagas disease chemotherapy. Mem Inst Oswaldo Cruz 2002;97:3-24 11. Kirchhoff LV. Chagas disease. American trypanosomiasis. Infect Dis Clin North Am 1993;7:487-502. 12. Cáceres D, Nicholls RS, Corredor A, Gualdrón L, Slait E, Dib J et al. Investigación de un brote de síndrome febril con miocarditis aguda en Guamal, Magdalena, 7 a 11 de junio de 1999. Inf Quinc Epidemiol Nac 1999;4:170-8. 13. Duque S, Pelaez D, Corredor A. Normas para cultivo in vitro de parásitos de la familia Tripanosomatidae. Manual de procedimientos. Bogotá: Instituto Nacional de Salud;1993. Cap VI.p.41. 14. Santana L, Montilla M, Nicholls S, Puerta C. Variación antigénica de la cepa Munantá de Trypanosoma cruzi después de pase por ratón. Biomédica 1998;18:134-40. 15. Montilla M, Guhl F, Jaramillo C, Nicholls S, Barnabe C, Bosseno MF et al. Isoenzyme clustering of trypanosomatidae Colombian populations. Am J Trop Med Hyg 2002;66:394-400. 16. Pavía P, Cuervo C, Montilla M, Nicholls S, Puerta, C. Diseño y estandarización de una prueba de PCR para la detección específica de Trypanosoma cruzi . Infectio 2003;7:129-36. 17. Vallejo GA, Guhl F, Chiari E, Macedo AM. Species specific detection of Trypanosoma cruzi and Trypanosoma rangeli in vector and mammalian hosts by polymerase chain reaction amplification of kinetoplast minicircle DNA. Acta Trop 1999;72:203-12. 18. Añez N, Carrasco H, Parada H, Crisante G, Rojas A, Gonzalez N et al. Acute Chagas’ disease in western Venezuela: a clinical, seroparasitologic, and epidemiologic study. Am J Trop Med Hyg 1999;60:215-22. 19. Carme B, Aune I, Nguyen G, Aznar C, Beaudet B. Four cases of acute chagasic myocarditis in French Guiana. Am J Trop Med Hyg 2001;64:162-3.

16

Biomédica 2007;27(supl. 1):8-17

Chagas agudo en Colombia 2002-2005

20. Pinto AY, Valente SA, Valente Vda C. Emerging acute Chagas disease in Amazonian Brazil: case reports with serious cardiac involvement. Braz J Infect Dis 2004;8: 454-60. 21. Mazza S, Miiraya S, Jorg M. Naturaleza de la reacción conjuntival en el primer periodo de la enfermedad de Chagas. En: Investigaciones sobre la enfermedad de Chagas. Publicación número 69. Buenos Aires: Universidad de Buenos Aires, Misión de Estudios de Patología Regional Argentina; 1945. 22. León-Sarmiento F, Prada D, Bayona J, Valderrama V, García I, León M et al. Neurotripanosomiasis americana: aspectos clínicos de un problema básico. Biomédica 2003;23:462-75. 23. Vaidian AK, Weiss LM, Tanowitz HB. Chagas’ disease and AIDS. Kinetoplastid Biol Dis 2004;3:1-6. 24. Madalosso G, Pellini AC, Vasconcelos MJ, Ribeiro AF, Weissmann L, Oliveira Filho GS et al. Chagasic meningoencephalitis: case report of a recently included AIDS-defining illness in Brazil. Rev Inst Med Trop Sao Paulo 2004;46:199-202. 25. Tribulatti MV, Mucci J, Van Rooijen N, Leguizamon MS, Campetella O. The trans-sialidase from Trypanosoma cruzi induces thrombocytopenia during acute Chagas’ disease by reducing the platelet sialic acid contents. Infect Immun 2005;73:201-7. 26. Medrano NM, Luz MR, Cabello PH, Tapia GT, Van Leuven F, Araujo-Jorge TC. Acute Chagas’ disease: plasma levels of alpha-2-macroglobulin and C-reactive protein in children under 13 years in a high endemic area of Bolivia. J Trop Pediat 1996;42:68-74. 27. Melo Coutinho CM, Cavalcanti GH, Bonaldo MC, Mortensen RF, Araujo-Jorge TC. Trypanosoma cruzi: detection of a surface antigen cross-reactive to human C-reactive protein. Exp Parasitol 1998;90:143-53.

28. Medrano-Mercado N, Luz MR, Torrico F, Tapia G, Van Leuven F, Araujo-Jorge TC. Acute-phase proteins and serologic profiles of chagasic children from an endemic area in Bolivia. Am J Trop Med Hyg 1996;54:154-61. 29. Ministerio de Salud. Dirección General de Salud Pública. Grupo de Vigilancia en Salud Pública. Sistema de Vigilancia en Salud Pública - SIVIGILA. La Vigilancia en Salud Pública de eventos transmisibles y de fuente común. Tripanosomiasis americana. Protocolos. Santa Fe de Bogotá: Ministerio de Salud; 2000.p.1-9. 30. Lorca M. La enfermedad de Chagas congénita, transfusional y otras vías en el contexto de la interrupción vectorial. Rev Patol Trop 2002;31:86-9. 31. Olivares-Villagomez D, McCurley TL, VnencakJones CL, Correa-Oliveira R, Colley DG, Carter CE. Polymerase chain reaction amplification of three different Trypanosoma cruzi DNA sequences from human chagasic cardiac tissue. Am J Trop Med Hyg 1998;59: 563-70. 32. Antas PR, Medrano-Mercado N, Torrico F, UgarteFernandez R, Gomez F, Correa Oliveira R et al. Early, intermediate, and late acute stages in Chagas’ disease: a study combining anti-galactose IgG, specific serodiagnosis, and polymerase chain reaction analysis. Am J Trop Med Hyg 1999;61:308-14. 33. Umezawa ES, Luquetti AO, Levitus G, Ponce C, Ponce E, Henriquez D et al. Serodiagnosis of chronic and acute Chagas’ disease with Trypanosoma cruzi recombinant proteins: results of a collaborative study in six Latin American countries. J Clin Microbiol 2004;42:449-52. 34. Devera R, Fernandes O, Coura JR. Should Trypanosoma cruzi be called “cruzi” complex? A review of the parasite diversity and the potential of selecting population after in vitro culturing and mice infection. Mem Inst Oswaldo Cruz 2003;98:1-12.

17

Santander S.P., Cuéllar A., Thomas M.del C. et al Biomédica 2007;27(supl. 1):18-27

Biomédica 2007;27(supl. 1):18-27

ARTÍCULO ORIGINAL

Expresión de marcadores en células dendríticas de pacientes chagásicos crónicos estimuladas con la proteína KMP-11 y el péptido K1 de Trypanosoma cruzi
Sandra Paola Santander 1+, Adriana Cuéllar 2+, María del Carmen Thomas 3, Fanny Guzmán 4, Alberto Gómez 5, Manuel Carlos López 3, Concepción Puerta 1
Laboratorio de Parasitología Molecular, Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá, D.C., Colombia. 2 Laboratorio de Inmunobiología y Biología Celular, Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá, D.C., Colombia. 3 Departamento de Biología Molecular, Instituto de Parasitología y Biomedicina López Neyra, CSIC, Granada, España. 4 Facultad de Medicina, Universidad Nacional de Colombia, Bogotá, D.C., Colombia. 5 Instituto de Genética Humana, Facultad de Medicina, Pontificia Universidad Javeriana, Bogotá, D.C., Colombia. + Autores con participación equivalente en el trabajo.
1

Introducción. La proteína de membrana 11 de kinetoplástidos, KMP-11, de Trypanosoma cruzi induce inmunidad humoral y celular en ratones capaz de conferir protección frente al reto con el parásito. Objetivo. Determinar la expresión de marcadores de maduración en las células dendríticas de pacientes chagásicos crónicos e individuos sanos, estimuladas con la proteína KMP-11 y su péptido amino terminal K1. Materiales y métodos. Monocitos de siete pacientes chagásicos y siete individuos sanos fueron diferenciados a células dendríticas y estimulados con la proteína KMP-11 y el péptido K1, determinándose por citometría de flujo y tras 7 días de cultivo, la expresión de los marcadores de superficie CD83, CD86 y HLA-DR y la producción de citocinas. Resultados. La proteína KMP-11 y el péptido K1 no indujeron la expresión del marcador de maduración CD83 en las células dendríticas de pacientes y controles. La exposición de células dendríticas de pacientes chagásicos de forma simultánea al péptido K1 y LPS mostró una disminución de la expresión de CD86 y CD83 con relación a la estimulación con LPS sólo, a diferencia de las células de controles sanos. También se evidenció una disminución en la producción de interleucina-12 en las células dendríticas de pacientes en relación a las de los controles. Conclusiones. La proteína KMP-11 no tiene un efecto significativo sobre la maduración de las células dendríticas, pero su péptido K1 en presencia de LPS induce una disminución en la expresión de CD86 y CD83 y en la producción de la interleucina-12 que podría modular la respuesta inmune in vivo y en particular la estimulación de los linfocitos T. Palabras clave: enfermedad de Chagas, interleucina-12, Trypanosoma cruzi Expression of markers on dendritic cells from chronic chagasic patients stimulated with the KMP-11 protein and the K1 peptide from Trypanosoma cruzi Introduction. The kinetoplastid membrane protein 11, KMP-11, from Trypanosoma cruzi elicits humoral and cellular immunity in mice that protects them from infection against further parasite challenge. Objective. To characterize the expression of surface markers on dendritic cells from chronic chagasic patients and healthy individuals, in response to the KMP-11 protein from Trypanosoma cruzi and its N-terminal peptide K1.

18

Biomédica 2007;27(supl. 1):18-27

Maduración de células dendríticas de pacientes chagásicos

Materials and methods. Monocyte-derived dendritic cells from seven chronic chagasic patients and seven healthy individuals were stimulated with the KMP-11 protein and the K1 peptide. Seven days after culturing, the CD83, CD86, and HLA-DR membrane expression as well as the production of cytokines were evaluated by flow cytometry. Results. Neither KMP-11 protein nor K1 peptide elicited the expression of the maturation marker CD83 on dendritic cells of patients or healthy control individuals. Dendritic cells from chronic chagasic patients exposed to K1 and LPS at the same time presented a significant reduction in CD86 and CD83 membrane expression in contrast to the cells exposed to LPS alone, whereas dendritic cells from healthy individuals did not show this behavior. The secretion of interleukin-12 was decreased in the cultures of dendritic cells from chronic chagasic patients but not from healthy controls. Conclusions. KMP-11 protein does not affect the maturation of dendritic cells, but in the presence of LPS the K1 peptide leads to a decreased expression of CD86 and CD83 as well as interleukin12 production, This phenomenon may be associated with an impaired T cell stimulation. Key words: Chagas disease, Interleukin-12, Trypanosoma cruzi

Las células dendríticas estimulan linfocitos T maduros que no han tenido contacto con el antígeno gracias a la alta expresión de moléculas del complejo mayor de histocompatibilidad, moléculas coestimuladoras como CD80 y CD86 y moléculas de adhesión como ICAM-1 e ICAM-3 (1). En la periferia, las células dendríticas se especializan para capturar antígenos por endocitosis mediada por receptor o macropinocitosis, y una vez activadas por antígenos, migran a los órganos linfoides proximales (2). Durante esta migración pierden capacidad fagocítica y aumentan la expresión de las moléculas relacionadas con la presentación antigénica, proceso conocido como maduración. Una vez en los órganos linfoides, las células dendríticas maduras tienen un papel importante en la instrucción de las células T para definir su polarización hacia una respuesta Th1 o Th2 (3).

La mayoría de humanos infectados por este parásito sobreviven a la fase aguda inicial, pero algunos desarrollan enfermedad crónica, lo cual indica que la respuesta generada en estos individuos no es capaz de controlar la infección, permitiendo la supervivencia del parásito en los tejidos y dando lugar al desarrollo de lesiones focales inflamatorias, características de la fase crónica de la enfermedad (6). Varias líneas de evidencia sugieren que la función de las células dendríticas es alterada por T. cruzi. Es así como células dendríticas derivadas de monocitos pueden ser infectadas por el parásito, permitiendo su multiplicación intracelular con consecuencias funcionales en células dendríticas inmaduras y alteración de su maduración inducida por el lipopolisacárido (LPS) (7). Estas alteraciones funcionales incluyen disminución de la producción de la interleucina-12 (IL-12), factor de necrosis tumoral α (TNFα) y de la expresión de moléculas de superficie tales como HLA-DR y CD40. También se ha visto que células dendríticas infectadas con T. cruzi tienen poca capacidad para presentar péptidos antigénicos a células T CD8+ y, por lo tanto, inducen bajos niveles de interferón gamma (IFNγ), efecto probablemente relacionado con la disminución en la expresión de moléculas de clase I del sistema mayor de histocompatibilidad (8). Aunque diferentes antígenos del parásito han sido caracterizados y examinados para estudiar su capacidad de estimulación de respuesta inmune, son pocos los que han demostrado capacidad para inducir respuesta protectora (9-11). Así, la proteína

Trypanosoma cruzi es un parásito protozoo hemoflagelado, agente causal de la enfermedad de Chagas, entidad que afecta a 18 millones de personas en 15 países endémicos, con una incidencia anual de 200.000 nuevos casos (4). En Colombia, se estima que hay cerca de 700.000 personas infectadas, un 23% de la población en riesgo de contraer la enfermedad y entre 30 y 40 mil nuevos casos anuales (5).
Correspondencia: Concepción Puerta Tel.:(+571) 3208320 ext 4024, Fax (571) 3208320, ext 4021 cpuerta@javeriana.edu.co Recibido: 19/08/05; aceptado: 27/12/05

19

Santander S.P., Cuéllar A., Thomas M.del C. et al

Biomédica 2007;27(supl. 1):18-27

11 de membrana de los cinetoplástidos, KMP-11, fusionada a la proteína de choque térmico HSP70 del parásito, induce tanto inmunidad humoral como celular en ratones y también es capaz de proteger a los animales inmunizados frente a un posterior reto con el parásito (9,12). Adicionalmente, el péptido correspondiente a los aminoácidos 4 a 12 de la región N-terminal de la proteína KMP-11 de T. cruzi, denominado K1, es un epítope inmunodominante en la inducción de respuesta citotóxica de células T CD8+ de ratones inmunizados con la proteína de fusión KMP-11/HSP70 (9). Así mismo, estudios recientes en pacientes chagásicos demuestran que el péptido K1 no sólo es reconocido y procesado de manera natural durante la infección, sino que induce la producción de IFNγ por parte de linfocitos T CD8+, los cuales presentan, además, actividad citotóxica (13). Teniendo en cuenta la importancia de las células dendríticas en la inducción de respuesta inmune y el papel de la proteína KMP-11 en la inducción de inmunidad protectora en los modelos estudiados, en el presente estudio se evaluó el potencial para inducir la maduración in vitro de células dendríticas derivadas de monocitos de pacientes chagásicos crónicos por parte de la proteína KMP-11 y el péptido K1 de T. cruzi. Materiales y métodos

Síntesis del péptido K1 y obtención de la proteína KMP-11
El péptido sintético K1 (TLEEFSAKL) de la proteína KMP-114-12 (9) fue sintetizado en fase sólida y purificado mediante cromatografía líquida de alta presión (HPLC) (14). La proteína recombinante KMP-11 se obtuvo de acuerdo con lo reportado previamente (15). Brevemente, el ADN correspondiente a la región codificante de la proteína fue digerido con las enzimas MscI y RsaI, subclonado en el vector de expresión pQE31 y expresado en células de Escherichia coli.

Obtención de células dendríticas derivadas de monocitos e inducción del proceso de maduración
A partir de 40 ml de sangre anticoagulada con heparina se obtuvieron células mononucleares de sangre periférica (CMSP) por gradientes de densidad con Ficoll-Hypaque (Sigma, St Louis, MO). Los monocitos fueron separados con anticuerpos monoclonales anti-CD14 (BD Pharmingen) acoplados a perlas magnéticas utilizando el sistema de MiniMaCs (Miltenyi Biotech GMBH, Bergisch, Gladbach, Germany). Las células obtenidas fueron lavadas en medio base RPMI 1640 (Invitrogen, Life Tecnologies, Carlsbad, CA) suplementado con 2% de suero fetal bovino (SFB, Sigma, St Louis, MO). La viabilidad y el número de las células se evaluaron por medio de coloración con azul de tripán y conteo celular en cámara de Newbauer, respectivamente. La pureza de la población se evaluó por citometría de flujo utilizando el anticuerpo anti-CD14.PE (BD Pharmingen). Las células CD14+ así obtenidas fueron diferenciadas a células dendríticas inmaduras mediante incubación en medio RPMI 1640 completo (antibióticos, aminoácidos no esenciales, piruvato de sodio y 10% de SFB) en placas de 48 pozos a una densidad de 5x105 por ml en presencia de 1.000 U/ml de IL-4 y 50 ng/ml de GM-CSF (R&D system) durante 5 días de cultivo, verificándose su morfología por microscopía de luz. En el día 5 se adicionaron 6 µg/ml de KMP11 en presencia o ausencia de 10 µg/ml de polimixina B durante 48 horas. Por otra parte, 10 µg/ml del péptido K1 fueron adicionados en presencia o ausencia de 1 µg/ml de LPS durante 48 horas. Cada ensayo se realizó por duplicado.

Población en estudio
Se seleccionaron siete pacientes con cardiomiopatía chagásica crónica, con edades comprendidas entre 35 y 85 años, que acudieron a la consulta de Cardiología del Hospital San Ignacio, Bogotá, Colombia. Dichos pacientes presentaron historia clínica, exámenes de diagnóstico clínico (electrocardiograma), prueba tamiz (Chagatek®) y pruebas confirmatorias (inmunofluorescencia indirecta y ELISA) compatibles con la enfermedad. Con el fin de comparar los resultados obtenidos, se incluyeron siete individuos controles sanos del mismo grupo de edad, que acudieron voluntariamente al Hospital San Ignacio, cuyas pruebas serológicas para T. cruzi fueron negativas y el examen clínico, normal. El presente estudio fue evaluado y aprobado por el Comité de Ética de la Facultad de Ciencias de la Pontificia Universidad Javeriana.

20

Biomédica 2007;27(supl. 1):18-27

Maduración de células dendríticas de pacientes chagásicos

Como control positivo de maduración se utilizó 1 µg/ml de LPS. Como control negativo, se cultivaron las células dendríticas inmaduras sin estímulo de maduración durante 7 días. La presencia de marcadores de células dendríticas maduras se evaluó por citometría de flujo (16). Todos los reactivos fueron probados para la presencia de LPS mediante la prueba de amebocitos de Lymulus spp. (Bio Whittaker).

Determinación de marcadores celulares por citometría de flujo
Los marcadores para células dendríticas se evaluaron con anticuerpos anti CD14-APC, CD83FITC, CD86-PE y HLA-DR-PerCP (BD Biosciences). La obtención de los datos se realizó usando un citómetro de flujo FACSCalibur (BD Immunocytometry Systems). Los análisis se realizaron con el programa Cell Quest.

marcadores de células dendríticas de pacientes con Chagas y controles sanos, se utilizaron células dendríticas diferenciadas a partir de monocitos de sangre periférica (células dendríticas inmaduras), las cuales fueron expuestas a la proteína KMP-11 en presencia o ausencia de polimixina B o al péptido K1 en presencia o ausencia de LPS. Aunque la prueba para detección de LPS en todos los reactivos utilizados fue negativa, se utilizó polimixina B en los cultivos expuestos a la proteína KMP-11 como inhibidor de la actividad de la endotoxina que pudiera estar presente en niveles no detectables por la prueba de amebocitos de Lymulus spp., con sensibilidad de 0,1 UE/ml. En todos los casos, la adición de IL-4 y GM-CSF a los monocitos de sangre periférica indujo la pérdida en la expresión de la molécula CD14, lo cual indica que los monocitos se diferenciaron a células dendríticas (datos no mostrados). Estas células expresaron CD86 y HLA-DR y la exposición al estímulo de maduración (LPS) indujo un aumento en su expresión, así como la expresión del marcador de maduración CD83, sin diferencia entre pacientes y controles sanos (figura 1).

Determinación de la producción de citocinas
La cuantificación de citocinas en los sobrenadantes de cultivo de las células dendríticas se realizó el día 7 con un estuche comercial de Cytometric Bead Array (CBA, BD Biosciences), en el cual se utilizan perlas de diferentes intensidades de fluorescencia en FL3, cubiertas con anticuerpos de captura fluorescentes en FL2 para IL-8, IL-1β, IL-6, IL-10, TNFα e IL- 12p70. El cálculo de la concentración se realizó utilizando patrones de las diferentes citocinas en concentraciones conocidas. La obtención de los datos se realizó usando un citómetro de flujo FACSCalibur (BD Immunocytometry Systems). Para la adquisición y análisis de los datos, se utilizó el programa Cell Quest.

Expresión de marcadores de células dendríticas expuestas a la proteína KMP-11
La exposición de células dendríticas inmaduras de pacientes a la proteína KMP-11 de T. cruzi indujo una disminución no significativa del marcador de coestimulación CD86 en comparación con los controles sanos (figura 2A). En cuanto a la expresión de HLA-DR, no se observaron diferencias de expresión tras la adición de la proteína KMP-11 en las células dendríticas inmaduras procedentes de pacientes chagásicos ni en las procedentes de controles sanos (figura 2A). La adición de polimixina B no originó modificación alguna del patrón de expresión observado. La adición de la proteína KMP-11 a células dendríticas inmaduras no indujo la expresión del marcador de maduración CD83.

Análisis de los resultados
Los resultados se muestran como el promedio y el error estándar de la media. Para establecer diferencias significativas, se utilizó la prueba no paramétrica U de Mann-Withney con un nivel de significación de 0,05. Resultados El aislamiento de monocitos de sangre periférica por selección positiva permitió obtener poblaciones de células CD14+ con purezas mayores al 92%. Con el fin de evaluar el efecto de la proteína KMP11 y el péptido K1 sobre la expresión de

Expresión de marcadores de células dendríticas expuestas al péptido K1
Al igual que lo observado para la proteína KMP11, la adición del péptido K1 a células dendríticas

21

Santander S.P., Cuéllar A., Thomas M.del C. et al

Biomédica 2007;27(supl. 1):18-27

Figura 1. Expresión de marcadores en células dendríticas de 7 pacientes chagásicos (gris) y 7 controles sanos (blanco) expuestas a LPS. Células dendríticas inmaduras (CDi) fueron diferenciadas a partir de monocitos CD14+ en presencia de IL-4 y GM-CSF durante cinco días de cultivo. Para la obtención de células dendríticas maduras (CDm), las CDi previamente obtenidas fueron expuestas durante 48 h a LPS. Los datos se muestran como promedio del porcentaje de células que expresan los distintos marcadores analizados. Las barras sobre las columnas indican el error estándar de la media (ESM). La significancia estadística de la diferencia de la expresión de los marcadores entre CDi y CDm fue de p = 0,007 para CD86 y CD83 en células de pacientes y controles, p = 0,02 para HLA-DR en las células de los pacientes y p = 0,007 en las de los controles.

Figura 2. Expresión de marcadores en células dendríticas inmaduras de 7 pacientes chagásicos (gris) y 7 controles sanos (blanco) estimuladas con la proteína KMP-11 (A) y el péptido K1 (B) el día 5 de cultivo durante 48 h. Los datos se muestran como promedio del porcentaje de células que expresan los distintos marcadores analizados. Las barras sobre las columnas indican el error estándar de la media (ESM).

de pacientes chagásicos y controles sanos no indujo la expresión del marcador de maduración CD83. La adición del péptido K1 a células dendríticas inmaduras indujo en las células de los pacientes chagásicos un incremento estadísticamente no significativo en la expresión de CD86 y HLA-DR comparado con los niveles observados en controles sanos (figura 2B). Con el propósito de evaluar el efecto del péptido K1 en la maduración de células dendríticas inducida por la adición de LPS, se expusieron células dendríticas inmaduras simultáneamente al péptido K1 y a LPS en el día 5 de cultivo. Los resultados obtenidos mostraron que la adición del péptido K1 dio lugar a una disminución estadísticamente significativa en la expresión de

las moléculas CD86 (p = 0,004) y CD83 (p = 0,003) frente a la que mostraron las células dendríticas incubadas únicamente con LPS (figuras 3A y 3B). Sin embargo, los resultados obtenidos no mostraron diferencias en la expresión de HLA-DR en las células de pacientes o individuos sanos incubadas con K1 y LPS con respecto a lo observado en células dendríticas expuestas únicamente a LPS (figura 3C).

Determinación de las citocinas secretadas por las células dendríticas
Con el fin de evaluar la actividad funcional de las células dendríticas frente a los diferentes estímulos, se procedió a cuantificar la producción de varias citocinas (IL-1β, TNF-α, IL-6, IL-8, IL10 e IL-12) en el sobrenadante de los cultivos. Al

22

Biomédica 2007;27(supl. 1):18-27

Maduración de células dendríticas de pacientes chagásicos

comparar las células dendríticas de pacientes y controles en presencia de LPS con o sin el péptido K1, no se observaron diferencias significativas en la producción de citocinas. Sin embargo, los resultados mostraron un descenso estadísticamente significativo (p = 0,02) en la secreción de IL-12 por parte de las células dendríticas de pacientes chagásicos expuestas al péptido K1 y LPS comparado con las células dendríticas de controles sanos igualmente tratadas (figura 4A). Además, se observó un aumento estadísticamente no significativo en la secreción de IL-10 por parte de las mencionadas células dendríticas de los pacientes chagásicos en comparación a los niveles observados en las células de controles sanos (figura 4B). No se observaron diferencias en los niveles de las citocinas IL-1β, TNF-α, IL-6 e IL-8 de las células dendríticas de pacientes chagásicos versus las de controles sanos tratadas ambas con K1 y LPS (datos no mostrados). Discusión Las células dendríticas regulan la respuesta inmune local y sistémica mediante la expresión

de moléculas en su superficie y de moléculas secretadas que generan señales que influencian el crecimiento, la muerte y la diferenciación de la célula T (17,18). Las células dendríticas tienen la capacidad de inducir la polarización de la respuesta linfoide hacia Th1 o Th2, dependiendo del patrón de moléculas que expresen o secreten. Por ejemplo, la secreción de IL-12 por células dendríticas induce la generación de células T de tipo Th1 (19,20). Además de su papel inductor de la respuesta linfoide, recientemente han surgido algunas líneas de evidencia que sugieren que las células dendríticas pueden tener un papel regulador en la inducción de tolerancia periférica. Es así como se ha mostrado que células dendríticas en estado inmaduro o semimaduro pueden inducir la activación de células T reguladoras (21). En el caso de la respuesta inmune a agentes infecciosos es de particular interés el hecho de que algunos patógenos pueden inducir la generación de células dendríticas reguladoras que inhiben la inducción de respuesta inmune efectiva, lo cual se relaciona con estrategias de evasión

Figura 3. Expresión de marcadores en células dendríticas maduras de 7 pacientes (gris) y 7 controles sanos (blanco) estimuladas con LPS o el péptido K1 y LPS (K1+LPS) el día 5 de cultivo durante 48 h. Los datos se muestran como promedio del porcentaje de células que expresan los distintos marcadores analizados. Las barras sobre las columnas indican el error estándar de la media (ESM). La significación estadística de la diferencia de la expresión de los marcadores entre células dendríticas de pacientes estimuladas con LPS o K1+LPS fue de p = 0,004 para CD86 y p = 0,03 para CD83.

23

Santander S.P., Cuéllar A., Thomas M.del C. et al

Biomédica 2007;27(supl. 1):18-27

Figura 4. Cuantificación de citocinas por citometría de flujo de células dendríticas de 7 pacientes (gris) y 7 controles sanos (blanco) expuestas a LPS o al péptido K1 y LPS (K1+LPS) el día 5 de cultivo durante 48 h. Los datos se muestran como promedio del porcentaje de células que expresan los distintos marcadores analizados. Las barras sobre las columnas indican el error estándar de la media (ESM). La significación estadística de la diferencia de la producción de IL-12 e IL 10 entre las células dendríticas de pacientes y controles estimuladas con K1 y LPS fue de p = 0,02 y p>0,05, repectivamente.

de la respuesta inmune por estos agentes y explica en parte la cronicidad de algunas enfermedades infecciosas (22,23). Los estudios sobre la interacción de las células dendríticas y T. cruzi muestran que el parásito puede infectar dichas células y multiplicarse en su interior alterando el programa de maduración de la célula dendrítica mediante la inhibición de la producción de citocinas, disminución de moléculas coestimuladoras (7), disminución de la expresión de moléculas de clase I y, por lo tanto, alteración de la capacidad para presentar péptidos antigénicos a linfocitos T CD8+ (8). Algunas moléculas, como los glicoinositolfosfolípidos (GIPL), han sido relacionadas con esta hiporreactividad inmune del parásito (24). Sin embargo, otras moléculas como la proteína Tc52, que es una oxidorreductasa necesaria para la supervivencia y la virulencia del parásito, induce maduración de células dendríticas derivadas de monocitos y protege ratones in vivo frente a una infección letal con T. cruzi (25), lo cual indica que aunque la infección de la célula dendrítica por T. cruzi altera su actividad en términos de estimulación de células T, algunas moléculas derivadas de éste podrían considerarse como buenos candidatos para la generación de vacunas específicas contra el parásito. La proteína 11 de membrana de cinetoplástidos (KMP-11) fue descrita en Leishmania donovani asociada al lipofosfoglicano (LPG) (26), localizada en el bolsillo flagelar y asociada al citoesqueleto;

esta proteína se considera una estructura crítica para la movilidad del parásito y para su unión a la célula hospedera (27,28). La presencia de la KMP11 ha sido demostrada en varias especies de leishmanias y tripanosomas, y no ha sido descrita en otros organismos diferentes a los cinetoplástidos, lo cual respalda el concepto de un rol específico en estos parásitos (28). Con base en los estudios que demuestran la importancia de la proteína KMP-11 y de su péptido K1 en la respuesta inmune frente a la infección (9,12,13,15), en este trabajo se evaluó la expresión de marcadores de maduración en células dendríticas derivadas de monocitos de pacientes chagásicos crónicos e individuos sanos estimuladas con la proteína KMP-11 y el péptido K1 de T. cruzi. Vale la pena anotar que estudios preliminares realizados por nuestro grupo indican que el péptido K1 induce una respuesta inmune humoral específica en pacientes infectados independientemente de su tipo de HLA (29), a pesar de haber sido reportado como un epítope restringido al HLA-A*0201 en trabajos previos (9,13). Los resultados obtenidos en este estudio muestran que si bien la proteína KMP-11 no induce la maduración de células dendríticas, su péptido amino terminal K1 en presencia de LPS se asocia con una menor expresión de los marcadores CD83 y CD86 en las células dendríticas de los pacientes. Por otra parte, la respuesta in vitro frente al péptido K1 en presencia de LPS muestra niveles

24

Biomédica 2007;27(supl. 1):18-27

Maduración de células dendríticas de pacientes chagásicos

significativamente inferiores en la producción de IL-12 por las células dendríticas de los pacientes. Estos resultados sugieren que K1 en presencia de LPS tiene un efecto en el programa de maduración de las células dendríticas que es característico de pacientes chagásicos, el cual podría afectar la estimulación de los linfocitos T, así como también interferir con la polarización hacia una respuesta Th1, la cual se ha visto que es crucial para el control de la infección por T. cruzi, al menos en los modelos murinos (30-32). Una posible explicación a esta disminución en la expresión de marcadores de membrana podría deberse a un efecto tóxico de la proteína o del péptido sobre las células. Sin embargo, el hecho de encontrar disminución en la expresión de las moléculas mencionadas en las células de los pacientes chagásicos y no en las de los controles sanos parece indicar que éste no es el caso. Además, el efecto de K1 y LPS se observa para la expresión de CD86 y CD83, mientras que la expresión de HLA-DR no se ve afectada. Si bien el papel de antígenos específicos parasitarios en la maduración de células dendríticas murinas ha sido descrito previamente, como es el caso de la proteína HSP70 de T. cruzi (33), este es el primer reporte que involucra a un péptido sintético derivado de una proteína del parásito en esta modulación. El mecanismo molecular mediante el cual K1 ejerce su acción es desconocido; sin embargo, llama la atención que otros péptidos derivados de patógenos tales como el péptido sintético T20 del virus de inmunodeficiencia adquirida 1 (HIV-1) y el péptido Hp(2-20) de Helicobacter pylori inhiben la producción de IL-12 por parte de monocitos humanos (34,35). Se ha visto que estos péptidos son agonistas de la familia de receptores FPR (formyl peptide receptor) (36-38). Así mismo, el péptido sintético WKYMVm, agonista de FPR y FPRL2, inhibe tanto la maduración de células dendríticas humanas como la producción de IL12 de las mismas (35). Adicionalmente, también se ha encontrado que el LPS es capaz de aumentar la expresión de FPR y FPRL1 en macrófagos y neutrófilos de ratones (39). Por lo tanto, es de especial interés investigar si K1 en

presencia de LPS, es capaz de interactuar con estos receptores, desencadenando una disminución en la producción de IL-12. El hecho de que el efecto de K1 en presencia de LPS sólo se observe en pacientes infectados y no en individuos sanos llama la atención por cuanto las células dendríticas hacen parte de la respuesta inmune innata y sugiere que de alguna manera el contacto previo con el parásito o algunas de sus moléculas alteraría el programa de maduración de tales células. Por otra parte, es posible que la diferencia en el comportamiento del péptido K1 en presencia de LPS y de la proteína KMP-11 se deba esencialmente a la diferencia estructural y antigénica entre las dos moléculas, lo que conllevaría a la activación de distintas vías de la respuesta inmune. Queda por determinar si el sistema de estimulación descrito en este trabajo es reproducible en pacientes infectados asintomáticos para poder llegar a conclusiones sobre el papel del péptido K1 en la modulación de la respuesta inmune específica in vivo. Conflicto de intereses Los autores manifestamos expresamente que durante la realización del presente trabajo no existió conflicto de interés alguno que pudiera afectar los resultados obtenidos. Agradecimientos Los autores expresan su agradecimiento a Miguel Vacca del Hospital Universitario San Ignacio, PUJB, a Rubén Santiago Nicholls, a Marleny Montilla y Astrid C. Flórez del Laboratorio de Parasitología del Instituto Nacional de Salud y a Marcela Mercado del Grupo de Enfermedades Infecciosas, PUJB, por su colaboración en la evaluación clínica de los pacientes y la realización de las pruebas de laboratorio IFI, ELISA y Chagatek®, respectivamente. Financiación Este estudio fue financiado por la Vicerrectoria Académica de la Pontificia Universidad Javeriana. Registro de proyecto 1767.

25

Santander S.P., Cuéllar A., Thomas M.del C. et al

Biomédica 2007;27(supl. 1):18-27

Referencias
1. Revy P, Sosperda M, Barbour B, Trautmann A. Functional antigen-independent synapses formed between T cells and dendritic cells. Nat Immunol 2001;2:925-31. 2. Russo V, Tanzarella S, Dalerba P, Rigatti D, Rovere P, Villa A, et al. Dendritic cells acquire the MAGE-3 human tumor antigen from apoptotic cells and induce a class I restricted T cell response. Proc Natl Acad Sci USA 2000;97:2185-90. 3. Lanzavecchia A, Sallusto F. The instructive role of dendritic cells on T cell responses: lineages, plasticity and kinetics. Curr Opin Immunol 2001;13:291-8. 4. World Health Organization. Control of Chagas disease. Second report of the WHO Expert Committee, Technical Report 2002, Series 905. Geneva: WHO; 2002. p.39-40. 5. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the Southern Cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 6. Tanowitz HB, Kirchhoff LV, Simon D, Morris SA, Weiss LM, Wittner M. Chagas’ disease. Clin Microbiol Rev 1992;5:400-19. 7. Van Overtvelt L, Vanderheyde N, Verhasselt V, Ismaili J, De Vos L, Goldman M, et al. Trypanosoma cruzi infects human dendritic cells and prevents their maturation: inhibition of cytokines, HLA-DR, and costimulatory molecules. Infect Immun 1999;67:4033-40. 8. Van Overtvelt L, Andrieu M, Verhasselt V, Connan F, Choppin J, Vercruysse V, et al. Trypanosoma cruzi down-regulates lipopolysaccharide-induced MHC class I on human dendritic cells and impairs antigen presentation to specific CD8(+) T lymphocytes. Int Immunol 2002;14:1135-44. 9. Marañon C, Thomas MC, Planelles L, Lopez MC. The immunization of A2/K(b) transgenic mice with the KMP-11-HSP70 fusion protein induces CTL response against human cells expressing the T. cruzi KMP-11 antigen: Identification of A2-restricted epitopes. Mol Immunol 2001;38:279-87. 10. Rodrigues MM, Ribeirao M, Pereira-Chioccola V, Renia L, Costa F. Predominance of CD4 Th1 and CD8 Tc1 cells revealed by characterization of the cellular immune response generated by immunization with a DNA vaccine containing a Trypanosoma cruzi gene. Infect Immun 1999;67:3855-63. 11. Villalta F, Lima MF, Howard SA, Zhou L, Ruíz-Ruano A. Purification of a Trypanosoma cruzi trypomastigote 60-Kilodalton surface glycoprotein that primes and activates murine lymphocytes. Infect Immun 1992;60:3025-32. 12. Planelles L, Thomas MC, Alonso C, Lopez MC. DNA immunization with Trypanosoma cruzi HSP70 fused to

the KMP-11 protein elicits a cytotoxic and humoral immune response against the antigen and leads to protection. Infect Immun 2001;69:6558-63. 13. Diez H, López MC, Thomas MC, Guzman F, Rosas F, Velazco V. et al. Evaluation of IFNg production by CD8+ T lymphocytes in response to the K1 peptide from KMP-11 protein in patients infected with Trypanosoma cruzi. Parasite Immunol 2006;28:101-5. 14. Chaves F, Calvo JC, Carvajal C, Rivera Z, Ramirez L, Pinto M, et al. Synthesis, isolation and characterization of Plasmodium falciparum antigenic tetrabranched peptide dendrimers obtained by thiazolidine linkages. J Pept Res 2001;58:307-16. 15. Thomas MC, Longobardo MV, Carmelo E, Maranon C, Planelles L, Patarroyo ME, et al. Mapping of the antigenic determinants of the T. cruzi kinetoplastid membrane protein-11. Identification of a linear epitope specifically recognized by human Chagasic sera. Clin Exp Immunol 2001;123:465-71. 16. Cuéllar A, Fonseca A, Gómez A. Efecto del lipopolisacárido en cultivos de células dendríticas humanas y su inhibición por la polimixina B. Biomédica 2004;24:413-22. 17. Modlin RL, Brightbill HD, Godowski PJ. The toll of innate immunity on microbial pathogens. N Engl J Med 1999;340:1834-5. 18. Lanzavecchia A, Sallusto F. Dynamics of T lymphocyte responses: intermediates, effectors, and memory cells. Science 2000;290:92-7. 19. Moser M, Murphy KM. Dendritic cell regulation of TH1TH2 development. Nat Immunol 2000;1:199-205. 20. Pearce EJ, Kane CM, Sun J. Regulation of dendritic cell function by pathogen-derived molecules plays a key role in dictating the outcome of the adaptive immune response. Chem Immunol Allergy 2006;90:82-90. 21. Lutz MB, Schuler G. Immature, semi-mature and fully mature dendritic cells: which signals induce tolerance or immunity? Trends Immunol 2002;23:445-9. 22. Smits HH, Engering A, van der Kleij D, De Jong EC, Schipper K, van Capel TM, et al. Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin. J Allergy Clin Immunol 2005;115:1260-7. 23. Auffermann-Gretzinger S, Keeffe EB, Levy S. Impaired dendritic cell maturation in patients with chronic, but not resolved, hepatitis C virus infection. Blood 2001;97:3171-6. 24. Brodskyn C, Patricio J, Oliveira R, Lobo L, Arnholdt A, Mendonca-Previato L, et al. Glycoinositolphospholipids from Trypanosoma cruzi interfere with macrophages and dendritic cell responses. Infect Immun 2002;70:3736-43.

26

Biomédica 2007;27(supl. 1):18-27

Maduración de células dendríticas de pacientes chagásicos

25.Ouaissi A, Guilvard E, Delneste Y, Caron G, Magistrelli G, Herbault N, et al. The Trypanosoma cruzi Tc52-released protein induces human dendritic cell maturation, signals via toll-like receptor 2, and confers protection against lethal infection. J Immunol 2002;168:6366-74. 26. Jardim A, Hanson S, Ullman B, McCubbin WD, Kay CM, Olafson RW. Cloning and structure-function analysis of the Leishmania donovanni kinetoplastid membrane protein-11. Biochem J 1995;305:315-20. 27. Thomas MC, García-Pérez JL, Alonso C, López MC. Molecular characterization of KMP-11 from Trypanosoma cruzi: a cytoskeleton-associated protein regulated at the translational level. DNA Cell Biol 2000;19:47-57. 28. Stebeck CE, Baron GS, Beecroft RP, Pearson TW. Molecular characterization of the kinetoplastid membrane protein-11 from African trypanosomes. Mol Biochem Parasitol 1996;81:81-8. 29. Diez H, López MC, Thomas MC, Guzman F, Rosas F, Velasco V, et al. Respuesta inmune al péptido K1 en pacientes infectados con Trypanosoma cruzi . Parasitol Latin 2005;60:208. 30. Hoft DF, Eickhoff CS. Type 1 immunity provides optimal protection against both mucosal and systemic Trypanosoma cruzi challenges. Infect Immun 2002;70:6715-25. 31. Kumar S, Tarleton RL. Antigen-specific Th1 but not Th2 cells provide protection from lethal Trypanosoma cruzi infection in mice. J Immunol 2001;166:4596-603. 32. Planelles L, Thomas MC, Marañon C, Morell M, López MC. Differential CD86 and CD40 co-stimulatory molecules and cytokine expression pattern induced by Trypanosoma cruzi in APCs from resistant or susceptible mice. Clin Exp Immunol 2003;131:41-7.

33. Planelles L, Thomas M, Pulgar M, Marañon C, Grabbe S, López MC. Trypanosoma cruzi heat-shock protein-70 kDa, alone or fused to the parasite KMP-11 antigen, induces functional maturation of murine dendritic cells. Immunol Cell Biol 2002;80:241-7. 34. Braun MC, Wang JM, Lahey E, Rabin RL, Kelsall BL. Activation of the formyl peptide receptor by the HIV-derived peptide T-20 suppresses interleukin-12 p70 production by human monocytes. Blood 2001;97: 3531-6. 35. Kang HK, Lee HY, Kim MK, Park KS, Park YM, Kwak JY, et al. The synthetic peptide Trp-Lys-Tyr-Met-ValD-Met inhibits human monocyte-derived dendritic cell maturation via formyl peptide receptor and formyl peptide receptor-like 2. J Immunol 2005;175:685-92. 36. Betten A, Bylund J, Cristophe T, Boulay F, Romero A, Hellstrand K, et al. A proinflammatory peptide from Helicobacter pylori activates monocytes to induce lymphocyte dysfunction and apoptosis. J Clin Invest 2001;108:1221-8. 37. Hartt JK, Liang T, Sahagun-Ruiz A, Wang JM, Gao JL, Murphy PM. The HIV-1 cell entry inhibitor T-20 potently chemoattracts neutrophils by specifically activating the N-formylpeptide receptor. Biochem Biophys Res Commun 2000;272:699-704. 38. Bylund J, Christophe T, Boulay F, Nystrom T, Karlsson A, Dahlgren C. Proinflammatory activity of a cecropin-like antibacterial peptide from Helicobacter pylori. Antimicrob Agents Chemother 2001;45:1700-4. 39. Mandal P, Novotny M, Hamilton TA. Lipopolysaccharide induces formyl peptide receptor 1 gene expression in macrophages and neutrophils via transcriptional and posttranscriptional mechanisms. J Immunol 2005;175:6085-91.

27

López D.C., Jaramillo C., Guhl F. Biomédica 2007;27(supl. 1):28-39

Biomédica 2007;27(supl. 1):28-39

ARTÍCULO ORIGINAL

Estructura poblacional y variabilidad genética de Rhodnius prolixus (Hemiptera: Reduviidae) procedente de diferentes áreas geográficas de Colombia
Diana Carolina López, Carlos Jaramillo, Felipe Guhl
Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT), Facultad de Ciencias, Universidad de los Andes, Bogotá D.C., Colombia.

Introducción. Rhodnius prolixus es el vector más importante de la enfermedad de Chagas en Colombia. La caracterización genética de esta especie resulta útil para comprender su potencial de dispersión. La distribución del vector y la estructura genética de sus poblaciones, son factores importantes para implementar de manera adecuada las estrategias de control y vigilancia epidemiológica de la enfermedad de Chagas. Objetivo. Establecer relaciones genéticas entre poblaciones de R. prolixus capturadas en diferentes hábitat y áreas geográficas de Colombia, para dilucidar la estructura genética y dispersión del vector en el territorio colombiano. Materiales y métodos. Se analizaron tres poblaciones domiciliadas de R. prolixus provenientes de Tolima, Cundinamarca y la Sierra Nevada de Santa Marta; y una población silvestre procedente de Casanare. Se emplearon dos técnicas moleculares para evaluar la estructura genética de las poblaciones: análisis del ITS-2 del ADN ribosomal por PCR/RFLP y RAPDs. Resultados. R. prolixus presenta variabilidad genética moderada (Fst 0,057-0,15), entre las poblaciones domiciliadas se encontraron tasas de migración (Nm>1) que revelan flujo genético. Se encontró diferenciación genética de moderada-alta entre la población silvestre de Casanare y las poblaciones domésticas del centro del país (Tolima y Cundinamarca). Conclusión. Las poblaciones domiciliadas de R. prolixus son homogéneas debido a que existe flujo genético entre éstas; lo cual es favorable para el control químico, mientras que la población silvestre agrupa aparte de las domiciliadas. Se evidencia la necesidad de estudiar la estructura genética de los focos silvestres, sus posibles rutas de dispersión y el riesgo epidemiológico que representan. Palabras clave: enfermedad de Chagas, vigilancia epidemiológica, control vectorial, Rhodnius, ADN espaciador ribosomal, reacción en cadena de la polimerasa, polimorfismo de longitud del fragmento de restricción, técnica del ADN polimorfo amplificado aleatorio. Population structure and genetic variability of Rhodnius prolixus (Hemiptera: Reduviidae) from different geographic areas of Colombia. Introduction. Rhodnius prolixus is the most important vector of Chagas disease in Colombia. Genetic characterization of this species is useful to understand its potential of dispersion. The distribution of the vector and the genetic population structure are important factors for the adequate implementation of control programs and epidemiological surveillance of Chagas disease. Objective. Genetic relationships were established for populations of R. prolixus collected from several habitat types and representative geographic areas of Colombia. A second aim was to assess its population genetic structure and dispersion across Colombia. Materials and methods. Genetic comparisons were made from three domestic populations of R. prolixus from (1) Tolima Province, (2) Cundinamarca Province and (3) the Sierra Nevada of Santa Marta in northern Colombia, and (4) one sylvatic population from Casanare. Two molecular techniques were used to evaluate the genetic structure of these populations—analysis of the ITS-2 of ribosomal DNA by PCR/RFLP and RAPDs.

28

Biomédica 2007;27(supl. 1):28-39

Estructura poblacional de R. prolixus en Colombia

Results. Rhodnius prolixus shows a moderate genetic variability (Fst 0.06–0.15). Among domestic populations, the migration rates found were adequate (Nm>1) to maintain gene flow. A moderate to large degree of genetic differentiation was observed between the sylvatic population from Casanare and the domestic populations from the centre of the country (Tolima and Cundinamarca). Conclusion. The domestic populations of R. prolixus are homogeneous because genetic flow exists between them, and this is favourable to chemical control, while the sylvatic population clusters apart from the domestic populations. Hence the need to study the genetic structure of the sylvatic foci, their possible dispersion routes and the epidemiological risk that they represents. Key words. Chagas disease, epidemiologic surveillance, vector control, Rhodnius, DNA, ribosomal spacer, polymerase chain reaction, polymorphism, restriction fragment length, random amplified polymorphic DNA technique.

La enfermedad de Chagas, exclusiva del continente americano, se extiende desde México hasta Argentina y es considerada una de las enfermedades parasitarias de mayor impacto social y económico (1). En Colombia constituye un problema de salud pública importante; se estima que la prevalencia de la infección en la población es del 5% y que existen alrededor de 3,5 millones de personas en riesgo de adquirir la enfermedad, dependiendo de la distribución geográfica de los insectos vectores (Hemiptera: Reduviidae) capaces de transmitir el parásito Trypanosoma cruzi (2). El vector más importante de la enfermedad de Chagas en Colombia, al igual que en Venezuela y Centro América, es Rhodnius prolixus, debido a su amplia distribución geográfica, sus hábitos domiciliarios, su alta frecuencia de dispersión y buena capacidad para infectarse y transmitir el parásito. Estudios recientes reportan la presencia de R. prolixus silvestre en el departamento de Casanare en plantaciones agroindustriales de palma africana ( Elaeis guineensis ) y palma nativa ( Attalea butyracea), con índices de infestación del 46,6 y 100% e índices de infección de 41,17 y 67,18%, respectivamente (Guhl et al., Primer reporte de Rhodnius prolixus Stal, en Elaeis guineensis I,
Correspondencia: Felipe Guhl, CIMPAT, Departamento de Ciencias Biológicas, Universidad de los Andes, bloque A, oficina 201. A.A. 4976. Carrera 1ª N° 18A -10, Bogotá, Colombia. Tel/Fax: +57 1 3324540. fguhl@uniandes.edu.co Recibido: 16/12/05; aceptado: 14/03/06

variedad Papúa, en plantaciones agroindustriales de Villanueva, Casanare (Pinto et al., Comprobación del ciclo silvestre de Rhodnius prolixus Stal en reductos de Attalea butyracea, en el departamento del Casanare. En: Memorias del XII Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2005;25(Suppl I):158-9). Reportes anteriores describen poblaciones silvestres de R. prolixus en 13 especies de palmas en Venezuela (3). La caracterización genética del vector con base en el análisis de especímenes domiciliados y silvestres provenientes de diferentes áreas del territorio colombiano resulta importante para comprender su distribución geográfica, potencial de dispersión y flujo genético, aspectos importantes en la endemicidad de la enfermedad de Chagas en las zonas donde se puede llevar a cabo la transmisión vectorial de T. cruzi. Diversas técnicas moleculares como la amplificación aleatoria de ADN polimorfo (RAPD, por sus siglas en inglés), la secuenciación de genes mitocondriales, microsatélites, y el análisis de genes y espaciadores ribosomales se han utilizado ampliamente en el estudio de la estructura genética de varias especies de triatominos para resolver relaciones filogenéticas y evolutivas entre especies, complejos de especies e incluso para la caracterización de poblaciones de una misma especie (4-7). Algunas regiones del ADN ribosomal (rADN) han demostrado ser importantes marcadores moleculares en estudios sistemáticos y filogenéticos de triatominos, debido a que presentan secuencias microsatélites útiles para

29

López D.C., Jaramillo C., Guhl F.

Biomédica 2007;27(supl. 1):28-39

la caracterización de poblaciones (8-10). El análisis de estas regiones mediante la reacción en cadena de la polimerasa (PCR) en búsqueda de polimorfismos de longitud y polimorfismos de fragmentos de restricción (RFLP) ha probado que son eficientes en la diferenciación de especies de Anopheles sp y cepas de Angiostrongylus sp (11). Los RAPDs se basan en la amplificación al azar de segmentos de ADN en búsqueda de polimorfismos, para así determinar relaciones genéticas entre individuos de una población o entre diferentes poblaciones. Esta técnica se ha utilizado para análisis de la estructura poblacional de varias especies de triatominos como Triatoma dimidiata, T. brasiliensis, R. prolixus, entre otras, permitiendo estimar el flujo genético entre poblaciones silvestres y domésticas de estos vectores (12-14). En este estudio se empleó la técnica RAPD y se analizó el espaciador interno transcrito2 (ITS-2) del rADN por PCR/RFLP con el propósito de evaluar la variabilidad intra-específica de R. prolixus a partir de cuatro poblaciones colombianas y determinar posibles relaciones genéticas entre ellas.

Materiales y métodos

Insectos
Se analizaron en total 48 insectos adultos R. prolixus, 12 por población (seis hembras y seis machos). Las poblaciones domiciliadas fueron capturadas en tres áreas geográficas endémicas para la enfermedad de Chagas en Colombia: en los municipios de Fomeque y Ubaque en Cundinamarca, en el municipio de Coyaima, Tolima, en el asentamiento indígena Kasakumake en la Sierra Nevada de Santa Marta, y en Dibuya, La Guajira; la población silvestre fue capturada en dos lotes de cultivos agroindustriales de palma de aceite (Elaeis guineensis) en el municipio de Villanueva, Casanare (figura 1). Adicionalmente, se incluyó un espécimen de R. prolixus domiciliado de Maracaibo, Venezuela, para compararlo con las poblaciones colombianas. Como grupos de exclusión se usaron un ejemplar de R. pallescens procedente de Vegachí, Antioquia, uno de R. colombiensis procedente de Totarco, Tolima, y un individuo T. dimidiata de Soatá, Boyacá. Todos los insectos utilizados en el estudio fueron clasificados siguiendo las claves de Lent & Wygodzinsky (15).

Figura 1. Ubicación geográfica de los sitios de captura de las poblaciones domiciliadas y silvestre de R. prolixus.

30

Biomédica 2007;27(supl. 1):28-39

Estructura poblacional de R. prolixus en Colombia

Extracción del ADN
El ADN se obtuvo a partir de las seis patas de cada insecto, que fueron retiradas y conservadas en alcohol en un tubo plástico de 1,5 ml. Las patas se lavaron con hipoclorito 1:50 y etanol al 70% para evitar la contaminación con ADN foráneo. Se empleó el estuche de extracción AquaPure Genomic de BIORAD®. El ADN fue almacenado a -20°C.

Cuantificación del ADN
La concentración de ADN se determinó por espectrofotometría (barrido de 234 a 320 nm). Se cuantificó el ADN extraído (15 µg/ml en promedio) y el ADN de los productos de PCR (329 µg/ml en promedio) para los protocolos de restricción enzimática.

Amplificación del ITS-2 por PCR
Se emplearon los iniciadores 5,8T (5-CTA AGC GGT GGA TCA CTC GG-3) y 28 T (5-GCA CTA TCA AGC AAC ACG ACT C-3) (10), que amplifican un fragmento de 127 pb del gen 5,8S, el ITS-2 completo y un fragmento de 350 pb del gen 28S. Se usó el estuche PCR Ready to go de Pharmacia®; cada perla fue hidratada con 15,25 µl de agua destilada estéril, se adicionó 1 pmol de cada iniciador y 3,75 µl de MgCl2 (10 mM), así como 5 µl del ADN molde (15 ng/µl), para un volumen final de 25 µl. En todas las reacciones se incluyó un blanco de reacción sin ADN. El perfil térmico usado fue el descrito por Jaramillo et al. (13). La electroforesis se realizó en geles de agarosa al 1,5%; en cada pozo se sembraron 6 ml de muestra previamente mezclada con 2 ml de buffer de carga. Los geles se corrieron 100 minutos a 70 voltios y luego fueron digitalizados en un documentador de geles CHEMI-DOC SYSTEM y analizados con el software Quantity One 1D de BIORAD®.

reconocimiento de 4 a 6 nucleótidos. La digestión de los productos de PCR se realizó por separado con las enzimas Rsa I, Nhe I, Dde I y Hpy 188 I. La enzima Rsa I tiene un sitio de corte sobre el ITS-2 de R. prolixus en la secuencia de reconocimiento GTνAC; la enzima Nhe I tiene un sitio de corte sobre la secuencia G νCTAG ? C del ITS-2 de R. prolixus; Dde I realiza dos cortes en el fragmento del rADN amplificado, uno sobre el gen 5,8S y el otro sobre el gen 28S de R. prolixus , en la secuencia de reconocimiento C?TNA?G; la enzima Hpy 188 I presenta dos sitios de corte sobre el fragmento del rADN de R. prolixus en la secuencia TC?N?GA. En las restricciones se siguió el protocolo sugerido por Promega®: en un tubo plástico estéril de 1,5 ml se mezcló agua destilada estéril, 2 ml del buffer de la enzima (10X) y 0,4 ml de BSA acetilada (5 mg/µl) (únicamente para las digestiones con Rsa I y Nhe I); se adicionaron 3,5 µl ADN (0,3 µg/µl) y cinco unidades de enzima (10 U/µl) para un volumen final de 20 µl. La digestión se realizó a 37°C durante 3 a 4 horas. Los patrones de restricción se visualizaron en geles de agarosa al 1,5 o 2%, dependiendo del tamaño de los fragmentos obtenidos. El producto se mezcló con 4µl de buffer de carga 6X y se sembraron 10 µl en cada pozo. La electroforesis, la digitalización de los geles y el cálculo del peso de los fragmentos se realizaron tal como se describió para los productos de PCR. Como controles experimentales, paralelos a los ensayos de restricción, se usaron el ADN no digerido y la reacción de restricción sin enzima.

RAPD
Se usó el estuche Ready To Go RAPD y los iniciadores RTG 2 (5 -GTTTCGCTCC-3) ,3 (5 GTAGACCCGT-3) y 4 (5-AAGAGCCCGT-3) de Pharmacia®; cada perla se hidrató con 19 µl de agua destilada y se agregaron 5 µl de iniciador (25 pmol) y posteriormente se adicionaron 4 µl del ADN molde (15 ng/µl) para un volumen final de reacción de 28 µl. Como control de amplificación se utilizó ADN de E. coli BL21 y como control negativo se realizó un blanco de reacción sin ADN. El perfil térmico consistió en un paso inicial de denaturación a 95°C por cinco minutos, seguido de 44 ciclos: a 95°C por 1

Análisis de restricción por PCR/RFLP
Para la elección de las enzimas se elaboró un mapa de restricción del ITS-2 de R. prolixus con el programa NEBcutter V2.0 de New England Biolabs disponible en Internet a partir de secuencias publicadas en Genbank (AJ286888, AY345868). Se buscaron enzimas que tuvieran uno o dos cortes sobre la secuencia y un sitio de

31

López D.C., Jaramillo C., Guhl F.

Biomédica 2007;27(supl. 1):28-39

minuto, a 36°C por 1 minuto y a 72°C por 2 minutos. Las reacciones se visualizaron en geles de poliacrilamida al 6% con un tiempo de corrido electroforético de 3 horas a 80 V. En cada pozo se sembraron 7 ml del producto previamente mezclado con 2 ml de buffer de carga. Los geles fueron teñidos usando el estuche Silver Stain Plus de Pharmacia®.

generados con el programa NEIGHBOR de PHYLIP 3.5C. El estadístico F (Fst) y la tasa efectiva de migración (Nm) entre poblaciones se estimaron con RAPDFST mediante tres metodologías: Wright (21), Weir & Cockerham (22) y Lynch & Milligan (23). El Fst es la razón de la varianza observada en la frecuencia de un alelo en un locus RAPD entre subpoblaciones y su máxima varianza en la población total; el programa computa los valores Fst para cada locus RAPD asumiendo que las subpoblaciones están en equilibrio de Hardy-Weinberg y la dominancia de cada loci. Los valores Fst y Nm son estimaciones indirectas del flujo genético y la migración entre poblaciones, en las cuales se asume que no hay selección, ya que ésta puede incrementar o disminuir el Fst, y que no hay mutaciones si la tasa de mutación es alta en relación a la tasa de migración, como sucede con microsatélites o en ADN mitocondrial; puede haber desviaciones en la estimación. Resultados

Análisis de datos RAPD
El análisis se realiza bajo tres supuestos: a) las poblaciones están en equilibrio de Hardy Weinberg, o sea que se asume que no hay presiones de selección que favorezcan a alguna población; b) los marcadores RAPD segregan en forma mendeliana con tasas constantes de evolución y sustitución, y c) los alelos recesivos son idénticos entre los individuos. Se elaboró una matriz binaria con la información genética obtenida de cada individuo bajo el criterio de presencia [1] y ausencia [0] de bandas de acuerdo con Welsh et al. (16). Teniendo en cuenta que en los marcadores RAPDs el fenotipo dominante de un locus se considera como la presencia de una banda, y el fenotipo recesivo es la ausencia de esa banda, los individuos se comparan fenotípicamente en cada locus. La matriz binaria se analizó con los programas RAPDPLOT (17) y SYNTAX 2000 (18). En RAPDPLOT se generó una matriz de distancias a partir de la matriz binaria usando el índice de similitud de Nei y Li (19), y en SYNTAX se empleó el índice de disimilitud de Jaccard para datos binarios; en los dos programas se generaron dendrogramas con el algoritmo de agrupamiento UPGMA (unweighted pair-group method using an arithmetic average). Se usó el programa RAPDDIST para calcular las distancias genéticas de Nei (20) entre las poblaciones y se realizó un análisis bootstrap de 1000 réplicas, método estadístico que se usa para evaluar la confiabilidad de un árbol y permite examinar qué tan frecuentemente se forma un conglomerado particular; el árbol consenso resultante se da por el número de veces que una ramificación o nodo se presenta y esto es producto de la proporción bootstrap. Los árboles fueron

Amplificación del ITS-2
Todos los R. prolixus presentaron una única banda de 1.180 pb (figura 2A). Se analizaron también ejemplares de R. colombiensis, R. pallescens y T. dimidiata, usados como grupos de exclusión en la técnica RAPD. R. colombiensis presentó una banda de 1.175 pb, R. pallescens una de 709 pb y T. dimidiata una de 964 pb (figura 2B).

Restricción con Rsa I
Se encontró el mismo patrón de restricción en todos los individuos de las poblaciones estudiadas, y dos fragmentos, uno de 833 y otro de 343 pb. El espécimen R. prolixus de Venezuela mostró un patrón de restricción idéntico al de las poblaciones colombianas (figura 3A). T. dimidiata mostró un sitio de corte y generó dos fragmentos, uno de 738 y otro de 239 pb; R. pallescens no fue cortado por la enzima y R. colombiensis mostró un patrón de restricción con un fragmento de 804 pb y otro de 362 pb (figura 3B).

Restricción con Nhe I
Todos los individuos R. prolixus analizados mostraron el mismo patrón de restricción

32

Biomédica 2007;27(supl. 1):28-39

Estructura poblacional de R. prolixus en Colombia

Figura 2. Amplificación del ITS-2 de R. prolixus (RP): A. 1. RP de Cundinamarca (CUN). 2. RP de Tolima (TOL). 3. RP de Sierra Nevada de Santa Marta (SNSM). 4. RP de Casanare (CAS). 5-6. RP de Venezuela (VEN). 7. R. colombiensis. B. 12. RP CAS. 3. T. dimidiata. 4. R. colombiensis. 5. R. pallescens. 6. RP CUN. MP: marcador de peso (100 pb); señalada la banda de 500 pb. Geles de agarosa al 1,5%.

conformado por dos bandas de 1.030 y 153 pb (figura 3C). También hay restricción en R. colombiensis, generando dos fragmentos de 1.020 y 153 pb; R. pallescens presenta un sitio de restricción para esta enzima generando fragmentos de 647 pb y 71 pb. En T. dimidiata no hay restricción (figura 3D).

sí tres bandas de 728, 320 y 136 pb. En T. dimidiata se encontraron cuatro bandas producto de la restricción: de 707, 534, 306 y 143 pb. R. pallescens presentó tres bandas: de 430, 269 y 125 pb (figura 3H).

RAPD
Con los iniciadores RTG 2,3 y 4 se visualizaron un total de 71 bandas o marcadores que representan cada uno un locus RAPD (figura 4). Los dendrogramas generados con los programas SYNTAX y RAPDPLOT muestran una distribución heterogénea de los individuos; no hay agrupamientos definidos por lugar de origen, aunque se observan conglomerados discretos entre individuos de Cundinamarca y Tolima. Todos los individuos R. prolixus del estudio se encuentran por debajo de un valor de disimilitud de Jaccard de 0,475 (en una escala de 0 a 1). R. colombiensis es el grupo de exclusión mas cercano a R. prolixus, seguido por R. pallescens y T. dimidiata (figura 5). En el análisis con RAPDDIST se generaron árboles con diferentes grupos de exclusión que muestran las relaciones genéticas entre las poblaciones. Se realizó un análisis bootstrap”de 1.000 repeticiones para comprobar la consistencia de los datos RAPD que soportan las relaciones representadas por las ramas del árbol.

Restricción con Dde I
Todos los R. prolixus evaluados presentaron dos sitios de corte y el mismo patrón de restricción, una banda de 751 pb, una de 212 pb y una de 150 pb (figura 3E). R. colombiensis presentó un patrón igual al de R. prolixus con dos sitios de corte; T. dimidiata presentó tres sitios de corte, originando cuatro fragmentos de 334, 218, 178 y 93 pb; R. pallescens mostró dos sitios de corte generando tres fragmentos de 293, 238 y 178pb (figura 3F).

Restricción con Hpy 188 I
Esta enzima teóricamente origina un patrón de restricción con tres fragmentos de aproximadamente 737, 323 y 120 pb; después de la digestión se obtuvo un patrón homogéneo de cuatro bandas en todas las poblaciones: 915, 735, 314 y 125 pb (figura 3G); estos fragmentos podrían sugerir la existencia de un sitio de corte adicional; sin embargo, la suma de los tamaños de las bandas sobrepasa el tamaño del producto sin digerir. R. colombiensis no presentó la banda de 915 pb, pero

33

López D.C., Jaramillo C., Guhl F.

Biomédica 2007;27(supl. 1):28-39

Figura 3. Resultados de PCR/RFLP. A. Restricción con Rsa I, bandas de 833 y 343 pb obtenidas para R. prolixus: 1. Control ADN sin digerir, 2. RP TOL, 3. RP SNSM, 4. RP CUN, 5. RP CAS, 6. RP VEN. B. Restricción con Rsa I: 1. T. dimidiata digerido (bandas de 738 y 239 pb), 2. T. dimidiata control sin digerir, 3. RP VEN digerido (bandas de 833 y 343 pb), 4. RP VEN control, 5. RP TOL (bandas de 833 y 343 pb), digerido, 6. RP TOL control, Geles de agarosa al 2%. C. Restricción con Nhe I, bandas de 1030 y 153 pb obtenidas para R. prolixus: 1. RP CAS, 2. RP SNSM, 3. RP TOL, 4. RP CUN, 5 y 6. RP VEN (duplicado), 7. R. colombiensis (bandas de 1020 y 153 pb). D. Restricción con Nhe I: 1. R. pallescens digerido (bandas de 647 pb y 71 pb), 2. R. pallescens control, 4. T. dimidiata digerido (no hay restricción), 5. T.dimidiata control. Geles de agarosa al 1,5%. E. Restricción con Dde I, bandas de 751 pb, 212 pb y 150 pb, obtenidas para R. prolixus: 1-2. RP CAS, 34. RP CUN, 5. RP TOL. F. Restricción con Dde I: 1. T. dimidiata digerido (bandas de 334, 218, 178 y 93 pb), 2. T. dimidiata control, 3. R. pallescens digerido (bandas de 293, 238 y 178 pb), 4. R. pallescens control, 6. R. colombiensis digerido (751 pb, 212 pb y 150 pb), 7. R. colombiensis control. Geles de agarosa al 2%. G. Restricción con Hpy 188 I, bandas de 915, 735, 314 y 125 pb obtenidas para R. prolixus: 1. RP SNSM control, 2. RP SNSM digerido, 3. RP CUN control, 4. RP CUN digerido, 5. RP TOL control, 6. RP TOL digerido. H. Restricción con Hpy 188 I: 1. RP SNSM digerido, 2. R. colombiensis digerido (bandas de 728, 320 y 136 pb), 3. R. colombiensis control, 4. T. dimidiata digerido (bandas de 707, 534, 306 y 143 pb), 5. T. dimidiata control, 6. R. pallescens digerido (bandas de 430, 269 y 125 pb), 7. R. pallescens control. Geles de agarosa al 2%. Para todos los geles MP: marcador de peso (100 pb).

34

Biomédica 2007;27(supl. 1):28-39

Estructura poblacional de R. prolixus en Colombia

Se estimó el índice de fijación o estadístico F (Fst), que mide el grado de diferenciación genética entre poblaciones y la tasa efectiva de migración (Nm) entre todas las poblaciones en conjunto y por pares. Los valores Fst obtenidos en todos los casos indican una diferenciación genética moderada (Fst 0,05 a 0,15) y una tasa de migración (Nm>1), suficiente para mantener homogeneidad genética entre las poblaciones (cuadro 1). El valor Fst más alto se encontró entre las poblaciones de Tolima y Casanare (Fst 0,150) siguiendo la metodología de Weir & Cockerham, que realiza una corrección en muestras de tamaño pequeño, e indicando una diferenciación genética grande; el siguiente valor Fst más alto se obtuvo entre Cundinamarca y Casanare (Fst 0,102). Las estimaciones del Fst y Nm concuerdan con lo observado en el dendrograma de RAPDDIST, en el que la población de Casanare proveniente de un hábitat silvestre se diferencia de las otras poblaciones. Discusión No se detectaron polimorfismos de longitud en la región del ITS-2; la digestión del fragmento amplificado con las enzimas Nhe I, Rsa I, Dde I y Hpy I mostró patrones de restricción homogéneos, indicando que los individuos evaluados no difieren en ninguno de los sitios de clivaje de las enzimas, y por lo tanto no se presentaron polimorfismos de fragmentos de restricción; por ello no es posible, usando estas enzimas, diferenciar a nivel molecular las poblaciones de R. prolixus con estos marcadores.

Figura 4. Patrones de bandas RAPD. Productos de amplificación de R. prolixus con el iniciador RTG 4. 1: control (E.coli), 2 y 3: RP CAS, 4 y 5: RP SNSM, 6 y 7: RP CUN, 8 y 9: RP TOL. Gel de acrilamida al 6%; teñido con plata.

Las poblaciones de Tolima y Cundinamarca se agrupan en un conglomerado con una distancia genética de 0,03175, mientras que las poblaciones de la Sierra Nevada y Casanare se encuentran aparte, un poco más alejadas genéticamente de las dos primeras, con distancias de 0,03605 y 0,03733, respectivamente, siendo la población de Casanare la más alejada (figura 6).

R. prolixus de Venezuela se encontró separado de las poblaciones de Colombia, con una distancia genética de 0,12521. Para R. colombiensis, usado como grupo de exclusión, se obtuvo una distancia de 0,19167; R. pallescens mostró una distancia de 0,22180 y T. dimidiata enraizó el árbol a una distancia de 0,29351.

Cuadro 1. Valores Fst y Nm entre las poblaciones de R. prolixus. Comparaciones Metodología Wrigth Weir & Cockerham Lynch & Milligan Fst Nm Fst Nm Fst Nm TP 0,107 2,1 0,097 2,3 0,097 2,3 Cun/Tol 0,071 3,3 0,085 2,7 0,074 3,1 Cun/Cas 0,074 3,1 0,102 2,2 0,080 2,9 Cun/SNS 0,075 3,1 0,094 2,4 0,075 3,1 Tol /Cas 0,102 2,2 0,150 1,4 0,134 1,6 Cas/SNS 0,062 3,8 0,070 3,3 0,057 5,1 Tol/SNS 0,074 3,1 0,085 2,7 0,067 3,5

TP: entre las 4 poblaciones. Cun: Cundinamarca, Tol: Tolima, SNS: Sierra Nevada, Cas: Casanare. Nm > 1 indica homogeneidad genética, Nm < 1 no es suficiente para mantener homogeneidad genética. Valores Fst de 0,05 a 0,15 indican poca diferenciación genética, de 0,05 a 0,15, diferenciación genética moderada, de 0,15 a 0,25, diferenciación genética grande, > 0,25, diferenciación genética muy grande.

35

López D.C., Jaramillo C., Guhl F.

Biomédica 2007;27(supl. 1):28-39

Figura 5. Dendrograma generado con SYNTAX para R. prolixus usando el coeficiente de disimilitud de Jaccard y el algoritmo UPGMA. En la parte inferior aparece el código de cada insecto y su lugar de origen (Cun: Cundinamarca, Tol: Tolima, Cas: Casanare, SNSM: Sierra Nevada, Ven: Venezuela). Grupos de exclusión: R. colombiensis, R. pallescens y T.dimidiata.

El patrón de restricción obtenido con la enzima Hpy I presentó una banda adicional que no desapareció ni modificando el tiempo de incubación ni la cantidad de enzima, por lo que puede tratarse de un genotipo heterocigoto, en el que se presenta el sitio de restricción en algunas de las cadenas y en otras no. El hecho de que el patrón se haya presentado en todos los individuos indicaría un alto porcentaje de heterocigocidad en la población. Sería conveniente corroborar estos

resultados mediante la secuenciación de dichos fragmentos. El marcador molecular ITS-2 presentó alta homogeneidad intra-específica, lo que concuerda con lo encontrado en otro estudio, en el cual secuencias del ITS-2 de dos individuos R. prolixus de Colombia fueron idénticas (Vergel C et al. Marcadores especie-específicos para la diferenciación entre Rhodnius prolixus y Rhodnius colombiensis . En: Memorias Curso Taller

36

Biomédica 2007;27(supl. 1):28-39

Estructura poblacional de R. prolixus en Colombia

fenotípica antenal de poblaciones domésticas de Rhodnius prolixus (Hemiptera:Reduviidae) de Colombia. En: Resúmenes del XXXII Congreso Sociedad Colombiana de Entomología; 2005 Jul 27-29; Ibagué. Colombia. p.110). Las estimaciones del índice de fijación (Fst) y la tasa efectiva de migración (Nm) indican que entre las poblaciones Tolima-Casanare y CundinamarcaCasanare existe una diferenciación genética moderada a grande. Sin embargo, a nivel general se mantiene entre todas las poblaciones una diferenciación genética moderada, debida a tasas de migración de por lo menos un individuo por generación. Este movimiento de insectos entre poblaciones separadas por grandes distancias y barreras geográficas puede ser resultado del transporte pasivo asociado a migraciones ruralurbanas (24), por lo tanto, las migraciones humanas y barreras geográficas parecen haber influido en la dinámica de dispersión de las poblaciones de R. prolixus, creando una diferenciación entre las poblaciones del oriente y el occidente del país. Los resultados obtenidos por la técnica de RAPD para las poblaciones domiciliadas concuerdan con lo reportado en estudios anteriores realizados por morfometría y patrones isoenzimáticos, en los cuales se demuestra que aunque R. prolixus presenta baja variabilidad genética, se observan algunas diferencias significativas entre poblaciones locales y otras variantes geográficas (25-28); otros estudios realizados por medio de análisis de secuencias de ADN mitocondrial y ADN nuclear reportan resultados similares a los obtenidos por medio de las otras técnicas, mostrando que R. prolixus es una especie muy homogénea genéticamente (29-32); sin embargo en ninguno de estos estudios se incluyen las poblaciones silvestres colombianas recientemente reportadas e incluidas en el presente estudio, razón por la cual encontramos una variabilidad genética moderada entre las poblaciones silvestres y las domiciliadas. Por otro lado, la población silvestre de Casanare parecer ser la menos relacionada con las otras poblaciones evaluadas y puede representar un riesgo epidemiológico para esa área. Estas

Figura 6. Dendrograma generado con RAPDDIST para las poblaciones de R. prolixus usando la distancia genética de Nei y aplicando bootstrap de 1.000 repeticiones . Cun: Cundinamarca, Tol: Tolima, Cas: Casanare, SNS: Sierra Nevada, Ven: Venezuela. Grupo de exclusión: R. colombiensis (Rco).

Internacional 2002: sistemas de información geográfica, sensores remotos y genética poblacional de vectores y parásitos aplicados al control de la enfermedad de Chagas; 2002 Dic 26; Universidad de los Andes, Bogotá. Colombia. p. 45-64). Algo similar fue reportado entre dos variedades cromáticas de R. stali (8), por lo cual se sugiere usar otros marcadores moleculares de evolución más rápida como lo son algunos genes mitocondriales. Los dendrogramas obtenidos con RAPDDIST indican que las poblaciones de Tolima y Cundinamarca son las más cercanas genéticamente, probablemente debido a la cercanía geográfica, y un Fst de 0,071 muestra un flujo genético de moderado a alto entre estas dos poblaciones. El conglomerado de Tolima y Cundinamarca se agrupa con la población de la Sierra Nevada, probablemente debido a un proceso de migración pasiva entre las cordilleras central y oriental a lo largo de todo el valle del Magdalena. La región del Casanare se encuentra separada por la Cordillera Oriental de las otras áreas de estudio; esta barrera geográfica al parecer ha conllevado a un aislamiento geográfico entre las poblaciones del occidente y oriente del país, lo cual concuerda con lo reportado en otro estudio realizado con patrones de sensilla entre poblaciones de R. prolixus de la zona andina y los llanos orientales (Esteban L et al. Variación

37

López D.C., Jaramillo C., Guhl F.

Biomédica 2007;27(supl. 1):28-39

poblaciones silvestres han mostrado ser un riesgo inminente en la transmisión de la enfermedad. Se ha reportado que el 3% de los niños infectados se debe a los insectos que están llegando de las palmas a las viviendas (Informe de la Secretaria de Salud del Casanare. En: Memorias del Primer Taller Internacional sobre Control de la Enfermedad de Chagas; 2005 Mayo 2-6; Universidad de los Andes. Bogotá, Colombia, p. 245-9). Los hallazgos de R. prolixus en hábitats silvestres en el departamento de Casanare sugieren que en la región oriental del país el vector podría ser autóctono, y que en las otras regiones fue introducido, encontrándose estrictamente domiciliado. Es indispensable determinar la distribución y variabilidad genética de las poblaciones que se encuentran asociadas al domicilio y su relación con las poblaciones silvestres, para establecer el riesgo que éstas representan y poder así realizar una adecuada vigilancia epidemiológica. Los resultados presentados en este estudio constituyen una primera aproximación a la estructura genética poblacional de R. prolixus en Colombia y muestra datos importantes acerca de la dispersión en el país. La variabilidad genética moderada detectada entre las poblaciones domiciliadas es favorable para las intervenciones de control químico y plantea que la eliminación del vector domiciliado es viable en Colombia a pesar de la existencia de focos silvestres, como se demostró en Venezuela (32), y como se ha observado en Centro América con el vector doméstico (33). Se puede concluir que las poblaciones domiciliadas de R. prolixus son homogéneas debido a que existe flujo genético entre ellas, mientras que la población silvestre se encuentra separada de las domiciliadas. Se evidencia la necesidad de estudiar la estructura genética de los focos silvestres, sus posibles rutas de dispersión y el riesgo epidemiológico que representan. Conflicto de intereses Los autores declaran no tener conflicto de intereses con respecto al estudio.

Financiación Este estudio se realizó con el apoyo financiero del Fondo de Investigaciones y Posgrados de la Facultad de Ciencias de la Universidad de los Andes y el CDIA-Chagas Disease Intervention Activities-EC Contract N° ICA4CT-2003-10049. Referencias
1. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the Southern cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 2. Guhl F, Restrepo M, Angulo VM, Antunes CM, Campbell-Lendrum D, Davies C. Lessons from a national survey of Chagas disease transmission in Colombia. Trends Parasitol 2005;21:259-62. 3. Gamboa CJ. Dispersión de Rhodnius prolixus en Venezuela. Bol Dir Malariol Saneam Ambient 1962;3:262-72. 4. Garcia AL, Carrasco HJ, Shofield CJ, Stothard JR, Frame IA, Valente SA, et al. Random amplification of polymorphism DNA as a tool for taxonomics studies of triatomine bugs (Hemiptera: Reduviidae). J Med Entomol 1998;35:38-45. 5. Monteiro FA, Escalante AA, Beard CB. Molecular tools and triatomine systematics: a public health perspective. Trends Parasitol 2001;17:344-7. 6. Bargues MD, Marcilla A, Ramsey JM, Dujardin JP, Schofield CJ, Mas-Coma S. Nuclear rDNA-based molecular clock of the evolution of triatominae (Hemiptera: Reduviidae) vectors of Chagas disease. Mem Inst Oswaldo Cruz 2000;95:567-73. 7. Pacheco RS, Almeida CE, Costa J, Klisiowicz DR, Mas-Coma S, Bargues MD. RAPD analyses and rDNA intergenic–spacer sequences discriminate Brazilian populations of Triatoma rubrovaria . Ann Trop Med Parasitol 2003;97:757-68. 8. Bargues MD, Marcilla A, Dujardin JP, Mas-Coma S. Triatominae vectors of Chagas disease: a molecular perspective based on nuclear ribosomal DNA markers. Trans R Soc Trop Med Hyg 2002;96(Suppl 1):159-64. 9. García BA, Manfredi C, Fichera L, Segura EL. Variation in mitochondrial 12S and 16S ribosomal DNA sequences in natural populations of Triatoma infestans (Hemiptera, Reduviidae). Am J Trop Med Hyg 2003;68:692-4. 10. Marcilla A, Bargues MD, Ramsey MJ, MagallonGastelum E, Salazar-Schettino PM, Abad-Franch F, et al. The ITS-2 of the nuclear rDNA as a molecular marker for populations, species, and phylogenetic relationships in Triatominae (Hemiptera: Reduviidae) vectors of Chagas disease. Mol Phylogenet Evol 2001;18:136-42.

38

Biomédica 2007;27(supl. 1):28-39

Estructura poblacional de R. prolixus en Colombia

11. Caldeira RL, Carvalho OS, Mendonça CL, GraeffTeixeira C, Silva MC, Ben R, et al . Molecular differentiation of Angiostrongylus costaricensis , A. Cantonensis, and A. Vasorum by polymerase chain reaction-restriction fragment length polymorphism. Mem Inst Oswaldo Cruz 2003;98:1039-43. 12. Jaramillo C, Montaña MF, Castro LR, Vallejo GA, Guhl F. Differentiation and genetic analysis of Rhodnius prolixus and Rhodnius colombiensis by rDNA and RAPD amplification. Mem Inst Oswaldo Cruz 2001;96:1043-8. 13. Ramírez CJ, Jaramillo CA, Delgado M, Pinto NA, Aguilera G, Guhl F. Genetic structure of sylvatic, peridomestic and domestic populations of Triatoma dimidiata (Hemiptera: Reduviidae) from an endemic zone of Boyaca, Colombia. Acta Trop 2005;93:23-9. 14. Borges EC, Romanha AJ, Diotaiuti L. Uso do random amplified polymorphic DNA (RAPD) no estudo populacional do Triatoma brasiliensis Neiva, 1911. Cad Saúde Pública 2000;16:97-100. 15. Lent H, Wygodzinsky P. Revision of the Triatominae (Hemiptera, Reduviidae) and their significance as vectors of Chagas disease. Bull Am Mus Nat Hist 1979;163:175-499. 16. Welsh J, Pretzrnan C, Postic D, Girons IS, Baranton G, McClelland M. Genomic fingerprinting by arbitrary primer polymerase chain reaction resolves Borrelia burgeri into three distinct phylogenetic groups. Int J Syst Bacteriol 1992; 42:370-7. 17. Kambhampati S, Black WC 4th, Rai KS. Random amplified polymorphic DNA of mosquito species and populations (Diptera: Culicidae): techniques, statistical analysis, and applications. J Med Entomol 1992;29: 939-45. 18. Podani J. SYNTAX. Computer programs for multivariate data analysis in ecology and systematics. Budapest: Scienta Publishing; 1993. 19. Nei M, Li WH. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci USA 1979;76:5269-73. 20. Nei M. Genetic distance between populations. Am Nat 1972;106:283-92. 21. Wright S. Evolution in Mendelian populations. Genetics 1931;16:97-159.

22. Weir BS, Cockerham CC. Estimating F-statistics for the analysis of population’s structure. Evolution 1984;38:1358-70. 23. Lynch M, Milligan BG. Analysis of population genetic structure with RAPD markers. Mol Ecol 1994;3:91-9. 24. Dias JC. Rural resource development and its potential to introduce domestic vectors into a new epidemiological situation. Rev Argent Microbiol 1988;20(Suppl. 1):81-5. 25. Harry M, Galindez I, Cariou ML. Isozyme variability and differentiation between Rhodnius prolixus , R. robustus and R. pictipes, vectors of Chagas disease in Venezuela. Med Vet Entomol 1992;6:37-3. 26. Harry M. Isozymic data question the specific status of some blood-sucking bugs of the genus Rhodnius , vectors of Chagas disease. Trans R Soc Trop Med Hyg 1993;87:492. 27. Harry M. Morphometric variability in the Chagas´disease vector Rhodnius prolixus. Jpn J Genet 1994;69:233-50. 28. Monteiro FA, Lazoski C, Noireau F, Sole-Cava AM. Allozyme relationships among ten species of Rhodniini, showing paraphyly of Rhodnius including Psammolestes. Med Vet Entomol 2002;16:83-90. 29. Monteiro FA, Wesson DM, Dotson EM, Schofield CJ, Beard CB. Phylogeny and molecular taxonomy of the Rhodniini derived from mitochondrial and nuclear DNA sequences. Am J Trop Med Hyg 2000;62:460-5. 30. Monteiro FA, Barrett TV, Fitzpatrick S, CordonRosales C, Feliciangeli D, Beard CB. Molecular phylogeography of the Amazonian Chagas disease vectors Rhodnius prolixus and R. robustus. Mol Ecol 2003;12:997-1006. 31. Abad-Franch F, Monteiro FA. Molecular research and the control of Chagas disease vectors. An Acad Bras Cienc 2005;77:437-54 32. Feliciangeli MD, Campbell-Lendrum D, Martinez C, Gonzales D, Coleman P, Davies C. Chagas disease control in Venezuela: lessons for the Andean region and beyond. Trends Parasitol 2003;19:44-9. 33. Zeledón R. Some historical facts and recent issues related to the presence of Rhodnius prolixus (Stal, 1859) (Hemiptera:Reduviidae) in Central America. Entomología y vectores 2004;11:233-46.

39

Rendón D.A., Genes C.M., Triana O. Biomédica 2007;27(supl.1):40-9

Biomédica 2007;27(supl.1):40-9

ARTÍCULO ORIGINAL

Lesión celular del miocardio y actividad de la ATPsintasa mitocondrial en ratas infectadas con una cepa colombiana de Trypanosoma cruzi
Dairo Alonso Rendón 1, Carlos M. Genes 2, Omar Triana
1

2

2

Facultad de Ciencias, Laboratorio de Biofísica, Universidad Nacional de Colombia sede Medellín, Medellín, Colombia. Grupo de Chagas, Instituto de Biología, Universidad de Antioquia, Medellín, Colombia.

Introducción. La enfermedad de Chagas es la principal causa de cardiomiopatía crónica en regiones endémicas de Latinoamérica. Alteraciones en el metabolismo energético mitocondrial cardiaco causadas por Trypanosoma cruzi pueden estar involucradas en el desarrollo de esta cardiomiopatía. Objetivo. En este trabajo se investigó la lesión celular del miocardio de ratas durante una infección por la cepa colombiana Mg8 de Trypanosoma cruzi y la actividad de la ATPsintasa mitocondrial para correlacionar el daño al miocardio con el metabolismo energético mitocondrial. Materiales y métodos. Se utilizaron grupos de cinco ratas, las cuales fueron infectadas con tripomastigotes. El curso de la infección se evaluó a nivel parasitológico, histopatológico y molecular. La actividad de la ATPsintasa mitocondrial del miocardio se evaluó tanto en las ratas infectadas con parásitos como en ratas control no infectadas. Resultados. Se determinaron los días 26 y 60 post-infección como el punto de máxima parasitemia y como el punto de desaparición de los parásitos en sangre circulante, respectivamente. Los resultados histopatológicos y moleculares muestran que la cepa Mg8 tiene tropismo por el tejido cardiaco y causa una considerable lesión celular del miocardio de ratas tanto a 26 días (fase aguda) como a 60 días post-infección (fase crónica). A pesar de la lesión observada, no se encontró diferencia estadísticamente significativa en la actividad de la ATPsintasa de las ratas infectadas en estos días al comparar con sus respectivos controles. Conclusión. Estos resultados sugieren que el metabolismo energético mitocondrial no está alterado en la lesión celular del miocardio de las ratas, observada durante la infección con la cepa colombiana Mg8 de T. cruzi. Palabras clave: Trypanosoma cruzi, enfermedad de Chagas, miocardiopatía chagásica, metabolismo energético, mitocondria. Myocardial cellular damage and the activity of the mitochondrial ATP synthase in rats infected with a Colombian strain of Trypanosoma cruzi Introduction. Chagas disease is the main cause of cardiomyopathy in endemic regions of Latin America. Alterations in the cardiac mitochondrial energy metabolism caused by Trypanosoma cruzi can be involved in the development of this cardiomyopathy during the course of Chagas disease. Objective. The cellular injury of the rat myocardium was investigated in rats infected with the Colombian Mg8 strain of Trypanosoma cruzi. The activity of mitochondrial ATP synthase was measured to determine the relationship heart damage with the energy metabolism. Materials and methods. Two groups of five rats each were infected with tripomastigotes, with 1 group of 6 rats serving as controls. The course of infection was characterized by parasitological, histopathological and molecular studies. The mitochondrial ATP synthase activity of the myocardium was evaluated in all rats. Results. Peak parasitaemia (day 26 post infection) and the time of parasite clearance from circulating blood (day 60 post infection) were determined for acute and chronic phase models.

40

Biomédica 2007;27(supl.1):40-9

Lesiones del miocardio durante la enfermedad de Chagas

The histopathological and molecular results showed that the Colombian Mg8 strain has tropism to the cardiac tissue and causes considerable cellular injury of the myocardium in rats during both phases. Despite the lesions observed in infected rats, no statistical difference in the activity of the mitochondrial ATPsynthase was observed between them and the non-infected rats. Conclusion. Mitochondrial energy metabolism of the cardiomyocites does not appear to change during cellular injury of rat myocardium associated with infection by the Colombian Mg8 T. cruzi strain. Key words: Trypanosoma cruzi, Chagas disease, Chagas cardiomyopathy, energy metabolism, mitochondria.

Trypanosoma cruzi, agente causal de la enfermedad de Chagas, afecta aproximadamente a 17 millones de personas de diferentes regiones de Centro y Suramérica, de las cuales probablemente entre el 20 y el 35% desarrolla la enfermedad. En Colombia, la enfermedad de Chagas se encuentra ampliamente distribuída en las zonas rurales y se estima que el 5% de la población asentada en las zonas endémicas está infectada (1).
La cardiomiopatía es la afección más importante secundaria a esta enfermedad, ya que puede producir muerte súbita o discapacidad física, lo que representa grandes costos socioculturales y económicos. Para esclarecer la génesis de la cardiomiopatía chagásica se ha prestado gran atención a las alteraciones en el metabolismo energético mitocondrial del miocardio (2,3). Las mitocondrias se consideran uno de los organelos más importantes de los cardiomiocitos, ya que en condiciones fisiológicas generan más del 90% de la energía necesaria para su funcionamiento (4). Además, pueden ser blanco de múltiples daños, producto de la respuesta inmunológica del hospedero a la infección (5). La importancia de las mitocondrias en el funcionamiento de las células cardiacas también se manifiesta en el hecho de que entre el 25 y 35% del volumen de los cardiomiocitos está ocupado por ellas. Es así como los eventos patofisiológicos que alteran la
Correspondencia: Omar Triana Chávez, Calle 67 N. 53-108, Instituto de Biología, Universidad de Antioquia, Medellín, Colombia. Telefax: 2105622 otriana@matematicas.udea.edu.co Recibido: 10/08/05; aceptado: 24/03/06

producción de energía por parte de las mitocondrias (síntesis del ATP), pueden desembocar en lesiones importantes del miocardio (6). En la producción de energía en los cardiomiocitos juega un gran papel la enzima ATPsintasa mitocondrial, la cual cataliza la síntesis de ATP utilizando la energía almacenada en el potencial electroquímico de la membrana mitocondrial interna. Por su importancia, esta enzima mitocondrial se ha estudiado ampliamente en las últimas tres décadas, tanto en condiciones fisiológicas como patológicas (7-10). Uyemura et al. (2) y Vyatkina et al. (3) mostraron una disfunción en la síntesis de ATP por parte de la ATPsintasa mitocondrial del miocardio durante la infección con Trypanosoma cruzi utilizando mitocondrias aisladas. Considerando que las cepas colombianas de T. cruzi tienen tropismo hacia el tejido cardiaco (11), es importante evaluar la posible lesión celular del miocardio durante una infección con estas cepas y la asociación de tal lesión con el metabolismo energético mitocondrial. En el presente trabajo se determinó la lesión celular del miocardio de ratas infectadas con una cepa colombiana de T. cruzi y se evaluó la actividad de la ATPsintasa mitocondrial en homogeneizados de este tejido. Materiales y métodos

Animales de laboratorio e infección con el parásito
Se inocularon subcutáneamente ratas hembras de la cepa Wistar de aproximadamente 200 gramos con 2 x 105 tripomastigotes sanguíneos obtenidos de ratones Balb/c previamente irradiados con 450 rad de rayos gamma en un volumen total de sangre de entre 50 y 100 µl.

41

Rendón D.A., Genes C.M., Triana O.

Biomédica 2007;27(supl.1):40-9

Para la infección se usó la cepa colombiana Mg8, perteneciente al grupo I de Trypanosoma cruzi. Esta cepa se aisló en el año 2003 a partir del vector Triatoma dimidiata de origen silvestre procedente del departamento del Magdalena, y se mantuvo por repiques sucesivos cada siete días en medio de cultivo líquido LIT a 28°C (12) y por infección en ratones Balb/c. Los ensayos realizados en este estudio se iniciaron en el mismo año de aislamiento de la cepa, después de 18 pases por medio de cultivo y varios pases por ratón. Todos los animales se mantuvieron de acuerdo a la reglamentación establecida por el Comité de Ética para la Experimentación con Animales de la Universidad de Antioquia.

100%) y finalmente en xilol. Luego, los cortes se incluyeron en parafina y se cortaron con el micrótomo en secciones tisulares de tres a cinco micrómetros de espesor. Las muestras se tiñeron con hematoxilina-eosina para detectar la presencia del parásito y el nivel de inflamación del tejido, y con coloración de tricrómico para determinar el grado de fibrosis del tejido cardiaco.

Extracción de ADN
El ADN se extrajo a partir de una preparación de tejido cardiaco de animales infectados, utilizando el método de Salting Out (14), y en algunos casos el método de fenol-cloroformo (15). Las muestras de ADN se disolvieron en 50 ml de agua destilada desionizada estéril a 37°C por cinco minutos (16) y se guardaron a -20°C.

Caracterización de la infección
Se utilizó un grupo de seis ratas para seguir el curso de la infección y determinar la fase aguda (máxima parasitemia en sangre circulante) y crónica de la enfermedad (desaparición de la parasitemia en sangre circulante). La evaluación de los animales infectados se realizó día por medio haciendo conteo de tripomastigotes sanguíneos en placa en un microscopio óptico con objetivo de 40X (13). Adicionalmente, se inocularon dos grupos de cinco ratas cada uno para determinar la actividad de la ATPsintasa mitocondrial y se hizo evaluación por reacción en cadena de la polimerasa (PCR) en la fase aguda y crónica de la enfermedad; así mismo, se inoculó un grupo de dos animales, para realizar los estudios histopatológicos tanto en la fase aguda como crónica de la enfermedad. Cada grupo de animales infectados tuvo un grupo control no infectado de igual número de animales mantenido en las mismas condiciones de laboratorio.

Detección del parásito por PCR
Se utilizaron dos marcadores diferentes para detectar la presencia del parásito en los tejidos cardiacos a partir de una preparación de corazón empleada en la determinación de la actividad de la ATPsintasa mitocondrial: el ADN del cinetoplasto (kDNA) y el espaciador intergénico de los genes mini-exón. Para la amplificación de la región variable del kDNA se utilizaron los iniciadores S35 y S36, que amplifican un fragmento de 330 pb (17). La mezcla de reacción para PCR se llevó a cabo en un volumen final de 25 µl que contenían 2,5 µl de ADN molde a una concentración de 50ng/µl, 2mM MgCl2, 2mM dNTPs, 10 pmol/µl iniciadores, 0,05 unidades de Taq ADN polimerasa (Fermentas), buffer 10X (750mM Tris-HCl pH 8,8; 200mM (NH4)2SO4 y 0,1% Tween 20), y agua tridestilada estéril. Los ciclos de la reacción se realizaron a una temperatura inicial de 94°C por tres minutos, seguida por 35 ciclos a 94°C por 45 segundos, a 63 °C por 45 segundos y a 72°C por 45 segundos, y un último ciclo a 72°C por 10 minutos. El espaciador intergénico de los genes mini-exón se amplificó utilizando los iniciadores TC1, TC2 y TCC, los cuales amplifican un fragmento de 300 pb para el grupo T. cruzi II y un fragmento de 350 pb para el grupo T. cruzi I (18). La PCR se realizó en un volumen final de 25 µl que contenían 2,5 µl de ADN molde a una concentración de 50ng/µl,

Lesión celular del miocardio
Para determinar la lesión celular del miocardio, a dos grupos de animales infectados y a sus respectivos controles se les extrajo el corazón a 26 y 60 dpi., e inmediatamente se fijó en formol al 10%. Los corazones se seccionaron en su totalidad en cortes seriados transversales de 2 a 3 mm, y se deshidrataron empleando una serie de alcoholes de gradación ascendente (50, 70, 80 y

42

Biomédica 2007;27(supl.1):40-9

Lesiones del miocardio durante la enfermedad de Chagas

1,5mM MgCl2,10 pmol de cada iniciador, 2mM dNTPs, 0,025 unidades de Taq DNA polimerasa, buffer 10X (750mM Tris-HCl (pH 8,8); 200mM (NH4)2SO4 y 0,1% Tween 20), y agua tridestilada estéril. Los ciclos de amplificación se realizaron a una temperatura inicial de 94°C durante un minuto, seguida de 27 ciclos a 94°C por 30 segundos, a 55°C por 30 segundos, a 72°C por 30 segundos y un ciclo final a 72°C por 10 minutos. Los productos amplificados se detectaron en geles de agarosa al 1,5% teñidos con bromuro de etidio a 0,5 mg/µl y se visualizaron con luz ultravioleta (15).

Actividad de la ATPsintasa mitocondrial
Los corazones de ratas sacrificadas por dislocación cervical se extrajeron rápidamente y se pusieron en solución de preparación del tejido a un pH de 7,5 entre 0 y 2°C (0,17 M KCl, 10 mM EDTA, 0,1% suero de albúmina bovina, 10 mM Tris-HCl) durante dos a tres minutos. Los corazones se pasaron por una prensa manual y con el tamizado se obtuvo un homogeneizado de tejido cardiaco (3,5 ml solución/1g de tejido) utilizando un equipo Potter-Elvehjem a una velocidad angular de 700 rev/min durante dos a tres minutos y a una temperatura entre 0 y 2°C. Finalmente, el homogeneizado obtenido se conservó entre 0 y 2°C hasta iniciar las mediciones. La actividad de la ATPsintasa mitocondrial se estimó por medio de un método potenciométrico (19), y se calculó según la siguiente fórmula: actividad de la ATPsintasa mitocondrial = 2 m x 200 nmol Pi / M x ( h1 + h2 ), donde h1 y h2 (en unidades de mV) son las alturas de los saltos en la señal de registro después de adicionar dos veces consecutivamente 200 nmol de fosfato inorgánico, m (en unidades de mV/min) es la pendiente de la señal de registro después de adicionar ADP, M (en unidades de mg) es la cantidad de proteína total adicionada con la suspensión de tejido cardiaco; y Pi es fosfato inorgánico (figura 1). Brevemente, los homogeneizados de corazón de rata (1 mg de proteína total de homogeneizado de tejido cardiaco) fueron incubadas durante un minuto y 30 segundos con 5 mM de glutamatomalato; después se realizaron las siguientes tres

Figura 1. Curva típica en la determinación de la actividad de la ATPsintasa mitocondrial. En orden secuencial se adicionaron en los puntos indicados en las flechas 3,5 ml medio de incubación, homogeneizado de corazón (1 mg de proteína total), 5mM glutamato-malato, 500 mM de ADP, 0,8 mg oligomicina/mg de proteína total de homogeneizado, y por último, dos adiciones consecutivas de 200nmol de KH2PO4 cada una. Los homogeneizados de tejido cardiaco se incubaron durante 1 min y 30 segundos con 5mM de glutamato-malato antes de adicionar ADP. El KH2PO4 se adiciona para calibrar la señal de registro.

adiciones: (i) 500µM ADP; (ii) oligomicina, 0,8 µg/g de proteína, y (iii) 200 nmol de fosfato inorgánico (KH2PO4) para calibrar la señal (figura 1). El alcohol que se adicionó con la oligomicina no superó el 0,1%. La actividad de la ATPsintasa es equivalente a la velocidad de cambio de pH después de la adición de ADP calibrada con respecto al fosfato inorgánico y a la cantidad de proteína total adicionada con la suspensión de tejido cardiaco. El principio de este método potenciométrico radica en que la desaparición del fosfato inorgánico (H2PO4-) del medio debido a la síntesis de ATP por la ATPsintasa mitocondrial está asociada al cambio en el pH (∆pH) causado por la disociación del H 2PO4 en HPO4 2 - y H + (ATP 4 -↔ ADP 3 - + H2PO4 -; H2PO4 - ↔ HPO4 2 - + H+). La solución para la determinación de la actividad de la ATPsintasa mitocondrial fue de 250 mM sacarosa, 5 mM KH2PO4, 2 mM tris-HCl, y 0,1 mM EDTA; pH 7,4 (HCl/KOH a 37°C). Las mediciones se realizaron en recipientes de vidrio bajo agitación magnética. El cambio en el pH se midió a 25°C utilizando un potenciómetro Corning modelo 12 de alta sensibilidad y rapidez conectado a un computador que visualiza la cinética del proceso. Las

43

Rendón D.A., Genes C.M., Triana O.

Biomédica 2007;27(supl.1):40-9

velocidades de síntesis del ATP se obtuvieron en nmol Pi/mg de proteína/min. La cuantificación de la proteína total en los homogeneizados de corazón se realizó por el método de Biuret (20), utilizando como patrón de calibración el suero de albúmina bovina.

mililitro. La desaparición de la parasitemia fue estimada para el día 60 pi (60 dpi), que se consideró como el inicio de la fase crónica de la enfermedad (datos no mostrados).

Lesión celular del miocardio
El análisis histopatológico se realizó en tejido cardiaco de dos animales sacrificados a los 26 y 60 dpi y de sus respectivos controles. En los animales control se observaron fibras ordenadas, distribución normal del núcleo en el miocito y las células intersticiales se mostraban histológicamente sanas (figura 2A). En los animales sacrificados a los 26 dpi se observó miocarditis y no se encontró fibrosis (figura 2B). Se observó un importante infiltrado inflamatorio mononuclear, confluente con escasos seudoquistes (uno en un campo de alto poder) (figura 2C). En los animales sacrificados a los 60 dpi se observó infiltrado inflamatorio mononuclear a nivel intersticial alrededor de las fibras cardiacas (figura 3A), seudoquistes (tres en un campo de alto poder) (figura 3B), miocarditis, miocitolisis focal y áreas de fibrosis alrededor de algunas fibras cardiacas degeneradas (figuras 3A y 3C). Dos de las seis ratas empleadas para la construcción de la curva de parasitemia murieron en los días 28 y 30 posterios a la infección. En estos animales se encontró un importante daño tisular en el tejido cardiaco. En el animal muerto a los 30 días pi se observaron abundantes fibras miocárdicas parasitadas con formación de

Análisis estadístico
Para el análisis de los valores obtenidos en la actividad de la ATPsintasa mitocondrial se compararon cada uno de los grupos infectados con su respectivo control. Se utilizaron los programas Graph Pad Prism versión 2,0 y JMP versión 3.2.6. Se usó el t-test y se consideró p < 0,05 como criterio de grupos significativamente diferentes. Los datos se presentaron como promedios ± error estándar de la media (SEM). Las mediciones se realizaron por triplicado para cada animal sacrificado y luego se obtuvo el promedio de estos datos. Resultados

Caracterización de la infección
El desarrollo de la enfermedad en las ratas infectadas con la cepa Mg8 estuvo marcado por la aparición de parásitos en sangre a los 11 días después de la infección (11 dpi). Se observó la presencia de dos picos de alta parasitemia: el primero en el día 26 (26 dpi), con aproximadamente 9,1x105 tripomastigotes por mililitro, y el segundo, en el día 40 pi, con aproximadamente 6,5 x105 tripomastigotes por

Figura 2. Corte histológico de tejido cardiaco de ratas infectadas con la cepa Mg8. A. Rata control no infectada: no hay presencia de infiltrado inflamatorio, fibrosis o miocitolisis. B. Miocitólisis (⇒) e infiltrado ⇒ inflamatorio mononuclear observado en ratas a los 26 días pi (40X) ( ). C. Seudoquiste de T. cruzi observado 26 días pi (40X) (→). La tinción de los cortes fue realizada con hematoxilina-eosina. →

44

Biomédica 2007;27(supl.1):40-9

Lesiones del miocardio durante la enfermedad de Chagas

Figura 3. Corte de tejido cardiaco de rata infectada con la cepa Mg8 a los 60 días pi. A. Quiste de T. cruzi (→) e infiltrado → inflamatorio mononuclear ( ) (10X). B. Nido de amastigotes (→) (40X). C. Fibrosis (→ ) (40X). La tinción de los cortes → → en las figuras 3A y 3B se realizó con hematoxilina-eosina. El corte de la figura 3C se tiñó con coloración de tricrómico.

seudoquistes intracelulares por la presencia de formas amastigotas de T. cruzi, reacción inflamatoria focal consistente en cúmulos de mononucleares, edema intersticial y fibrosis focal. En el animal muerto a los 28 días pi se encontró mayor reacción inflamatoria consistente en focos confluentes de células mononucleares con algunos polimorfonucleares neutrófilos alrededor de las fibras cardíacas, miocitolisis y edema. Se identificaron menos fibras cardiacas parasitadas, infiltrado mononuclear en el epicardio y no se observó fibrosis (datos no mostrados). En conclusión, los resultados muestran una grave lesión celular del miocardio en los corazones de estas ratas muertas durante el establecimiento de la infección.

a los 26 pi no fue estadísticamente diferente a aquella obtenida para su respectivo control (figura 5A). De igual forma, cuando se compararon las velocidades de síntesis de ATP para esta enzima en los animales y en sus respectivos controles a

Análisis por PCR
En el corazón de todos los animales infectados se observó la banda de 330 pb esperada para la región variable del marcador k-DNA de T. cruzi (figura 4A). De igual manera, se observó que todas las muestras amplifican la banda de 350 pb para el gen mini-exón, característica del grupo I de T. cruzi (figura 4B).

Actividad de la ATPsintasa mitocondrial
La actividad de la ATPsintasa mitocondrial durante la infección con T. cruzi se determinó en un grupo de cinco animales para el día 26 pi, que representa la fase aguda (figura 5A), y en otro grupo de cinco animales para el día 60 pi, que representa el inicio de la fase crónica (figura 5B). Cada grupo de animales infectados contaba con su respectivo grupo control (n = 5). La actividad de la ATPsintasa mitocondrial durante la infección al miocardio por T. cruzi en animales observada

Figura 4. Amplificación por PCR de la región variable del kDNA (A) y la región intergénica del gen mini-exón (B). Se usó el ADN extraído de corazón de animales infectados a los días 26 y 60 después de la infección (pi). A. Carril 1: escalera de 100pb; carriles 2 a 6: muestras extraídas de tejido cardiaco de ratas a los 60 días pi; carriles 7 a 11: muestras extraídas de tejido cardiaco de ratas a los 26 días pi; carril 12: control positivo (ADN de cepa en cultivo); carril 13: control negativo. B. Carril 1: control negativo; carril 2: escalera de 100pb; carril 3: control positivo (ADN de cepa en cultivo); carril 4: control negativo (animal no infectado); carriles 5 a 9: muestras extraídas de tejido cardiaco de rata a los 60 días pi.; carriles 10 a 14: muestras extraídas de tejido cardiaco de rata a los 26 días pi. Gel de agarosa al 1,5% teñido con bromuro de etidio.

45

Rendón D.A., Genes C.M., Triana O.

Biomédica 2007;27(supl.1):40-9

Figura 5. Actividad de la ATPsintasa mitocondrial en tejido cardiaco de rata a los 26 días pi (A) y 60 días pi (B) con T. cruzi. Los datos son los promedios de cinco mediciones independientes ± SEM (n = 5); p < 0,05 fue el criterio de diferencias estadísticamente significativas. Cada medición independiente se realizó tres veces.

los 60 pi, no se evidenciaron diferencias estadísticamente significativas en la actividad de la ATPsintasa mitocondrial (figura 5B). Discusión La enfermedad de Chagas se presenta con una gran variedad de manifestaciones clínicas y es la mayor causa de miocarditis aguda y de cardiomiopatía crónica en las regiones endémicas de Latinoamérica (21,22). Considerando que las cepas colombianas de T. cruzi muestran tropismo hacia el tejido cardiaco (11), es importante establecer si este tropismo está asociado con la lesión celular del miocardio en el hospedero. Para esto, la lesión celular del miocardio del hospedero se estudió en ratas infectadas con la cepa colombiana Mg8 de Trypanosoma cruzi aislada del vector Triatoma dimidiata silvestre en el mismo año de inicio de este estudio, lo que implica que conserva sus características naturales de virulencia y patogenicidad. Los análisis histopatológicos (figuras 2 y 3) revelaron la capacidad de la cepa colombiana Mg8 para producir lesiones celulares en el miocardio del hospedero, características de la cardiomiopatía chagásica (22-25), lo que muestra que se está frente a una manifestación típica de la enfermedad de Chagas. Así, la presencia continua del parásito en las zonas de lesión del corazón puede ser importante en el origen de la cardiomiopatía chagásica (26). Los resultados moleculares permiten asegurar que todos los organismos infectados tenían en su

tejido cardiaco la presencia del parásito (ADN) o restos de éste, lo que garantiza que en todos los casos en que se evaluó la actividad de la ATPsintasa mitocondrial del miocardio, el parásito manifestó tropismo por el tejido cardiaco. Esto es importante ya que los tejidos de los animales infectados y usados para la determinación de la actividad de la ATPsintasa mitocondrial del miocardio no fueron sometidos a estudios histopatológicos debido a que todo el corazón se necesitó para preparar las suspensiones cardiacas. Los resultados permiten concluir que la cepa Mg8 de Colombia produce importantes lesiones celulares en el tejido cardiaco, activación de la respuesta inmunológica a nivel de este órgano y presencia de las formas replicativas de T. cruzi, tanto a los 26 dpi como a los 60 dpi. Además, la cepa Mg8 es una cepa virulenta y altamente patogénica, hecho corroborado por la mortalidad antes de los 20 dpi que presentaron los ratones utilizados como fuente de tripomastigotes (50% de mortalidad), y la presentada por las ratas utilizadas en la determinación de la curva de parasitemia (30% de mortalidad). Ello permite concluir que esta cepa generó en los individuos infectados un importante proceso degenerativo a nivel celular en el miocardio del hospedero, característico de la cardiopatía chagásica, lo que implica la presencia del parásito o de su ADN en el tejido cardiaco o en las células inflamatorias como un factor que probablemente contribuye en la producción de las lesiones y en la mortalidad observada en los hospederos estudiados (26). Es

46

Biomédica 2007;27(supl.1):40-9

Lesiones del miocardio durante la enfermedad de Chagas

importante destacar que se observaron considerables lesiones celulares del miocardio del hospedero (figura 2) en un periodo relativamente inicial en la curva de parasitemia (26 dpi de la fase aguda), lo que permite concluir que en este inicio de la infección ya hay una manifestación clara de lesiones del miocardio. Existen varias hipótesis sobre la patogénesis de la cardiomiopatía chagásica, como la neurogénica, la autoimmunidad (27-30), los problemas en la micro circulación del corazón (31,32) y las alteraciones en el metabolismo energético mitocondrial del miocardio (2,3). Esta última adquiere gran interés en el estudio de todas las patologías cardiovasculares, ya que más del 90% de la energía necesaria para el funcionamiento de los cardiomiocitos se produce en las mitocondrias. Por tal motivo era importante determinar si la lesión celular del miocardio observada a los 26 y 60 dpi con la cepa colombiana Mg8 de T. cruzi compromete al metabolismo energético mitocondrial del miocardio. En este proceso es crucial la actividad de la ATPsintasa mitocondrial, ya que esta enzima es en última instancia la encargada de sintetizar el ATP mitocondrial necesario para el buen funcionamiento de los cardiomiocitos. La actividad de la ATPsintasa mitocondrial representa en esencia la cantidad de ATP sintetizado por las mitocondrias contenidas en una unidad de tejido (en nuestro caso, 1 mg de proteína total del homogeneizado de tejido cardiaco) por unidad de tiempo. Por ello, la actividad de la ATPsintasa mitocondrial es un criterio del funcionamiento del metabolismo energético mitocondrial del miocardio. Lo más usual es estudiar el metabolismo energético mitocondrial del miocardio en mitocondrias aisladas del tejido cardiaco o en partículas submitocondriales preparadas a partir de las mitocondrias aisladas. Sin embargo, se han reportado alteraciones estructurales y funcionales adicionales en las mitocondrias cuando éstas se aíslan de su ambiente natural (33). Dichas alteraciones adicionales pueden ser más marcadas cuando se usan tejidos isquémicos (34), como es el caso del tejido del corazón durante la infección con T. cruzi (28,29). Por lo tanto, lo más conveniente para evitar estas posibles alteraciones

adicionales de las mitocondrias en los estudios del metabolismo energético mitocondrial durante diferentes lesiones celulares del miocardio es el uso de homogeneizados rápidamente preparados a partir del tejido cardiaco (35,36). En el presente trabajo fue crucial buscar las condiciones experimentales que permitieran diferenciar, usando homogeneizados de tejidos cardiacos infectados con parásitos, la actividad de la ATPsintasa mitocondrial tipo miocardio de la actividad de la ATPsintasa mitocondrial tipo parásito. La clave que permitió usar homogeneizados de tejido cardiaco en el presente trabajo radica que en T. cruzi el complejo I de la cadena transportadora de electrones no está funcionalmente presente (37). De esta forma, si usamos como substrato de respiración glutamato/malato, que pone a funcionar la cadena transportadora de electrones a partir del complejo I, en presencia de ADP sólo las mitocondrias que poseen este complejo (mitocondrias del corazón) podrán sintetizar ATP. Los resultados obtenidos (figura 5A y 5B) indican que durante el proceso de inicio de la enfermedad de Chagas no hay alteración en la actividad enzimática de la ATPsintasa mitocondrial ni en el día 26 pi, fase aguda, ni en el día 60 pi, fase crónica en comparación con los respectivos controles; esto quiere decir que por cada unidad (en nuestro caso 1 mg de proteína total de homogeneizado de tejido cardiaco) de tejido cardiaco infectado con la cepa colombiana Mg8 no hay déficit de cantidad de ATP mitocondrial (necesario para otras funciones celulares) por unidad de tiempo con respecto a los controles. Partiendo del hecho de que la actividad de la ATPsintasa mitocondrial es un criterio del metabolismo energético mitocondrial, estos resultados (figura 5A y 5B) permiten afirmar que el metabolismo energético mitocondrial no está comprometido durante una infección con la cepa colombiana Mg8 a los 26 y 60 días pi, a pesar de las considerables lesiones celulares del miocardio observadas (figuras 2 y 3). La no variación con respecto a cada control de la actividad de la ATPsintasa mitocondrial observada en homogeneizados de tejido cardiaco infectadas con la cepa colombiana Mg8 de T. cruzi no significa que uno de los complejos mitocondriales,

47

Rendón D.A., Genes C.M., Triana O.

Biomédica 2007;27(supl.1):40-9

o la fina sincronización entre estos, no se vea afectado negativamente durante la infección. Es posible que la cantidad de ATP mitocondrial producido por una sola mitocondria en la unidad de tiempo disminuya con respecto a las muestras no infectadas, pero que en un proceso de defensa el tejido cardiaco genere más mitocondrias por unidad de tejido infectado que su control para compensar la caída en la síntesis de ATP mitocondrial por una sola mitocondria. Este aspecto, por ahora simplemente especulativo, amerita futuras investigaciones. Por último, es importante señalar que investigaciones previas reportan alteraciones en la actividad de la ATPsintasa mitocondrial durante una infección con T. cruzi, y con base en esto se concluye que durante la infección hay compromiso del metabolismo energético mitocondrial (2,3). Es plausible que estas alteraciones negativas en la actividad de la ATPsintasa mitocondrial durante una infección del miocardio con T. cruzi sean producto de diferentes mecanismos de lesión celular del miocardio dependientes del tipo de cepa, o de alteraciones adicionales originadas durante la manipulación de las muestras biológicas (33,34), dado que los investigadores utilizaron mitocondrias aisladas y partículas submitocondriales obtenidas a partir de tejidos isquémicos, como es el caso del tejido cardiaco durante una infección con T. cruzi (28,29). En conclusión, nuestros resultados sugieren que el metabolismo energético mitocondrial no está alterado en la lesión celular del miocardio de ratas infectadas con una cepa colombiana de T. cruzi perteneciente al grupo T. cruzi I. Es necesario realizar futuras investigaciones con cepas pertenecientes a los dos grupos de este parásito para entender las manifestaciones clínicas de la enfermedad de Chagas. Agradecimientos Al Laboratorio de Chagas de la Universidad de Antioquia y al Laboratorio de Biofísica de la Universidad Nacional de Colombia sede Medellín. Conflicto de intereses Los autores declaramos que no existe ningún conflicto de intereses.

Financiación Esta investigación fue financiada por el CODI, proyecto CPT 0321 de la Universidad de Antioquia y por el DIME, proyecto 030802601 de la Universidad Nacional de Colombia, sede Medellín. Referencias
1. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the Southern Cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 2. Uyemura SA, Jordani MC, Polizello AC, Curti C. Heart FoF1-ATPase changes during the acute phase of Trypanosoma cruzi infection in rats. Mol Cell Biochem 1996;165:127-33. 3. Vyatkina G, Bhatia V, Gerstner A, Papaconstantinou J, Garg N. Impaired mitochondrial respiratory chain and bioenergetics during chagasic cardiomyopathy development. Biochim Biophys Acta 2004;1689:162-73. 4. Harris DA, Das AM. Control of mitochondrial ATP synthesis in the heart. Biochem J 1991;280:561-73. 5. Garg N, Popov VL, Papaconstantinou J. Profiling gene transcription reveals a deficiency of mitochondrial oxidative phosphorylation in Trypanosoma cruzi infected murine hearts: implications in chagasic myocarditis development. Biochim Biophys Acta 2003;1638:106-20. 6. Jennings RB, Hawkins HK, Lowe JE, Hill ML, Klotman S, Reimer KA. Relation between high energy phosphate and lethal injury in myocardial ischemia in the dog. Am J Pathol 1978; 92:187-214. 7. Boyer PD. The ATP synthase a splendid molecular machine. Annu Rev Biochem 1997;66:717-49. 8. Das Anibh M. Regulation of mitochondrial ATP synthase activity in human myocardium. Clin Sci 1998;94:499-504 9. Das Anibh M. Regulation of the mitochondrial ATPsynthase activity in health and disease. Mol Genet Metab 2003;79:71-82. 10. Senior AE, Nadanaciva S, Weber J. The molecular mechanism of ATP synthesis by Fo F1-ATP synthase. Biochim Biophys Acta 2002;1553:188-211. 11. Mejía AM, Triana O. Análisis por LSSP-PCR de la variabilidad genética de Trypanosoma cruzi en sangre y órganos de ratones. Biomédica 2005;25:76-86. 12. Camargo EP. Growth and differentiation in Trypanosoma cruzi. Origin of metacyclic trypanosomes in liquid media. Rev Inst Med Trop Sao Paulo 1964;12:93-100. 13. Brener Z. Therapeutic activity and criterion of cure on mice experimentally infected with Trypanosoma cruzi. Rev Inst Med Trop Sao Paulo 1962;4:389-96.

48

Biomédica 2007;27(supl.1):40-9

Lesiones del miocardio durante la enfermedad de Chagas

14. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. 15. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. 2 ed. Cold Spring Harbor, New York: Cold Harbor Laboratory Press;1989. 16. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning. A laboratory manual. Cold Spring Harbor, New York: Cold Harbor Laboratory Press;1982. 17. Sturm N, Degrave W, Morel C, Simpson L. Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences. Use in diagnosis of Chagas disease. Mol Biochem Parasitol 1989;33:205-14. 18. Fernández O, Souto RP, Castro JA, Pereira JB, Fernández NC, Junqueira AC, et al. Brazilian isolates of Trypanosoma cruzi from humans and triatomines classified into two lineages using mini-exon and ribosomal RNA sequences. Am J Trop Med Hyg 1998;58:807-11. 19. Nishimura M, Ito T, Change B. Studies on bacterial photophosphorylation. III. A sensitive and rapid method of determination of photophosphorylation. Biochim Biophys Acta 1962;59:177-82. 20. Gornall AG, Bardawill CJ, David MM. Determination of serum proteins by means of the biuret reaction. J Biol Chem 1949;177:751-66. 21. Chagas C. Estado sobre a morfologia e o ciclo evolutivo do Schizotrypanum cruzi, n. gen. sp. agente etiológico de nova entidade mórbida do homen. Mem Inst Oswaldo Cruz 1909;1:159-219. 22. Mukherjee S, Belbin TJ, Spray DC, Iacobas Da, Weiss LM, Kitsis RN, et al. Microarray analysis of changes in gene expression in a murine model of c h r o n i c chagasic cardiomyopathy. Parasitol Res 2003;91:187-96. 23. Moreira da Silva A, Ramirez Le, Vargas M, Chapadeiro E, Brener Z. Evaluation of the rabbit as a model for Chagas disease - II. Histopatologic studies of the Herat, digestive tract and skeletal muscle. Mem Inst Oswaldo Cruz 1996;91:199-206. 24. de Oliveira JS, Bestetti RB, Soares EG, Marin Nieto JA. Ajmaline-induced electrocardiographic changes in chronic Trypanosoma cruzi-infected rats. Trans R Soc Trop Med Hyg 1986;80:415-9. 25. Acosta AM, Santos-Buch CA. Autoimmune myocarditis induced by Trypanosoma cruzi. Circulation 1985;71:1255-61.

26. Jones EM, Colley DG, Tostes S, Lopes ER, VnencakJones CL, McCurley TL. Amplification of a Trypanosoma cruzi DNA sequence from inflammatory lesions in human chagasic cardiomyopathy. Am J Trop Med Hyg 1993;48:348-57. 27. Köberle F. Chagas´ disease and Chagas´ syndroms: the pathology of American trypanosomiasis. Adv Parasitol 1968;6:63-116. 28. Teixeira AR. Patogenia da doenςa de Chagas. J Bras Med 1980;38:23-33. 29. Oliveira JS. A natural human model for intrinsic heart nervous system denervation: Chagas´ cardiopathy. Am Heart J 1985;110:1092-8. 30. Junqueira Junior LF, Beraldo PS, Chapadeiro E, Jesus PC. Cardiac autonomic dysfunction and neuroganglionitis in a rat model of chronic Chagas´ disease. Cardiovasc Res 1992;26:324-9. 31. Rossi MA, Carobrez SG. Experimental Trypanosoma cruzi cardiomyopathy in BALB/c mice histochemical evidence of hypoxic changes in the myocardium. Br J Exp Pathol 1985;66:155-60. 32. Rossi MA. Microvascular changes as a cause of chronic cardiomyopathy in Chagas´s disease. Am Heart J 1990;20:233-6. 33. Nohl H, Gille L, Stanick K. Intracellular generation of reactive oxygen species by mitochondria. Biochem Pharmacol 2005;69:719-23. 34. Veksler VI, Kuznetsov AV, Sharov VG, Kapelko VI, Saks VA. Mitochondrial respiratory parameters in cardiac tissue: a novel method of assessment by using saponin-skinned fibers. Biochim Biophys Acta 1987;892:191-6. 35. Rendon DA, Lopez LF. Mitochondrial oligomycinsensitive ATPase during isoproterenol-induced cell injury of myocardium. Arch Inst Cardiol Mex 2000;70:130-5. 36. Rendon DA, Lopez LF. Activation of mitochondrial oxidative phosphorylation during (+/-)-isoproterenolinduced cell injury of myocardium. Arch Cardiol Mex 2001;71:13-9. 37. Denicola Seoane A, Rubbo H, Prodanov E, Turrens J. Succinate-dependent metabolism in Trypanosoma cruzi epimastigotes. Mol Biochem Parasitol 1992;54: 43-50.

49

Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

Biomédica 2007;27(supl. 1):50-63

ARTÍCULO ORIGINAL

Análisis de polimorfismos en los genes tripanotión reductasa y cruzipaína en cepas colombianas de Trypanosoma cruzi
Winston Rojas 1, Maria Antonieta Caro 1, Juan Guillermo Lopera 1, Omar Triana 2, Juan Carlos Dib 2, Gabriel Bedoya 1
1 2

Genética Molecular, Universidad de Antioquia, Medellín, Colombia. Grupo de Chagas, Universidad de Antioquia, Medellín, Colombia.

Introducción. Los estudios genéticos en Trypanosoma cruzi han buscado establecer asociaciones de variantes genéticas del parásito con manifestaciones clínicas de la enfermedad, origen biológico y geográfico de los aislamientos; sin embargo, los resultados de asociación con los marcadores comúnmente usados en estos estudios han generado mucha controversia, principalmente en la asociación de grupos con características clínicas y epidemiológicas de la enfermedad. Objetivo. Se planteó determinar la variabilidad de genes que codifican para las proteínas tripanotión reductasa y cruzipaína, involucradas en mecanismos de infección y supervivencia del parásito en el hospedador mamífero, y probar la asociación de variantes génicas con origen biológico y geográfico de cepas colombianas de T. cruzi. Materiales y métodos. Se tipificaron por reacción en cadena de la polimerasa- polimorfismo de longitud del fragmento de restricción seis SNPs (Single Nucleotide Polymorphisms) en tripanotión reductasa y ocho SNPs en cruzipaína en 36 cepas colombianas de T. cruzi de diferentes regiones y origen biológico. Resultados. Con las enzimas Acy I y Hae III se determinaron tres genotipos para tripanotión reductasa. Para cruzipaína se identificaron seis genotipos con las enzimas Rsa I, Ban I y Bsu 36I. Conclusiones. Para tripanotión reductasa no fue posible establecer una asociación con el origen biológico o geográfico; sin embargo los alelos producidos en las posiciones 102 y 210, permitieron discriminar los grupos tradicionales I y II. Con los genotipos obtenidos para cruzipaína se establecieron relaciones a estos grupos, origen biológico y geográfico. Los resultados sugieren la utilidad de estos genes como marcadores moleculares para determinar y diferenciar variedades genéticas en T. cruzi. Palabras clave: Trypanosoma cruzi, genes protozoarios, polimorfismo, polimorfismo de longitud del fragmento de restricción, Colombia. Analysis of polymorphisms in the trypanothione reductase and cruzipain genes in Colombian strains of Trypanosoma cruzi Introduction. Genetic studies of Trypanosoma cruzi have tried to establish relations between genetic variants and their biological characteristics, such as clinical manifestations, host or geographic origin. However, much controversy exists on the associations between the commonly used DNA markers with group, clinical characteristics and disease epidemiology. Objective. In this study determined the variability of the genes that code for the proteins trypanothione reductase and cruzipain, both involved in the infection and survival of the parasite in the mammalian host, was studied and the association between genetic polymorphism and biological and geographic sources in Colombian T. cruzi strains was examined. Materials and methods. The genotypes for each of six SNPs (single nucleotide polymorphisms) for trypanothione reductase and eight SNPs for cruzipain genes were identified by polymerase chain reaction-restriction fragment length polymorphism.in 36 T. cruzi Colombian stocks from several regions and biological origins.

50

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Results. Three genotypes were identified for trypanothione reductase with Acy I and Hae III enzymes and six genotypes for cruzipain with the Rsa I, Ban I and Bsu 36I enzymes. Conclusions. For trypanothione reductase ,an association was not established with biological or geographical origin; however, alleles at positions 102 and 210 allowed discrimination with groups I and II. For cruzipain, specific genotypes were associated with group, biological and geographic origin. The usefulness of molecular markers on these genes was demonstrated for the determination and differentiation of genetic varieties in T. cruzi. Key words: Trypanosoma cruzi, genes, protozoan polymorphism, restriction fragment length polymorphism; Colombia.

Trypanosoma cruzi, el flagelado que causa la enfermedad de Chagas, realiza su ciclo de vida entre reservorios mamíferos e insectos de la familia Reduviidae. Para este protozoario se ha propuesto un modo de reproducción predominantemente clonal (1), con lo cual se esperaría encontrar una baja diversidad. Sin embargo, al evaluar marcadores fenotípicos, morfológicos y bioquímicos (2), muchos estudios muestran, por el contrario, una alta heterogeneidad. Es razonable pensar que esta diversidad pueda estar influyendo, por lo menos en parte, en el rango variable de las manifestaciones clínicas de la enfermedad (2). Con este planteamiento se han emprendido estudios que buscan asociaciones entre la heterogeneidad genética del parásito y la heterogeneidad clínica de la enfermedad (3-9).
Con el uso de marcadores de ADN anónimos (Random Amplified Polymorphic DNA, RAPD) o en los genes kADN, espaciadores intergénicos del gen mini-exón, y en el ADN ribosomal se ha logrado determinar grupos y subgrupos de T. cruzi e incluso establecer un patrón regional en relación con estas divisiones (10-15). Sin embargo, hasta la fecha existe mucha controversia sobre las reales asociaciones entre los grupos y las características clínicas y epidemiológicas de la enfermedad, puesto que ambos grupos se han encontrado en todos los estados de transmisión, en diversas fases de la enfermedad y en sus diferentes rasgos fenotípicos (16). Es también razonable pensar que, de existir una asociación,
Correspondencia: Winston Rojas, Calle 62 # 52-59, Sede de Investigación Universitaria (SIU), 4 piso- 430, Medellín, Colombia. Tel. (4) 2106464, fax: (4) 210 64 69. winstonrojas@yahoo.com Recibido: 20/12/05; aceptado: 07/04/06

sería útil estudiar los genes involucrados en procesos como la infección de la célula hospedera, la supervivencia y la progresión del ciclo de vida del parásito, así como aquellos útiles en evadir la respuesta inmune del hospedero, podrían ser un blanco importante. El genoma de T. cruzi consta de aproximadamente 22.570 genes, de los cuales casi el 50% conforma grupos parálogos. Entre ellos se encuentra la cruzipaína (Crp), que pertenece a una familia de cisteín peptidasas compuesta por 20 miembros por genoma haploide (17). El porcentaje restante corresponde a genes de copia única como la tripanotión reductasa (TriR) (18). Los tripanosomátidos carecen de la enzima glutatión peroxidasa y para defenderse del estrés oxidativo utilizan el tripanotión reducido en un sistema propio de estos organismos (19). Esta reducción es catalizada por la tripanotión reductasa, una flavoproteína dependiente de NADPH, la cual además participa en el metabolismo y detoxificación de drogas y en la reducción de precursores para la síntesis de ADN (20,21). En Leishmania spp. este sistema está involucrado en la supervivencia intracelular del parásito (22). El gen que codifica para esta enzima también ha demostrado ser útil en la determinación de grupos dentro de T. cruzi, pues ha revelado la existencia de cuatro grupos principales en lugar de las dos divisiones ya conocidas (18). La cruzipaína pertenece a la familia de las cisteín proteinasas, y es codificada por un alto número de genes organizados como grupos localizados en diferentes cromosomas (23,24). Por tener un elevado número de copias se ha encontrado una variabilidad que va desde la ausencia de diferencias entre las copias (25) hasta formas muy divergentes, como es el caso de la cruzipaína 2

51

Rojas W., Caro M.A., Lopera J.G. et al

Biomédica 2007;27(supl. 1):50-63

(26,27). El dominio C terminal de la cruzipaína es responsable del carácter inmunodominante antigénico de esta proteína en infecciones humanas naturales (28), en las que la gran mayoría de los anticuerpos detectados en el suero de pacientes chagásicos crónicos está dirigida contra este dominio (29). La cruzipaína y su actividad como proteasa se ha implicado en funciones tan importantes como la supervivencia y la progresión en el ciclo de vida del parásito (30,31), la penetración e invasión del tripomastigote en la célula hospedadora (32-34), la protección contra la respuesta inmune del hospedero (35) y la diseminación del parásito (2). El análisis de las secuencias disponibles en las bases de datos para estos dos genes muestra un nivel de polimorfismo que no se ha evaluado en cepas de Colombia. Dada la importancia de estos genes en el ciclo de vida del parásito se propuso examinar la variabilidad genética de tripanotión reductasa (TriR) y cruzipaína (Crp) en relación con el origen geográfico y biológico en cepas de T. cruzi de Colombia. Conociendo la variabilidad de estos genes en cepas que circulan en nuestro país, se podrá en el futuro proponer estudios de asociación entre esta variabilidad y la enfermedad. Materiales y métodos Se analizaron 36 cepas colombianas de T. cruzi y 7 clones de la cepa Cas15, provenientes de diferentes hospederos, vectores y regiones de Colombia (cuadro 1). Se incluyeron las cepas de referencia Tulahuen y CL clasificadas como T. cruzi II. Todas las cepas y los clones provinieron del banco de cepas del Laboratorio de Chagas de la Universidad de Antioquia, donde son mantenidas en medio de cultivo LIT suplementado con suero bovino fetal a 27,5°C (36). El ADN del parásito se obtuvo por el método salting out (37) y su concentración se midió por densidad óptica a 260 nm (38). El ADN se disolvió en 50 µl de H2O dd y se almacenó a -20°C para su posterior genotipificación. El diseño experimental incluyo un análisis de las secuencias disponibles en www.ncbi.nlm.nih.gov y www.tigr.org. Para TriR se usaron 41 secuencias de ADN (cuadro 2) y para Crp, 10 secuencias

(nueve de Crp1 y una de Crp2, cuadro 3), las cuales fueron alineadas usando el algoritmo Clustal W (39). Para Crp2 se cuenta con mayor número de caracteres y por ello se usó como referencia para el alineamiento. La identificación de sitios polimórficos y su posible discriminación en ensayos de reacción en cadena de la polimerasapolimorfismos de longitud de fragmentos de restricción (polymerase chain reaction-restriction fragment lenght polymorphisms, PCR-RFLP) se realizó usando los programas pDRAW32 (www.acaclone.com), DAMBE (39) y DnaSP (40). Con las secuencias disponibles se diseñaron los cebadores para el fragmento de TriR (TriR directo: 5´AGTGTTACTTTCGAGAGCG3´; TriR inverso: 5´GTAGAAGTCGGATATTTTGG3´), los cuales amplifican una región de 564 pb, correspondiente a las posiciones 726 a 1.290 de la secuencia AF359000, pero numeradas en el cuadro 2 como posiciones 1 a 564 según el fragmento amplificado, y para el fragmento del gen Crp (Crp directo: 5´GTTGAGTGCCAGTGGTTTC3´; Crp reverso: 5´TGGTCAGGAGACACTGACC3´), los cuales producen un fragmento de 700 pb correspondiente a las posiciones 1.346 a 2.046 de la secuencia M90067 (cuadro 3). Las reacciones de amplificación se realizaron en un volumen de 25 µL (Tris-HCl 10mM, pH 8.0, KCl 50mM, MgCL2 2.4 mM, dNTP 0.1mM, 0.1 µM de cada cebador, 1 U Taq ADN polimerasa Promega® y 50 ng de ADN molde). El perfil térmico para ambos marcadores fue de un minuto de desnaturalización a 94°C, un minuto de alineamiento a 54°C para Crp y 56°C para TriR y extensión del cebador por un minuto a 72°C, para un total de 35 ciclos para Crp y 30 ciclos para TriR. Las reacciones de amplificación se observaron en electroforesis en geles de agarosa al 1,5% seguida de tinción con bromuro de etidio. Los fragmentos amplificados incluyen regiones polimórficas que pueden ser resueltas con las enzimas mostradas en las cuadros 2 y 3. Para cruzipaína, las enzimas Rsa I, Bsu 36I y Ban I permiten la diferenciación de polimorfismos en tercera posición, mientras que Dra III permite la identificación de una transición A:G en la posición 457, la cual da lugar a un cambio de alanina por serina. Ambas formas de la cruzipaína poseen

52

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Cuadro 1. Origen geográfico, biológico y clasificación previa de los aislamientos de Trypanosoma cruzi. ID se refiere al código de identificación. Cepa AMP 07 AF 1 Yg03 Cas 18 HA Cas16 Cas 15 B138 B114 B51 Sb 1 Ac17 Mag 11 Mag 1 Mag5 Mag 9 Mag8 Mag 10 Putumayo4 SN3 SN 8 SN5 SN6 So 6 OV 1 G20 Gal 34 W3534 Gal 61 Gal 52 LB53 Ov17 So5 So8 STP 2.2 Coy8 Tulahuen CL Cas 15 cl 47 Cas 15 cl 48 Cas 15 cl 49 Cas 15 cl 55 Cas 15 cl 56 Cas 15 cl 73 Cas 15 cl 79 Origen geográfico Antioquia Antioquia Antioquia Casanare Casanare Casanare Casanare Córdoba Córdoba Córdoba Córdoba Chocó Magdalena Magdalena Magdalena Magdalena Magdalena Magdalena Putumayo Sierra Nevada Sierra Nevada Sierra Nevada Sierra Nevada Sucre Sucre Sucre Sucre Sucre Sucre Sucre Sucre Sucre Sucre Sucre Tolima Tolima Chile Brasil Casanare Casanare Casanare Casanare Casanare Casanare Casanare Origen biológico ID internacional IPANS/CO/1997/AMP07 I-PANS/CO/93/Af1 I-PANS/CO/97/YG 03 M.DID/CO/02/CAS18 M-HUM/CO/97/HA I.RHO/CO/00/CAS16 TPRX/CO/2000/CAS15 I-TRI/CO/99B138 I-TRI/CO/99/B114 TPAC/CO/1999/B51 I-RHO/CO/98/Sb1 I-RHO/CO/99/Ac17 I:RHO/CO/03/MG11 I.RHO/CO/01/MG1 TCUS/CO/2003/MG5 I.TRI/CO/03/MG9 TDIM/CO/2003/MG8 TDIM/CO/2003/MG10 I.RHO/CO/01/PUT-4 TPRX/CO/2003/SN3 I.RHO/CO/03/SN-8 TPRX/CO/2003/SN5 TPRX/CO/2003/SN6 I.RHO/CO/94/SO6 I-PANS/CO/98/Ov1 TPAC/CO/1997/G20 TPAC/CO/1991/Gal 34 M-HUM/CO/98/W3534 MMUS/CO/91/Gal61 MDID/CO/1991/Gal 52 TDIM/CO/1999/LB53 I.PANS/CO/98/OV17 I.RHO/CO/94/SO5 TPAC/CO/1995/So8 I.RHO/CO/91/COY6 M.DID/CO/91/COY8 TINF/CH/1956/Tulahuen TINF/BR/1963/CL X X X X X X X Grupo I IIb I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II II I I I I I I I

P. geniculatus P. geniculatus P. geniculatus D. marsupialis H. sapiens R. prolixus R. prolixus T. dimidiata T. dimidiata R. pallescens R. pallescens R. pallescens R. pallescens R. pallescens E. cuspidatus T. dimidiata T.dimidiata T.dimidiata R. robustus R. prolixus R. prolixus R. prolixus R. prolixus R. pallescens P. geniculatus R. pallescens R. pallescens H. sapiens Ratón D. marsupialis T. dimidiata P. geniculatus R. pallescens R. pallescens R. prolixus D. marsupialis T. infestans T. infestans R. prolixus R. prolixus R. prolixus R. prolixus R. prolixus R. prolixus R. prolixus

los tres sitios de corte identificados para la enzima Rsa I. Sin embargo, a diferencia de la Crp1, la Crp2 carece de diana de corte en la posición 142 para la enzima Ban I (cuadro 3). Las enzimas Bsu 36I y Dra III carecen de sitios de corte en esta isoforma (cuadro 3). Las enzimas utilizadas en el análisis de RFLP de tripanotión reductasa - Acy

I, Hae III y Bsm AI - sólo identifican polimorfismos en la tercera posición. Para verificar la presencia de ambas formas de la cruzipaina se usó la enzima Apa I según el protocolo descrito por Lima et al, 1994 (26); cruzipaína 2 cuenta con un sitio de corte en la posición 298, distinguiendo el sitio variante

53

Rojas W., Caro M.A., Lopera J.G. et al

Biomédica 2007;27(supl. 1):50-63

Cuadro 2. Posiciones evaluadas y enzimas que las reconocen en las secuencias disponibles en las bases de datos públicas para el gen tripanotión reductasa. 59* (HaeIII) † G G G G G G G G G G G G G G G G 101 (Acy I/ 102) C C C C C C C C C C C C T C C C 179 (Acy I) A A A A A A A A A A A A A A A A 211 (HaeIII/ 210) G G G T G G G G G G G G G G G T 331 (Bsm AI) A A A A A A A A A A A A A A A A 535 (BsmAI/ 534) C C C C C C C C C C C C C A C C

ID. Secuencia TC10727 Z13958 AF358981 M38051 AF358975 AF358982 AF358987 AF358971 AF358973 AF358972, AF35976 AF358985,AF358984, AF358983,AF358977, AF358979,AF358980 AF358978,AF358970, AF358969,AF358974 AF358989, AF358988 AF358986 M97953

Grupo I I I I I I I I I I I II II II II

AF359003,AF358997, AF358994, AF358993, AF358992,AF359001, AF358999,AF359005 AF359002,AF358996, AF359000,AF358998, AF359004,AF358991 AF358990 AF358995

II II II

G G G

T T C

A A A

G G T

A A A

C C C

* Posición en la cual la enzima realiza el corte. † Entre paréntesis se indica la enzima que realiza el corte y la posición del polimorfismo que identifica.

297 (cuadro 3) y generando fragmentos de 297 y 403 pb. Los productos de amplificación se sometieron a digestiones simples a un volumen final de 20 µl con 1 U de enzima a 37°C por 16 horas. Una alícuota de 12 µL se analizó en geles de agarosa al 3% teñidos con bromuro de etidio. El resultado de la digestión fue registrado en un analizador de imágenes Gel Doc (BioRad, USA). Los patrones de bandas obtenidos fueron analizados con el software Imagej 1.33 (http://rsb.info.nih.gov/ij) y Quantity One (BioRad, USA). Para cada cepa y para cada gen se definieron los genotipos de acuerdo con los patrones observados en los electroferogramas.

Resultados Los productos de amplificación obtenidos en los ensayos de PCR para TrR y Crp se muestran en la figura 1. Algunos de los perfiles de las digestiones simples se muestran en las figuras 2 a 6. Los resultados de las digestiones se representan como genotipos compuestos de las digestiones simples. De seis sitios evaluados para TriR, sólo dos mostraron polimorfismo. Sólo la combinación de los genotipos obtenidos para las enzimas Hae III y Acy I muestran patrones polimórficos, denominados TriR 1, 2 y 3 (cuadro 4). El genotipo TriR 3 puede definirse con certeza debido a que el corte sólo se presenta ante la presencia de los alelos C y G para los sitios Acy I-102 y Hae III-

54

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Cuadro 3. Posiciones evaluadas y enzimas que las reconocen en las secuencias disponibles en las bases de datos públicas para el gen cruzipaína. 142* (BanI/ 147)† C C C C C C C C C T 151 (RsaI) 222 (DraIII/ 225) G G G G G G G G T G 226 (BanI/ 231) C C C C C T C C C C 257 (Bsu36I/ 258) T G T T T G G G T G 299 (ApaI/ 297) T T T T T T T T T G‡ 430 (RsaI/ 432) C C C C T C C C C C 461 (DraIII/ 462) G G G G G T G G G T 613 (RsaI/ 612) G G C G G G G G G G

Secuencia

Grupo

M84342 TC10685 AF314930 AF314929 AY0317 AF265227 AF265226 U41454 AF004594 M90067 (Cruzipaína2)

II I II II II I I I II I

T T T T T T T T T T

* Posición en la cual la enzima realiza el corte. † Entre paréntesis se indica la enzima que realiza el corte y la posición del polimorfismo que identifica. ‡ Sitio para distinguir las copias reportadas de cruzipaína.

210, respectivamente; este genotipo, presente en 35 de 38 cepas, se encuentra en las cepas caracterizadas como T. cruzi I, en las cuales es definido por la ausencia del alelo T en ambas posiciones (cuadro 4). El genotipo TriR 1, heterocigótico para ambas posiciones, se

encontró en las dos cepas de referencia, de acuerdo con lo reportado en las bases de datos (cuadro 2, identificaciones de acceso: AF358997 y AF359002 para Tulahuen y AF358999 y AF358998 para CL), mientras que el genotipo TriR 2 se encontró en la cepa AF1 proveniente de Amalfi, Antioquia (cuadro 4). Para estos dos genotipos se infiere el alelo T en ambas posiciones debido a que es el polimorfismo alternativo presente en las secuencias analizadas y a que no se reporta otro sitio polimórfico alrededor de la diana de reconocimiento de la enzima. La distribución de estos genotipos no mostró ninguna asociación con origen geográfico o biológico (datos no mostrados). En los ensayos de digestión para Crp, la enzima Apa I permitió identificar la cruzipaína 2 diferenciada por el polimorfismo en la posición 297 (figura 3). La presencia de por lo menos dos copias resulta en patrones de digestión complejos, en los que es posible obtener más de dos alelos para cada posición; para facilitar el análisis, denominamos como genotipo “heterocigoto” a aquel que poseía más de un alelo en un locus, lo cual puede corresponder a diferencias entre copias de Crp o a una condición heterocigótica en sentido estricto. Basados en las secuencias reportadas para Crp, los sitios 150 a 153 representan una diana de

Figura 1. Productos de amplificación obtenidos para cruzipaína (izquierda) y tripanotión reductasa (derecha). Sólo se muestra el producto para algunas cepas del grupo I (Cas15) y grupo II (AF1, Tulahuen y CL). MP = marcador de peso de 100 pb.

55

Rojas W., Caro M.A., Lopera J.G. et al

Biomédica 2007;27(supl. 1):50-63

Figura 2. Patrones RFLP para TriR con la enzima Acy I (A) y Hae III (B) en algunas cepas de los grupos I (Mag1, HA y Mag5) y grupo II (CL, Tulahuen y AF1). MP = Marcador de peso de 50 pb. Los tamaños de los fragmentos se muestran en los electroferogramas (A y B) y en los mapa de restricción (C y D), para cada una de las enzimas y su diana de reconocimiento (y= Purina; r=Pirimidina). Sólo los perfiles para las enzimas que produjeron patrones polimórficos entre cepas son mostrados.

Cuadro 4. Genotipos compuestos Tripanotión reductasa. Cepa TUL, CL AF1 HA, Cas18, Mag5, SN5, SN8, OV1, Cas16, Mag10, LB53, Cas15, Amp07, Yg03, B138, B114, B51, Sb1, Ac17, Mag1, Mag8, Mag9, Mag11, Putumayo4, SN3, SN6, So6, G20, Gal34 W3534, Gal61, Gal52, Ov17, So5, So8, STP2.2, Coy8, Clones Cas 15 *C corte en la posición 101 con la enzima Acy I †G corte en la posición 211 con la enzima Hae III

Acy I 102
C/T* C/C

Hae III 210
G/T† T/T

Genotipo
TriR 1 TriR 2

C/C

G/G

TriR 3

56

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Figura 3. Digestión simple de cruzipaína con la enzima Apa I en cepas del grupo I (Mag5) y del grupo II (Tulahuen) para distinguir la presencia de más de una copia del gen usando el protocolo descrito por Lima et al., 1994.

Figura 4. Patrones RFLP para Crp con la enzima Bsu 36I en cepas del grupo I (Cas15) y II (Tulahuen). Los tamaños de los fragmentos se muestran en el electroferograma (A) y en el mapa de restricción (B).

reconocimiento para la enzima Rsa I con corte en la posición 151 (cuadro 3); estos sitios se reportan monomórficos en todas las secuencias (datos no mostrados), pero en algunas cepas analizadas en este estudio dicha diana se perdió originando genotipos heterocigotos; sus alelos se representan como 1/0 debido a que no se puede comprobar cuál es el sitio polimórfico dentro de la diana de reconocimiento de la enzima (cuadro 5). Los alelos Ban I-C y Rsa I-C en las posiciones 231 y 432, respectivamente, se definen con certeza porque la enzima sólo corta cuando éstos están presentes. Los alelos Ban I-T, Bsu 36I-G y Rsa IT en las posiciones 231, 258 y 432 se infieren debido a que es el polimorfismo alternativo reportado en las secuencias analizadas y a que no se reporta otro polimorfismo alrededor de la diana de reconocimiento para cada enzima. Los sitios evaluados con la enzima Dra III fueron monomórficos y por esto no se consideran en los genotipos compuestos. A diferencia de TriR, y probablemente por la presencia de más de una copia, para Crp se obtuvieron seis genotipos compuestos representados como Crp 1 a Crp 6 (cuadro 5). El genotipo Crp 5, homocigótico para todos los loci, agrupa

26 cepas clasificadas como T. cruzi I (cuadro 5). El genotipo Crp 1 se encontró en las cepas del grupo T. cruzi II y es diferenciado por la presencia del alelo T en la posición 258 (cuadro 5). Éste y el genotipo Crp 3 son los más polimórficos; los genotipos Crp 2, Crp 4 y Crp 6 mostraron polimorfismo en la diana alrededor del sitio 151; adicionalmente, Crp 2 varió en la posición 432, y Crp 4 y Crp 6 variaron en la posición 231 (cuadro 5). Para Crp fue posible establecer algunas asociaciones entre los genotipos y el origen geográfico y biológico de las cepas (cuadro 6). Cuando se consideró el origen geográfico, la región del oriente (departamento de Casanare) mostró ser más diversa, con cuatro de los seis genotipos; dos de ellos, Crp 3 y Crp 6, son específicos de esta región y son diferenciados por el alelo T en el sitio 231. El genotipo Crp 2 se encuentra en el noroccidente (Sucre, Magdalena, Sierra Nevada) y oriente de Colombia (Casanare); este genotipo también se encontró en aislamientos de Rhodnius prolixus, Pastrongylus geniculatus y Eratyrus cuspidatus; entre los hospedadores mamíferos este genotipo sólo se encontró en Didelphis marsupialis (cuadro 6). El genotipo Crp 4 tiene una distribución similar al genotipo Crp 2, pero está ausente en la Sierra

57

Rojas W., Caro M.A., Lopera J.G. et al

Biomédica 2007;27(supl. 1):50-63

Cuadro 5. Genotipos compuestos de cruzipaína. Cepa

Rsa I 151
1/0§ 1/0 1/0 1/0 1/1

Ban I 231*
C/C C/C C/T C/C C/C

Bsu 36I 258†
G/T G/G G/G G/G G/G

Rsa I 432‡
C/T C/T C/T C/C C/C

Genotipo

CL, Tulahuen, AF1 Cas18,Mag5, SN5,SN8,OV 1 HA Cas16, Mag10,LB53 Amp07, Yg03, B138, B114, B51, Sb1, Ac17, Mag1, Mag8, Mag9, Mag11, Putumayo4, SN3, SN6, So6, G20, Gal34, W3534, Gal61, Gal52, Ov17, So5, So8, STP2.2,Coy8, Cas 15, Clones Cas 15
*

Crp Crp Crp Crp

1 2 3 4

Crp 5

1/1

C/T

G/G

C/C

Crp6

C corte en la posición 226 †G no corte en la posición 257 ‡C corte en la posición 430 §1 = corte; 0 = no corte

Figura 5. Patrones RFLP para Crp con la enzima Ban I en cepas del grupo I (Cas15) y II (Tulahuen). Los tamaños de los fragmentos se muestran en el electroferograma (A) y en el mapa de restricción (B). La banda de 558 pb se explica por la ausencia de corte en la posición 226 y la banda de 226 pb, por ausencia de corte en la posición 142.

Figura 6. Patrones RFLP para Crp con la enzima RsaI en cepas del grupo I (Cas15 y HA) y II (Tulahuen). Los tamaños de los fragmentos se muestran en el electroferograma (A) y en el mapa de restricción (B). La banda de 430 pb se explica por la ausencia de corte en la posición 151; la banda de 462 pb, por la ausencia de corte en la posición 430; la banda de 613 pb, por la ausencia simultánea de corte en las posiciones 151 y 430.

58

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Cuadro 6. Distribución de genotipos compuestos de acuerdo con el departamento o región de procedencia y con el origen biológico de las cepas estudiadas. Genotipo compuesto Departamento/Región (No. de cepas) Chile (1) Brasil (1) Antioquia (1) Casanare (1) Magdalena(1) Sierra Nevada (2) Sucre (1) Casanare (1) Casanare (1) Magdalena (1) Sucre (1) Antioquia (2) Córdoba (4) Chocó (1) Magadalena (4) Sierra Nevada (2) Putumayo (1) Sucre (9) Origen biológico (No. de cepas)

Crp 1 *1/0 C/C G/T C/T Crp 2 1/0 C/C G/G C/T Crp 3 1/0 C/T G/G C/T Crp 4 1/0 C/C G/G C/C

T. infestans (1) T. infestans (1) P. geniculatus (1) D. E. R. P. marsupialis (1) cuspidatus (1) prolixus (2) geniculatus (1)

H. sapiens (1) R. prolixus (1) T. dimidiata (1) T. dimidiata (1) P. geniculatus (2) T. dimidiata (2) R. pallescens (2) R. pallescens (1) R. pallescens (2) T. dimidiata (2) R. prolixus (2) R. robustus (1) R. pallescens (5) P. geniculatus (1) D. maruspialis (1) H. sapiens (1) Ratón (1) R. prolixus (1) D. marsupialis (1) R. prolixus (1)

Crp 5 1/1 C/C G/G C/C

Tolima (2) Crp 6 1/1 C/T G/G C/C *1 = corte; 0 = no corte Casanare (1)

Nevada de Santa Marta; este genotipo está asociado a R. prolixus y Triatoma dimidiata, principales vectores domiciliados. El genotipo Crp 5 fue el más frecuente; se presentó en todas las regiones del occidente de la cordillera oriental, en la totalidad de los hospederos mamíferos y en la mayoría de los insectos vectores, a excepción de E. cuspidatus; es el único genotipo encontrado en los 10 aislamientos de Rhodnius pallescens. En R. prolixus se encontró el mayor número de genotipos (Crp 2, Crp 4, Crp 5 y Crp 6). Discusión La evaluación de TriR con las enzimas Acy I y Hae III permitió distinguir cepas de los grupos

previamente descritos con otros marcadores moleculares. Las cepas del grupo T. cruzi I evaluadas en este estudio mostraron en las posiciones 102 y 211 ausencia del alelo T (cuadro 4). Al considerar las secuencias reportadas, el alelo T en la posición 102 está ausente de todas las cepas del grupo I, como también en algunas del grupo II; el alelo T en la posición 211 fue consistente con las cepas del grupo T. cruzi II en nuestros ensayos; sin embargo, los datos de secuencias muestran que este alelo también puede estar presente en cepas de T. cruzi I (cuadro 2), por lo que no puede considerársele un alelo específico de grupo. El gen TriR es codificado por un locus único en el genoma de T. cruzi (18) y la condición

59

Rojas W., Caro M.A., Lopera J.G. et al

Biomédica 2007;27(supl. 1):50-63

heterocigótica observada en el genotipo compuesto TriR 1 (C/T y G/T) podría reflejar cualquiera de varias situaciones: una combinación de clones en la cepa (41-43), o una heterocigosis “real” causada por mutación o intercambio genético dentro del grupo T. cruzi II (18,44-47). Si se considera la naturaleza heterogénea de los aislamientos originales de cepas de T. cruzi (42), ello podría argumentarse a favor de la primera situación. Sin embargo, no es posible descartar que los genotipos heterocigotos encontrados representen eventos antiguos de intercambio génico (18,44-47), en particular en el sitio 210, el cual puede ser producto de intercambio entre genotipos homocigotos. La evaluación del gen TriR en cepas de Colombia mostró en nuestro análisis una baja diversidad de genotipos. El cálculo del polimorfismo (θ) y diversidad nucleotídica (π) a partir de las secuencias reportadas para este gen fue de 0,0083+/-0,00186 y 0,011+/-0,00062, respectivamente. Una relación de menor polimorfismo con una mayor diversidad permite suponer que se trata de un gen sujeto a selección, o que efectivamente existe una estructura clonal en las cepas de Colombia; sin embargo, esta afirmación requeriría de confirmación, dado que los rangos de estos valores se superponen. Esta afirmación puede contradecirse si se considera que el polimorfismo en dichas secuencias se localiza en terceras posiciones del codón, dando lugar a cambios neutros. La tripanotión reductasa cumple una función en la detoxificación de productos endógenos y exógenos en el ciclo de vida del parásito y nuestros resultados no muestran una asociación con origen biológico; ello sugiere que, de estar sujeta a selección, su fuerza no ha operado diferencialmente entre los distintos orígenes biológicos y geográficos de donde proceden las cepas. Por este bajo polimorfismo, esta proteína podría constituirse en un blanco adecuado para diseños terapéuticos (48,49). La presencia de por lo menos dos formas de Crp hace más complejo el análisis tanto de los genotipos como de su asociación con orígenes geográficos y biológicos. El mayor polimorfismo de este gen (cuatro sitios polimórficos de ocho sitios evaluados, excluido el sitio Apa I) dio lugar

a seis genotipos, en contraste con tres genotipos para TriR, lo cual concuerda con la presencia de más de una copia del gen. Desde este punto de vista, muchas cepas (genotipo Crp 5) podrían representar eventos de concertación génica (5052) en los que los loci de ambas copias son homocigóticos; pero esto requiere asumir hipótesis ad hoc de mutación para los mismos loci en otras cepas (genotipos Crp 1 a 4). Algunos estudios previos con cepas de Colombia han podido establecer relaciones entre genotipos de T. cruzi con ciclos de transmisión (53,54). En este estudio no fue posible establecer relaciones entre genotipos TriR y Crp y ciclos de transmisión, debido a que no se evaluaron cepas aisladas de vectores domiciliados; las cepas SN se obtuvieron de R. prolixus al interior de las viviendas, pero su ubicación dentro de un nicho selvático en la Sierra Nevada de Santa Marta podría introducir errores en dichas comparaciones. Sin embargo, se pudo evaluar la relación entre genotipos y el origen geográfico y biológico de las cepas, en particular con las especies de vectores. En cuanto a Crp , se puede concluir que el departamento del Casanare es la región con más diversidad de genotipos (cuadro 6). De acuerdo con esto, en estudios previos (53,55) se determinó que la región de los Llanos Orientales exhibió un alto número de fenotipos isoenzimáticos. Dada la alta prevalencia de la enfermedad en esta región (IV Reunión de la Comisión Intergubernamental de la Iniciativa Andina de Control de la Transmisión Vectorial y Transfusional de Chagas. Guayaquil, 2003;56,57), valdría la pena formular hipótesis sobre la diversidad de T. cruzi en relación con la eficacia biológica (58) y con la epidemiología de la enfermedad. En cuanto a las asociaciones con los vectores, también se puede concluir que en R. pallescens, el vector/hospedero de donde proviene el mayor número de cepas en este estudio, se encontró exclusivamente el genotipo compuesto Crp 5; vale la pena evaluar también una hipótesis de especificad parásito-vector ampliando los marcadores en aislamientos de este vector. En contraste, en las demás especies de vectores se encontró más de un genotipo; en R. prolixus,

60

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

principal vector de la enfermedad de Chagas en el país, se encontró el mayor número de genotipos; éste es un insecto ampliamente distribuido en regiones distantes de Colombia; la importancia de este aspecto también puede evaluarse en relación con sus implicaciones por sus hábitos antropofílicos y su domiciliación. Las cepas provenientes de P. geniculatus, aunque con una distribución más restringida, también mostraron tres de seis genotipos; esta diferencia en la diversidad genotípica entre especies podría reflejar el efecto de filtros biológicos selectivamente diferentes (59,60). Usando marcadores de isoenzimas, RAPDs y ADNr, se ha podido demostrar la mayor prevalencia del grupo T. cruzi I en el país (53-55,61). Con dos sistemas diferentes en genes codificadores de proteínas también fue posible en este estudio reproducir esta observación, agrupándose la mayoría de cepas del grupo I dentro de los genotipos TriR 3 y Crp 5; esta consistencia de agrupación con diferentes sistemas refuerza así la estructura clonal de las poblaciones de T. cruzi. Los resultados de este estudio sugieren que estos genes son útiles como posibles marcadores moleculares para determinar y diferenciar variedades genéticas en T. cruzi, y permiten plantear la futura evaluación de la hipótesis sobre la interacción parásito-hospedero. Conflicto de intereses Los autores declaramos que no existe ningún conflicto de intereses. Financiación El estudio fue desarrollado como parte del proyecto 1115-04-14387 financiado por Conciencias. Referencias
1. Tibayrenc M, Kjellberg F, Ayala FJ. A clonal theory of parasitic protozoa: the population structures of Entamoeba, Giardia, Leishmania, Naegleria, Plasmodium, Trichomonas and Trypanosoma and their medical and taxonomical consequences. Proc Natl Acad Sci USA 1990;87:2414-8. 2. Scharfstein J, Morrot A. A role for extracellular amastigotes in the immunopathology of Chagas disease. Mem Inst Oswaldo Cruz 1999;94(Suppl 1):51-63.

3. Brener Z. Biology of Trypanosoma cruzi. Annu Rev Microbiol 1973;27:347-82. 4. Melo RC, Brener Z. Tissue tropism of different Trypanosoma cruzi strains. J Parasitol 1978;64:47582. 5. Andrade Z, Brener ZE. Trypanosoma cruzi e Doença de Chagas. Rio de Janeiro: Ed. Guanabar Koogan; 1979. 6. Andrade SG, Andrade V, Brodskyn C, Magalhaes JB, Netto MB. Immunological response of Swiss mice to infection with three different strains of Trypanosoma cruzi. Ann Trop Med Parasitol 1985;79:397-407. 7. de Castro SL, de Meirelles M de N. Effect of drugs on Trypanosoma cruzi and on its interaction with heart muscle cell in vitro . Mem Inst Oswaldo Cruz 1987;82:209-18. 8. Neal RA, van Bueren J. Comparative studies of drug susceptibility of five strains of Trypanosoma cruzi in vivo and in vitro . Trans R Soc Trop Med Hyg 1988;82:709-14. 9. Vago AR, Andrade LO, Leite AA, d’Avila Reis D, Macedo AM, Adad SJ, et al. Genetic characterization of Trypanosoma cruzi directly from tissues of patients with chronic Chagas disease: differential distribution of genetic types into diverse organs. Am J Pathol 2000;156:1805-9. 10. Morel C, Chiari E, Camargo EP, Mattei DM, Romanha AJ, Simpson L. Strains and clones of Trypanosoma cruzi can be characterized by pattern of restriction endonuclease products of kinetoplast DNA minicircles. Proc Natl Acad Sci USA 1980;77:6810-4. 11. Souto RP, Zingales B. Sensitive detection and strain classification of Trypanosoma cruzi by amplification of a ribosomal RNA sequence. Mol Biochem Parasitol 1993;62:45-52. 12. Tibayrenc M, Neubauer K, Barnabe C, Guerrini F, Skarecky D, Ayala FJ. Genetic characterization of six parasitic protozoa: parity between random-primer DNA typing and multilocus enzyme electrophoresis. Proc Natl Acad Sci USA 1993; 90:1335-9. 13. Souto RP, Fernandes O, Macedo AM, Campbell DA, Zingales B. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi . Mol Biochem Parasitol 1996;83:141-52. 14. Momen H. Taxonomy of Trypanosoma cruzi : a commentary on characterization and nomenclature. Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):181-4. 15. Brisse S, Dujardin JC, Tibayrenc M. Identification of six Trypanosoma cruzi lineages by sequencecharacterized amplified region markers. Mol Biochem Parasitol 2000;111:95-105. 16. Brisse S, Barnabé C, Tibayrenc M. Trypanosoma cruzi: How many relevant phylogenetic subdivisions are there? Parasitol Today 1998;14:178-9.

61

Rojas W., Caro M.A., Lopera J.G. et al

Biomédica 2007;27(supl. 1):50-63

17. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, Tran A, et al. The genome sequence of Trypanosoma cruzi , etiologic agent of Chagas disease. Science 2005;309:409-15. 18. Machado CA, Ayala FJ. Nucleotide sequences provide evidence of genetic exchange among distantly related lineages of Trypanosoma cruzi. Proc Natl Acad Sci USA 2001;98:7396-401. 19. Krieger S, Schwarz W, Ariyanayagam MR, Fairlamb AH, Krauth-Siegel RL, Clayton C. Trypanosomes lacking trypanothione reductase are avirulent and show increased sensitivity to oxidative stress. Mol Microbiol 2000;35:542-52. 20.Schmidt A, Krauth-Siegel RL. Enzymes of the trypanothione metabolism as targets for antitrypanosomal drug development. Curr Top Med Chem 2002;11:1239-59. 21. Fairlamb AH, Cerami A. Metabolism and functions of trypanothione in the Kinetoplastida. Annu Rev Microbiol 1992;46:695-729. 22. Dumas C, Ouellette M, Tovar J, Cunningham ML, Fairlamb AH, Tamar S, et al . Disruption of the trypanothione reductase gene of Leishmania decreases its ability to survive oxidative stress in macrophages. EMBO J 1997;16:2590-8. 23. Eakin AE, Mills AA, Harth G, McKerrow JH, Crack CS. The sequence, organization, and expression of the major cysteine protease (cruzain) from Trypanosoma cruzi. J Biol Chem 1992;267:7411-20. 24. Campetella O, Henriksson J, Aslund A, Frasch AC, Petterson U, Cazzulo JJ. The major cysteine proteinase (cruzipain) from Trypanosoma cruzi is encoded by multiple polymorphic tandemly organized genes located on different chromosomes. Mol Biochem Parasitol 1992;50:225-34. 25. Tomas AM, Kelly JM. Stage-regulated expression of cruzipain, the major cysteine protease of Trypanosoma cruzi is independent of the level of RNA1. Mol Biochem Parasitol 1996;76:91-103. 26. Lima AP, Tessier DC, Thomas DY, Scharfstein J, Storrer AC, Vernet T. Identification of new cysteine protease gene isoforms in Trypanosoma cruzi . Mol Biochem Parasitol 1994;67:333-8. 27. Lima AP, dos Reis FC, Serveau C, Lalmanach, Juliano L, Ménard R, et al. Cysteine protease isoforms from Trypanosoma cruzi , cruzipain 2 and cruzain, present different substrate preference and susceptibility to inhibitor. Mol Biochem Parasitol 2001;114:41-52. 28. Cazzulo JJ, Stoka V, Turk V. Cruzipain, the major cysteine proteinase from the protozoan parasite Trypanosoma cruzi. Biol Chem 1997;378:1-10. 29. Cazzulo JJ. Cruzipain, major cysteine proteinase of Trypanosoma cruzi : sequence and genomic

organization of the codifying genes. Medicina (B Aires) 1999;59 (Suppl. 2):7-10. 30. Engel JC, Doyle PS, Hsieh I, McKerrow JH. Cysteine protease inhibitors cure an experimental Trypanosoma cruzi infection. J Exp Med 1998;188:725-34. 31. Klemba M, Goldberg DE. Biological roles of proteases in parasitic protozoa. Annu Rev Biochem 2002;71:275-305. 32. Del Nery E, Juliano MA, Lima AP, Schafstein J, Juliano L. Kininogenase activity by the major cysteinyl proteinase (cruzipain) from Trypanosoma cruzi. J Biol Chem 1997;272:25713-8. 33. Scharfstein J, Schmitz V, Morandi V, Capella MM, Lima AP, Morrot A, et al. Host cell invasion by Trypanosoma cruzi is potentiated by activation of bradykinin B(2) receptors. J Exp Med 2000;192:1289-300. 34. Aparicio IM, Scharfstein J, Lima AP. A new cruzipainmediated pathway of human cell invasion by Trypanosoma cruzi requires trypomastigote membranes. Infect Immun 2004;72:5892-902. 35. Berasain P, Carmona C, Frangione B, Cazzulo JJ, Goni F. Specific cleavage sites on human IgG subclasses by cruzipain, the major cysteine proteinase from Trypanosoma cruzi . Mol Biochem Parasitol 2003;130:23-9. 36. Camargo EP. Growth and differentiation in Trypanosoma cruzi. I. Origin of metacyclic trypanosomes in liquid media. Rev Inst Med Trop Sao Paulo 1964;12:93-100. 37. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. 38. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. Second edition. Cold Spring: Harbor Laboratory Press; 1989. 39. Xia X , Xie Z. DAMBE: software package for data analysis in molecular biology and evolution. J Hered 2001;92:371-3. 40. Rozas J, Sanchez-DelBarrio JC, Messeguer X, Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 2003;19:2496-7. 41. Carreño H, Rojas C, Aguilera X, Apt W, Miles MA, Solari A. Schizodeme analyses of Trypanosoma cruzi zymodemes from Chile. Exp Parasitol 1987;64:252-60. 42. Macedo AM, Pena SD. Genetic variability of Trypanosoma cruzi: implications for the pathogenesis of Chagas disease. Parasitol Today 1998;14:119-23. 43. Solari A, Wallace A, Ortiz S, Venegas J, Sánchez G. Biological characterization of Trypanosoma cruzi stocks from Chile. Exp Parasitol 1998;89:312-22. 44. Bogliolo AR, Lauria-Pires L, Gibson W. Polymorphisms in Trypanosoma cruzi : evidence of genetic recombination. Acta Trop 1996;61:31-40.

62

Biomédica 2007;27(supl. 1):50-63

Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

45. Gaunt MW, Yeo M, Frame IA, Stothard JR, Carrascos HJ, Taylor MC, et al. Mechanism of genetic exchange in American trypanosomes. Nature 2003;421:936-9. 46. Brisse S, Henriksson J, Bernabé C, Douzery EJ, Berkvens D, Serrano M, et al. Evidence for genetic exchange and hybridization in Trypanosoma cruzi base on nucleotide sequences and molecular karyotype. Infect Genet Evol 2003;2:173-83. 47. Sturm NR, Vargas NS, Westenberger SJ, Zingales B, Campbell DA. Evidence for multiple hybrid groups in Trypanosoma cruzi. Int J Parasitol 2003;33:269-79. 48. Paulino M, Iribarne F, Dubin M, Aguilera-Morales S, Tapia O, Stoppani AO. The chemotherapy of Chagas’ disease: an overview. Mini Rev Med Chem 2005;5:499-519. 49. Meiering S, Inhoff O, Mies J, Vincek A, Garcia G, Kramer B, et al . Inhibitors of Trypanosoma cruzi trypanothione reductase revealed by virtual screening and parallel synthesis. J Med Chem 2005;48:4793-802. 50. Zimmer EA, Martin SL, Beverly SM, Kan YM, Wilson AC. Rapid duplication and loss of genes coding for the a chain of haemoglobin. Proc Natl Acad Sci USA 1980;77:2158-62. 51. Lynch M, Conery LM. The evolutionary fate and consequences of duplicate genes. Science 2000;290:1151-5. 52. Hurles M. Gene duplication: the genomic trade in spare parts. PloS Biol 2004;2:E206. 53. Saravia NG, Holguín AF, Cibulskis RE, D´Alessandro A. Divergent isoenzyme profiles of sylvatic and domiciliary Trypanosoma cruzi in the Eastern plains, piedmont, and highlands of Colombia. Am J Trop Med Hyg 1987;36:59-69.

54. Cuervo P, Cupolillo E, Segura I, Saravia N, Fernandes O. Genetic diversity of Colombian sylvatic Trypanosoma cruzi isolates revealed by the ribosomal DNA. Mem Inst Oswaldo Cruz 2002;97:877-80. 55. Jaramillo N, Moreno J, Triana O, Arcos-Burgos M, Muñoz S, Solari A. Genetic structure and phylogenetic relationships of Colombian Trypanosoma cruzi populations as determined by schizodeme and isoenzyme markers. Am J Trop Med Hyg 1999;61: 986-93. 56. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the Southern Cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 57. Guhl F, Restrepo M, Angulo VM, Antunes CMF, Campbell-Lendrum D, Davies CR. Lessons from a national survey of Chagas disease transmission risk in Colombia. Trends Parasitol 2005;21:259-62. 58. Hartl CL, Clark AG. Principles of population genetics. Sunderland, Massachusetts; Sinauer Associate: 1997. 59. Garcia ES, Gonzalez MS, Azambuja P. Biological factors involving Trypanosoma cruzi life cycle in the invertebrate vector, Rhodnius prolixus . Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):213-6. 60. Azambuja P, Garcia ES, Ratcliffe NA. Gut microbiota and parasite transmission by insect vectors. Trends Parasitol 2005;21:568-72. 61. Rodríguez P, Escalante M, Díez H, Cuervo C, Montilla M, Nicholls RS, et al. Estudio de la variabilidad de seis cepas colombianas de Trypanosoma cruzi mediante polimorfismos de longitud de los fragmentos de restricción (RFLP) y amplificación aleatoria de ADN polimórfico (RAPD). Biomédica 2002;22:263-71.

63

Botero L.A., Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

Biomédica 2007;27(supl.1):64-74

ARTÍCULO ORIGINAL

Caracterización biológica y genética de dos clones pertenecientes a los grupos I y II de Trypanosoma cruzi de Colombia
Luz Adriana Botero, Ana María Mejía, Omar Triana
Grupo de Chagas, Instituto de Biología, Universidad de Antioquia, Medellín, Colombia.

Introducción. T. cruzi I y T. cruzi II son grupos genéticamente diferentes y se cree que dicha variabilidad es determinante del tropismo tisular en el hospedero vertebrado y responsable de las diversas manifestaciones clínicas de la enfermedad de Chagas. Objetivo. Caracterizar biológica y genéticamente dos clones colombianos de los grupos T. cruzi I y II en el modelo murino. Materiales y métodos. Las cepas CAS15 y AF1 pertenecientes a los grupos T. cruzi I y II fueron clonadas en medio semisólido. Un clon de cada una de ellas y una mezcla de ambos se utilizaron para infectar ratones, los cuales se sacrificaron a diferentes tiempos post-infección. Para analizar la presencia del parásito en sangre y diferentes órganos, se utilizaron el microhematocrito y la reacción en cadena de la polimerasa con los marcadores de la secuencia satélite del ADN nuclear y con el espaciador intergénico del gen mini-exón. Resultados. El clon T. cruzi I fue más infectivo, observándose un tropismo preferencial por corazón, recto y músculo esquelético, mientras que el clon T. cruzi II presentó un tropismo preferencial por bazo e hígado. Durante la infección con la mezcla de los clones, se observó que el clon T. cruzi I predominó sobre el T. cruzi II tanto en sangre como en órganos. Conclusiones. Los resultados confirman que las diferencias genéticas entre los grupos de T. cruzi podrían estar determinando el tropismo tisular y de esta manera jugar un papel fundamental en el entendimiento de las manifestaciones clínicas de la enfermedad de Chagas en Colombia. Palabras claves: Trypanosoma cruzi, enfermedad de Chagas, variación (Genética), tropismo. Biological and genetic characterization of two Colombian clones of Trypanosoma cruzi groups I and II Introduction. Genetic differences between T. cruzi I and T. cruzi II may determine differences in their tissue tropism in the vertebrate host and may also be responsible for the differences in clinical manifestations of Chagas disease. Objective. Two Colombian clones of the T. cruzi groups I and II were characterized biologically and genetically in a murine model. Materials and methods. Strains Cas15 and AF1 belonging to the T. cruzi groups I and II were cloned in semisolid medium. A clone of each strain and a mix of both were used to infect mice; the mice were subsequently sacrificed at selected post-infection intervals. In order to identify the parasite presence in blood and organs, two methods were used (a) microhematocrit and (b) polymerase chain reaction with primers for satellite DNA and the intergenic region of miniexon. Results. The T. cruzi I clone was more infectious, with a preferential tropism observed in heart, rectum and skeletal muscle, whereas clone T. cruzi II exhibited a preferential tropism for spleen and liver. During the infection with the clone mixture a predominance of the T. cruzi I clone over clone II in blood as well as in organs was observed. Conclusions. The results corroborate that the genetic differences between the T. cruzi groups correlate with their tissue tropism, and can play an essential role in explaining the clinical manifestations of Chagas disease observed in Colombia. Key words: Trypanosoma cruzi, Chagas disease, variability (Genetics), tropism.

64

Biomédica 2007;27(supl.1):64-74

Caracterización de clones de Trypanosoma cruzi I y II

La enfermedad de Chagas, causada por el parásito Trypanosoma cruzi , se encuentra ampliamente distribuida en países de Centro y Sur América, afectando aproximadamente a 20 millones de individuos (1). En Colombia, afecta a cerca del 5% de la población y aproximadamente el 11% está en riesgo de contraer la infección (2). La enfermedad presenta un curso clínico variable que inicia con una fase aguda asintomática, caracterizada por alta parasitemia y detección de T. cruzi prácticamente en todos los órganos del hospedero (3). La enfermedad avanza a una fase crónica, caracterizada por baja parasitemia y un impredecible curso clínico que puede involucrar problemas cardiacos o gastrointestinales (4). En esta fase el parasitismo en tejidos es muy alto y restringido a algunos órganos como corazón, músculo esquelético, hígado, esófago, bazo y recto (5,6). La habilidad del parásito para sobrevivir a la fase aguda y avanzar hacia la fase crónica e invadir determinados órganos depende tanto de factores genéticos del parásito como del hospedero (7-11). Por esto, diversas investigaciones han estudiado la variabilidad genética del parásito y su posible relación con las manifestaciones clínicas de la enfermedad (7). En T. cruzi se han utilizado diferentes marcadores bioquímicos y moleculares para tratar de correlacionar la diversidad genética del parásito con sus características biológicas. El uso del espaciador intergénico de los genes mini-exón genera dos claras divisiones filogenéticas conocidas como T. cruzi I y T. cruzi II (12), las cuales permiten establecer algunas asociaciones importantes entre la taxonomía y la biología del parásito, el desarrollo de la enfermedad y diferentes parámetros epidemiológicos, entre otros (13,14). Tradicionalmente, el grupo T. cruzi I se ha asociado al ciclo selvático de transmisión y se dice que predomina en los países ubicados al norte de la cuenca amazónica, entre ellos Colombia,
Correspondencia: Omar Triana Chávez, Calle 62 N° 52-59, Sede de Investigación Universitaria SIU, U de A, Medellín, Antioquia, Colombia, teléfono 2106520, fax 2105622, otriana@gmail.com Recibido: 19/12/05; aceptado: 24/04/06

mientras que el grupo T. cruzi II predomina en los países del sur y se encuentra asociado a los humanos y, por ende, al ciclo doméstico de transmisión (15). Por otra parte, se ha visto que áreas con gran morbilidad presentan la circulación del grupo T. cruzi II, mientras que en donde circula el grupo T. cruzi I es poco frecuente la enfermedad (7). Sin embargo, estudios recientes muestran que los dos grupos están circulando en ambos ambientes (13-16); en Venezuela, por ejemplo, un estudio realizado durante el año 2004 reveló un mayor número de pacientes infectados con el grupo T. cruzi I que presentaban la fase aguda de la enfermedad con manifestaciones clínicas similares a las observadas en pacientes infectados con el grupo T. cruzi II (16). Así mismo, en infecciones experimentales se ha encontrado que el grupo al que pertenecen los parásitos determina el tropismo a tejidos, la parasitemia y la patogénesis de la enfermedad (1,7,17). En Colombia también se ha reportado recientemente la presencia simultánea de los dos grupos filogenéticos en varias de las cepas estudiadas, evidenciando una mezcla de ambos, pero con predominio del grupo I en medios de cultivo (18). Este resultado, junto con el hallazgo de los dos grupos de T. cruzi en las heces de vectores recolectados de poblaciones silvestres del norte de Colombia (datos no publicados), sugiere la posibilidad de que ambos grupos circulan de manera simultánea en la naturaleza, generando una epidemiología más compleja, pues tanto vectores como hospederos podrían estar infectados con los dos grupos y, en éstos últimos, darse un tropismo diferencial a tejidos ocasionando manifestaciones clínicas diversas (1,18,19). Por lo anterior, y teniendo en cuenta que en Colombia se ha reportado la presencia de los dos grupos de T. cruzi, el objetivo del presente trabajo fue caracterizar biológica y genéticamente dos clones de T. cruzi aislados de cepas colombianas pertenecientes a los grupos I y II. Para esto, se evaluó el tropismo a órganos de ratones infectados individualmente con cada uno de ellos y durante una infección mixta con ambos clones. Este aspecto es de gran importancia para entender las manifestaciones clínicas y la epidemiología de la enfermedad de Chagas en Colombia.

65

Botero L.A., Mejía A.M., Triana O.

Biomédica 2007;27(supl.1):64-74

Materiales y métodos

Parásitos
Se utilizaron las cepas colombianas I.RHO/CO/ 00/CAS-15.CAS (CAS15) y I·PANS/CO/93/AF1.ANT (AF1) caracterizadas genéticamente por isoenzimas, por RAPD y con el marcador miniexón como T. cruzi I y T. cruzi IIb, respectivamente (datos no publicados). La cepa CAS15 se aisló en el año 2000 del vector Rhodnius prolixus silvestre del departamento de Casanare y la cepa AF1 del vector Panstrongylus geniculatus silvestre del municipio de Amalfi, departamento de Antioquia. Las cepas se han mantenido en el laboratorio del Grupo de Chagas de la Universidad de Antioquia por repiques cada siete días en medio de cultivo LIT suplementado con suero bovino fetal al 10% y a una temperatura de 28°C (20).

que se han encontrado en las cepas mezclas de ambos grupos (18). Para amplificar dicha región se utilizaron los iniciadores TC1 (5´-GTGTCCGCCACCT-CCTTCGGGCC-3´), TC2 (5´-CCTGCAGGCACACGTGTGTGTG-3´) y TCC (5´-CCCCCCTCCCAGGCCACACTG-3´), los cuales amplifican un fragmento de 350 pb para el grupo T. cruzi I y un fragmento de 300 pb para el grupo T. cruzi II (13). La PCR se hizo en un volumen final de 25 µl que contenían 2,5 µl de ADN molde, 50 mM KCl, 10mM Tris-HCl, 0,1% Triton X-100, 1,5mM MgCl2, 12,5 pmol de cada iniciador, 200mM dNTPs y 0,625 unidades de Taq ADN polimerasa. Los ciclos de amplificación se realizaron a una temperatura inicial de 94°C por 3 minutos, seguida de 27 ciclos a 94°C por 30 segundos, 55°C por 30 segundos, 72°C por 30 segundos y un ciclo final de 72°C por 10 minutos. Para determinar si los clones aislados eran genéticamente diferentes se utilizó la técnica PCR de baja astringencia con un único iniciador específico (LSSP-PCR), que requiere un primer paso de amplificación de la región variable del ADN del cinetoplasto (kADN). Para amplificar dicha región se utilizaron los iniciadores S35 (5´AAATAATGTACGGGGAGATGCATGA-3´) y S36 (5´-GGGTTCGATTGGGGTTGGTGT-3´), los cuales amplifican un fragmento de 330 pb correspondiente a la región variable de los minicírculos (24). La PCR se llevó a cabo en un volumen final de 50 µL de reacción que contenía 1 ml de ADN molde, 50 mM de KCl, 10 mM TrisHCl, 0,1% Triton X-100, 1,5 mM de MgCl2, 10 pmol de cada iniciador, 200 mM de dNTPs y 2,5 unidades de Taq ADN polimerasa. Los ciclos de amplificación se realizaron a una temperatura inicial de 94°C por 3 minutos, seguida de 35 ciclos de 94°C por 45 segundos, 63°C por 45 segundos y 72°C por 45 segundos, y un ciclo final de 72°C por 10 minutos. La banda de 330 pb, obtenida del kADN, se purificó a partir de geles de agarosa de bajo punto de fusión al 1,5% y se diluyó 10 veces en agua bidestilada. Se usó 1 µl de la dilución como molde para la reacción de LSSP-PCR (24), la cual se llevó a cabo en 25 µl de volumen final utilizando 50 mM

Clonación de las cepas
Los clones para cada una de las cepas fueron obtenidos a partir de epimastigotes cultivados en medio semisólido AGAR-LIT-BHI-sangre (21). Para esto se mezclaron 50 ml de agar estéril con pH 7,2, 100ml de LIT con suero bovino fetal al 10%, 100 ml de infusión de hígado y corazón (BHI) estéril y 6,25 ml de sangre desfibrinada. A continuación, se vertieron 25 ml de esta mezcla en cajas de Petri de 95 mm de diámetro y, luego de comprobar la esterilidad del medio, se sembraron 20 células por caja. Posteriormente se envolvieron las cajas en papel estéril y se incubaron aproximadamente 30 días a 28°C hasta observar el crecimiento de colonias puntiformes transparentes. Se aislaron y cultivaron siete clones para la cepa CAS15 y dos para la cepa AF1 en medio LIT suplementado con suero bovino fetal al 10%, según lo reportado previamente (22).

Extracción de ADN y caracterización genética de los clones en cultivo
El ADN de las cepas parentales y de sus respectivos clones se obtuvo por el método salting out (23). Cada clon se caracterizó genéticamente por la técnica de reacción en cadena de la polimerasa (PCR) con el espaciador intergénico de los genes del mini-exón para evaluar si efectivamente el grupo de T. cruzi encontrado correspondía al de su cepa de origen, debido a

66

Biomédica 2007;27(supl.1):64-74

Caracterización de clones de Trypanosoma cruzi I y II

de KCl, 10 mM Tris-HCl, 0,1% Triton X-100, 1,5 mM de MgCl2, 120 pmoles del iniciador S35, 200 mM de cada dNTP y 4 unidades de Taq polimerasa. Los ciclos de amplificación se realizaron a una temperatura inicial a 94°C por 3 minutos, seguida de 35 ciclos a 94°C por 45 segundos, 30°C por 45 segundos y 72°C por 45 segundos y un ciclo final a 72°C por 10 minutos (5). Los productos amplificados se analizaron en geles de poliacrilamida al 6% (25) teñidos con nitrato de plata (1). Este procedimiento se realizó por duplicado con el fin de evaluar la reproducibilidad de la técnica.

cloroformo-alcohol isoamilico (25:24:1), previa homogenización en solución de digestión (SDS 10%, NaCl 5 M, EDTA 0,5M, Tris-HCL 1M pH 7,5) y proteinasa K (100mg/ml), con posterior precipitación con etanol (27).

Detección del parásito por PCR
Para determinar si el parásito se encontraba presente en los diferentes órganos de los tres tipos de infección se usó una secuencia satélite del ADN nuclear de T. cruzi (Sat-ADN). Para amplificar el Sat-ADN se utilizaron los iniciadores TcZI (5´-CGAGCTCTTGCCCACACG GGTGCT-3´) y TcZII (5´-CCTCCAAGCAGCGG ATAGTTCAGG-3´), los cuales amplifican un fragmento de 188 pb (28). La PCR se llevó a cabo en un volumen final de 50 µL de reacción que contenía 1 µl de ADN molde, 50 mM de KCl, 10 mM Tris-HCl, 0,1% Triton X-100, 1,5 mM de MgCl2, 20 pmol de cada iniciador, 200 mM de dNTPs, y 2,5 unidades de Taq ADN polimerasa. Los ciclos de amplificación se realizaron a una temperatura inicial de 94°C por 3 minutos, seguida de 35 ciclos de 94°C por 45 segundos, 60°C por 1 minuto y 72°C por 1 minuto, y un ciclo final de 72°C por 10 minutos. Además, para determinar el grupo filogenético presente en las muestras de sangre y órganos de la infección con la mezcla de los clones se utilizó el marcador mini-exón mediante el procedimiento descrito anteriormente. Los productos amplificados fueron analizados en geles de agarosa al 2%, teñidos con bromuro de etidio y visualizados bajo un transiluminador UV (29). Cada uno de estos ensayos se hizo por duplicado. Resultados

Infección experimental de ratones
Tres grupos de dieciocho ratones machos suizos de 20 días de nacidos fueron inoculados intraperitonealmente con tripomastigotes obtenidos de medio de cultivo de cada clon y con una mezcla de ambos. El inoculo utilizado fue de 800.000 tripomastigotes de cada clon, tanto en las infecciones individuales como en la mixta. Para determinar la presencia de parásitos en sangre, al séptimo día de infección se revisaron los ratones por el método del microhematocrito y se tomó una muestra de sangre de la cola de los ratones infectados con la mezcla de los clones en un trozo de tela para su posterior análisis por PCR (26). Para determinar la presencia de los clones en órganos, se sacrificaron grupos de tres ratones de cada infección y se les extrajo corazón, hígado, bazo, recto y músculo esquelético tomado del fémur de cada ratón. Estos procedimientos se repitieron cada siete días hasta llegar al día 28 y luego se hicieron a los días 60 y 90 de la infección (pi). Como control negativo se utilizó un ratón macho suizo no infectado al que se le tomaron las mismas muestras. El sacrificio de los ratones se llevó a cabo por el método de inhalación de CO2, el cual fue aprobado por el Comité de Bioética de la Universidad de Antioquia.

Aislamiento y caracterización genética de los clones
Para la cepa CAS15 se aislaron 7 clones, los cuales se denominaron como CAS15 cl1 hasta CAS15 cl7. Todos los clones amplificaron la banda de 350 pb para el marcador del gen miniexón, característica del grupo T. cruzi I (figura 1). Para la cepa AF1 se aislaron dos clones a los que se les denominó AF1 cl1 y AF1 cl2, los cuales

Extracción del ADN
La obtención del ADN de la tela impregnada con sangre de los ratones se hizo por el método de Chelex®, que consiste en adicionar a la sangre una resina y someterla a altas temperaturas que liberan el ADN en el sobrenadante (26). El ADN de los órganos fue extraído por el método de fenol-

67

Botero L.A., Mejía A.M., Triana O.

Biomédica 2007;27(supl.1):64-74

amplificaron la banda de 300 pb, característica del grupo T. cruzi II (figura 1). El análisis de los patrones electroforéticos con la técnica LSSP-PCR indicó que los clones CAS15 cl1, CAS15 cl3, CAS15 cl4, CAS15 cl5 y CAS15 cl6 presentaron un patrón de bandas idéntico, mientras que los clones CAS15 cl2 y CAS15 cl7 presentaron perfiles únicos (figura 2). Debido al bajo número de clones obtenidos para la cepa AF1 no se realizó el análisis por LSSP-PCR. Para realizar la caracte-rización biológica de los clones pertenecientes a estos dos grupos de T. cruzi se seleccionaron al azar los clones CAS15 cl3 y AF1 cl1.

positivas. A los días 21, 28 y 60 pi, todas las muestras analizadas para el clon CAS15 cl3 fueron positivas, mientras que para el clon AF1 cl1 se encontró al día 21 pi un 41% de muestras positivas y a los días 28 y 60 pi un 100%. Para la infección con la mezcla de los clones se encontró que los parásitos aparecieron en sangre el mismo día que el clon CAS15 cl3, presentando un 100% de muestras positivas. Al día 90 pi se observó ausencia de parásitos en todas las muestras (cuadro 1).

Detección del parásito por PCR en sangre y órganos de ratones
Las muestras de sangre positivas por PCR amplificaron sólo la banda de 350 pb, indicando la predominancia del grupo T. cruzi I (figura 3). Con el marcador sat-ADN se observó que el porcentaje de órganos parasitados disminuyó con el transcurso de la infección, encontrándose a los días 7, 14 y 21 pi un tropismo por casi todos los órganos, tanto en infecciones individuales como en la mixta, mientras que a partir del día 28 pi se observó un histotropismo preferencial de cada clon. En las infecciones individuales se encontró la presencia del clon CAS15 cl3 en el 88,8% de los corazones y en el 100% de los músculos esqueléticos analizados, mientras que en recto, hígado y bazo se observó el 66,6, 44,4 y 38,8% de infección, respectivamente. Con el clon AF1 cl1 se observó un porcentaje de infección en bazo, hígado, músculo esquelético y recto del 83,3, 61,1, 50 y 27,7%, respectivamente, mientras que el corazón de estos ratones no presentó infección. Con la infección mixta se encontró un porcentaje de infección en corazón y músculo esquelético del 100%, mientras que en recto, hígado y bazo se encontró una infección del 94,4, 72,2 y 11,1%, respectivamente (cuadro 2 y figuras 4a, 4b y 4c). La caracterización molecular con el marcador miniexón de los parásitos presentes en órganos durante la infección mixta reveló en todos los órganos positivos un amplificado de 350 pb, mostrando un 88,9% de corazones y un 66,7% de músculos esqueléticos positivos, mientras que el recto e hígado mostraron un porcentaje de infección del 44,4 y 11,1%, respectivamente. Sin embargo, las muestras de bazo positivas con

Detección de parásitos en sangre por microhematocrito
Durante la infección individual con el clon Cas15 cl3 se observó que los parásitos en sangre comenzaron a aparecer al día 7 de la infección (pi), con un 78% de muestras positivas, mientras que para la infección con el clon AF1 cl1 los parásitos en sangre empezaron a aparecer al día 14 pi, encontrándose sólo un 28% de muestras

Figura 1. Amplificación por PCR de la región intergénica del gen mini-exón para los clones aislados de las cepas CAS15 y AF1. M: marcador de tamaño molecular, escalera de 100 pb. CN: control negativo. CAS15 y AF1: cepas parentales. Carriles 1 a 7: clones 1 al 7 de la cepa CAS 15. Carriles 8 a 9: clones 1 y 2 de la cepa AF1.

Figura 2. LSSP-PCR de los siete clones aislados de la cepa CAS15. M: marcador de tamaño molecular, escalera de 50 pb. Carriles 1 a 7: clones 1 al 7 de la cepa CAS 15. * Diferencias en el perfil de bandas.

68

Biomédica 2007;27(supl.1):64-74

Caracterización de clones de Trypanosoma cruzi I y II

Cuadro 1. Detección por microhematocrito del parásito en sangre de ratones infectados con los clones CAS15 cl3, AF1 cl1 y con la mezcla de ambos. Ratones 7 8 9 + + + + +

Parásitos Clon CAS15 cl3

Día pi. 7 14 21 28 60 90 7 14 21 28 60 90 7 14 21 28 60 90

1 +

2 +

3 +

4 + -

5 -

6 + -

10 + +

11 + +

12 + + +

13 + + + + + + + + + + + +

14 + + + + + + + + + + +

15 + + + + + + + + + + + +

16 + + + + + + + + + + + + + -

17 + + + + + + + + + + + -

18 + + + + + + + + + + + + -

ClonAF1 cl1

-

-

-

-

-

-

+

-

-

+

+ + +

+

Mezcla

+

+

+

+ -

+ -

+ -

+ +

+ +

+ + +

+ + +

+ + +

+ + + +

+: Positivo; -: negativo. La región en blanco corresponde a ratones sacrificados el día indicado. pi: post-infección

diferencial por tejidos del hospedero durante la fase crónica de la enfermedad (1). Muchas de las cepas naturales de T. cruzi son multiclonales y se encuentran compuestas de poblaciones del parásito tanto del grupo T. cruzi I como del grupo T. cruzi II. Sin embargo, este número de clones puede cambiar drásticamente a medida que trascurre el tiempo de infección, ya que en la fase crónica de la enfermedad ciertos clones del parásito son eliminados probablemente como resultado de factores inmunológicos del hospedero o debido a la capacidad de multiplicación o requerimientos nutricionales de cada clon (30). En el presente trabajo, mediante una infección mixta de clones pertenecientes a los dos grupos de T. cruzi, se simularon las condiciones de una infección natural en el modelo murino, permitiendo entender varios aspectos de la enfermedad, entre ellos, cuál es el genotipo causante de un tropismo específico y cuál de estos predomina en el hospedero después de un largo periodo de infección. La clonación de las cepas de T. cruzi ha permitido establecer la homogeneidad o heterogeneidad genética y el comportamiento biológico y

Figura 3. Amplificación de la región intergénica del gen miniexón en el día 7 después de la infección en sangre de ratones inoculados con la mezcla de los clones. M: marcador de tamaño molecular, escalera de 100 pb. CN: control negativo. CAS15: cepa parental. Carriles 1 a 8: sangre de ratones.

sat-ADN no amplificaron con el marcador miniexón, imposibilitando determinar el grupo filogenético presente en dicho órgano (figura 5). Discusión La enfermedad de Chagas se considera un problema de salud pública en muchos países por la gran cantidad de personas afectadas y la variedad de manifestaciones clínicas con que se presenta. Muchos estudios han llevado a pensar que dicha variación está ligada directamente al genotipo de los parásitos circulantes, ya que diferencias genéticas en las poblaciones del parásito hacen que estos presenten un tropismo

69

Botero L.A., Mejía A.M., Triana O.

Biomédica 2007;27(supl.1):64-74

Figura 4. Amplificación de la secuencia satélite del ADN nuclear de T. cruzi en órganos de ratones inoculados con los clones CAS15 cl3 (a), AF1 cl1 (b), con la mezcla de ambos, y de ratón negativo no infectado (c). M: marcador de tamaño molecular, escalera de 100 pb. CN: control negativo. CAS 15 y AF1: cepas parentales. Ratones 1 y 10: sacrificados a los días 7 y 60 después de la infección, respectivamente. c: corazón. h: hígado. b: bazo. r: recto. m: músculo esquelético.

Cuadro 2. Detección del parásito por PCR en órganos de ratones infectados con los clones CAS15 cl3, AF1 cl1 (marcador Sat-ADN) y con la mezcla de ambos. Parásitos Clon CAS15.3 Día post-infección 7 14 21 28 60 90 7 14 21 28 60 90 7 14 21 28 60 90 Corazón 2 3 3 2 3 3 0 0 0 0 0 0 3/3 3/2 3/2 3/3 3/3 3/3 Hígado 3 3 2 0 0 0 3 0 2 2 2 2 3/1 3/1 3/0 2/0 1/0 1/0 Bazo 3 2 1 1 0 0 3 1 2 3 3 3 1/0 1/0 0/0 0/0 0/0 0/0 Recto 3 3 1 2 2 1 3 2 0 0 0 0 2/2 3/2 3/1 3/1 3/1 3/1 Músculo esquelético 3 3 3 3 3 3 0 1 2 2 2 2 3/1 3/1 3/1 3/3 3/3 3/3

Clon AF1.1

Mezcla

Órganos de ratones inoculados con la mezcla que amplificaron por mini-exón la banda de 350 pb correspondiente al grupo T. cruzi I. Número de ratones positivos con Sat-ADN/número de ratones positivos con mini-exón.

70

Biomédica 2007;27(supl.1):64-74

Caracterización de clones de Trypanosoma cruzi I y II

infección de cada clon, encontrándose un genotipo más infectivo en el clon CAS15 cl3. Reportes previos han encontrado en suero de humanos provenientes de Argentina, Chile y Brasil anticuerpos contra los dos grupos de T. cruzi (32), indicando infección con ambos grupos. Los resultados obtenidos en este estudio con el marcador mini-exón nos permiten inferir que probablemente haya en la sangre de los ratones inoculados con la mezcla de los clones un predominio del clon CAS15 cl3 con respecto al clon AF1 cl1, ya que las pocas muestras que se encontraron positivas amplificaron la banda de 350 pb. Sin embargo, podría pensarse también que en sangre había muy pocos parásitos pertenecientes a ambos clones, principalmente al clon AF1 cl1, y que éstos fueron escasamente detectados por la PCR con dicho marcador. Por otra parte, numerosos estudios han mostrado que durante la fase crónica de la enfermedad los parásitos ya han invadido y colonizado órganos y, por tanto, no están circulando en sangre, lo que se verificó en este estudio, pues se encontró una ausencia total de parásitos en sangre a los tres meses después de la infección, tanto en las infecciones individuales como en la mixta. Trabajos previos en ratones machos BALB/c han demostrado que luego de tres meses de infección, periodo correspondiente a la fase crónica de la enfermedad en dicho modelo experimental, diferentes clones de T. cruzi presentan distribuciones titulares diferenciales (9). Así mismo, otros autores han mostrado un tropismo preferencial de la cepa CAS15 por corazón (18) y de la cepa AF1 por bazo e hígado (33). Nuestro estudio apoya tales resultados, al ser el corazón uno de los órganos que más se encontró parasitado con el clon CAS15 cl3, y el hígado y el bazo con el clon AF1 cl1 en la fase crónica de la infección. Esta idea nos permite sugerir que la variabilidad genética de los parásitos es uno de los factores determinantes de la distribución diferencial en los tejidos y, probablemente, de las manifestaciones clínicas de la enfermedad de Chagas. Por otro lado, se ha encontrado que tanto en Chile como en otros países del Cono Sur, donde se sabe que prevalece el grupo T. cruzi II, predominan

Figura 5. Amplificación de la región intergénica del gen miniexón en órganos de ratones inoculados con la mezcla de los clones. M: marcador de tamaño molecular, escalera de 100 pb. CN: control negativo. AF1: cepa parental. Ratón negativo: control no infectado con T. cruzi; ratones 7 y 10: sacrificados a los días 28 y 60 después de la infección, respectivamente. c: corazón. h: hígado. b: bazo. r: recto. m: músculo esquelético.

bioquímico de las poblaciones del parásito que las componen. Campos y Andrade (31) encontraron que la cepa 21SF, aislada de un paciente en la fase aguda de la enfermedad, presentó homogeneidad en cuanto a parámetros biológicos y bioquímicos entre los clones y subclones que la componen, sugiriendo la presencia de un clon principal representante del comportamiento biológico de dicha cepa. Los resultados encontrados en este estudio, específicamente durante la clonación de la cepa CAS15, nos permiten sugerir que también se observa la predominancia de un clon, ya que los perfiles de bandas obtenidos con la LSSP-PCR son iguales para cinco de los siete clones aislados. Por otra parte, se podría pensar que muchos de los resultados encontrados en este trabajo son consecuencia del clon seleccionado, pues al ser uno de los predominantes en la cepa CAS15 puede sobresalir frente al clon de AF1 debido a una mayor capacidad de replicación, favoreciendo su presencia en el transcurso de la infección como se observó en el presente estudio. En cuanto a la cinética de aparición de los clones en sangre de los ratones en los diferentes cortes de tiempo pi, se encontró que los dos clones presentaron diferentes tiempos de aparición. El clon CAS15 cl3 apareció en sangre en el día 7 pi y el clon AF1 cl1, en el día 14. Además, la cantidad de muestras de sangre de ratones que fueron positivas en todos los tiempos de infección fue mayor para el clon CAS15 cl3 que para el AF1 cl1. Estos resultados evidencian la capacidad de

71

Botero L.A., Mejía A.M., Triana O.

Biomédica 2007;27(supl.1):64-74

las formas digestivas de la enfermedad (7), mientras que en Colombia la manifestación clínica más frecuente es la cardiaca. Nuestros resultados aportan evidencia que confirma que la forma cardiaca de la enfermedad en Colombia puede ser causada por T. cruzi I, puesto que el clon AF1 cl1, representante de T. cruzi II en Colombia, no invadió corazón, mientras que el clon del grupo I se encontró en la mayoría de los corazones. Sin embargo, es necesario que en futuros estudios se evalúe el tropismo tisular de un mayor número de clones pertenecientes a T. cruzi II para verificar lo anterior. Nuestros resultados concuerdan con lo planteado por N. Añez y col (16), quienes encontraron que la infección con T. cruzi I presenta parasitemias mucho más altas que las causadas por T. cruzi II y que, además, T. cruzi I genera en pacientes durante la fase crónica un alto grado de daño en miocardio y músculo esquelético (34). Por el contrario, otros autores han encontrado que las infecciones con T. cruzi II son bastante graves y que comprometen algunos tejidos como recto y esófago (1,16,31). Los resultados encontrados en este estudio muestran que la parasitemia y el tropismo por órganos de parásitos pertenecientes al grupo T. cruzi II es menor que la de parásitos del grupo T. cruzi I, con tropismo preferencial por bazo e hígado. Consideramos que estas diferencias pueden deberse al alto polimorfismo encontrado en parásitos pertenecientes al grupo T. cruzi II, ya que se ha comprobado que los diferentes subgrupos en los que se encuentra dividido difieren en su infectividad, virulencia y patogenicidad. Como ejemplo está el clon CLBrener, perteneciente al grupo T. cruzi IIe, que después de ser inoculado en ratas presentó una alta tasa de mortalidad al sobrevivir a la fase aguda de la infección (31). Es importante destacar que diversos estudios han reportado el músculo esquelético como uno de los órganos que más se encuentra parasitado con T. cruzi tanto en la fase aguda como en la fase crónica de la enfermedad (35). Lo encontrado en este estudio corrobora lo anterior, pues en las infecciones individuales ambos clones se encuentran parasitando dicho músculo. Además, los resultados obtenidos en este órgano y en el

hígado fueron muy interesantes, ya que a pesar de que el parasitismo en dichos órganos se observó en las dos infecciones individuales, durante la infección mixta sólo se encontró la presencia del grupo T. cruzi I (clon CAS15 cl3). Esto podría explicarse por diferencias entre los dos clones en la cinética de la fase aguda, ya que las respuestas inmunes estimuladas por una población de T. cruzi podrían favorecer la invasión y colonización tisular de la otra (16). Además, como se ha informado anteriormente, algunos clones pueden ser eliminados por su inhabilidad para competir y propagarse en el hospedero, o por la acción de sus mecanismos de defensa (36). Se podría pensar también en la posibilidad de que ambos grupos lleguen a infectar los órganos, pero al igual que ocurre con las cepas, T. cruzi II no se puede detectar por estar presente en menor proporción. A pesar de que el mini-exón es un buen marcador para diferenciar los dos grupos de T. cruzi, los resultados obtenidos mostraron que no fue muy sensible en la detección del parásito, posiblemente por su bajo número de copias comparado con el marcador sat-ADN. Finalmente, nuestro trabajo aporta evidencia que sugiere que en Colombia el grupo T. cruzi I es más virulento que T. cruzi II y probablemente por ello es que predomina en las infecciones. Además, se comprueba que el polimorfismo genético de las poblaciones de T. cruzi puede ejercer influencia sobre el tropismo tisular y consecuentemente sobre las manifestaciones clínicas de la enfermedad. Estos aspectos son de gran importancia para una mejor comprensión de la epidemiología de la enfermedad de Chagas. Agradecimientos Luz Adriana Botero recibió apoyo del CODI– Universidad de Antioquia a través del programa de jóvenes investigadores. Conflicto de intereses Los autores declaramos que no existe ningún conflicto de intereses. Financiación Este proyecto fue financiado por el programa de sostenibilidad 2005–2006 del CODI, Universidad de Antioquia.

72

Biomédica 2007;27(supl.1):64-74

Caracterización de clones de Trypanosoma cruzi I y II

Referencias
1. Andrade LO, Machado CR, Chiari E, Pena SD, Macedo AM. Differential tissue distribution of diverse clones of Trypanosoma cruzi in infected mice. Mol Biochem Parasitol 1999;100:269-75. 2. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the Southern Cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 3. Lenzi HL, Oliveira DN, Lima MT, Gatas CR. Trypanosoma cruzi: paninfectivity of CL strain during murine acute infection. Exp Parasitol 1996;84:16-27. 4. Prata A. Clinical and epidemiological aspects of Chagas disease. Lancet Infect Dis 2001;1:92-100. 5. Vago AR, Macedo AM, Oliveira RP, Andrade LO, Chiari E, Galvao LM, et al. Kinetoplast DNA signatures of Trypanosoma cruzi strains obtained directly from infected tissues. Am J Pathol 1996;149:2153-9. 6. Vago AR, Andrade LO, Leite AA, d’Avila Reis D, Macedo AM, Adad SJ, et al. Genetic characterization of Trypanosoma cruzi directly from tissues of patients with chronic Chagas disease: differential distribution of genetic types into diverse organs. Am J Pathol 2000;156:1805-9. 7. Macedo AM, Machado CR, Oliveira RP, Pena SD. Trypanosoma cruzi: genetic structure of populations and relevant of genetic variability to the pathogenesis of Chagas disease. Mem Inst Oswaldo Cruz 2004;99:1-12. 8. Oliveira RP, Broude NF, Macedo AM, Cantor CR, Smith CL, Pena SD. Probing the genetic population structure of Trypanosoma cruzi with polymorphic microsatellites. Proc Natl Acad Sci USA 1998;95:3776-80. 9. Andrade LO, Machado CR, Chiari E, Pena SD, Macedo AM. Trypanosoma cruzi: role of host genetic background in the differential tissue distribution of parasite clonal populations. Exp Parasitol 2002;100:269-75. 10. Macedo AM, Martins MS, Chiari E, Pena SD. DNA fingerprinting of Trypanosoma cruzi : a new tool for characterization of strains and clones. Mol Biochem Parasitol 1992;55:147-53. 11. Tibayrenc M, Neubauer K, Barnabé C, Guerrini F, Skarecky D, Ayala FJ. Genetic characterization of six parasitic protozoa: parity betweem random-primer DNA typing and multilocus enzyme electrophoresis. Proc Natl Acad Sci USA 1993;90:1335-9. 12. Souto RP, Fernandes O, Macedo AM, Campbell DA, Zingales B. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi . Mol Biochem Parasitol 1996;83:141-52. 13. Fernandes O, Souto RP, Castro JA, Pereira JB, Fernandes NC, Junqueira AC, et al. Brazilian isolates of Trypanosoma cruzi from humans and triatomines

classified into two lineages using mini-exon and ribosomal RNA sequences. Am J Trop Med Hyg 1998;58:807-11. 14. Fernandes O, Mangia RH, Lisboa CV, Pinho AP, Morel CM, Zingales B, et al. The complexity of the sylvatic cycle of Trypanosoma cruzi in Rio de Janeiro state (Brazil) revealed by the non-transcribed spacer of the mini-exon gene. Parasitology 1999;118:161-6. 15. Miles MA, Feliciangeli MD, de Arias AR. American trypanosomiasis (Chagas disease) and the role of molecular epidemiology in guiding control strategies. BMJ 2003;326:1444-8. 16. Añez N, Crisante G, da Silva FM, Rojas A, Carrasco H, Umezawa E, et al. Predominance of lineage I among Trypanosoma cruzi isolates from Venezuelan patients with different clinical profiles of acute Chagas disease. Trop Med Int Health 2004;9:1319-26. 17. Magalhães-Santos IF, Souza MM, Lima CS, Andrade S. Infection of Calomys callosus (Rodentia Cricetidae) with strains of different Trypanosoma cruzi biodemes: Pathogenicity, histotropism, and fibrosis induction. Mem Inst Oswaldo Cruz 2004;99:407-13. 18. Mejía AM, Triana O. Análisis por LSSP-PCR de la variabilidad genética de Trypanosoma cruzi en sangre y órganos de ratones. Biomédica 2005;25:76-86. 19. Freitas JM, Lages-Silva E, Crema E, Pena SD, Macedo AM. Real time PCR strategy for the identification of major lineages of Trypanosoma cruzi directly in chronically infected human tissues. Int J Parasitol 2005;35:411-7. 20. Bernabé C, Tibayrenc M. Trypanosoma cruzi: longterm sub-cultures in two different culture media do not confirm the existence of highly versatile multilocus genotypes. Int J Parasitol 2004;34:779-84. 21. Goldberg SS, Chiari E. Growth and isolation of single colonies of Trypanosoma cruzi on solid medium. J Parasitol 1980;66:677-9. 22. Camargo EP. Growth and differentiation in Trypanosoma cruzi. Origin of metacyclic trypanosomes in liquid media. Rev Inst Med Trop São Paulo 1964;12:93-100. 23. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. 24. Sturm N, Degrave W, Morel C, Simpson L. Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences. Use in diagnosis of Chagas disease. Mol Biochem Parasitol 1989;33:205-14. 25. Pena SD, Barreto G, Vago AR, De Marco L, Reinach F, Dias Neto E, et al. Sequence-specific gene signatures can be obtained by PCR with single specific primers at low stringency. Proc Natl Acad Sci USA 1994;91:1946-9.

73

Botero L.A., Mejía A.M., Triana O.

Biomédica 2007;27(supl.1):64-74

26. Campos RF, Goncalves MS, dos Reis EA, dos Reis MG, Andrade SG. Comparative analysis by polymerase chain reaction amplified minicircles of kinetoplast DNA of a stable strain of Trypanosoma cruzi from Sao Felipe, Bahia, its clones and subclones: possibility of predominance of a principal clone in this area. Mem Inst Oswaldo Cruz 1999;94:23-9. 27. Walsh PS, Metzger DA, Higuchi R. Chelex® 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 1991;10:506-13. 28. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. Second edition. Cold Spring: Harbor Laboratory Press; 1989. 29. Virreira M, Torrico F, Truyens C, Alonso-Vega C, Solano M, Carlier Y, et al. Comparison of polymerase chain reaction methods for reliable and easy detection of congenital Trypanosoma cruzi infection. Am J Trop Med Hyg 2003;68:574-82. 30. Franco DJ, Vago AR, Chiari E, Meira FC, Galvao LM, Machado CR. Trypanosoma cruzi : mixture of two populations can modify virulence and tissue tropism in rat. Exp Parasitol 2003;104:54-61. 31. Campos RM, Andrade SG. Characterization of subpopulations (clones and subclones) of the 21 SF

strain of Trypanosoma cruzi after long lasting maintenance in the laboratory. Mem Inst Oswaldo Cruz 1996;91:795-800. 32. Di Noia JM, Buscaglia CA, De Marchi CR, Almeida IC, Frasch CC. A Trypanosoma cruzi small surface molecule provides the first immunological evidence that Chagas disease is due to a single parasite lineage. J Exp Med 2002;195:401-13. 33. Rios JF. Estudio del tropismo tisular de dos cepas colombianas de Trypanosoma cruzi (Tesis). Medellín: Universidad de Antioquia; 1995. 34. Camandaroba EL, Campos RF, Magalhaes JB, Andrade SG. Clonal structure of Trypanosoma cruzi Colombian strain (biodeme type III): biological, isoenzymic and histopathological analysis of seven isolated clones. Rev Soc Bras Med Trop 2001;34: 151-7. 35. Cummings KL, Tarleton RL. Rapid quantitation of Trypanosoma cruzi in host tissue by real-time PCR. Mol Biochem Parasitol 2003;129:53-9. 36. Macedo AM, Pena SD. Genetic variability of Trypanosoma cruzi: implications for the pathogenesis of Chagas disease. Parasitol Today 1998;14:119-23.

74

Biomédica 2007;27(supl.1):75-82

Efecto tóxico de insecticidas en T. dimidiata y T. maculata

ARTÍCULO ORIGINAL

Efecto tóxico de β-cipermetrina, deltametrina y fenitrotión en cepas de Triatoma dimidiata (Latreille, 1811) y Triatoma maculata (Erichson, 1848) (Hemiptera, Reduviidae)
Marlene Reyes 1, Víctor Manuel Angulo 2, Claudia Magaly Sandoval
1

2

2

Escuela de Biología, Facultad de Ciencias, Universidad Industrial de Santander, Piedecuesta, Santander, Colombia. Centro de Investigaciones en Enfermedades Tropicales de la Universidad Industrial de Santander, CINTROP-UIS, Piedecuesta, Santander, Colombia.

Introducción. La evaluación de la susceptibilidad a insecticidas de las diferentes especies de triatominos, involucrados en la transmisión de la enfermedad de Chagas de cada región, es indispensable para el éxito de las campañas de control. Objetivo. Determinar la línea base de susceptibilidad para los principios activos deltametrina, β-cipermetrina y fenitrotión en ninfas de primer y quinto estadio de Triatoma dimidiata y en ninfas de primer estadio de Triatoma maculata. Materiales y métodos. Se utilizó el protocolo de evaluación de la actividad insecticida en triatominos (técnica de aplicación tópica) para las especies en estudio. Resultados. Los valores de DL50 en ninfas de primer estadio de T. maculata expresados en nanogramos/insecto (ng/i) fueron de: 0,07, 0,05 y 4,12. Las DL99 fueron de: 1,08, 0,37 y 17,89 para deltametrina, β- cipermetrina y fenitrotión respectivamente. En T. dimidiata los valores de DL 50 fueron de: 0,44, 0,46 y 16,45. Las DL99 obtenidas fueron de: 2,22, 1,97 y 36,07 ng/i para deltametrina, β- cipermetrina y fenitrotión respectivamente. En ninfas de quinto estadio de T. dimidiata las DL50 fueron de: 510,72, 1623,59 y 838,91. Las DL99 fueron de: 9607,50, 11717,91 y 1525 para deltametrina, β- cipermetrina y fenitrotión respectivamente. Conclusión. En ninfas de primer estadio de T. dimidiata y T. maculata los insecticidas piretroides fueron mas efectivos; en ninfas de quinto estadio de T. dimidiata la efectividad de los piretroides y del organofosforado fue diferente con las DL50; las ninfas de este estadio requirieron dosis altas comparadas con las utilizadas para otros triatominos, lo cual sugiere una baja susceptibilidad. La DL99 para el organofosforado fue significativamente menor, lo que podría indicar una mayor efectividad en campo. Es importante realizar estudios de efectos sinergistas para mostrar el posible rol de mecanismos bioquímicos que determine su tolerancia a los piretroides, esto representa un nuevo reto para las campañas de control en los países andinos y centroamericanos donde esta especie es endémica. Palabras clave: Triatominae, Triatoma, enfermedad de Chagas, insecticidas organofosforados, piretroides. Toxic effect of β -cipermethrin, deltamethrin and fenitrothion in colonies of Triatoma dimidiata (Latreille, 1811) and Triatoma maculata (Erichson, 1848) (Hemiptera, Reduviidae) Introduction. The susceptibility to insecticides of triatomine species must be evaluated because of their involvement in the transmission of the Chagas disease. In each region with Chagas endemicity, evaluation of insecticide response is necessary to predict the success of the control campaigns. Objective. The baseline susceptibility was determined for the active principles deltamethrin, β-cypermethrin and fenitrothion in nymphs of first and fifth instar of Triatoma dimidiata and nymphs of first instar of Triatoma maculata. Materials and methods. The insecticide activity in triatomines was evaluated by the technique of topical application.

75

Reyes M., Angulo V.M., Sandoval C.M.

Biomédica 2007;27(supl.1):75-82

Results. The values of the LD50 in nymphs of first instar for T. maculata, expressed in nanograms per insect (ng/i), were 0.07, 0.05 and 4.12 for deltamethrin, β-cypermethrin and fenitrothion respectively. The corresponding LD99 values were 1.08, 0.37 and 17.89 ng/i. In T. dimidiata, the LD50 values were 0.44, 0.46 and 16.45 ng/i; the LD99 values were 2.22, 1.97 and 36.07 ng/i. In nymphs of fifth instar T. dimidiata, the LD50 values were 510.7, 1,623.6 and 838.9 ng/i; the LD99 values were 9,607.5, 11,717.9 and 1,525.0 ng/i, respectively. Conclusion. In first instar nymphs of T. dimidiata and T. maculata, the pyrethroid insecticides were more effective; in fifth instar nymphs of T. dimidiata, the effectiveness of the pyrethroids and the organophosphate differed in the LD50 comparison—the nymphs required much higher doses compared with the other triatomines and suggested a low susceptibility. The LD99 for the organophosphate (fenitrothion) was significantly lower and may indicate its greater effectiveness in field. Studies of synergistic effects amonst insecticides are important to clarify the role of biochemical mechanisms that determine tolerance to the pyrethroids. Insecticide tolerance represents a new challenge for control campaigns in the Andean and Central American countries where Chagas disease is endemic. Key words: Triatominae, Triatoma, Chagas disease, insecticides, organophosphate, pyrethrins,

La enfermedad de Chagas afecta a una población de 16 a 18 millones de personas, y más de 100 millones se encuentran en riesgo de infección en 21 países (1). En Latinoamérica las especies domiciliadas más importantes implicadas en la transmisión de Trypanosoma cruzi son Triatoma infestans, en los países del Cono sur, Rhodnius prolixus, en Centro América y el Norte de Sur América, y Triatoma dimidiata, que se extiende a lo largo de la costa Pacífica desde México hasta el Ecuador y el norte de Perú (2-4). En Colombia, durante los últimos 20 años, T. dimidiata ha ocupado hábitats domiciliarios, peridomiciliarios, silvestres y viviendas de buena construcción en cabeceras municipales. Este fenómeno ha ocurrido también en algunas ciudades de Centroamérica (4-8).

Las experiencias de control vectorial en América Central, los países Andinos y del Cono Sur han demostrado que una de las pocas alternativas prácticas para controlar la enfermedad de Chagas es a través del control de los triatominos domiciliarios (10,11). En 1996 se creó en Colombia el Programa Nacional de Control Vectorial de la enfermedad de Chagas (12); en su marco se han iniciado actividades de aspersión de insecticidas piretroides y organofosforados y políticas de mejoramiento de vivienda en Boyacá, Casanare, Santander, Norte de Santander y Arauca (12,13). Dichos departamentos forman parte de las zonas catalogadas como de alto y mediano riesgo de infección, donde el uso de la deltametrina se ha hecho extensivo como medida de control (14). Algunos países de Centroamérica han tenido éxito utilizando piretroides en la eliminación de colonias de T. dimidiata intradomiciliarias (15-7). Sin embargo, las zonas infestadas con triatominos de algunos países de Suramérica han mostrado diferencias en la susceptibilidad y la resistencia a insecticidas en poblaciones de T. infestans de Brasil y Argentina, así como en una población de R. prolixus en Carabobo, Venezuela (18-21). En Colombia, estudios recientes muestran altos niveles de infestación postratamiento; una de las causas sugeridas por los investigadores es la presencia de poblaciones de esta especie con menor susceptibilidad al piretroide usado (5). Teniendo en cuenta que en la actual situación colombiana una de las estrategias que hacen parte

Triatoma maculata se distribuye en la zona nororiental de Sur América, colonizando ambientes domésticos, peridomésticos, silvestres y urbanos del país con altos niveles de infestación (2,9) Mojíca MT, Cuervo LA, Ariza K, Chacón E, Chacón R, Dib JC, et al. Distribución de Triatoma maculata e infestación domiciliaria en Santa Marta, Colombia. Biomédica 2003;23:96).
Correspondencia: Marlene Reyes Jerez, Laboratorio de Entomología, Centro de Investigaciones en Enfermedades Tropicales de la Universidad Industrial de Santander, Km 2 vía El Refugio, Piedecuesta, Santander, Colombia. Tel: 6563971, fax: 6540177. marejez1@hotmail.com Recibido: 22/08/05; aceptado: 02/06/06

76

Biomédica 2007;27(supl.1):75-82

Efecto tóxico de insecticidas en T. dimidiata y T. maculata

del control integrado de los triatominos es el uso de sustancias químicas insecticidas, se hace necesario evaluar el efecto triatomicida en el laboratorio con el fin de monitorizar la susceptibilidad y la resistencia de las poblaciones blanco a los insecticidas en uso. En el país son pocos los estudios sobre este tema que se reportan en la literatura, y todos han estado dirigidos a evaluar la susceptibilidad y resistencia en R. prolixus (22,23). Si el conocimiento de T. dimidiata en este aspecto es escaso, también lo es en cuanto a la determinación de factores que influyen en la respuesta a los insecticidas como por ejemplo el estado nutricional; las observaciones sobre la actividad insecticida con β-cipermetrina aplicada por vía tópica en ninfas de V estadio muestran diferencias que indican una muy baja absorción insecticida asociada con mecanismos de detoxificación (datos no publicados, CINTROP-UIS). En este estudio se propuso establecer la línea de base de susceptibilidad en T. dimidiata y T. maculata con dos piretroides y un organofosforado como inicio de los estudios de monitorización de la susceptibilidad y la resistencia a insecticidas en poblaciones de campo, ante todo para orientar las políticas de control en el país y, además, para contribuir a la extensión de los protocolos de evaluación de la actividad insecticida de los triatominos en Latinoamérica. Materiales y métodos

y T. maculata; las ninfas I tenían entre 24 y 36 horas (24), con un peso entre 1,4±2,1mg y 0,6±1,1mg, respectivamente, y las ninfas de quinto estadio de T. dimidiata tenían 10 a 12 días de edad, no recibieron alimento y su peso era de 97± 30 mg (datos no publicados, CINTROP-UIS).

Insecticidas
Los insecticidas (grado técnico) utilizados en este estudio fueron deltametrina al 99,1% (Agrevo S.A, Argentina), β-cipermetrina al 99,4% (Chemotecnica Sintyal, Argentina), y fenitrotión al 98,5% (Lab Dr.Ehrenstorfer-Schafers,Germany). Las diluciones seriales de insecticidas se prepararon en acetona (JT Baker, México).

Ensayos biológicos Evaluación del efecto insecticida. Las ninfas de primer estadio de T. dimidiata y T. maculata y las de quinto estadio de T. dimidiata se trataron con aplicación tópica de principios activos (fenitrotión, β-cipermetrina y deltametrina) diluidos y aplicados con microjeringas Hamilton de 5 y 25 µl provistas de descargador repetitivo. En la región dorsal del abdomen de cada ninfa en estadios I y V se aplicaron 0,1 y 0,5 µl de la solución, respectiva mente. En los ensayos biológicos se seleccionaron cuatro niveles de dosis que registraron entre 10 y 90% de mortalidad; se utilizaron 10 ninfas por dosis con mínimo tres réplicas en diferentes días; como grupo control se utilizaron 10 insectos en cada réplica con igual volumen de acetona. Después del tratamiento, los insectos se colocaron en frascos plásticos y se mantuvieron en una incubadora bajo condiciones ambientales constantes a 25 ± 2°C, 70 a 80% de HR. La lectura de mortalidad para el insecticida organofosforado fenitrotión se realizó a las 48 horas y para los piretroides β-cipermetrina y deltametrina a las 72 horas de aplicación del tratamiento. Criterio de muerte. Se consideró muerto el insecto que colocado sobre un papel de filtro no tuviera actividad locomotora propia, ya fuera en forma espontánea o al ser estimulado con un pincel o una pinza según lo establecido por el protocolo de evaluación de la actividad insecticida en triatominos de la Organización Mundial de la Salud (24).

Material biológico
Se utilizaron cepas de T. dimidiata y T. maculata provenientes de San Joaquín y San José de Miranda, municipios del departamento de Santander, áreas éstas sin tratamiento sistemático de control estatal en el momento de la recolección. La cría de las cepas se inició en 1998, manteniéndolas sin aporte de material externo en condiciones ambientales constantes de laboratorio a 25 ± 2°C, 70 a 80% de HR y fotoperíodo de 12:12, y alimentándolas cada 15 días con sangre de gallina. En los ensayos biológicos con insecticidas se utilizaron ninfas de primer estadio de T. dimidiata

77

Reyes M., Angulo V.M., Sandoval C.M.

Biomédica 2007;27(supl.1):75-82

Análisis de datos
Los valores obtenidos de la dosis-respuesta en los ensayos biológicos fueron sometidos al análisis EPA PROBIT versión 1.5 de 1999 para determinar los valores estadísticos DL50 y DL 99. Se aplicó una prueba de ji2 según el caso para comparar los niveles de significación. El potencial insecticida de la β-cipermetrina y el fenitrotión se calculó tomando como referencia la deltametrina: DL50 de deltametrina/DL50 de β-cipermetrina o fenitrotión x 100. Se utilizó la deltametrina como referencia por su comprobado efecto triatomicida (25) Resultados Mediante un análisis estadístico de los valores de DL50 por aplicación tópica de ambos piretroides en ninfas de primer estadio de T. dimidiata, en el cuadro 1 se indica que los parámetros DL50 de la deltametrina y la β-cipermetrina son similares (p = 0,82) y no presentan diferencias estadísticas. Se evidenció una mayor toxicidad de la deltametrina (p < 0,05) y la β-cipermetrina (p < 0,05) con diferencias significativas respecto al fenitrotión. En este estadio, la DL99 también mostró una mayor toxicidad de los piretroides deltametrina y β-cipermetrina (p < 0,05), con diferencias significativas respecto al organofosforado fenitrotión. Los valores de las pendientes de los insecticidas deltametrina, β-cipermetrina y fenitrotión en ninfas de primer estadio de T. dimidiata indican que la

respuesta de la cepa fue heterogénea para deltametrina (3,3) y β-cipermetrina (3,6), a diferencia de la respuesta homogénea (6,8) del fenitrotión (p < 0,05) que sí presentó diferencias estadísticas. Los valores obtenidos de DL50 en ninfas de primer estadio de T. maculata (cuadro 1) muestran un efecto tóxico similar de la β-cipermetrina y la deltametrina (p = 0,34), sin presentar diferencias significativas. Los valores de DL50 y DL99 obtenidos en ambos piretroides indican (p < 0,05) que son significativamente menores (mayor toxicidad) que los determinados en fenitrotión. Los valores de las pendientes en ninfas de primer estadio de T. maculata para deltametrina (1,9) y β-cipermetrina (2,7) sugieren que la respuesta es heterogénea para los insecticidas piretroides comparados con el fenitrotión (3,6) (p < 0,05), presentando diferencias significativas. Los valores DL 50 y DL 99 por aplicación tópica en ninfas de quinto estadio de T. dimidiata de los tres insecticidas se muestran en el cuadro 1. Es sorprendente la baja toxicidad de los insecticidas estudiados en ninfas V de esta especie. En este contexto de marcada tolerancia, y tomando como parámetro la DL50, se observa que la deltametrina y el fenitrotión son más activos que la β-cipermetrina (p < 0,05) con diferencias significativas. Con el parámetro estadístico DL99 encontramos mayor efectividad del fenitrotión frente a los piretroides (p < 0,05), siendo la diferencia significativa.

Cuadro 1. Nivel de susceptibilidad en ninfas de estadios I y V sin alimentar de Triatoma dimidiata y Triatoma maculata, cepa referencial susceptible a la aplicación tópica de los principios activos deltametrina, β-cipermetrina y fenitrotión. Especie Estadio Insecticida I I I V V V I I I deltametrina β-cipermetrina fenitrotión deltametrina β-cipermetrina fenitrotión deltametrina β-cipermetrina fenitrotión DL50 ng/i 0,44 0,46 16,45 510,72 1623,59 838,91 0,07 0,05 4,12 IC 95% DL99ng/i IC95% b±DE 3,3±0,4 3,6±0,8 6,8±0,5 1,8±0,4 2,7±0,5 8,9±1,8 1,9±0,5 2,7±0,4 3,6±0,7 n 240 250 200 180 200 220 102 151 150

Triatoma dimidiata

Triatoma maculata

0,38-0,51 2,22 1,69-3,75 0,39-0,52 1,97 1,42-3,44 15,22-17,64 36,07 31,24-44,86 279,49-706,23 9607,50 3819,48-170498 1322,36-1894,34 11717,91 6767,58-42048,42 791,36-887,51 1525 1277,69-2302,04 0,05-0,09 1,08 0,46-7,67 0,05-0,07 0,37 0,21-1,45 3,56-4,78 17,89 11,89-41,64

DL50 = dosis que ocasiona el 50% de mortalidad de los insectos expuestos, expresada en nanogramos por insecto; DL99 = dosis que ocasiona el 99% de la mortalidad de los insectos expuestos, expresada en nanogramos por insecto. b = pendiente de la recta; DE = desviación estándar; n = número total de insectos.

78

Biomédica 2007;27(supl.1):75-82

Efecto tóxico de insecticidas en T. dimidiata y T. maculata

En ninfas de quinto estadio de T. dimidiata, los valores de las pendientes encontrados (cuadro 1) muestran que la respuesta de la población fue heterogénea para la deltametrina (1,8) y para la βcipermetrina (2,7). En cambio se observó una respuesta homogénea (8,9) para el fenitrotión con diferencias significativas (p < 0,05) respecto a los piretroides. La efectividad insecticida, medida por el potencial insecticida, se muestra en el cuadro 2. En ninfas de primer estadio de T. dimidiata, la toxicidad intrínseca de la deltametrina fue similar a la de la β-cipermetrina, pues sólo fue 1,02 veces más efectiva, pero respecto al fenitrotión mostró una efectividad 37,1 veces mayor. En ninfas de quinto estadio, y en el marco de la acentuada tolerancia observada a los insecticidas estudiados, la toxicidad intrínseca de la deltametrina sólo fue 3,2 veces mayor que la de la β-cipermetrina y 1,6 veces mayor que la del fenitrotión. En ninfas I de T. maculata, la β-cipermetrina presentó 1,2 veces más potencial insecticida que la deltametrina; la deltametrina fue 63 veces más efectiva que el fenitrotión. Discusión El análisis de los valores de DL50 obtenidos para cada insecticida en ninfas de primer estadio de T. dimidiata y T. maculata muestra claramente

las diferencias de efectividad entre los insecticidas piretroides y el organofosforado en estudio, lo que se asemeja a lo reportado en ninfas I de T. infestans susceptibles (deltametrina 0,13 ng/i; βcipermetrina 0,24 ng/i, y fenitrotión 21,6 ng/i) (20), y concuerda con la reconocida acción triatomicida de los piretroides (25). Todos los insecticidas mostraron mayor toxicidad en ninfas de primer estadio que en ninfas de quinto estadio; estas diferencias de toxicidad pueden ser atribuidas a diferencias en los procesos de toxicocinética en cada uno de los estadios (26). Considerando las dos especies y todos los insecticidas estudiados en ninfas de primer estadio, T. maculata es más susceptible que T. dimidiata en cuanto a los parámetros de toxicidad expresados en peso de ingrediente activo por insecticida con relación al peso del insecto vivo; esta condición fue observada por Oliveira Filho para R. prolixus al compararlo con T. infestans y Panstrongylus megistus (21). Los resultados obtenidos en ninfas de quinto estadio de T. dimidiata mostraron su sorprendente tolerancia a los insecticidas estudiados, particularmente a la deltametrina, aunque si bien éste fue el insecticida más efectivo, las dosis necesarias para causar volteo al 50% de los insectos tratados fueron altas en comparación con las requeridas en otras especies (27). En este

Cuadro 2. Potencial insecticida por aplicación tópica de la β-cipermetrina y fenitrotión versus deltametrina en ninfas I de Triatoma dimidiata y Triatoma maculata y ninfa V de Triatoma dimidiata. Especie Insecticida deltametrina β-cipermetrina fenitrotión deltametrina fenitrotión β-cipermetrina deltametrina β-cipermetrina fenitrotión DL50 o CL 50 deltametrina Potencial insecticida= DL: dosis letal CL: concentración letal DL50 o CL50 β-cipermetrina o fenitrotión X100 Estadio I I I V V V I I I Potencial insecticida 100 98,31 2,69 100 60,87 31,45 100 122 1,57

Triatoma dimidiata

Triatoma maculata

79

Reyes M., Angulo V.M., Sandoval C.M.

Biomédica 2007;27(supl.1):75-82

estudio se reportó una DL50 de 510 ng/i para esta especie; con T. infestans se presentó una DL50 de 215 ng/i (25). Es posible plantearse la pregunta sobre qué mecanismos enzimáticos con rol clave en la detoxificación de insecticidas, particularmente de los piretroides, podrían tener una actividad marcada en ninfas V de T. dimidiata como para conferirles tolerancia frente a la acción triatomicida. Al comparar los valores estadísticos DL50 1623,59 ng/i en ninfas V de T. dimidiata sin alimentar con los DL50 432,57 ng/i en ninfas V alimentadas se observa una menor respuesta tóxica a la βcipermetrina en las ninfas de V estadio sin alimentar que en las alimentadas, lo cual evidencia mayor susceptibilidad de las ninfas V alimentadas y sugiere una baja absorción de este insecticida en ninfas sin alimentar. Este hallazgo es similar a lo reportado en ninfas de segundo estadio de T. infestans, en las cuales se encontró un importante incremento en la penetración y mortalidad con DDT en insectos tratados después de la alimentación (28); estas diferencias de penetración en ninfas sin alimentar sugieren baja absorción del insecticida, lo que asociado a los caminos metabólicos de desintoxicación ya establecidos, podrían explicar la muy baja actividad del insecticida. Una población de insectos susceptible a insecticidas presenta valores elevados de pendiente (población homogénea), que van disminuyendo cuando la respuesta se hace más heterogénea (29). Esta homogeneidad de respuesta de una población susceptible concuerda con los resultados obtenidos para el fenitrotión en ninfas de primer y quinto estadio de T. dimidiata y ninfas de primer estadio de T. maculata. Sin embargo, no concuerda con la respuesta heterogénea detectada para los insecticidas β-cipermetrina y deltametrina en las dos especies. Probablemente esta heterogeneidad de respuesta en las especies estudiadas podría atribuirse al particular modo de acción de los piretroides en triatominos, en los que el efecto letal no tiene una muy clara manifestación y puede superponerse con un volteo prolongado, tal como se ha encontrado en R. prolixus (28). En T.

dimidiata y T. maculata la intoxicación producida por piretroides se manifiesta por incoordinación, parálisis del tercer par de patas y convulsiones.
Al analizar los resultados obtenidos a través del cálculo del potencial insecticida en ninfas de primer estadio de T. dimidiata y T. maculata, se observa nuevamente una mayor efectividad insecticida de los piretroides frente al organofosforado. En las ninfas de quinto estadio de T. dimidiata, la toxicidad intrínseca de la deltametrina fue mayor comparada con la β-cipermetrina. Con las DL50 se observaron diferencias entre los piretroides y el fenitrotión; sin embargo, con la DL99 se encontró una mayor efectividad del organofosforado. Si bien este resultado hace pensar en una mayor efectividad del fosforado en condiciones de campo, es necesario plantear que la tolerancia de las ninfas V de T. dimidiata a piretroides y fenitrotión representa un problema para las campañas de control de vectores de la enfermedad de Chagas en los países andinos y centroamericanos. Recientemente, en Colombia se han reportado altas prevalencias de infestación intradomiciliarias y peridomiciliarias desde los primeros meses postratamiento por parte de adultos y ninfas de cuarto y quinto estadio de T. dimidiata, con un aumento creciente del número de triatominos capturados por mes de vigilancia en zonas rociadas con deltametrina (5) (Turriago BC, Pinto N, Guhl F. Evaluación de deltametrina KOthrine SC50 y K-Othrine WP 50 como alternativa de control de Triatoma dimidiata. Biomédica 2005;25:195). Nuevos estudios con sinergistas podrían demostrar algún mecanismo que justifique esta tolerancia, lo cual ayudaría a mejorar las formulaciones de los insecticidas que se destinan al control de T. dimidiata. Este estudio contribuye a la extensión del protocolo, evaluación de la actividad insecticida de los triatominos en Latinoamérica y permite el desarrollo de estudios en la siguiente etapa, es decir, comparar la línea de base de susceptibilidad con poblaciones de campo que hayan sido sometidas a control con los insecticidas probados.

80

Biomédica 2007;27(supl.1):75-82

Efecto tóxico de insecticidas en T. dimidiata y T. maculata

Todo esto en el marco de un seguimiento entomológico de las acciones de control químico en el país. Agradecimientos A Eduardo Zerba y al CIPEIN por su asesoría y revisión de este manuscrito. Conflicto de interés No hay conflicto de intereses. Financiación Este estudio fue financiado por UNDP/ World Bank/ WHO Special Programme for Research & Training in Tropical Diseases (TDR), proyecto ID: 990163. Referencias
1. World Health Organization. Infectious diseases home. Specific information: disease. 2004. [Consultado: abril 27 de 2005]. Disponible en: http://www.who.int/ ctd/chagas/burdens.htm. 2. Dujardin JP,Schofield CJ, Panzera F. Les vecteurs de la maladie de Chagas. Recherches taxonomiques, biologiques et génétiques. Bruxelles: Academie Royale des Sciences d’Outre Mer; 2000. p.162. 3. Aguilar M H, Abad Franch F, Racines VJ, Paucar CA. Epidemiology of Chagas disease in Ecuador. A brief review. Mem Inst Oswaldo Cruz 1999;94 (Suppl. 1):387-93. 4. Schofield CJ. Challenges of Chagas disease vector control in Central America. Geneva: WHO;2000. p.36. 5. Angulo VM. Ensayo de estrategias de control y vigilancia de Triatoma dimidiata en Colombia. En: Guhl F, editor. Primer Taller Internacional Sobre Control de la Enfermedad de Chagas; Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el control de la Enfermedad de Chagas. Bogotá D.C.: Ediciones Uniandes; 2005. p.91-102. 6. Guhl F, Angulo VM, Restrepo M, Nicholls S, Montoya R. Estado del arte de la enfermedad de Chagas en Colombia y estrategias de control. Biomédica 2003;23:31-4. 7. Molina JA, Gualdrón LE, Brochero HL, Olano VA, Barrios D, Guhl F. Distribución actual e importancia epidemiológica de las especies de triatominos (Reduviidae:Triatominae) en Colombia. Biomédica 2000;20:344-60. 8. Zeledón R, Montenegro VM, Zeledón O. Evidence of colonization of man-made ecotopes by Triatoma dimidiata (Latreille,1811) in Costa Rica. Mem Inst Oswaldo Cruz 2001;96:659-60.

9. Corredor A, Santacruz M, Paez S, Guatame LA. Distribución de los triatominos domiciliados en Colombia. Bogotá: Ministerio de Salud-Instituto Nacional de Salud; 1990 p.144. 10. Zerba EN. Susceptibility and resistance to insecticides of Chagas disease vectors. Medicina (B Aires) 1999;59:41-6. 11. Dias J, Schofield CJ. The evolution of Chagas disease (American trypanosomiasis) control after 90 years since Carlos Chagas discovery. Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):103-21. 12. Guhl F, Vallejo GA. Interruption of Chagas disease transmission in the Andean countries: Colombia. Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):413-5. 13. Angulo VM, Sandoval CM. Triatominos y Programa Nacional de Control en Colombia. Monitoreo de la resistencia a insecticidas en triatominos en América Latina, Buenos Aires: Fundación Mundo Sano, Red Latinoamericana de Control de Triatominos RELCOT; 2001. p.21-6. 14. Sánchez JF. Informe comportamiento del programa de Chagas, Cundinamarca años 2002-2005. Secretaría de Salud de Cundinamarca. En: Guhl F, editor. Primer Taller Internacional Sobre Control de la Enfermedad de Chagas. Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el control de la Enfermedad de Chagas. Bogotá D.C: Ediciones Uniandes; 2005. p.135-40. 15. Nakagagua J, Cordón-Rosales C, Juárez J, Itzep C, Nonami T. Impact of residual spraying on Rhodnius prolixus and Triatoma dimidiata in the department of Zacapa in Guatemala. Mem Inst Oswaldo Cruz 2003;98:277-81. 16. Ceceré MC, Gurtler RE, Canale DM, Chuit R, Cohen JE. Effects of partial housing improvement and insecticide spraying on the reinfestation dynamics of Triatoma infestans in rural northwestern Argentina. Acta Trop 2002;84:101-16. 17. Tabarú Y, Monroy C, Rodas A, Mejia M, Rosales R. Chemical control of Triatoma dimidiata and Rhodnius prolixus (Reduviidae:Triatominae), the principal vectors of Chagas disease in Guatemala. Med Entomol Zool 1998;49:87-92. 18. Vassena CV, Piccollo MI, Zerba EN. Insecticide resistance in Brazilian Triatoma infestans and Venezuelan Rhodnius prolixus . Med Vet Entomol 2000;14:51-5. 19. Vassena CV, Piccollo MI. Monitoreo de resistencia a insecticidas en poblaciones de campo en Triatoma infestans y Rhodnius prolixus, insectos vectores de la enfermedad de Chagas. Boletín Electrónico Mensual del Servicio de Toxicología del Sanatorio de Niños de Rosario 2003:13. [Consultado: abril 5 de 2004]. Disponible en: http://www.sertox.com.ar/retel/n03/ 004.htm.

81

Reyes M., Angulo V.M., Sandoval C.M.

Biomédica 2007;27(supl.1):75-82

20. Piccollo MI, Vassena C, Santo Orihuela P, Barrios S, Zaidemberg M, Zerba E. High resistance to pyrethroid insecticides associated with ineffective field treatments in Triatoma infestans (Hemiptera: Reduviidae) from Northern Argentina. J Med Entomol 2005; 42:637-42. 21. Oliveira Filho AM. Differences of susceptibility of five Triatomine species to pyrethroid insecticides -implications for Chagas disease vector control. Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):425-8. 22. Fox I, Bayona IG. Toxicity of DDT, dieldrin, mlathion and fenthion to Rhodnius prolixus in the laboratory. Bull World Health Organ 1966;35:974-6. 23. Sandoval CM. Actividad insecticida del malatión y la deltametrina en una cepa colombiana de Rhodnius prolixus (Hemiptera:Rudiviidae). Monitoreo de la resistencia a insecticidas en triatominos en América Latina. Buenos Aires: Fundación Mundo Sano, Red Latinoamericana de Control de Triatominos RELCOT; 2001. p.27-33.

24. WHO. Protocolo de evaluación de efecto insecticida sobre triatominos. Acta Toxicol Arg 1994;2:29-32. 25. Zerba EN. Evolución del control químico de los insectos vectores de la enfermedad de Chagas. Anales de la Sociedad Científica Argentina 1997;227:35-9. 26. Alzogaray RA, Zerba EN. Third instar nymphs of Rhodnius prolixus exposed to α-cyanopyrethroids: from hyperactivity to death. Arch Insect Biochem Physiol 2001;46:119-26. 27. Kostaropoulos I, Papadopoulos AI, Metaxakis A, Boukouvala E, Papadopoulou-Mourkidou E. Glutathione S-transferase in the defence against pyrethroids in insects. Insect Biochem Mol Biol 2001;31:313-9. 28. Fontán A, Zerba EN. Influence of the nutritional state of Triatoma infestans over the insecticidal activity of DDT. Comp Biochem Physiol C 1992;101:589-91. 29. Georghiou G. Insecticide resistance and prospects for its management. Residue Rev 1980;76:131-45.

82

Biomédica 2007;27(supl. 1):83-91

PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

ARTÍCULO ORIGINAL

Comparación de una prueba de PCR basada en los genes codificantes para la histona H2A/SIRE con pruebas serológicas convencionales para el diagnóstico de la enfermedad de Chagas crónica en pacientes colombianos
Juliana Gil 1, Paula Pavía 1, Marleny Montilla 2, Astrid C. Florez 2, Claudia Quintero 3, Marcela Mercado 1, Miguel Vacca 4, Santiago Nicholls 2, Concepción Puerta 1
1

2 3

4

Laboratorio de Parasitología Molecular, Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá D.C., Colombia. Laboratorio de Parasitología, Instituto Nacional de Salud, Bogotá D.C., Colombia. Unidad de Epidemiología, Departamento de Microbiología, Pontificia Universidad Javeriana, Bogotá D.C., Colombia. Unidad de Cardiología, Hospital Universitario San Ignacio, Pontificia Universidad Javeriana, Bogotá D.C., Colombia.

Introducción. El diagnóstico de la enfermedad de Chagas en sus fases latente y crónica se dificulta por la baja parasitemia, razón por la cual se recurre a métodos serológicos y moleculares. Objetivo. Comparar la prueba de reacción en cadena de la polimerasa basada en la amplificación del elemento SIRE insertado en el gen que codifica para la histona H2A con las pruebas serológicas convencionales para el diagnóstico de la enfermedad de Chagas en pacientes colombianos. Materiales y métodos. Se realizó un estudio de concordancia comparando la PCR TcH2AF/ R con las pruebas de inmunoensayo enzimático e inmunofluorescencia indirecta, determinándose además la sensibilidad y especificidad de la prueba. Se clasificaron y examinaron 156 individuos según los hallazgos clínicos y epidemiológicos y los resultados de las pruebas serológicas. Adicionalmente, 97 de las 156 muestras fueron comparadas con la PCR S35/S36. Resultados. De 156 muestras, 89 (57%) fueron positivas por IFI y ELISA, y 84 (53,8%) presentaron el perfil de amplificación correspondiente a la banda esperada de 234 pb, obteniéndose una sensibilidad de 88% (I.C. 95%: 75% - 95%) y especificidad de 92,5% (I.C. 95%: 87,7% - 97,2%). El índice kappa, indicador de concordancia entre las pruebas serológicas y TcH2AF/R fue de 0,8 (I.C. 95%: 73% - 86%), en tanto entre las PCR TcH2AF/R y S35/S36 fue de 0,9 (I.C. 95%: 84% - 96%), interpretados como una concordancia buena y casi perfecta, respectivamente. Conclusiones. La PCR TcH2AF/R es una prueba diagnóstica promisoria complementaria a las pruebas serológicas, para la detección de Trypanosoma cruzi. Palabras clave: reacción en cadena de la polimerasa, histonas, miocardiopatía chagásica, Trypanosoma cruzi. Comparison of a PCR test based on the histone H2A/SIRE genes with classical serological tests for the diagnosis of chronic Chagas disease in Colombian patients Introduction. Diagnosis of Chagas disease in its latent and chronic phase is difficult because of the low parasitemia levels. Therefore, serological and molecular techniques are necessary to achieve an appropriate diagnosis. Objective. The polymerase chain reaction based on the amplification of the SIRE element inserted into H2A encoding genes was compared with classical serological tests for the diagnosis of Chagas disease in Colombian patients.

83

Gil J., Pavía P., Montilla M. et al

Biomédica 2007;27(supl. 1):83-91

Materials and methods. An agreement study was carried out by comparing the PCR with ELISA (enzyme linked immuno sorbent assay) and IFAT (indirect immunofluorescence) tests. In addition, the PCR sensitivity and specificity were determined. A sample of 156 individuals was tested with the H2A PCR primers after a Chagas disease classification based on clinical, epidemiological and serological data associated with each patient. In addition, 97 out of 156 samples were also compared with the S35/S36 PCR primers. Results. Eighty-nine of 156 samples (57%) were positive by both IFAT and ELISA and 84 (53.8%) presented the expected 234 bp amplification fragment. The sensitivity of the TcH2AF/ R PCR was 88% (95% C.I.: 75%--95%) and its specificity 92.5% (95% C.I.: 87.7%--97.2%). The kappa index for concordance between serological tests and TcH2AF/R PCR was 0.8 (95% C.I.: 73%--86%), and between the TcH2AF/R and S35/S36 PCR primers was 0.9 (95% C.I.: 84%-96%). These indices indicated a “good” and “almost perfect” agreement, respectively. Conclusions. The TcH2AF/R PCR is a promising diagnostic tool for the detection of T. cruzi and is suggested as a tool complementary to the classical serological tests. Key words: polymerase chain reaction, histones, Chagas myocardiopathy, Trypanosoma cruzi

Trypanosoma cruzi es un parásito protozoo hemoflagelado, agente causal de la enfermedad de Chagas, entidad que afecta a 18 millones de personas en 15 países endémicos, con una incidencia anual de 200.000 nuevos casos (1). En Colombia se estima que hay cerca de 700.000 personas infectadas con un 23% de la población en riesgo de contraer la enfermedad y entre 30 y 40 mil nuevos casos anuales (2). T. cruzi se distribuye ampliamente en Sur América, presentando un amplio rango de vectores, hospederos y reservorios, así como un amplio pleomorfismo genético y biológico (3-6). En Colombia se ha visto que aun cuando la mayoría de las cepas del parásito pertenecen al grupo T. cruzi I o zimodema Z1 (7-13, Dib J, Restrepo M, Parra G, Tibayrenc M, Barnabe C, Triana O. Definición de dos poblaciones de Trypanosoma cruzi I en el norte de Colombia mediante análisis de RAPD y el gen de la proteína flagelar. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2005;25:207-8.), éstas varían en sus características genéticas dependiendo especialmente de su
Correspondencia: Concepción Puerta, Laboratorio de Parasitología Molecular, Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá D.C., Colombia. Teléfono:(+571) 3208320 ext. 4024, fax (571) 3208320 ext. 4021 cpuerta@javeriana.edu.co Recibido: 15/02/06; aceptado: 09/06/06

ciclo de transmisión (7, Dib J, Restrepo M, Parra G, Tibayrenc M, Barnabe C, Triana O. Definición de dos poblaciones de Trypanosoma cruzi I en el norte de Colombia mediante análisis de RAPD y el gen de la proteína flagelar. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2005;25:207-8.). Por otra parte, T. cruzi presenta morfología similar y reacción inmunológica cruzada con Trypanosoma rangeli, parásito con el cual también comparte zonas endémicas, vectores y reservorios (14,15). Debido a lo anterior, se hace necesario el desarrollo de pruebas específicas que disminuyan o eliminen el riesgo de falsos negativos por variabilidad intra-cepa y falsos positivos por la presencia de T. rangeli. Algunos estudios han demostrado la utilidad y el alto potencial de la prueba de reacción en cadena de la polimerasa (PCR) para el diagnóstico de la enfermedad de Chagas, tanto en su etapa aguda como en la crónica (16,17). Una de las pruebas más usadas es la PCR basada en los iniciadores S35/S36, los cuales amplifican los minicírculos del ADN del cinetoplasto (kADN) del parásito (18). Sin embargo, estos iniciadores también amplifican el kADN de T. rangeli, presentándose perfiles que sólo pueden ser distinguidos en geles de poliacrilamida y que, en caso de infecciones mixtas por ambos tripanosomas, pueden enmascarar la presencia de T. rangeli haciéndolo pasar por T. cruzi (19). Además, recientemente se ha visto que el kADN es capaz de integrarse al ADN de la célula hospedera, de manera que

84

Biomédica 2007;27(supl. 1):83-91

PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

existe la posibilidad de amplificación de las bandas esperadas en ausencia de infección (20). Por estas razones se requiere explorar el uso de otras pruebas para la identificación específica de T. cruzi. Teniendo en cuenta lo anterior, en este trabajo se propuso la evaluación de la prueba de PCR basada en la amplificación del gen que codifica para la histona H2A en pacientes colombianos para la detección de T. cruzi y su comparación con los métodos serológicos convencionales de inmunofluorescencia indirecta (IFI) e inmunoensayo enzimático (Elisa) (21). Materiales y métodos

Universitario San Ignacio de la Pontificia Universidad Javeriana y del Instituto Nacional de Salud.

Extracción de ADN a partir de sangre
A partir de una muestra de 5 ml de de sangre anticoagulada con EDTA se realizó la extracción de ADN utilizando una alícuota de 0,5 ml mediante el estuche comercial “GFX™ Genomic Blood DNA Purification Kit” (Amersham Pharmacia) y el método fenol-cloroformo-alcohol isoamílico según el protocolo descrito por Vallejo y colaboradores (18), realizando el paso de extracción con fenolcloroformo-alcohol isoamílico tres veces. El ADN obtenido fue resuspendido en 10 mM de Tris y 1 mM de EDTA, pH 8,0 (TE) estéril.

Pacientes y grupos de estudio
En este estudio participaron 156 individuos entre los 18 y 65 años, de quienes se obtuvo consentimiento informado. Dichos individuos fueron clasificados de acuerdo con el cuadro clínico, las variables epidemiológicas y el resultado de las pruebas serológicas IFI y Elisa (22) en 4 grupos: grupo control (A), conformado por 55 (35,3%) individuos sin riesgo epidemiológico, examen físico y electrocardiograma normal y resultados de IFI y Elisa negativos; grupo de pacientes infectados sin cardiopatía (B), conformado por 16 (10,2%) individuos asintomáticos, con riesgo epidemiológico, examen físico y electrocardiograma normales y pruebas serológicas positivas; grupo de pacientes infectados con cardiopatía (C), constituído por 73 (46,8%) individuos sintomáticos con riesgo epidemiológico, examen físico y electrocardiograma anormales con síntomas cardiovasculares clínicamente significativos y pruebas serológicas positivas, y grupo control de individuos no infectados con cardiopatía (D), conformado por 12 (7,7%) individuos con examen físico y electrocardiograma anormales, con cardiopatía dilatada de origen no chagásico y pruebas serológicas negativas. Este estudio corresponde a una investigación con riesgo mínimo, de acuerdo con la resolución No. 08430 del Ministerio de Salud de Colombia, y fue aprobado por el Comité de Investigación y Ética de la Facultad de Ciencias y del Hospital

Extracción de ADN del parásito
Se trabajó con formas epimastigotas de las cepas de T. cruzi, D.A. (MHOM/CO/01/DA) y Munantá (IRHO/CO/98/MTA). El cultivo en masa de los parásitos en fase logarítmica se centrifugó a 4.000 r.p.m. durante una hora. El precipitado obtenido se lavó tres veces con 1 ml de solución salina amortiguada con fosfatos (PBS); se centrifugó nuevamente a 6.000 r.p.m. durante 10 min a 4°C y se resuspendió en 1 ml de PBS y 100 µl de NP40 al 10% en agua; se mezcló, centrifugó a 10.000 r.p.m. por 5 min y se resuspendió en 2 ml de PBS y SDS al 10%. El ADN se extrajo según el método de fenol-cloroformo-alcohol isoamílico, seguido de precipitación con etanol. Finalmente, se midió la concentración del ADN por espectrofotometría a 260/280 nm y se evaluó en geles de agarosa al 1% coloreados con bromuro de etidio (23).

Pruebas de PCR
Para la reacción de PCR TcH2AF/R se utilizaron los oligonucleótidos TcH2AF (5´- AGT GGC AGA CTT TGG GGT C -3´) y TcH2AR (5´- GAG AGT GAT GGG AGA GC -3´), los cuales anillan en el elemento SIRE insertado en la región no codificante de la unidad de 1,2 kb del gen de la histona H2A de T. cruzi (24). La reacción de PCR se llevó a cabo de acuerdo con lo descrito por Pavia y colaboradores (21), utilizando el siguiente programa en un termociclador PTC -100 MJ Research®: denaturación inicial a 95°C por 5 min,

85

Gil J., Pavía P., Montilla M. et al

Biomédica 2007;27(supl. 1):83-91

15 ciclos con el siguiente perfil: denaturación a 95°C por 30 segundos, anillaje y extensión a 72°C por 30 segundos cada uno. Luego, se realizaron 30 ciclos con denaturación a 95°C por 30 segundos, anillaje a 65°C por 30 segundos y extensión a 72°C por 30 segundos, seguidos de la extensión final a 72°C por 5 min. Como blanco de reacción se reemplazó el ADN de la muestra por agua o por TE; como control negativo se utilizó ADN humano y como positivo ADN de la cepa Munantá (IRHO/CO/98/MTA) del parásito. Los productos de amplificación fueron analizados mediante electroforesis en gel de agarosa al 1,5% teñido con bromuro de etidio (23). La prueba de PCR S35/S36 se realizó de acuerdo a lo descrito por Vallejo y colaboradores (18). Con el fin de eliminar la posibilidad de inhibición de la reacción de PCR en las muestras negativas, éstas fueron amplificadas nuevamente tras la adición de 50 ng ADN de la cepa Munantá (IRHO/CO/98/MTA) del parásito.

PCR. Ambos ensayos se realizaron tres veces para asegurar la reproducibilidad de los resultados.

Análisis estadístico
Los datos fueron consignados en una base de datos elaborada con el paquete estadístico EPIINFO 6.0. El análisis estadístico descriptivo de las pruebas diagnósticas se realizó a través del paquete estadístico Stata 6.0. Se analizaron las características operativas de la prueba (sensibilidad y especificidad) y se realizó el cálculo del índice de concordancia kappa con sus respectivos intervalos de confianza (25). Resultados

Determinación de la capacidad de detección de la prueba de PCR TcH2AF/R
Se observó el producto de amplificación esperado de 234 pb con la PCR TcH2AF/R hasta con una forma del parásito en ambas cepas a partir del ADN extraído por el método de triple extracción con fenol-cloroformo-alcohol isoamílico en tres réplicas del experimento (figura 1). Igualmente, con la PCR S35/S36 se pudo detectar hasta un parásito utilizando el método de extracción de triple fenol-cloroformo-alcohol isoamílico, independientemente de la cepa empleada. No obstante, con el estuche comercial disminuyó el poder de detección de ambas pruebas de PCR de

Determinación del poder de detección de la PCR
Se determinó la cantidad mínima de parásitos a detectar por ambas reacciones de PCR mezclando cantidades en base 10 de formas epimastigotas del parásito con sangre humana libre de infección, seguida de la extracción de ADN y ensayos de

Figura 1. Prueba de PCR basada en los iniciadores TcH2AF/R a partir de epimastigotes de la cepa Munanta de T. cruzi mezclados con sangre humana libre de infección y extracción de ADN por el método triple fenol: cloroformo: alcohol isoamílico. Gel de agarosa al 1,5%, teñido con bromuro de etidio: marcador de peso molecular 100 pb (Promega) (1); 10 2 parásitos (2); 102 parásitos diluidos 1/5 (3); 102 parásitos diluidos 1/10 (4); 101 parásitos (5); 101 parásitos diluidos 1/5 (6); 101 parásitos diluidos 1/10 (7); 100 parásitos (8); 100 parásitos diluidos 1/5 (9); 100 parásitos diluidos 1/10 (10); agua milli-Q como blanco de reacción (11) y ADN de la cepa Munantá de T. cruzi como control positivo (12).

86

Biomédica 2007;27(supl. 1):83-91

PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

1 a 100 parásitos en el caso de la cepa D.A. y de 1 a 10 parásitos en el caso de la PCR S35/S36 usando el ADN de la cepa Munantá como blanco de amplificación. Con el fin de corroborar los resultados anteriores, se realizó una prueba piloto con 31 muestras de pacientes chagásicos y 26 de individuos sanos, en la cual se observó que de 57 muestras a las cuales se les realizó la prueba de PCR TcH2AF/ R a partir del ADN extraído con ambos métodos de extracción, 18 (31,5%) fueron positivas para ambos métodos, dos (3,5%) fueron positivas únicamente para el estuche comercial y 13 (22,8%) para el de triple extracción con fenol-cloroformoalcohol isoamílico. Se obtuvo un índice de concordancia kappa de 0,49 (IC 95%: 36 - 62%), interpretado como una concordancia moderada entre estos dos métodos de extracción. Con base en estos resultados, se seleccionó el método de triple extracción con fenol-cloroformo-alcohol isoamílico para la extracción del ADN de las muestras a analizar.

enfermedad de Chagas, utilizando cepas nativas colombianas (22). Ambas pruebas serológicas en este estudio arrojaron resultados idénticos. Del total de 156 muestras, 89 (57%) fueron positivas por IFI y Elisa y 84 (53,8%) presentaron el perfil de amplificación correspondiente a la banda esperada de 234 pb, presentándose 79 muestras positivas por ambos métodos (figura 2). Por su parte, de las 67 muestras negativas por ambas pruebas serológicas, 62 de ellas también fueron negativas por la prueba de PCR TcH2AF/ R (figura 2). Se obtuvo una sensibilidad de 88% (IC 95%: 75 95%) y especificidad de 92,5% (IC 95%: 87,7 97,2%) al comparar la prueba de PCR TcH2AF/R con las pruebas serológicas. El índice de concordancia kappa entre la prueba de PCR TcH2AF/R y ambas pruebas serológicas fue de 0,8 (IC 95%: 73 - 86%), interpretado como una buena concordancia. El análisis del desempeño de la PCR TcH2AF/R en cada grupo de estudio fue el siguiente: en el grupo control de pacientes no infectados (A), de un total de 55 muestras, cuatro (7,3%) fueron positivas por PCR y 51 (92,7%) fueron negativas. En el grupo de pacientes infectados asintomáticos (B), de un total de 16 muestras, 15 (93,7%) fueron positivas por la PCR TcH2AF/R. En el grupo de

Comparación de la prueba de PCR TcH2AF/R con las pruebas serológicas y la PCR S35/S36
Se realizó un estudio de concordancia en donde se comparó la PCR TcH2AF/R con las pruebas serológicas de IFI y Elisa, técnicas utilizadas en el Instituto Nacional de Salud como referencia para el diagnóstico y confirmación de la

Figura 2. Detección de T. cruzi en sangre total de pacientes colombianos mediante la PCR TcH2AF/R. Gel de agarosa al 1,5%, teñido con bromuro de etidio: marcador de peso molecular de 100 pb (Promega) (1); muestra 085, negativa (2); muestra 085 diluida 1/5 (3); muestra 085 diluida 1/10 (4); muestra 079, positiva (5); muestra 079 diluida 1/5, (6); muestra 079 diluida 1/10 (7); muestra 074, positiva (8); muestra 074 diluida 1/5 (9), muestra 074 diluida 1/10 (10); ADN de la cepa Munantá de T. cruzi como control positivo (11); ADN humano como control negativo (12) y agua Milli-Q estéril como blanco de reacción (13).

87

Gil J., Pavía P., Montilla M. et al

Biomédica 2007;27(supl. 1):83-91

pacientes sintomáticos (C), de un total de 73 muestras, 64 (87,6%) fueron positivas por PCR y 9 (12,3%) fueron negativas. En el grupo de individuos control con cardiopatía (D), de un total de 12 muestras, 11 (91,7%) fueron negativas por la PCR TcH2AF/R y una fue positiva. Considerando los individuos seropositivos (grupos B y C) o seronegativos (grupos A y D), se tiene que en los primeros la PCR TcH2AF/R detectó como positivos al 88,7% (79 de 89), en tanto que en los segundos, de 67 muestras, 5 (7,5%) de ellas fueron positivas por la prueba de PCR. Por otra parte, de las 156 muestras, 96 de ellas también fueron analizadas mediante la PCR S35/ S36, encontrando un índice kappa de 0,9 (IC 95%: 84 -96%), interpretado como una concordancia casi perfecta. Discusión El diagnóstico de la enfermedad de Chagas depende de la etapa de la enfermedad en la que se encuentre el paciente y se debe apoyar en la información tanto epidemiológica como clínica del paciente, así como en las pruebas de laboratorio. Mientras en la etapa aguda de la enfermedad el diagnóstico no presenta problemas debido a la elevada parasitemia, en las etapas indeterminada y crónica, el diagnóstico es muy complejo y requiere de varias pruebas de laboratorio para su confirmación (1,17,22). Entre las pruebas de laboratorio disponibles para el diagnóstico en las etapas indeterminada y crónica de la enfermedad, actualmente se encuentran las pruebas serológicas y el diagnóstico molecular directo por PCR. Mientras las primeras son pruebas indirectas que se basan en la detección de anticuerpos contra el parásito y dependen del estado inmunológico del paciente, de los antígenos, de la fase de desarrollo del parásito empleado en la prueba y del tiempo transcurrido desde la infección, los segundos se basan en la detección directa del ADN del parásito y no dependen del estado inmunológico del paciente ni del tiempo de adquisición de la infección (16,26). En este trabajo se comparó el desempeño de la prueba de PCR TcH2AF/R para el diagnóstico de

pacientes chagásicos indeterminados y crónicos con miras a su utilización como una prueba de apoyo en el diagnóstico de esta enfermedad. El poder de detección de la prueba TcH2AF/R, evidenciada por la detección de hasta una forma parasitaria en los ensayos de infección artificial, se explica por la abundancia de los genes H2A (24,27) y por que el elemento SIRE short interspersed repetitive element, con 2.000 a 3.000 copias por genoma, se encuentra integrado en el extremo 3’ no traducido (UTR) de los genes codificantes para la histona H2A del parásito y sus nucleótidos 16 a 248 (no. de acceso al GenBank, AF098063) corresponden al fragmento amplificado con los cebadores TcH2AF/R (27,28). Los resultados obtenidos en este trabajo se apoyan en la especificidad de la prueba TcH2AF/ R reportada por Pavía y colaboradores, según la cual los iniciadores TcH2AF/R amplifican exclusivamente el ADN de cepas de T. cruzi pertenecientes a los grupos I y II hasta ahora descritos del parásito (29), en tanto que no amplifican el ADN de otros tripanosomátidos que circulan en Colombia, como T. rangeli tanto de cepas KP 1(+) como KP 1(-), representantes de los linajes de este parásito (30) ni de Leishmania spp. y Crithidia spp., entre otros (21). Es así como la PCR TcH2AF/R fue capaz de detectar el 88% de los individuos serológicamente positivos, porcentaje similar al 84,8% descrito por Gutiérrez y colaboradores en un estudio llevado a cabo en 79 individuos seropositivos en Santander (Colombia) utilizando como blanco el ADN del cinetoplasto del parásito (31). Resultados similares de 83,5 y 90% de positividad fueron reportados por Gomes y colaboradores en 79 pacientes seropositivos y por Britto y colaboradores en 61 en Brasil (32,33). Porcentajes superiores de positividad por PCR en pacientes crónicos han sido descritos con un número menor de pacientes (34) o sometiendo los productos de amplificación a un paso posterior de hibridación con un cebador interno dentro de la secuencia amplificada (35). En este estudio, el 12% de los individuos seropositivos no fue detectado a pesar de que se

88

Biomédica 2007;27(supl. 1):83-91

PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

descartó la presencia de inhibición de la PCR. Estos resultados pueden deberse a alguna de las siguientes razones o a una combinación de las mismas: (i) niveles escasos de parasitemia, de forma que en los 500 µl de la muestra no estuviera presente ningún parásito (36); (ii) intermitencia en la parasitemia (37), o (iii) presencia de falsos positivos en las pruebas serológicas posiblemente por reacción cruzada con otros tripanosomátidos como Leishmania y T. rangeli (38). En el caso de los cinco pacientes positivos por PCR y negativos por serología, en primer lugar llama la atención cómo estos pacientes fueron positivos tanto por la prueba TcH2AF/R, que amplifica blancos nucleares (21), como por la prueba S35/S36, que amplifica blancos mitocondriales (18), lo cual apoya la presencia de infección. Se ha reportado que pacientes chagásicos pueden presentar pruebas de xenodiagnóstico positivas y serologías negativas en algunos momentos de la enfermedad, especialmente en individuos recién infectados o con estado inmunológico comprometido (39), situación que puede explicar la presencia de PCR positiva en ausencia de anticuerpos IgG antiT.cruzi. Este hallazgo también fue observado en el estudio reportado por Gutiérrez y colaboradores, en el que uno de los 25 individuos serológicamente negativos (4%) fue positivo por PCR (31); por Salomone y colaboradores, quienes encontraron que de 80 individuos seronegativos, 12 (15%) tenían PCR positiva y tres de éstos presentaban síntomas clínicos compatibles con la enfermedad de Chagas (40); por Gomes y colaboradores, quienes reportaron que 10 de 21 (47,6%) pacientes con serología negativa presentaron PCR y ensayos de lisis mediada por el complemento positivas (32), y por Avila y colaboradores, quienes encontraron PCR positiva en tres de cuatro pacientes seronegativos (35). Adicionalmente, analizando los posibles factores de riesgo de contaminación durante el proceso de manipulación, extracción y amplificación del ADN, se tiene que cada uno de los pasos de las pruebas de PCR (extracción del ADN, reacción de pre-PCR, amplificación y electroforesis) se realizó en áreas diferentes y separadas, utilizando

material anti-aerosol, blancos de reacción y controles negativos. Es de especial interés el buen desempeño presentado por la prueba de PCR TcH2AF/R en el grupo de pacientes crónicos asintomáticos, en los cuales no se dispone de la ayuda que brinda la sintomatología para el diagnóstico basado en la tríada pruebas de laboratorio, sintomatología y epidemiología. Así mismo, en pacientes cardiópatas con síntomas compatibles con la enfermedad de Chagas, la PCR TcH2AF/R puede constituir una herramienta valiosa para descartar la infección por T. cruzi. Teniendo en cuenta los resultados de este trabajo y las deficiencias de las pruebas serológicas convencionales en cuanto a la posibilidad de reacción cruzada con otros tripanosomátidos, lo que da lugar a falsos positivos y también a falsos negativos en casos de infección reciente o estado inmunológico comprometido, la PCR TcH2AF/R se perfila como una prueba diagnóstica promisoria de apoyo para la detección de T. cruz i en pacientes crónicos. Con el fin de aumentar el poder de detección de la prueba de PCR se proponen las siguientes estrategias: (i) aumentar el volumen de sangre a analizar a una alícuota de 0,7-1 ml; (ii) preservar la muestra de sangre en clorhidrato de guanidina; (iii) tomar muestras seriadas con intervalos mínimos de dos a tres meses, e (iv) hibridar el producto de amplificación obtenido con un iniciador interno. A pesar de los resultados prometedores de las pruebas de PCR, se requiere de un mayor número de estudios sobre consistencia y conformidad con la PCR TcH2AF/R y otras pruebas de PCR que utilizan blancos diferentes de amplificación, para postular su uso como patrón de oro en el diagnóstico de la enfermedad de Chagas. Adicionalmente, el requerimiento de equipo especializado y elevado costo de las pruebas de PCR hace difícil su uso común y de rutina, característica primordial de todo patrón de oro. No obstante, estudios paralelos del grupo de investigación proponen el uso de un “constructo” como patrón de oro, utilizando la PCR como prueba diagnóstica, además de los hallazgos clínicos y epidemiológicos (41).

89

Gil J., Pavía P., Montilla M. et al

Biomédica 2007;27(supl. 1):83-91

Agradecimientos Los autores expresan su agradecimiento a la Unidad de Electrofisiología y Cardiología del Hospital Universitario San Ignacio (HUSI), a la Clínica Shaio y al Centro de Salud del municipio de Santana, departamento de Boyacá. Conflicto de intereses Los autores manifestamos expresamente que durante la realización del presente trabajo no existió conflicto de intereses que pudiera afectar los resultados obtenidos. Financiación Este estudio fue financiado por la Vicerrectoría Académica de la Pontificia Universidad Javeriana. Registro de proyecto 1702. Referencias
1. World Health Organization. Control of Chagas Disease. Second report of the WHO Expert Committee. Technical Report 2002. Series 905. Geneva: WHO;2002. p.39-40. 2. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the Southern Cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 3. Macedo AM, Machado CR, Oliveira RP, Pena SD. Trypanosoma cruzi : genetic structure of populations and relevance of genetic variability to the pathogenesis of Chagas disease. Mem Inst Oswaldo Cruz 2004;99:112. 4. Huete-Perez JA, Flores-Obando RE, Ghedin E, Caffrey CR. Genomic and proteomic approaches for Chagas’ disease: critical analysis of diagnostic methods. Expert Rev Mol Diagn 2005;5:521-30. 5. D’Avila DA, Gontijo ED, Lages-Silva E, Meira WS, Chiari E, Galvao LM. Random amplified polymorphic DNA profiles of Trypanosoma cruzi isolates from chagasic patients with different clinical forms. Parasitol Res 2006;98:455-61. 6. Machado CR, Augusto-Pinto L, McCulloch R, Teixeira SM. DNA metabolism and genetic diversity in Trypanosomes. Mutat Res 2006;612:40-57. 7. Saravia NG, Holguin AF, Cibulskis RE, D’Alessandro A. Divergent isoenzyme profiles of sylvatic and domiciliary Trypanosoma cruzi in the eastern plains, piedmont, and highlands of Colombia. Am J Trop Med Hyg 1987;36:59-69. 8. Rodríguez P, Montilla M, Nicholls RS, Zarante I, Puerta, C. Isoenzymatic characterization of Colombian

strains of Trypanosoma cruzi. Mem Inst Oswaldo Cruz 1998;93:739-40. 9. Marquez E, Arcos-Burgos M, Triana O, Moreno J, Jaramillo N. Clonal population structure of Colombian sylvatic Trypanosoma cruzi . J Parasitol 1998;84: 1143-9. 10. Triana O, Jaramillo N, Moreno J. Genetic variability of Colombian populations of Trypanosoma cruzi and Trypanosoma rangeli. Biol Res 1999;32:1-10. 11. Montilla MM, Guhl F, Jaramillo C, Nicholls S, Barnabe C, Bosseno MF, et al. Isoenzyme clustering of Trypanosomatidae Colombian populations. Am J Trop Med Hyg 2002;66:394-400. 12. Rodríguez P, Escalante M, Díez H, Cuervo C, Montilla M, Nicholls RS, et al. Estudio de la variabilidad de seis cepas colombianas de Trypanosoma cruzi mediante polimorfismos de longitud de fragmentos de restricción (RFLP) y amplificación aleatoria de ADN polimórfico (RAPD). Biomédica 2002;22:263-71. 13. Mejia AM, Triana O. Análisis por LSSP-PCR de la variabilidad genética de Trypanosoma cruzi en sangre y órganos de ratones infectados. Biomédica 2005;25:76-86. 14. D’Alessandro A, Saravia N. Trypanosoma rangeli. En: Gilles HM, editor. Protozoal diseases. London: Arnold Press;1999. p.398-412. 15. Guhl F, Vallejo GA. Trypanosoma ( Herpetosom a) rangeli Tejera, 1920: an updated review. Mem Inst Oswaldo Cruz 2003;98:435-42. 16. Vallejo GA. Estudios comparativos entre las secuencias de kDNA de Trypanosoma cruzi y Trypanosoma rangeli y su aplicación en el diagnóstico molecular de la tripanosomiasis americana. Actual Biol 1998;20:43-56. 17. Guhl F, Jaramillo C, Carranza JC, Vallejo GA. Molecular characterization and diagnosis of Trypanosoma cruzi and Trypanosoma rangeli. Arch Med Res 2002;33:362-70. 18. Vallejo GA, Gulh F, Chiari E, Macedo AM. Species specific detection of Trypanosoma cruzi and Trypanosoma rangeli in vector and mammalian hosts by polymerase chain reaction amplification of kinetoplast minicircle DNA. Acta Trop 1999;72:203-12. 19. Vargas N, Souto RP, Carranza JC, Vallejo GA, Zingales B. Amplification of a specific repetitive DNA sequence for Trypanosoma rangeli identification and its potential application in epidemiological investigations. Exp Parasitol 2000;96:147-59. 20. Nitz N, Gomes C, de Cassia Rosa A, D’Souza-Ault MR, Moreno F, Lauria-Pires L, et al . Heritable integration of kDNA minicircle sequences from Trypanosoma cruzi into the avian genome: insights into human Chagas disease. Cell 2004;118:175-86.

90

Biomédica 2007;27(supl. 1):83-91

PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

21. Pavía P, Cuervo C, Montilla M, Nicholls S, Puerta C. Diseño y estandarización de una prueba de PCR para la detección específica de Trypanosoma cruzi. Infectio 2003;7:129-36. 22. Beltrán M, Duque S, Guhl F, Herrera CP, López MC, Moreno AL, et al. Prueba de ELISA y prueba de inmunofluorescencia indirecta (IFI). En: Guhl F, Nicholls RS, editores. Manual de procedimientos para el diagnóstico de la enfermedad de Chagas. Bogotá: Ministerio de Salud; 2001. p.32-48. 23. Sambrook JF, Russell DW. Gel electrophoresis of DNA. En: Molecular cloning A laboratory manual. Tercera edición. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 2001.p.5.1-17. 24. Puerta C, Martin J, Alonso C, Lopez MC. Isolation and characterization of the gene encoding histone H2A from Trypanosoma cruzi . Mol Biochem Parasitol 1994;64:1-10. 25. Sackett D, Haynes R, Guyatt G, Tugwell P. Selección de pruebas diagnosticas. En: Epidemiologia Clínica. Segunda Edición. México, D.F.: Editorial Médica Panamericana; 1998. p.64-7. 26. Wincker P, Britto C, Pereira JB, Cardoso MA, Oelemann W, Morel CM. Use of a simplified polymerase chain reaction procedure to detect Trypanosoma cruzi in blood samples from chronic chagasic patients in a rural endemic area. Am J Trop Med Hyg 1994;51:771-7. 27. Thomas MC, Olivares M, Escalante M, Maranon C, Montilla M, Nicholls S, et al. Plasticity of the histone H2A genes in a Brazilian and six Colombian strains of Trypanosoma cruzi. Acta Trop 2000;75:203-10. 28. Vázquez MP, Schijman AG, Levin MJ. A short interspersed repetitive element provides a new 3’ acceptor site for trans-splicing in certain ribosomal P2 beta protein genes of Trypanosoma cruzi. Mol Biochem Parasitol 1994;64:327-36. 29. Brisse S, Verhoef J, Tibayrenc M. Characterisation of large and small subunit rRNA and miniexon genes further support the distinction of six Trypanosoma cruzi lineages. Int J Parasitol 2001;31:1218-26. 30. Urrea DA, Carranza JC, Cuba CA, GurgelGoncalves R, Guhl F, Schofield CJ, et al. Molecular characterisation of Trypanosoma rangeli strains isolated from Rhodnius ecuadoriensis in Peru, R. colombiensis in Colombia and R. pallescens in Panama, supports a co-evolutionary association between parasites and vectors. Infect Genet Evol 2005;5:123-9. 31. Gutierrez R, Angulo VM, Tarazona Z, Britto C, Fernandes O. Comparison of four serological tests for the diagnosis of Chagas disease in a Colombian endemic area. Parasitology 2004;129:439-44.

32. Gomes ML, Galvao LM, Macedo AM, Pena SD, Chiari E. Chagas’ disease diagnosis: comparative analysis of parasitologic, molecular, and serologic methods. Am J Trop Med Hyg 1999;60:205-10. 33. Britto C, Cardoso MA, Vanni CM, HasslocherMoreno A, Xavier SS, Oelemann W, et al. Polymerase chain reaction detection of Trypanosoma cruzi in human blood samples as a tool for diagnosis and treatment evaluation. Parasitology 1995;110:241-7. 34. Wincker P, Bosseno MF, Britto C, Yaksic N, Cardoso MA, Morel CM, et al. High correlation between Chagas’ disease serology and PCR-based detection of Trypanosoma cruzi kinetoplast DNA in Bolivian children living in an endemic area. FEMS Microbiol Lett 1994;124:419-23. 35. Avila HA, Pereira JB, Thiemann O, De Paiva E, DeGrave W, Morel CM, et al . Detection of Trypanosoma cruzi in blood specimens of chronic chagasic patients by polymerase chain reaction amplification of kinetoplast minicircle DNA: comparison with serology and xenodiagnosis. J Clin Microbiol 1993;31:2421-6. 36. Junqueira AC, Chiari E, Wincker P. Comparison of the polymerase chain reaction with two classical parasitological methods for the diagnosis of Chagas disease in an endemic region of north-eastern Brazil. Trans R Soc Trop Med Hyg 1996;90:129-32. 37. Castro AM, Luquetti AO, Rassi A, Rassi GG, Chiari E, Galvao LM. Blood culture and polymerase chain reaction for the diagnosis of the chronic phase of human infection with Trypanosoma cruzi . Parasitol Res 2002;88:894-900. 38. Marcon GE, Andrade PD, de Albuquerque DM, Wanderley Jda S, de Almeida EA, Guariento ME, et al. Use of a nested polymerase chain reaction (N-PCR) to detect Trypanosoma cruzi in blood samples from chronic chagasic patients and patients with doubtful serologies. Diagn Microbiol Infect Dis 2002;43:39-43. 39. Luquetti AO. Megaesofago e anticorpos anti– Trypanosoma cruzi . Rev Goiana Med 1987;33:1-16. 40. Salomone OA, Basquiera AL, Sembaj A, Aguerri AM, Reyes ME, Omelianuk M, et al . Trypanosoma cruzi in persons without serologic evidence of disease, Argentina. Emerg Infect Dis 2003;9:1558-62. 41. Vacca M, Mercado M. Determinación de las características operativas de las pruebas serológicas con cepas colombianas de Trypanosoma cruz i utilizadas para el diagnóstico de la enfermedad de Chagas. (Tesis de Maestría en Epidemiología Clínica). Bogotá D.C.: Unidad de Epidemiología Clínica, Hospital Universitario San Ignacio, Pontificia Universidad Javeriana; 2006.

91

Arroyo C.M., Esteban L., Catalá S., Angulo V.M. Biomédica 2007;27(Supl. 1):92-100

Biomédica 2007;27(supl. 1):92-100

ARTÍCULO ORIGINAL

Variación del fenotipo antenal de poblaciones del domicilio, peridomicilio y silvestres de Triatoma dimidiata (Hemiptera: Reduviidae) en Santander, Colombia
Corina María Arroyo 1, Lyda Esteban 1, Silvia Catalá 2, Víctor Manuel Angulo
1

1

2

Centro de Investigaciones en Enfermedades Tropicales (CINTROP), Universidad Industrial de Santander, Piedecuesta, Santander, Colombia. Centro Regional de Investigaciones Científicas y Transferencia Tecnológica (CRILAR) Anillaco, La Rioja, Argentina.

Introducción. Triatoma dimidiata es uno de los triatominos más ampliamente distribuidos en Colombia, la caracterización fenotípica antenal de poblaciones de diferentes hábitats proporcionaran conocimientos sobre su biología y comportamiento que podrán ser utilizados en nuevas propuestas metodológicas para su control. Objetivo. Estudiar el comportamiento de poblaciones de Triatoma dimidiata en diferentes hábitats utilizando el fenotipo antenal. Materiales y métodos. Se analizaron un mecanorreceptor y tres quimiorreceptores antenales de 60 individuos de Triatoma dimidiata provenientes de diferentes hábitats en Santander utilizando análisis univariados y multivariados. Resultados. Los análisis multivariados diferenciaron significativamente las poblaciones de las hembras, estas diferencias estuvieron asociadas a variaciones en el número de tricoides de pared gruesa, con aumento de los tricoides de pared fina en hábitats cercanos al domicilio humano. Los machos con mayor número de sensilla y de tricoides de pared fina, no se diferenciaron, sin embargo tendencias similares fueron apreciadas. Se observó dimorfismo sexual entre todas las poblaciones y fue menor en el del domicilio. Conclusiones. El fenotipo de sensilla antenal fue útil en la diferenciación intraespecífica de Triatoma dimidiata en diferentes hábitats. Las diferencias en hembras ponen de manifiesto nuevos arreglos sensoriales para la explotación del hábitat a diferencia de los machos, que por su mayor capacidad de dispersión, no se diferenciaron entre los ecotopos. La similitud entre hembras de zona urbana, con hembras de peridomicilio rural permite proponer al fenotipo antenal como un sencillo y eficiente indicador para la determinación del origen de triatominos que intentan colonizar nuevos hábitats. Palabras claves: Triatoma, Triatominae, hábitat, enfermedad de Chagas, Colombia. Antennal phenotype variation in sylvatic, peridomestic and domestic populations of Triatoma dimidiata (Hemiptera: Reduviidae) from Santander, Colombia. Introduction. Triatoma dimidiata is one of the widely distributed triatomines in Colombia. The phenotype of the antenna is a characteristic of populations that can differ among habitats and can give information concerning its biology and behavior. This information in turn can be used in the development of new methodological proposals for its control. Objective. The behavior of populations of Triatoma dimidiate was studied in several different habitats, using the antennal phenotype. Materials and methods. A mechanoreceptor and three chemoreceptors were compared in the antennae of 60 Triatoma dimidiata adults from several defined habitats in Santander, using unvariate and multivariate analyses. Results. The multivariate analysis differentiated the female populations significantly. These differences were associated with variations in the number of thick-walled trichoids and with the numerical increase of the thin walled trichoids in habitats close to human housing. The males, with a larger number of sensilla and thin walled trichoids, were not differentiated significantly, although, similar tendencies were observed. Sexual dimorphism was clear in these characters

92

Biomédica 2007;27(supl. 1):92-100

Fenotipo antenal de Triatoma dimidiata

in the total population, but less pronounced in the domestic populations. Conclusions. The antennal sensilla patterns were useful in the intraspecific differentiation of Triatoma dimidiata in different habitats. The differences in the female population shed light on new sensorial arrangements for the exploration of the habitat, in contrast with the male populations that, because of their great capacity for dispersion, were not differentiated in the distinct habitats. The differences in sensilla patterns between females from urban areas and those from rural surroundings may be a simple and efficient marker of the origin of individual Triatominae attempting to colonize new habitats. Key words: Triatoma dimidiata, Triatominae, habitat, Chagas disease, Colombia.

La enfermedad de Chagas afecta a una población de entre 16 y 18 millones de personas en 21 países de América (1); su agente causal es Trypanosoma cruzi , protozoo transmitido por insectos hematófagos de las subfamilia Triatominae (Hemiptera: Reduviidae) (2); las especies de mayor importancia epidemiológica debido a su adaptación en el ambiente domiciliario son Triatoma infestans, Rhodnius prolixus y Triatoma dimidiata. Esta última especie está distribuida en Centro América y Colombia, en donde ocupa una gran diversidad de hábitats: domicilio, peridomicilio y silvestres en áreas rurales y urbanas (3-5). Por otra parte, en regiones costeras de Ecuador y norte de Perú se ha encontrado sólo en el domicilio humano (6). En Colombia ha aumentado su distribución de 4 a 13 departamentos en las últimas décadas (7), y al igual que en Centro América, se ha detectado en viviendas de zonas urbanas con buena construcción. Esta distribución y su gran capacidad para colonizar varios hábitats han favorecido las reinfestaciones observadas después de la aplicación de insecticidas piretroides (8-11) (Turriago B, Pinto N, Ghul F. Evaluación de deltametrina (K-Otrine SC 50® y K-Otrine WP 50®) como alternativa de control de Triatoma dimidiata. Biomédica 2005;25(Suppl.1): 195). Estas poblaciones reinfestantes probablemente no fueron alcanzadas por la acción insecticida y constituyen poblaciones peridomiciliarias o silvestres que incursionan en el domicilio humano; por ello, T.
Correspondencia: Corina María Arroyo, CINTROP, Universidad Industrial de Santander, Km 2 vía Guatiguará, Piedecuesta, Santander, Colombia. Teléfono: (57) 76563971, fax (57)76540177. corina_arroyo@yahoo.com Recibido: 20/10/05; aceptado: 13/07/06

dimidiata se convierte en una especie cuya erradicación no puede realizarse utilizando los métodos disponibles (12, Schofield CJ. Evolución y control del Triatoma dimidiata. Taller para el establecimiento de pautas técnicas en el control de Triatoma dimidiata. San Salvador; 2002. OPS/ HCD/HCT/214/02. p.12-8).
El estudio de la estructura poblacional y el uso de marcadores fenéticos y genéticos de las poblaciones de este vector es indispensable para obtener información sobre su biología y comportamiento y puede contribuir a una mejor planificación de la acciones de control vectorial, como se ha demostrado con esta especie y R. prolixus (13,14). El análisis de la estructura genética de T. dimidiata con RAPDS realizado en Boavita, Colombia, sugiere una baja diferenciación genética, indicando que las poblaciones extradomiciliarias representan un riesgo epidemiológico en la transmisión de la enfermedad de Chagas (15). En triatominos, el fenotipo antenal refleja modificaciones de los patrones ancestrales por la adaptación a diferentes hábitats y hospederos (16-18) y es útil en la diferenciación intraespecífica, Este estudio, primero en poblaciones de T. dimidiata de Colombia, se realizó para detectar variaciones en cuatro receptores antenales en los diferentes hábitats conocidos de una misma área geográfica y como contribución al conocimiento de la bioecología y ecoepidemiología de esta especie, y como orientación para metodologías de control vectorial en la zona endémica. Materiales y métodos

Área de estudio
El estudio se realizó en los años 2003 y 2004 en áreas rurales de los municipios de Macaravita y 93

Arroyo C.M., Esteban L., Catalá S., Angulo V.M.

Biomédica 2007;27(supl. 1):92-100

Capitanejo del departamento de Santander, ubicados sobre la cordillera oriental colombiana. El área está localizada entre los 1.090 y 2.500 msnm, 6°31’ a 6°27’ de latitud norte y 72°35’ a 72°42’ de longitud oeste, con temperaturas entre 12 y 25 °C, en la zona de influencia del Cañón del Chicamocha y los ríos Nevado, Servitá y otras corrientes menores. Las zonas de vida predominante son bosque seco premontano y bosque húmedo montano bajo con precipitación promedio anual de 731-1058 mm (19). El paisaje se caracteriza por el relieve montañoso quebrado y escarpado, con parches de bosque secundario, y por la presencia de formaciones rocosas de piedra caliza y vegetación xerofítica hacia la parte baja del cañón. Las actividades económicas de mayor importancia son la agricultura y la ganadería, principalmente cultivos de tabaco, la cría de cabras y animales de pastoreo. La mayoría de las viviendas en esta zona están construidas con paredes y pisos en tierra o ladrillo, techos de teja de barro sostenidos en entramado de cañabarro, poca iluminación y presencia de animales domésticos.

seleccionó un total de 60 individuos adultos de T. dimidiata de ambos sexos con sus antenas completas. En cada hábitat, se incluyeron 10 machos y 10 hembras en los análisis univariados y multivariados. Adicionalmente, se analizaron cuatro hembras capturadas en una vivienda urbana (VU) del municipio de Macaravita.

Preparación de la antena para el estudio del fenotipo antenal
Una antena por insecto se cortó a nivel del escapo (segmento basal o primero) y se almacenó en alcohol al 70%. Para su diafanización, la cutícula se sumergió en hidróxido de sodio al 4% durante 6 horas a 60°C, se neutralizó con ácido acético al 5% por 2 minutos, y finalmente se montó en lámina portaobjetos con glicerina al 87%.

Identificación y conteo de sensilias
El procedimiento se realizó en la cara ventral de los tres segmentos distales de la antena, pedicelo (P) y flagelos 1 y 2 (F1 y F2), utilizando un microscopio (Nikon E400, 40X) conectado a la cámara lúcida (Nikon y-IDT). Se analizaron tres quimiorreceptores: tricoide de pared fina (TPF), tricoide de pared gruesa (TPG) y basicónico (BA), y un mecanorreceptor Bristles (BR) de acuerdo al protocolo de Catalá et al. 1994 (20) y Catalá et al. 2005 (16).

Búsqueda de los insectos
Se recolectaron en los dormitorios (D) y peridomicilios (P) de las viviendas rurales y biotopos silvestres (S) localizados hasta 400 mts alrededor de las viviendas. Se consideró peridomicilio (P) el área que circunda a la vivienda humana y en el cual el hombre desarrolla sus actividades domésticas y productivas. Se tomaron muestras en corrales de animales, hornos de barro y pequeñas construcciones abiertas de bahareque y caña (caney) utilizadas para almacenar tabaco, elementos de trabajo y como lugares de reposo para gallinas, cabras y ganado vacuno. Las capturas en el domicilio y peridomicilio se hicieron a través de la búsqueda activa hora/hombre y con material que la comunidad envió al laboratorio de entomología. Para la captura de los triatominos silvestres (S) se utilizaron trampas diseñadas en el laboratorio de entomología, (Angulo VM, datos sin publicar), que se colocaron en cuevas por un periodo de 12 horas/noche. Los insectos recolectados fueron almacenados en tarros plásticos y etiquetados con datos de localidad, fecha y lugar de captura. Se 94

Medición de los segmentos antenales y conteo de sensilias
Se midió la longitud de cada uno de los segmentos antenales y se contaron las sensilias que cubrían estos segmentos. Las medidas se tomaron con estereoscopio (Olympus SZ40, 2X) previamente calibrado con micrómetro ocular de 1cm y 100 graduaciones.

Análisis estadístico
Se hizo análisis de correlación entre el número de sensilias y la longitud total de la antena. Mediante el test de Levene se determinó la homogeneidad de las varianzas y posteriormente se aplicó un ANOVA para la comparación entre grupos y una prueba de t para la comparación entre sexos, con previa transformación de los datos en logaritmo natural. Se utilizaron pruebas no paramétricas de Kruskall Wallis y U Mann

Biomédica 2007;27(supl. 1):92-100

Fenotipo antenal de Triatoma dimidiata

Withney (21) cuando las variables mostraron heterocedasticidad. Para reducir el error experimental, se corrigió el valor de significación usando el método secuencial de Bonferroni (21). Se realizó un análisis discriminante para cada sexo y segmento antenal usando el programa Statistica versión 6. Este análisis se hizo con base en el modelo discriminante forward stepwise, en el cual todas las variables se incluyeron en el modelo y en cada paso se eliminó la variable que menos contribuyó a la predicción de los miembros del grupo. La significación de las distancias de Mahalanobis (d2) se demostró utilizando los programas PADwin versión 65 (después de 1.000 permutaciones) y NTSYS versión 2.02. Resultados

y el mayor número de sensilias se presentó en el flagelo en hembras y en el pedicelo en machos.

Dimorfismo sexual
Se encontró un significativo dimorfismo sexual en patrón de sensilias antenales de T. dimidiata, diferenciación que se debió a la variación del número de TPF del pedicelo, el cual fue mayor en los machos (p < 0,0317). El dimorfismo entre hábitats varió según las distancias de Mahanalobis así: domicilio (d2 = 24,56), silvestre (d2 = 73,62) y peridomicilio (d2 = 361,06).

Comparación entre hábitats
Debido al dimorfismo sexual de T. dimidiata los análisis se hicieron por separado para cada sexo.

Características generales de la antena
Los promedios y la desviación estándar de la longitud de cada segmento se muestran en el cuadro 1. Los machos presentaron antenas más largas y con mayor cantidad de sensilias que las hembras, con un promedio de 12,04 mm, 1170,77 y 11,85mm 922,07, respectivamente. Las hembras se diferenciaron significativamente según la longitud de la antena en cada hábitat (p = 0,0014). No se observó correlación del número de quimiorreceptores con la longitud total de la antena (n = 60, r = 0,05, p = 0,701). El segmento más largo fue el pedicelo

Análisis univariado. El ANOVA entre las hembras mostró diferencias significativas (p = 0,0046) en los TPG del flagelo uno; en los machos no se observaron variaciones signficativas en ningún receptor (figura 1). Análisis multivariado. Para resolver el problema de multicolinealidad, las variables se agruparon en 12 componentes principales obtenidos a partir de una matriz de covarianza. Estas 12 nuevas variables con independencia lineal se usaron en el análisis discriminante. En hembras, el modelo excluyó la variable PBR con un Partial λ = 0,946. Las variables que contribuyeron significativamente al análisis (Wilks λ = 0,006; F (22.34) = 3,432; p ‹ 0,006) produjeron dos funciones discriminantes (FD1 =

Cuadro 1. Media y desviación estándar del número de sensilias y la longitud de cada segmento antenal de T. dimidiata.
Longitud Hábitat Domicilio Sexo p 4,6 0,2 4,6 0,3 4,4 0,2 4,6 0,2 4,6 0,2 4,7 0,2 f1 4,0 0,2 3,9 0,3 3,8 0,2 3,9 0,2 3,9 0,2 4,0 0,2 f2 Pedicelo Flagelo 1 Flagelo 2

pRB pTPF pTPG pBS f1RB 62,2 8,9 16,6 21,0 3,0 3,2 56,9 10,0 19,2 12,5 2,2 4,5 47,6 14,0 69,5 14,5 58,2 21,7 61,3 26,0 8,3 2,4 8,9 2,6 8,7 3,4 9,6 2,5 19,1 3,1 17,3 4,6 15,6 2,0 16,8 3,9

Sensilias f1TPF f1TPG f1BS f2RB f2TPF f2TPG f2BS totales 71,7 22,9 113,5 24,1 57,5 11,5 104,7 38,9 54,6 9,1 119,9 40,5 250,2 32,2 231,2 38,5 42,2 11,0 12,3 3,0 47,7 11,8 13,8 2,9 20,2 6,3 28,4 5,7 20,0 5,8 28,9 8,0 21,1 5,3 27,0 9,9 188,8 59,5 218,9 30,1 36,7 10,6 45,5 11,4 945,5 141,3 1154,0 171,3 947,9 56,5 1196,0 146,9 872,8 106,2 1163,1 125,9

3,3 67,0 170,0 0,2 5,7 49,5 3,3 68,3 302,6 0,2 12,0 78,0 3,2 71,2 146,7 0,3 8,3 27,9 3,4 65,5 363,0 0,2 11,5 50,3 3,5 71,1 164,4 0,3 8,3 39,5 3,5 67,9 345,1 0,4 9,5 63,8

Peridomicilio

262,3 34,2 11,8 30,7 9,6 2,1 231,4 39,3 11,7 34,5 14,6 2,2 216,8 28,8 10,6 25,0 9,1 2,0 218,4 37,7 10,4 57,3 12,7 3,0

227,0 42,2 22,7 13,5 213,8 42,0 41,5 6,7 186,5 36,4 29,4 6,0 205,7 43,3 38,0 11,4

Silvestre

95

Arroyo C.M., Esteban L., Catalá S., Angulo V.M.

Biomédica 2007;27(supl. 1):92-100

Figura 1. Análisis discriminante de hembras de T. dimidiata recolectadas en D: domicilio, P: peridomicilio, S: silvestre (cueva). DF1 y DF2, función discriminante 1 y 2, respectivamente.

Figura 2. Análisis discriminante de hembras de T. dimidiata incluidos individuos de vivienda urbana (VU). D: domicilio, P: peridomicilio, S: silvestre (cueva). DF1 y DF2, función discriminante 1 y 2, respectivamente.

0,0004; FD2 = 0,0137) con una asignación correcta al grupo de origen de 96,67%, indicando que los caracteres estudiados fueron altamente discriminantes entre las tres poblaciones. La discriminación de las poblaciones se relacionó con las siguientes variables: PTPF + F1TPF (parcial λ = 0,505), F1BA + F1BR (Partial λ = 0,684), F1TPG (Partial λ = 0,686), F2BA (Partial λ = 0,651), PTPF (Partial λ = 0,666), F1BA (Partial λ = 0,689), F2BR (Partial λ = 0,718), PTPG (Partial λ = 0,856), F1BR (Partial λ = 0870), PTPG + PBA + F1BA (Partial λ = 0,874) (en orden decreciente de Wilks λ ). Las distancias de Mahalanobis diferenciaron significativamente cada uno de los hábitats (cuadro 2a), donde PTPF + F1TPF; F1BA + F1BR; PTPG + PBA + F1BA se combinaron dentro de una función matemática. Un nuevo análisis discriminante entre las hembras se realizó incluyendo a los individuos de viviendas urbanas (Wilks λ = 0,7493; F(30.62)= 2,9446; p ‹ 0,0002). El 85,29% de estos individuos fue asignado correctamente a su grupo de origen y agrupado en el peridomicilio (figura 2); además se observó una leve asociación con el hábitat silvestre (cuadro 2b). Al utilizar en los análisis multivariados solamente las sensilias del flagelo 1 en hembras, las distancias de Mahalanobis concordaron con las obtenidas cuando se utilizaron todos los segmentos antenales. Las variables que 96

contribuyeron significativamente en este análisis produjeron dos funciones discriminantes con 80% de asignación a cada grupo (Wilks λ = 0,29521; F (6.50) = 7,0041; p ‹ 0,0000.), las cuales se relacionaron con las siguientes variables: F1BR, PTPF, F2BA + F2TPG + F1TPG con un Partial λ = 0,599, 0,640 y 0,665, respectivamente, donde F2BA + F2TPG + F1TPG se combinaron en una función matemática (combinación lineal) (cuadro 2c). El análisis multivariado entre los machos no diferenció significativamente las poblaciones; sin embargo, se observó una tendencia similar a las hembras (Wilks λ = 0,3511; F(16.42) = 1,8047; p ‹ 0,0636, figura 3).
Cuadro 2. Distancia de Mahalanobis (d2) y valores de significación (p) obtenidos del análisis discriminante de hembras de T. dimidiata en: a. las poblaciones de estudio, b. individuos de zona urbana y c. en el primer segmento antenal. a. peridomicilio-silvestre domicilio-peridomicilio domicilio-silvestre b. domicilio-VU silvestre-VU peridomicilio-VU c. peridomicilio-silvestre domicilio-silvestre domicilio-peridomicilio d2 16,21 13,52 10,95 d2 16,23 13,96 6,48 d2 6,86 5,11 3,63 p 0,0043 0,0105 0,0269 p 0,0336 0,0617 0,4596 p 0,0002 0,0013 0,0073

Biomédica 2007;27(supl. 1):92-100

Fenotipo antenal de Triatoma dimidiata

Figura 3. Análisis discriminante (no significativo) de machos de T. dimidiata recolectados en D: domicilio, P: peridomicilio, S: silvestre (cueva). DF1 y DF2, función discriminante 1 y 2, respectivamente.

en el hábitat (24,25). El aumento significativo de los tricoides de pared fina en las antenas de los machos de T. dimidiata, observado también por Catala et al. 2005 (16), podría estar asociado a la captación de feromonas de hospederos vertebrados y a la percepción de moléculas relacionadas con el comportamiento sexual como sucede en otras especies de triatominos (1618,26) (Esteban L, Sandoval CM, Angulo VM, Catalá S. Estudio morfológico de los patrones sensoriales en adultos y ninfas de Belminus herreri (Reduviidae: Triatominae). Biomédica 2002;22 (Suppl. 1):113) y especies de Noctuidae , Acrididae y Dyctioptera (27,28). Adicionalmente, el aumento de este receptor multiporoso ha sido relacionado con la variabilidad intraespecífica y el polimorfismo alar del género Mepraia (29). Los estudios de Monroy et al. 2003 (30) y Tabaru et al. 1996 (31) sugieren que los machos de T. dimidiata tienen mayor probabilidad de dispersión a través del vuelo que las hembras, lo que les permite incursionar en diferentes hábitats y al mismo tiempo incrementar su sistema de reconocimiento sexual, facilitando el encuentro entre adultos dispersos. En general, en los triatominos los machos son más pequeños, y, en consecuencia, menos pesados y más hábiles para desplazarse a través del vuelo en búsqueda de alimento. El aumento de estos receptores relacionados con la capacidad de dispersión es un factor clave en la invasión de nuevos hábitats; quizás por esta razón no observamos diferencias entre ecotopos en machos, a pesar de que presentaron tendencias similares a las hembras. Los basicónicos también fueron abundantes, especialmente en el flagelo uno, como se ha observado en T. sordida (17); estos receptores han sido implicados en la recepción de moléculas NH 3 y ácidos grasos (32) como termohigrorreceptores y son similares a los receptores “C” de Cimex lecticularius (22). En mosquitos de la familia Psychodidae se ha observado función olfatoria en el hallazgo del hospedero (33), y en insectos como Locusta migratoria, Schistocerca gregaria , Hylobus habiteis y Leptinotarsa decemlineata este receptor es responsable del dimorfismo sexual (27,34-37). 97

Discusión

T. dimidiata del área estudiada, al igual que las poblaciones de Guatemala y de otras especies de triatominos, presentó los tres tipos de quimiorreceptores en el pedicelo, lo que sugiere una capacidad para la invasión y dispersión en diferentes hábitats (17,22, Catalá S, Carbajal AL, Torres M, Moreno M, Ordoñez R, Montaña MF, et al. La antena de los Triatominae: características ancestrales y marcadores funcionales. En: Guhl F. editor. Proceedings of the Fourth International Workshop on Population and Control of Triatominae. Cartagena de Indias, 2000. p.125-32), lo cual demuestra que el sistema sensorial de los insectos ha evolucionado hacia numerosas especializaciones que les permiten detectar características del ambiente externo y monitorizar constantemente el estado de interacción del organismo. T. dimidiata presentó mayor densidad de sensilias en el pedicelo que en el flagelo uno, a diferencia de otras especies de Triatoma (22,23), lo que probablemente muestra una característica de la especie. Dimorfismo sexual
Las variaciones en el número de sensilias antenales entre hembras y machos en insectos podría ser una respuesta a la atracción del macho por las feromonas de la hembra o por variaciones

Arroyo C.M., Esteban L., Catalá S., Angulo V.M.

Biomédica 2007;27(supl. 1):92-100

Entre ecotopos, el dimorfismo sexual fue menor para la población del domicilio, seguida por la silvestre. Los machos de estos hábitats presentaron menor cantidad de tricoides de pared fina en el pedicelo, lo cual tiene relación con especies adaptados a un rango limitado de hábitats como T. infestans (18). La reducción del número de receptores que intervienen en la reproducción podría ser consecuencia de la domiciliación (38). Por el contrario, en la población peridomiciliada, el aumento de estos sensilias podría involucrar la necesidad de detectar olores para identificar nuevos hábitats y compañero sexual.

asociarse, además, con la presencia de cabras y animales de pastoreo en la región. Por otra parte, el aumento de los BR en hembras del peridomicilio podría relacionarse con la alta densidad de insectos observada en campo, ya que estas sensilias han mostrado ser susceptibles a la densidad poblacional (23), perciben estímulos mecánicos relacionados con el micro hábitat (18) y se han asociado con la selección del hábitat más que con la del huésped (20). La asociación entre las hembras domiciliadas de T. dimidiata de la zona urbana con el peridomicilio rural podría explicarse por el transporte e intercambio que hace el hombre de animales desde una zona a otra en los días de mercado. Otros estudios sugieren que insectos del peridomicilio y silvestres de T. dimidiata vuelan estacionalmente hacia las viviendas debido a cambios en la disponibilidad de alimento (39). Las poblaciones peridomiciliadas y silvestres de T. dimidiata representan un riesgo epidemiológico para la población humana debido a su dispersión pasiva o activa hacia las viviendas rurales y urbanas en esta zona del país. El control de estas poblaciones es actualmente un reto para los programas de control vectorial (12). Finalmente, el fenotipo antenal de las sensilias fue útil en la diferenciación intraespecífica de T. dimidiata según el hábitat. El estudio de los nichos dentro de los hábitats es escaso y su estructura, junto con factores bióticos y abióticos, debe estudiarse en profundidad para el conocimiento de la relación del sistema sensorial y la explotación del hábitat. Las diferencias del fenotipo antenal observado en hembras revelan una mayor plasticidad fenotípica en la diferenciación y adaptación a diferentes hábitats, como también se observó en estudios de morfometría de la cabeza de T. dimidiata y T. infestans (40,41). La rápida adaptación de las hembras a las nuevas condiciones ecológicas pone de manifiesto nuevos arreglos sensoriales característicos de ese hábitat; por otra parte, la ausencia de diferenciación en el fenotipo antenal de machos podría ser un indicador de mayor dispersión entre hábitats.

Variación entre hábitats
En los triatominos una serie de cambios morfológicos y genéticos se han asociado a la adaptación a hábitats domésticos, y se ha señalado que la densidad de sensilias antenales disminuye progresivamente en el pedicelo y sobre el total de la antena en especies que viven en “hábitats estables” como la vivienda humana (1618,22,23); sin embargo, este término puede usarse de manera ambigua, puesto que, además de las fluctuaciones ambientales, en un hábitat intervienen la explotación de diferentes recursos tróficos, espaciales y reproductivos, los cuales podrían modificar en forma particular el fenotipo de las sensilias antenales. Las variaciones observadas en hembras se asociaron con los TPG y BR; una reducción de los primeros se observó a medida que disminuía la amplitud del nicho y se incrementaba la estabilidad del hábitat, lo que podría indicar una reducción de la sensibilidad y superficie del área para la captura de moléculas olorosas. En el domicilio humano y en las cuevas las variaciones climáticas son pocas, y la ausencia de luz es característica, por lo que insectos que ocupan estos hábitats podrían tener una selección más acusada de sensilias olfatorias que de mecanorreceptores y quimiorreceptores de contacto. En el peridomicilio, el incremento espacial del hábitat podría generar un comportamiento exploratorio con una selección menos especializada de sus hospederos, lo que puede 98

Biomédica 2007;27(supl. 1):92-100

Fenotipo antenal de Triatoma dimidiata

La similitud entre las hembras de zona urbana y las hembras de peridomicilio rural permite proponer el fenotipo antenal como un sencillo y eficiente indicador para el reconocimiento del origen de triatominos que intentan colonizar nuevos hábitats. Estas metodologías podrían utilizarse en los programas de vigilancia entomológica. Agradecimientos A Jean Pierre Dujardin por su asesoría y colaboración en el análisis de datos; a COLCIENCIAS por el apoyo financiero; a las comunidades de Macaravita y Capitanejo, y a los técnicos de la Secretaria de Salud de Santander por la colaboración en el trabajo de campo. Conflicto de interés Los autores declaramos que no existe ningún conflicto de intereses en este trabajo. Financiación Financiado por Colciencias, proyectos códigos 1102-04-13009, 1102-04-13010 y 1102-04-13029. Referencias
1. World Health Organization. Chagas. [Consultado: 27 de abril de 2005]. Disponible en: http://www.who.int/ ctd/chagas/burdens.htm. 2. Galvao C, Carcavallo R, Da Silva Rocha D, Jurberg J. A checklist of the current valid species of the subfamily Triatominae Jeannel, 1919 (Hemiptera, Reduviidae) and their geographical distribution, with nomenclatural and taxonomic notes. Zootaxa 2003;202:1-36. 3. Lent H, Wygodzinsky P. Revision of the Triatominae (Hemiptera, Reduviidae), and their significance as vectors of Chagas disease. Bull Am Mus Nat Hist 1979;163:123-520. 4. Tabarú Y, Monroy C, Rodas A, Mejía M, Rosales R. Chemical control of Triatoma dimidiata and Rhodnius prolixus (Reduviidae: Triatominae), the principal vectors of Chagas disease in Guatemala. Med Entomol Zool 1998;49:87-92. 5. Zeledon R, Calvo N, Montenegro VM, Lorosa ES, Arévalo C. A survey on Triatoma dimidiata in an urban area of the province of Heredia, Costa Rica. Mem Inst Oswaldo Cruz 2005;100:507-12. 6. Aguilar VH, Abad Franch F, Racines J, Paucar A. Epidemiology of Chagas disease in Ecuador. A brief review. Mem Inst Oswaldo Cruz 1999;94(Suppl. 1): 387-93. 7. Angulo VM, Sandoval CM. Triatominos y Programa Nacional de Control en Colombia. Monitoreo de la

resistencia a insecticidas en triatominos en América Latina. Serie enfermedades transmisibles. Buenos Aires: Fundación Mundo Sano; 2001. p.21-6. 8. Dumonteil E, Ruiz- Piña H, Rodríguez Félix E, Barrera Pérez M, Ramírez Sierra MJ, Rabinovich JE, et al. Re-infestation of houses by Triatoma dimidiata after intra domicile insecticide application in the Yucatán Peninsula, México. Mem Inst Oswaldo Cruz 2004;99:253-6. 9. Schofield CJ. Challenges of Chagas disease vector control in Central America: Global collaboration for development of pesticides for public health. Geneva: World Health Organization (WHO/CDS/WHOPES/ GCDPP/2000.1); 2000. 10. Marinkelle CJ. Colombian Triatominae and their infestation with trypanosomatid flagellates. Mitt Inst Colombo Alemán Invest Cient 1972;6:13-29. 11. Angulo VM. Ensayo de estrategias de control y vigilancia de Triatoma dimidiata en Colombia. En: Guhl F editor. Primer Taller Internacional sobre Control de la Enfermedad de Chagas. Bogotá: Universidad de los Andes; 2005. p.91-102 12. Schofield CJ. Propuestas de estrategias para el control de Triatoma dimidiata en Colombia. En: Guhl F editor. Primer Taller Internacional sobre Control de la Enfermedad de Chagas. Bogotá: Universidad de los Andes; 2005. p.55-61. 13. Panzera F, Ferrandis I, Ramsey J, Ordóñez R. Salazar-Schettino PM, Cabrera M, et al . Chromosomal variation and genome size support the existence of cryptic species of Triatoma dimidiata with different epidemiological importance as Chagas disease vectors. Trop Med Int Health 2006;2:1092-103. 14. Esteban L, Angulo VM, Feliciangeli MD, Catala S. Analysis of antennal sensilla patterns of Rhodnius prolixus from Colombia and Venezuela. Mem Inst Oswaldo Cruz 2005;100:909-14. 15. Ramirez CJ, Jaramillo CA, Delgado MP, Pinto NA, Aguilera G, Guhl F. Genetic structure of sylvatic, peridomestic and domestic populations of Triatoma dimidiata (Hemiptera: Reduviidae) from an endemic zone of Boyaca, Colombia. Acta Trop 2005;93:23-9. 16. Catalá S, Sachetto C, Moreno M, Rosales R, SalazarSchettino PM, Gorla D. The antennal phenotype of Triatoma dimidiata populations and its relationship with species of the phyllosoma and protracta complexes. J Med Entomol 2005;42:719–25. 17. Catalá S. Antennal sensilla of Triatominae (Hemiptera: Reduviidae): a comparative study of five genera. Int J Insect Morphol Embryol 1997;26:67-73. 18. Catalá S, Dujardin JP. Antennal sensilla patterns indicate geographic and ecotopic variability among Triatoma infestans (Hemiptera: Reduviidae) populations. J Med Entomol 2001;38:423-8.

99

Arroyo C.M., Esteban L., Catalá S., Angulo V.M.

Biomédica 2007;27(supl. 1):92-100

19. Álvarez LS, García A, Gómez J, González LH, Guerrero AA, Porras H, et al . Santander nuestro departamento. Bucaramanga: CER; 1999. 20. Catalá S, Schofield CJ. Antennal sensilla of Rhodnius. J Morphol 1994;219:193-204. 21. Sokal R, Rohlf J. Biometry. The principles and practice of statistics in (biological. OJO, revisar esta palabra en el título a ver si se trata de "biology". Nota correctora). 3d ed. New York: Freeman and Company; 1997. 22. Gracco M, Catalá S. Inter-specific and developmental differences on the array of antennal chemoreceptors in four species of Triatominae (Hemiptera: Reduviidae). Mem Inst Oswaldo Cruz 2000;95:67-74. 23. Catalá S, Maida DM, Caro-Riaño H, Jaramillo N, Moreno J. Changes associated with laboratory rearing in antennal sensilla patterns of Triatoma infestans , Rhodnius prolixus , and Rhodnius pallescens (Hemiptera, Reduviidae, Triatominae). Mem Inst Oswaldo Cruz 2004;99:25-30. 24. Chapman RF. Chemoreception: The significance of receptors numbers. Adv Insect Physiol 1982;16: 247-333. 25. Bland RG. Antennal sensilla of Acrididae (Orthoptera) in relation to subfamily and food preference. Ann Entomol Soc Am 1989;82:368-84. 26. Carbajal de la Fuente AL, Catalá S. Relationship between antennal sensilla pattern and habitat in six species of Triatominae . Mem Inst Oswaldo Cruz 2002;97:1121-5. 27. Chen HH, Zhao YX, Kang L. Antennal sensilla of grasshoppers (Orthoptera: Acrididae) in relation to preferences and habits. J Biosci 2003;28:743-52. 28. Castrejón-Gómez VR, Valdez-Carrasco J, CibrianTovar J, Camino-Lavin M, Osorio O. Morphology and distribution of the sense organs of the antennae of Copitarsia consueta (Lepidoptera: Noctuidae). Fla Entomol 1999;82:546-55. 29. Moreno ML, Gorla D, Catalá S. Association between antennal phenotype, wing polymorphism and sex the genus Mepraia (Reduviidae: Triatominae). Infect Genet Evol 2006;6:228-34. 30. Monroy MC, Bustamante DM, Rodas AG, Enriquez ME, Rosales RG. Habitats, dispersion and invasion of sylvatic Triatoma dimidiata (Hemiptera: Reduviidae) in Petén, Guatemala. J Med Entomol 2003;40:800-6.

31. Tabaru Y, Rodas A, Mejía M, Monroy C, Hashimoto T. Producción masiva y comportamiento de Triatoma dimidiata y Rhodnius prolixus . En: Tabarú Y editor. Informe Anual N.4 (GJET-72), Proyecto de Cooperación Guatemala-Japón para la Investigación de enfermedades tropicales. Guatemala: JICA 1996. p.120-5. 32. Taneja J, Guerin PM. Ammonia attract Triatoma : behavioral and neurophysiological data on nymphs. J Comp Physiol 1997;181:21-34. 33. Zayed AB, Hassan MI, Mohammed H, Fares A. Antennal sensilla of the sandflies, Phlebotomus papatasi and Phlebotomus bergeroti (Diptera:Psichodidae). Exp Patol Parasitol 2002;5:10-20. 34. Ameismeier F. Ultrastructure of the chemosensitive basiconic single-walled walled-pore sensilla on the antennae in adults and embryonic stages of Locusta migratoria L (Insecta, Orthoptera). Cell Tissue Res 1987;247:605-12. 35. Ma WC, Visser JH. Single unit analysis of odor quality coding by the olfactory antennal receptor system of Colorado beetle. Entomol Exp Appl 1987;24:520-33. 36. Mustaparta H. Responses of single olfactory cells in the pine weevil Hylobius abietis L: (Col: Curculionidae). J Comp Physiol 1975;97:271-90. 37. Ocheing SA, Hallberg E, Hansson BS. Fine structure and distribution of antennal sensilla of the desert locust, Schistocerca gregaria (Orthoptera: Acrididae). Cell Tissue Res 1998;291:525-36. 38. Schofield CJ. Biosystematics of the Triatominae. En: Service M editor. Biosystematics of Haematophagous insects. Vol 37. Oxford: Clarendon Press; 1998.p.284-312. 39. Dumontiel E, Gourbiere S, Barrera-Pérez M, Rodriguez-Félix E, Ruíz-Piña H, Baños-López O, et al. Geographic distribution of Triatoma dimidiata and transmission dynamics of Trypanosoma cruzi in the Yucatan Peninsula of Mexico. Am J Trop Med Hyg 2002;67:176-83. 40. Dujardin JP, Bermudez H, Casini C, Schofield CJ, Tibayrenc M. Metric differences between sylvatic and domestic Triatoma infestans (Heteroptera:Reduviidae) in Bolivia. J Med Entomol 1997;34:544-51. 41. Bustamante DM, Monroy C, Menes M, Rodas A, Salazar-Schettino PM, Rojas G, et al. Metric variation among geographic populations of the Chagas vector Triatoma dimidiata (Hemiptera:Reduviidae: Triatominae) and some related species. J Med Entomol 2004;41: 296-301.

100

Biomédica 2007;27(supl.1):101-9

Patrones de alimentación y defecación de Rhodnius

ARTÍCULO ORIGINAL

Comparación de los patrones de alimentación y defecación de Rhodnius colombiensis y Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) en condiciones de laboratorio
Andrea Arévalo 1, Julio César Carranza 1, Felipe Guhl 2, Jairo A. Clavijo 3, Gustavo Adolfo Vallejo 1
1

2

3

Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia. Centro de Investigaciones en Microbiología y Parasitología Tropical, Universidad de los Andes, Bogotá D.C., Colombia. Departamento de Matemáticas y Estadística, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia.

Introducción. Rhodnius colombiensis ocasionalmente ingresa a las viviendas humanas por lo cual se ha sugerido que podría desempeñar un importante papel en la transmisión de la tripanosomiasis americana. Objetivo. Definir el desempeño de R. colombiensis como vector, comparando los patrones de alimentación y defecación con los de R. prolixus, el principal vector domiciliado de Trypanosoma cruzi en Colombia. Materiales y métodos. Para cada estadio de R. colombiensis y R. prolixus se estudió el tiempo promedio para iniciar la picada, el tiempo para alcanzar la repleción, el número de interrupciones y defecaciones durante la comida, el tiempo transcurrido entre el fin de la alimentación y la primera defecación, el número de defecaciones durante 10, 60 y 95 min después de la comida y la cantidad de sangre ingerida. Resultados. El tiempo promedio para iniciar la picada de las ninfas N5, machos y hembras presentaron diferencias significativas entre las dos especies. El promedio de defecaciones por insecto durante los 10 min después de la alimentación fue mayor para cada estadio de R. prolixus y presentó diferencias significativas con R. colombiensis. Por otro lado, el peso promedio de sangre ingerida por R. colombiensis y R. prolixus en cada estadio presentó diferencias significativas en N1, N2, N5 y hembras. Conclusión. R. colombiensis presenta menor número de defecaciones que R. prolixus durante la comida. Un mayor porcentaje de R. prolixus defecan durante los 10, 60 y 95 min después de la alimentación. Sin embargo, R. colombiensis permanece mayor tiempo asociado al hospedero vertebrado, lo cual aumentaría la probabilidad de transmisión teniendo en cuenta el ingreso ocasional de los adultos a las viviendas humanas y sus elevadas prevalencias con T. cruzi y T. rangeli. Palabras clave: Rhodnius/fisiología, defecación, crecimiento y desarrollo, Trypanosoma, enfermedad de Chagas. Comparison of feeding and defecation patterns of Rhodnius colombiensis and Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) under laboratory conditions. Introduction. Rhodnius colombiensis occasionally comes into human dwellings and consequently its role as an important potential vector in the transmission of American trypanosomiasis has been suggested. Objective. The potential role of R. colombiensis as vector was defined by comparing the feeding and defecation patterns between R. colombiensis and R. prolixus, the main domiciliary vector of Trypanosoma cruzi in Colombia. Materials and methods. For each developmental stage of R. colombiensis and R. prolixus the following data were collected: (1) time of feeding initiation, (2) the time for reaching the repletion,

101

Arévalo A., Carranza J.C., Guhl F.

Biomédica 2007;27(supl.1):101-9

(3) the number of interruptions and defecations during the feeding, (4) the time between the end of the feeding and the first defecation, (5) the number of defecations during 10, 60 and 95 minutes of observation after feeding, and (6) the quantity of blood ingested. Results. The mean time of feeding initiation of the fifth instar nymphs, males and females, showed significant differences between the two species. The average of insects that defecated within 10 minutes after feeding was higher for each successive stage of R. prolixus and showed significant differences with Rhodnius colombiensis . In contrast, the mean weight of blood ingested by each stage of R. colombiensis and R. prolixus was significantly different between the N1, N2, N5 and females of these species. Conclusion. Rhodnius colombiensis produced fewer defecations than R. prolixus during feeding. A higher percentage of R. prolixus defecated within 10, 60 and 95 minutes after feeding. However, R. colombiensis remains a longer time in contact with the vertebrate host, thus raising the probability of its role in transmission considering its occasional entry to human dwellings and its higher prevalences of infection withT. cruzi and T. rangeli. Key words: Rhodnius, physiology, defecation, growth and development, Trypanosoma, Chagas disease.

El género Rhodnius incluye 16 especies, en algunas de las cuales se han descrito las características biológicas, bioquímicas y moleculares (1). R. colombiensis es una especie recientemente descrita, que con R. pallescens y R. ecuadoriensis conforman el grupo “pallescens” de la cordillera de los Andes en el noroeste de América del Sur (2). Por otro lado, R. colombiensis se ha encontrado asociada a las palmas de vino (Attalea butyraceae) en la cuenca alta del valle del río Magdalena en la región central de Colombia (3), constituyendo un posible riesgo en la transmisión de la enfermedad de Chagas, pues esta especie ocasionalmente ingresa a las viviendas, presentando elevadas prevalencias de T. cruzi y T. rangeli (Vallejo GA, Lozano LE, Carranza JC, Sánchez JL, Jaramillo JC, Guhl F, et al. Ecología de los triatominos no domiciliados en Colombia con especial referencia a Rhodnius colombiensis en el departamento del Tolima. En: Vallejo GA, Carranza JC y Jaramillo JC editores. Curso Taller Internacional: Biología, Epidemiología y Control de la Tripanosomosis Americana y Leishmaniosis. Ibagué, Colombia 2000; p.1-134). Los estudios sobre el comportamiento de los triatominos durante la toma del alimento son de
Correspondencia: Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, A.A. 546, Ibagué, Colombia. Fax (+57-8) 2669176. gvallejo@ut.edu.co Recibido: 14/03/06; aceptado: 19/05/06

gran importancia para comprender la dinámica de transmisión de T. cruzi. Varios autores han demostrado que algunas especies de triatominos no defecan durante, ni tampoco inmediatamente después de la comida, mientras que otras especies son muy eficientes en la transmisión de T. cruzi debido a las altas tasas de defecación durante el alimento y durante los primeros minutos después de la alimentación (4). Estas diferencias en los patrones de alimentación y de defecación podrían explicar, al menos en parte, las diferencias en las prevalencias de T. cruzi en humanos y en reservorios en diferentes regiones de América Latina. Para contribuir al conocimiento de la biología y el papel de R. colombiensis en la transmisión de la enfermedad de Chagas en la región central de Colombia, se estudió para cada estadio de desarrollo el tiempo promedio para iniciar la picada, el tiempo de alimentación hasta la repleción, el número de interrupciones y defecaciones durante la comida, el intervalo entre el fin de la alimentación y la primera defecación, el número de defecaciones durante 10, 60 y 95 minutos de observación después de la comida y la cantidad de sangre ingerida. Con fines comparativos, estos mismos parámetros se estudiaron en los diferentes estadios de desarrollo de R. prolixus, especie domiciliada que se encuentra en simpatría con R. colombiensis en la cuenca alta del río Magdalena. Materiales y métodos

R. colombiensis fueron capturados en palmas de Attalea butyracea y R. prolixus domiciliados

102

Biomédica 2007;27(supl.1):101-9

Patrones de alimentación y defecación de Rhodnius

fueron capturados en la vereda Totarco-Tamarindo en el municipio de Coyaima, departamento del Tolima (Colombia central). Las colonias de ambas especies se mantuvieron a una temperatura de 28 ± 1°C, humedad relativa de 75 a 80% y fotoperiodicidad de 12/12 horas en una incubadora automática B.O.D. Lab-Line. Los insectos fueron alimentados con sangre de gallina semanalmente. Se compararon las variables sobre alimentación y defecación de R. colombiernsis y R. prolixus en tres etapas experimentales. En la primera etapa se estudió el comportamiento de los insectos durante el tiempo en que permanecieron tomando el alimento sobre ratones ICR, para lo cual se midió el tiempo promedio de picada, el tiempo promedio para alcanzar la repleción, el promedio de interrupciones por insecto y el promedio de defecaciones durante la comida. En la segunda etapa se estudiaron los patrones de defecación después de la comida, calculándose el tiempo promedio para defecar por primera vez después de la comida y el promedio de defecaciones durante 10, 60 y 95 min. En la tercera etapa se calculó el peso y volumen de sangre ingerida en promedio por cada estadio de R. colombiensis y R. prolixus y se estimó el número de veces que cada estadio aumentó su peso después de la comida.

repleción se cronometró, se calculó el promedio de defecaciones durante la comida, así mismo, se contaron las interrupciones y las defecaciones durante y después de la comida.

Cantidad de sangre ingerida
En un experimento independiente se calculó la cantidad de sangre ingerida, para lo cual se utilizaron 210 R. colombiensis y 210 R. prolixus (30 por cada estadio de desarrollo). Los insectos fueron sometidos a 15 días de ayuno, pesados antes y después de la alimentación en una balanza analítica y alimentados con sangre de gallina. Cada individuo se colocó en un vial previamente marcado para llevar el correspondiente registro.

Análisis estadístico
Para cada variable se calcularon las medias con los respectivos intervalos de 95% de confianza. Se utilizó análisis multivariado de varianza (MANOVA) para comparar los promedios de las variables en cada estadio de desarrollo de las dos especies. Para los patrones de alimentación, de defecación y la cantidad de sangre ingerida de las ninfas se usó un diseño factorial 5x2 balanceado con 30 réplicas. Para los patrones de alimentación y defecación de los adultos, el diseño factorial fue 2x2 desbalanceado. Para la cantidad de sangre ingerida por los adultos se utilizó un diseño factorial 2x2 balanceado. Para las comparaciones se realizó la prueba de Duncan. El software utilizado fue SAS versión 8.2. Resultados

Patrones de alimentación y defecación
Para R. colombiensis se utilizaron 30 individuos de cada estadio, incluidos machos y hembras, para un total de 210 insectos. Para R. prolixus, se utilizaron 203 insectos (30 N1; 30 N2; 30 N3; 30 N4; 30 N5; 30 machos y 23 hembras). Cada individuo fue identificado con marcas de tinta blanca en el dorso para facilitar la observación. Grupos de tres a seis insectos fueron alimentados hasta la repleción sobre ratones ICR sedados con maleato de acepromacina e inmovilizados con una malla de nylon. Cada ratón fue puesto en un recipiente transparente y sujeto con cinta de enmascarar para evitar movimientos bruscos. Los insectos se dejaron en el contenedor entre 60 y 180 minutos en un cuarto ligeramente oscuro con una temperatura promedio de 28°C y un mismo observador los monitorizó continuamente sin mover el recipiente durante el experimento. Los tiempos para iniciar la picada y para alcanzar la

Patrones de alimentación y defecación durante la comida
En el cuadro 1 se presentan los resultados del comportamiento de R. colombiensis y R. prolixus durante la comida. Se observó que los tiempos promedios antes de iniciar la picada (tiempo de ataque), no presentaron diferencias significativas entre las dos especies cuando se compararon las N1, N2, N3 y N4; sin embargo, el tiempo promedio de ataque de N5, machos y hembras, en R. colombiensis fue mayor que en R. prolixus, con diferencias significativas entre las dos especies. El tiempo promedio para alcanzar la repleción fue mayor en N2 y N5 R. colombiensis, con

103

Arévalo A., Carranza J.C., Guhl F.

Biomédica 2007;27(supl.1):101-9

Cuadro 1. Comparación del tiempo para iniciar la comida (tiempo de ataque), tiempo de comida hasta repleción, interrupciones y defecaciones durante la alimentación de Rhodnius colombiensis y Rhodnius prolixus sobre ratón Mus musculus. El tiempo está expresado en minutos:segundos.
Tiempo de ataque (intervalo de confianza del 95%) Tiempo para comer hasta repleción (intervalo de confianza del 95%) Interrupciones por insecto Defecaciones durante la comida (intervalo de confianza del 95%) (intervalo de confianza del 95%) Valores Rhodnius Rhodnius Valores p colombiensis prolixus p
0,07 (0 – 0,2) 0 0,3 (0,03 – 0,5) 0,2 (0,04 – 0,4) 0,4 (0,2 – 0,6) 0,8 (0,1 – 1,4) 0,4 (0,04 – 0,8) 0,3 (0 – 0,8)

Estadio

Rhodnius colombiensis
N1 N2 0:10,5 (0* - 0:27,7) 0:7,1 (0:0,5 – 0:13,7) 0:4,4 (0:1,4 – 0:7,4)

Rhodnius prolixus
0:7 (0:2,8 – 0:11,2) 0:1,7 (0:1,1 – 0:2,4) 0:4,9 (0:1,8- 0:8,1)

Valores Rhodnius p colombiensis

Rhodnius prolixus

Valores Rhodnius Rhodnius p colombiensis prolixus

13:3 12:31,8 0,6867 (10:6,3 – 15:59,7) (10:0,9 – 15:2,7) 13:57 10:11,2 0,1025 (10:39,4 – 17:14,5) (9:1,8 – 11: 20,5) 13: 56,4 14:51 0,8144 (11:31,6 – 16:21,2) (12:29 -17:13,3) 22:12 (18:8- 26:16) 30:48 (25:35 – 36:1) 18:44,4 (15:21- 22: 7,8)

0,7851 0,0315

0 0,3 (0* - 0,7)

0,3 (0,02 – 0,6) 0,3 (0,02 – 0,6)

0,0324 0,9018

0,1169 0,0139

N3

0,5854

0,2 (0* - 0,4)

0,8 (0,4 – 1,3)

0,0145

0

0,0006

N4 N5

1:8,1 0:23 (0:25,2 – 1: 50,9) (0:4,1 – 0:41,9)

0,0538

0,1866

0,3 (0,05 - 0,5) 1,5 (0,4 - 2,6)

0,5 (0,2 – 0,9) 0,9 (0,4 – 1,5)

0,2148 0,4045

0 0

0,0214 0,0274

3:33,4 1:39 (2:13,1- 4: 53,8) (0:35,1 – 2: 42,1) 0,0255 1:56 (0:49,1 – 3:2,8) 1:48 (0:7,1- 3:29) 0:14,9 (0* - 0:38,6)

23:13,3 (18:48,3 – 27:38,3) 0,0271

Hembras

20:21,3 19:13 0,0118 (14:21,1 – 26:21,4) (13:20,1 – 25:5) 19:23,1 (13:30,3 – 25:16) 13:36 (10:51- 16:21,2)

0,7847

1,5 (0,8 - 2,1)

1,5 (0,9 – 2,1)

0.9785

0 0,03 (0 – 0,1)

0,1034

Machos

0:8,2 (0:0,05 – 0:16,3) 0,0484

0,0736

1,1 (0,3 – 1,9)

0,7 (0,4 – 0,9)

0,3032

0

0,3215

diferencias significativas entre las dos especies (cuadro 1). De acuerdo a las observaciones realizadas, la mayoría de los estadios de desarrollo de R. colombiensis y R. prolixus interrumpieron la toma del alimento; la única excepción fue N1 de R. colombiensis, pues ningún insecto de este estadio interrumpió su alimentación. El promedio de interrupciones por insecto entre R. colombiensis y R. prolixus presentó diferencias significativas en N1 y N3. Por otro lado, el promedio de defecaciones por insecto durante la comida fue mayor en R. prolixus, presentando diferencias significativas con los mismos estadios de R. colombiensis; los N1, las hembras y los machos no presentaron diferencias significativas al comparar el promedio de defecaciones durante la comida en las dos especies.

durante los primeros 10 minutos fue mayor en todos los estadios de R. prolixus, presentando diferencias significativas con los estadios de R. colombiensis . Así mismo, el promedio de defecaciones acumuladas por insecto durante 60 minutos de observación fue mayor en R. prolixus, presentando diferencias significativas con las N1, N3, N4, N5 y hembras de R. colombiensis. De igual manera, después de 95 minutos de observación, el promedio de defecaciones acumuladas por insecto fue mayor en R. prolixus, presentando diferencias significativas con N1, N3, N4, N5, hembras y machos de R. colombiensis (cuadro 2).

Cantidad de sangre ingerida
La comparación de la sangre ingerida por los distintos estadios de R. colombiensis y de R. prolixus se muestra en el cuadro 3. El peso promedio y el volumen promedio de sangre ingerida presentó diferencias significativas entre N1, N2, N5 y hembras de las dos especies; las ninfas N3, N4 y los machos no presentaron diferencias significativas en el peso y volumen de sangre ingerida. Con relación al número de veces que cada estadio aumentó su peso inicial después de la comida, se observaron diferencias significativas entre las N2, N5 y hembras; los demás estadios no presentaron diferencias significativas. Las N5

Patrones de defecación después de la comida
El cuadro 2 presenta los patrones de defecación de R. colombiensis y R. prolixus después de la toma del alimento. El tiempo promedio para defecar por primera vez después de la toma del alimento fue mayor en todos los estadios de R. colombiensis , presentando diferencias significativas con los estadios de R. prolixus. Por otro lado, el promedio de defecaciones por insecto

104

Biomédica 2007;27(supl.1):101-9

Patrones de alimentación y defecación de Rhodnius

Cuadro 2. Comparación del tiempo para defecar por primera vez después de la comida; defecaciones después de diez minutos, una hora y noventa y cinco minutos entre Rhodnius colombiensis y R. prolixus. El tiempo está expresado en minutos:segundos. Las diferencias fueron significativas cuando p < 0,05.
Tiempo para defecar por primera vez después de la comida. (intervalo de confianza del 95%) Estadio Defecaciones por insecto durante Defecaciones por insecto durante los primeros 10 minutos la primera hora (intervalo de confianza del 95%) (intervalo de confianza del 95%) Defecaciones por insecto durante durante los 95 minutos (intervalo de confianza del 95%)

Rhodnius colombiensis
38:12,6 (29:23 – 47:2,6) 30:32,4 (23:0,8 – 38:3,9)

Rhodnius prolixus
11:10,8 (7:4,2 – 15:17,4)

Rhodnius Rhodnius Valores p colombiensis prolixus
0,07 (0 – 0,2) 0,07 (0 – 0,2) 0,1 (0 – 0,2) 0,03 (0 – 0,1) 0,07 (0 – 0,2) 0,07 (0 – 0,2) 0,03 (0 – 0,1) 0,8 (0,5 – 1,0) 0,9 (0,6 – 1,1) 0,9 (0,2 – 0,6) 0,8 (0,6 – 1,1) 0,8 (0,5 – 1,1) 0,9 (0,6 – 1,2) 0,4 (0,1 – 0,6)

Rhodnius Rhodnius Rhodnius Rhodnius Valores p colombiensis prolixus Valores p colombiensis prolixus Valores p
2,3 (1,6 – 2,9) 2,3 (1,8 – 2,9) 2,1 (1,5 – 2,6) 1 0,6 – 1,4) 0,7 (0,4 – 1) 0,7 (0,3 – 0,9) 0,7 (0,3 – 1,1) 3,7 (2,8 – 4,4) 3,2 (2,3 – 4) 3,8 (3,6 – 4,5) 3,0 (2,4 – 3,5) 4,6 (3,6 – 5,7) 3,7 (2,5 – 5) 1,5 (0,8 – 2,1) 3,7 (2,8-4,5) 4,2 (3,4-5,1) 3,8 (3,1-4,4) 2,1 (1,4-2,7) 1,7 (1,2-2,2) 1,5 (1,0-2,0) 1,3 (0,7-1,9) 5,5 (4,6-6,5) 4,8 (3,7-5,8) 5,7 (4,9-6,6) 4,1 (3,4-4,8) 6,4 (5,0-7,7) 5,5 (3,9-7,0) 2,6 (1,7-3,5)

N1 N2 N3 N4 N5 Hembras Machos

0,0001

0,0001 0,0001 1 0.0001 0,0001 0,0001 0.0001 0,0108

0,0109 0,0897 0,0001 0,0001 0,0001 0,0001 0,0501

0,0044 0,4329 0,0004 0,0001 0,0001 0,0001 0,0240

11:37,2 (5:54,9 – 17:19,5) 0,0001 0,0001 0.0001 0.0001 0,0001 0,0199

33:48 11:46 (26:16,5 – 41:20) (6:22,9 – 17:8,3) 54:46 9:54,8 (43:13,4 – 66:18,2) (3:7 – 16:42,5) 53:43,5 12:3,6 (42:0,7 – 65:26,2) (4:58,6 – 19:8,7) 58:27,1 (48:22,1 – 68:32) 22:22 (7:7 – 37:37)

68:28,2 47:34 (57:24,4 – 79:32) (33:32 – 61:35)

Cuadro 3. Comparación de la cantidad de sangre ingerida por cada estadio de desarrollo de Rhodnius colombiensis y Rhodnius prolixus. El nivel de significación es de 0,05. Las diferencias fueron significativas cuando p < 0,05.
Estadios Variables Promedio de sangre ingerida (mg) (Intervalo de confianza del 95%) Volumen de sangre ingerida (µl) (Intervalo de confianza del 95%) Número de veces que aumenta su peso inicial después de la comida (Intervalo de confianza del 95%

Rhodnius colombiensis
N1 N2 N3 N4 N5 Hembras Machos 3,3 (3,0 - 3,5) 9,4 (8,6 - 10,2) 27,8 (24,8 - 30,8) 74,3 (64,4 - 84,2)

Rhodnius prolixus
2,9 (2,9 - 3,1) 10,6 (9,7 - 11,5) 30,1 (27,3 - 32,9) 77,6 (70,8 - 84,4)

Valores p

Rhodnius colombiensis
3,1 (2,8 – 3,3) 8,7 (7,7 – 9,6) 26,7 (23,8 – 29,5) 71,5 (62 - 81)

Rhodnius prolixus
2,8 (2,7 – 2,9) 10,1 (9,3 – 11) 28,9 (26,3 – 31,6) 74,6 (68,1 – 81,2)

Valores p

Rhodnius Rhodnius colombiensis prolixus
7,7 (6,6 – 8,7) 7 (6,4 – 7,7) 8,8 (7,8 – 9,7) 8,5 (7,4 – 9,6) 8,6 (7,6 - 9,6) 2,2 (1,9 – 2,6) 2 (1,9 – 2,2) 7,7 (6,9 – 8,4) 8,9 (8,0 – 9,7) 8,4 (7,7 – 9,0) 8,2 (7,3 – 9,0) 7,4 (6,7 – 8,1) 2,9 (2,6 – 3,2) 2,2 (2 – 2,5)

Valores p

0,0339 0,0445 0,2425 0,5789 0,0332 0,0281 0,5137

0,0338 0,0205 0,2387 0,58 0,0332 0,0280 0,5147

0,9842 0.0009 0,4424 0,6386 0,0444 0,0054 0,1249

237,9 207 (215,7 - 260,2) (188,4 - 225,6) 99,6 122,8 (82,6 - 116,6) (110,4 - 135,2) 65,4 (57,6 - 73,3) 69,4 (60 - 78,7)

228,9 199,2 (207,6 – 250,4)(181,3 – 217,1) 95,8 118,2 (79,4 – 112,2) (106,2 – 130,1) 62,9 (55,4 – 70,5) 66,7 (57,7 – 75,7)

de las dos especies fueron los estadios con mayor avidez por el alimento, pues ingirieron entre dos y tres veces más sangre que el promedio de los adultos. En los adultos de ambas especies, los machos ingirieron menos sangre que las hembras (cuadro 3).

Discusión

Patrones de alimentación y defecación durante la comida
La comparación entre R. colombiensis y R. prolixus mostró evidentes diferencias en los

105

Arévalo A., Carranza J.C., Guhl F.

Biomédica 2007;27(supl.1):101-9

patrones de alimentación y defecación entre las dos especies y entre los diferentes estadios dentro de cada especie. Una interesante observación fue que las ninfas N1, N2, N3 y N4 de R. colombiensis y R. prolixus no presentaron diferencias significativas en el tiempo promedio para iniciar la picada sobre ratones ICR, mostrando el mismo grado de avidez por la toma del alimento en las condiciones experimentales utilizadas. Por otro lado, las N5, los machos y las hembras de R. prolixus iniciaron más rápido la toma del alimento que los mismos estadios de R. colombiensis (cuadro 1). Aunque los adultos de R. colombiensis son más tímidos para la toma del alimento, ingresan a las viviendas atraídos por la luz o por diferentes fuentes de alimento. La frecuencia con que los adultos de R. colombiensis ingresan a las viviendas fue confirmada en la encuesta entomológica realizada en el departamento del Tolima en el año 2000, en la cual se capturaron adultos de R. colombiensis en el interior de las viviendas de los municipios de Alvarado, Carmen de Apicalá, Coyaima, Coello, Guamo, Ibagué, Icononzo, Lérida, Libano, Ortega, Prado, Purificación, Santa Isabel y San Luis, los cuales constituían el 33% de los municipios encuestados (Guhl F et al. Implementación de la Etapa III del Programa Nacional de Prevención y Control de la Enfermedad de Chagas y la Cardiopatía Infantil. Región Centro Oriental: Departamento del Tolima. Informe Final. Universidad de los Andes). Previas observaciones en el municipio de Coyaima, Tolima, mostraron que en R. colombiensis adultos capturados en el interior de las viviendas y en adultos capturados en las palmas aledañas a las viviendas, la infección por T. cruzi alcanzó una prevalencia del 98% (datos no publicados). Por otro lado, el examen de 396 R. prolixus domiciliados en la misma área geográfica mostró una prevalencia general del 3,03% de T. cruzi (5). De conformidad con lo anterior se podría esperar que cualquier adulto de R. colombiensis que logre picar y defecar sobre un vertebrado del domicilio humano presentaría mayor probabilidad para la transmisión de T. cruzi que las ninfas y los adultos de R. prolixus domiciliados en esta región. La comparación de los datos obtenidos en el presente estudio con datos de otros autores es

difícil debido a las diferencias en variables experimentales como la temperatura ambiente, humedad relativa y fuente de alimento, o al uso de pequeños números de insectos, entre otras. Adicionalmente, existen variaciones inter e intraespecíficas en el comportamiento de triatominos como Triatoma dimidiata, en la que se observó que las ninfas de primer estadio son más tímidas para iniciar la picada que los restantes estadios (4). Por otro lado, Rocha da Silva D. et al mostraron que los adultos de R. pictipes presentan mayor timidez y que, por lo tanto, en ellos transcurre mayor tiempo entre el ofrecimiento de la comida y la picada (6). Igualmente se observó en los adultos de T. brasilensis un mayor tiempo entre el ofrecimiento de la comida y la picada que en los demás estados ninfales; en T. pseudomaculata las N4 fueron más tímidas para la toma del alimento que los demás estadios ninfales (7). Una posible causa de esta variabilidad en el comportamiento de los triatominos con relación al tiempo transcurrido entre el ofrecimiento de la comida y la picada podría ser la fuente de alimento, como fue sugerido por Martínez-Ibarra et al., quienes observaron que cuando Meccus picturatus es alimentado sobre gallinas, los adultos son más tímidos para iniciar la picada que los restantes estadios ninfales, pero cuando esta misma especie es alimentada sobre conejos, las N4 son las más tímidas (8). El tiempo desde la picada hasta la repleción total del insecto fue mayor en R. colombiensis, que presentó diferencias significativas con las N2 y N5 de R. prolixus; en los demás estadios de desarrollo no se presentaron diferencias significativas. En el presente trabajo se destaca el hecho de que las N5 de R. colombiensis y de R. prolixus presentaron el mayor tiempo para obtener la repleción; otros autores también han reportado que las N5 de diferentes especies gastan mayor tiempo para la repleción, como fue observado en N5 de T. dimidata y R. prolixus (4), N5 de T. brasiliensis y T. seudomaculata (7) y N5 de M. picturatus (8). Una explicación a este especial comportamiento de las N5 estaría relacionada con que precisamente las N5 son los estadios que mayor cantidad de sangre ingieren con relación a todos los demás estadios de

106

Biomédica 2007;27(supl.1):101-9

Patrones de alimentación y defecación de Rhodnius

desarrollo, lo que a su vez demanda mayor tiempo para alcanzar la repleción, pues las N5 requieren una suficiente cantidad de alimento para la adquisición de nuevas estructuras anatómicas durante la muda al estado adulto. Los tiempos para alcanzar la repleción disminuyeron en los adultos de ambos sexos de R. colombiensis y R. prolixus; de igual manera, se observó disminución en los adultos de T. dimidiata, T. infestans y R. prolixus (4), T. brasiliensis y T. pseudomaculata (7). Trabajos previos también mostraron una extensa variación, puesto que el tiempo hasta la repleción se ve afectado por el tipo de alimento y por el tamaño de la especie del insecto, entre otras variables. En este orden de ideas, Zeledón et al. (4) mostraron que los promedios generales del tiempo para alcanzar la repleción son mayores en T. dimidiata y T. infestans que en R. prolixus. Algunos autores plantean una relación directa entre los patrones de defecación antes de finalizar la comida y las frecuentes interrupciones durante ésta, como sucede con T. dimidiata (4). Por otro lado, se pueden presentar variaciones en las interrupciones durante el proceso de alimentación, incluso entre las mismas especies, posiblemente por el origen de la cepa o por la temperatura bajo la cual se realizan las observaciones (4,9). Para explicar la razón de las interrupciones se han observado las señales eléctricas de la bomba cibarial de varias especies de Rhodnius cuando ésta se contrae para succionar la sangre. Se concluyó que las interrupciones probablemente se deben al hallazgo de otro vaso sanguíneo por parte del vector, ya que en muchas ocasiones el proceso de alimentación fue interrumpido aun sin retirar el rostro del huésped, lo cual se verificó por señales eléctricas irregulares en la bomba cibarial (Viana Sant’ Anna MR, Diotaiuti L, Figueiredo Gontijo A, Figueiredo Gontijo N, Pereira MH. Feeding behaviour of morphologically similar Rhodnius species (Hemiptera: Reduviidae): influence of mechanical characteristics and salivary function. En: Guhl F, Schofield CJ, editors. Cuarto Taller Internacional sobre Genética Poblacional y Control de Triatominos (ECLAT 4). Punta Iguana, Cartagena, Colombia, 2002. p. 139-50). Los únicos estadios de R. colombiensis que defecaron durante la comida fueron las N1 y los

machos. Así mismo, el mayor promedio de interrupciones durante la comida lo exhibieron las N5 y las hembras, pero en estos estadios no se llevó a cabo ninguna defecación durante la toma del alimento (cuadro 1). El patrón descrito mostró que no existe una relación directa entre el número de interrupciones y el número de defecaciones durante la comida en R. colombiensis, es decir que existieron individuos que defecaron durante la alimentación sin interrumpir tal proceso, o que lo interrumpieron sin efectuar ninguna defecación durante éste. En R. prolixus se observó que el promedio de defecaciones durante la toma del alimento fue mayor y presentó diferencias significativas con N2, N3, N4 y N5 de R. cololombiensis . Por otro lado, en todos los estadios de R. prolixus se presentaron interrupciones durante la comida, indicando una posible relación entre las interrupciones y las defecaciones durante la comida. Esta diferencia entre R. prolixus y R. colombiensis en relación con el número de defecaciones durante la toma del alimento indica que durante la toma del alimento R. prolixus tiene mayor probabilidad de transmisión de T. cruzi que R. colombiensis.

Patrones de defecación después de la comida
Como se observó en el cuadro 2, el promedio de defecaciones por insecto durante los primeros 10, 60 y 95 minutos después de la comida fue mayor en R. prolixus y presentó diferencias significativas con R. colombiensis. Por otro lado, al igual que en otros estudios, se observó que los patrones más bajos de defecación los presentaron los machos en las dos especies estudiadas (4,10-12). Sin embargo, el comportamiento de las dos especies después de la toma del alimento puede afectar la eficiencia de la transmisión de T. cruzi. Se observó que independientemente del estadio, cuando R. prolixus finaliza la toma del alimento huye velozmente, pues está adaptado para refugiarse en grietas o en estructuras anexas al domicilio, de manera que las defecaciones después de la toma del alimento son depositadas lejos del huésped vertebrado, principalmente en paredes y techos de palma. Por el contrario, cuando R. colombiensis finaliza la toma del alimento, permanece junto al huésped. Este

107

Arévalo A., Carranza J.C., Guhl F.

Biomédica 2007;27(supl.1):101-9

comportamiento podría explicarse porque en condiciones naturales vive estrechamente asociado a nidos de Didelphis marsupialis, en espacios muy reducidos conformados por las brácteas de las palmas de vino A. butyraceae, y permanece y defeca muy cerca o sobre el huésped vertebrado. De esta manera, R. colombiensis compensaría la falta de defecación durante el alimento, asegurando una eficiente transmisión para D. marsupialis, en la que se han observado prevalencias del 89% de T. cruzi en individuos capturados en Coyaima (Tolima) (datos no publicados). Como se mencionó anteriormente, el promedio de defecaciones durante la toma del alimento promueve la transmisión de T. cruzi directamente sobre el vertebrado por parte de R. prolixus, pero en menor grado por R. colombiensis. Sin embargo, aunque el promedio de defecaciones después de 10, 60 y 95 minutos es mayor en R. prolixus que en R. colombiensis, las diferencias en el comportamiento entre las dos especies podrían afectar la eficiencia de la transmisión, pues como se mencionó, R. prolixus huye del huésped y R. colombiensis permanece cerca de él, de manera que después de la toma del alimento compensaría su eficiencia para la transmisión del parásito. Aunque no existen datos sobre la relación de R. colombiensis y los vertebrados domésticos, asumimos que cuando adultos de R. colombiensis ingresan esporádicamente al interior de las viviendas humanas, podrían permanecer cerca de los vertebrados, aumentando así la probabilidad de transmisión de T. cruzi.

de la cantidad de sangre ingerida llegaron a duplicar la cantidad ingerida por las hembras y a triplicar la ingerida por los machos. La cantidad de sangre que ingiere R. colombiensis es similar a la que ingieren otras especies selváticas como R. pictipes alimentado artificialmente y sobre ratón (13) y R. brethesi (17). Cuando se comparan los patrones de alimentación y defecación de R. colombiensis con los de R. prolixus, se observa que esta última especie presenta un comportamiento que favorece la transmisión de T. cruzi, por cuanto R. prolixus presenta mayor número de defecaciones durante la comida y un mayor porcentaje de insectos que defecan durante los primeros 10, 60 y 95 minutos después la alimentación. Aunque R. colombiensis presenta menor número de defecaciones que R. prolixus, es necesario tener en cuenta que R. colombiensis permanece mayor tiempo cerca del hospedero vertebrado, aumentando así la probabilidad de transmitir T. cruzi al vertebrado. De las 15 especies de Rhodnius descritas, tres de ellas se encuentran comúnmente en ambientes domésticos (R. prolixus , R. pallescens y R. ecuadoriensis); las demás especies se registran principalmente en ambientes arbóreos como las brácteas de las palmas y las bromelias. Sin embargo, desde hace varias décadas, en varios países de América Latina se ha señalado el comportamiento de varias especies de Rhodnius que ingresan a las viviendas con frecuencias progresivas, entre las que se destacan R. neglectus, R. pictipes y R. nasutus (18). Más recientemente se presentaron evidencias sobre el papel putativo de R. robustus como vector extradomiciliario de la enfermedad de Chagas en el occidente de Venezuela, pues esta especie es atraída por la luz artificial, y la transmisión de T. cruzi podría ocurrir cuando se alimenta sobre las personas de las viviendas (19). Hasta el momento no se conoce el papel de R. colombiensis en la transmisión de T. cruzi en áreas en donde esta especie existe en cercanías al peridomicilio humano. Se ha comprobado que los adultos R. colombiensis invaden con frecuencia el domicilio humano, presentando elevadas prevalencias de T. cruzi, lo que aumentaría la

Cantidad de sangre ingerida
La cantidad y calidad del alimento ingerido es importante en el desarrollo de los triatominos debido a que el número de huevos producidos por las hembras está directamente relacionado con la cantidad de sangre ingerida (13-16). El peso promedio de la cantidad de sangre ingerida varía de una especie a otra, llegando a ser diferente en muchos casos dentro de la misma especie, inclusive cuando se utiliza la misma fuente de alimento (13). Las N5 necesitan obtener suficientes reservas energéticas para efectuar la última muda hacia el estadio adulto; por tal razón, los promedios

108

Biomédica 2007;27(supl.1):101-9

Patrones de alimentación y defecación de Rhodnius

probabilidad de transmisión al hombre y a los animales domésticos. De conformidad con lo anterior, es de gran importancia estudiar el posible papel de R. colombiensis en la transmisión de T. cruzi, especialmente en aquellas áreas en donde R. prolixus se ha controlado. Conflicto de intereses Los autores del presente artículo declaramos que no teníamos conflictos de intereses de orden académico, institucional u operacional en el momento de realización de la investigación. Financiación Este trabajo recibió financiación del Instituto Colombiano "Francisco José de Caldas" (Colciencias), proyecto 105-05-279-99, y del Fondo de Investigaciones de la Universidad del Tolima. También recibió apoyo internacional de la red ECLAT (European Community–Latin-American Network for Research on the Biology and Control of Triatominae). Referencias
1. Galvão C, Carcavallo R, Silva RD, Jurberg J. A checklist of the current valid species of the subfamily Triatominae Jeannel, 1919 (Hemiptera, Reduviidae) and their geographical distribution, with nomenclatural and taxonomic notes. Zootaxa 2003;202:1-36. 2. Schofield CJ, Dujardin JP. Theories on the evolution of Rhodnius. Actual Biol 1999;21:183-97. 3. Moreno MJ, Galvão C, Jurberg J. Rhodnius colombiensis sp. n. da Colômbia com quadros comparativos entre estructuras fálicas do género Rhodnius Stal, 1859 (Hemiptera, Reduviidae, Triatominae). Entomol Vect 1999;6:601-17. 4. Zeledón R, Alvarado R, Jirón LF. Observations on the feeding and defecation patterns of three triatomine species (Hemiptera: Reduviidae). Acta Trop 1977;34:65-77. 5. Monroy E, Susunaga G. Caracterización biológica de las cepas de Trypanosoma cruzi aisladas de Rhodnius prolixus en el departamento del Tolima. (Tesis, biología). Ibagué: Universidad del Tolima; 1990. p.151. 6. Richa DS, Galvão C, Jurberg J. Biología do Rhodnius pictipes Stal, 1872 em Condições de Laboratório (Hemiptera, Reduviidae, Triatominae). Mem Inst Oswaldo Cruz 1994;89:265-70. 7. Soares RP, das Graças Evangelista L, Laranja LS, Diotaiuti L. Population dynamics and feeding behavior of Triatoma brasiliensis and Triatoma pseudomaculata,

main vectors of Chagas disease in northeastern Brazil. Mem Inst Oswaldo Cruz 2000;95:151-5. 8. Martínez-Ibarra JA, Novelo López M, Hernández Robles MR, Grant Guillén Y. Influence of the blood meal source on the biology of Meccus picturatus Usinger 1939 (Hemiptera: Reduviidae:Triatominae) under laboratory conditions. Mem Inst Oswaldo Cruz 2003;98:227-32. 9. Wood SF. Importance of feeding and defecation times of insect vectors in transmission of Chagas’ desease. J Econ Entomol 1951; 44: 52-54. 10. Dias E. Obsevações sôbre eliminação de dejeções e tempo de sucção em alguns triatomineos sulamericanos. Mem Inst Oswaldo Cruz 1956;54:11524. 11. Pipkin AC Sr. Domiciliary reduviid bugs and the epidemiology of Chagas’ disease in Panama (Hemiptera: Reduviidae: Triatominae). J Med Entomol 1968;5:107-24. 12. Pippin WF. The biology and vector capability of Triatoma sanguisuga texana Usinger and Triatoma gerstaeckeri (Stal) compared with Rhodnius prolixus (Stal) (Hemiptera: Triatominae). J Med Entomol 1970;7:30-45. 13. Rocha DS, Fonseca AH, Costa FA, Jurberg J, Galvâo C. Desenvolvimento de Rhodnius pictipes Stal, 1872 alimentado através de membrana de silicone e em camundongos (Hemiptera, Reduviidae, Triatominae). Mem Inst Oswaldo Cruz 1997;92:553-8. 14. Buxton PA. The biology of a blood sucking bug Rhodnius prolixus . Trans Ent Sco Soc London 1930;78:227-36. 15. Friend WG, Choy CT, Cartwright E. The effect of nutrient intake on the development and the egg prodution of Rhodnius prolixus Stal (Hemiptera: Reduviidae). Can J Zool 1965;43:891-904. 16. Regis L. The role of the blood meal in egg-laying periodicity and fecundity in Triatoma infestans. Internat J Inver Reprod 1979;1:187-95. 17. Rocha DS, dos Santos CM, Cunha V, Jurberg J, Galvao C. Life cycle of Rhodnius brethesi Matta, 1919 (Hemiptera, Reduviidae, Triatominae), a potential vector of Chagas disease in the Amazon region. Mem Inst Oswaldo Cruz 2004;99:591-5. 18. Dujardin JP, García-Zapata MT, Jurberg J, Roelants P, Cardozo L, Panzera F, et al. Which species of Rhodnius is invading houses in Brazil?. Trans R Soc Trop Med Hyg 1991;85:679-80. 19. Feliciengeli MD, Dujardin JP, Bastrenta B, Mazzarri M, Villegas J, Flores M, et al. Is Rhodnius robustus (Hemiptera: Reduviidae) responsible for Chagas disease transmission in Western Venezuela? Trop Med Int Health 2002;7:280-7.

109

Vallejo G.A., Guhl F., Carranza J.C. et al Biomédica 2007;27(Supl. 1):110-8

Biomédica 2007;27(supl. 1):110-8

ARTÍCULO ORIGINAL

Interacción tripanosoma-vector-vertebrado y su relación con la sistemática y la epidemiología de la tripanosomiasis americana
Gustavo Adolfo Vallejo 1, Felipe Guhl 2, Julio César Carranza 1, Omar Triana 3, Gerardo Pérez 4, Paola Andrea Ortiz 1, Dairo Humberto Marín 1, Lina Marcela Villa 1, Jazmín Suárez 1, Isaura Pilar Sánchez 1, Ximena Pulido 1, Ingrid Bibiana Rodríguez 1, Leyder Elena Lozano 1, Daniel Alfonso Urrea 1, Fredy Arvey Rivera 1, César Cuba-Cuba 5, Jairo Alfonso Clavijo 6
1

2

3

4

5

6

Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia. Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT), Universidad de los Andes, Bogotá D.C., Colombia. Laboratorio de Chagas, Instituto de Biología, Facultad de Ciencias Exactas y Naturales, Universidad de Antioquia, Medellín, Colombia. Grupo de Investigación en Química de Proteínas, Departamento de Química, Universidad Nacional de Colombia, Bogotá D.C., Colombia. Unidade de Parasitologia Médica e Biología de Vetores, Facultade de Medicina, Universidade de Brasilia, Brasilia, DF, Brasil. Departamento de Matemáticas y Estadística, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia.

Introducción. Trypanosoma rangeli es la segunda especie de tripanosoma que infecta al hombre en América Latina. Se ha observado variabilidad en las características biológicas, bioquímicas y moleculares en diferentes aislamientos de este parásito. Objetivo. Estudiar las características morfológicas y moleculares de cepas de T. rangeli aisladas de diferentes especies de Rhodnius e inoculadas en diferentes especies de vertebrados. Materiales y métodos. Se utilizaron 19 cepas de T. rangeli aisladas de R. prolixus, R. pallescens y R. colombiensis en Colombia, R. ecuadoriensis en Perú y R. pallescens en Panamá. Se evaluó el polimorfismo de los tripomastigotes sanguíneos en ratones ICR y se estudió el pleomorfismo de la cepa P53 de T. rangeli KP1(-) inoculada en ratón, marsupial y canino. Se efectuó análisis de ADN polimorfo amplificado aleatorio en 12 cepas aisladas de cuatro especies de Rhodnius. Resultados. Se observaron tres grupos discretos en la longitud total de los tripomastigotes sanguíneos y la cepa P53 presentó diferencias significativas en el tamaño de los tripomastigotes sanguíneos en ratón, marsupial y canino. El análisis de ADN polimorfo amplificado aleatorio mostró segregación de las cepas en dos ramas correspondientes a las cepas de T. rangeli KP1(+) y T. rangeli KP1(-). De otra parte todos las cepas de T. rangeli KP1(-) se agruparon de acuerdo con las especies de Rhodnius de las cuales fueron aisladas. Conclusión. Este es el primer estudio que revela una estrecha asociación entre cepas de T. rangeli y las especies de Rhodnius, confirmando que cada especie de Rhodnius transmite al hospedero vertebrado poblaciones del parásito con claras diferencias fenotípicas y genotípicas, lo cual soporta la evolución clonal de estas poblaciones. Palabras clave: Trypanosoma, Rhodnius, tripanosomiasis/epidemiología, técnica del ADN polimorfo amplificado aleatorio (RAPD), enfermedad de Chagas.

Trypanosoma rangeli parasite-vector-vertebrate interactions and their relationship to the systematics and epidemiology of American trypanosomiasis
Introduction. Trypanosoma rangeli is a species of trypanosome second to T. cruzi, that is infective to humans in Latin America. Variability in the biological, biochemical and molecular characteristics between different isolates isolates of this parasite have been recorded. Objective. Morphological and molecular characteristics were recorded from strains of T. rangeli

110

Biomédica 2007;27(supl. 1):110-8

Interacción tripanosoma-vector-vertebrado

that were isolated from different species of Rhodnius and maintained in different vertebrate species. Materials and methods. Nineteen strains of T. rangeli were isolated from R. prolixus, R. pallescens and R. colombiensis in Colombia, R. ecuadoriensis in Peru and R. pallescens in Panama. Polymorphism of blood trypomastigotes in ICR mice was evaluated and pleomorphism of P53 strain of T. rangeli KP1(-) inoculated in mouse, marsupial and canine was studied. RAPD analysis (randomly amplified polymorphic DNA analysis) of 12 strains isolated from four species of Rhodnius was performed. Result. Based on the total length of blood trypomastigotes, three discrete groups were observed. The P53 strain showed significant differences in the size of blood trypomastigotes in mouse, marsupial and canine. RAPD analysis showed that the strains segregated into two branches corresponding to strains of T. rangeli KP1(+) and T. rangeli KP1(-). All strains of T. rangeli KP1 (-) clustered according to the species of Rhodnius from which they were isolated . Conclusion. These data reveal, for the first time, a close association amongst T. rangeli strains and Rhodnius species, confirming that each species of Rhodnius transmits to vertebrate hosts a parasite population with clear phenotypic and genotypic differences. This is further evidence that supports the concept of clonal evolution of these parasites. Key words: Trypanosoma , Rhodnius , trypanosomiasis/epidemiology, random amplified polymorphic DNA technique, Chagas disease.

Trypanosoma rangeli es un interesante parásito no patógeno para el hombre, que exhibe particulares características biológicas, entre las cuales se destacan la patogenicidad del parásito para el vector (1-3), la susceptibilidad de las especies de Rhodnius a cepas de T. rangeli del mismo origen geográfico (4,5), la reacción serológica cruzada de T. rangeli con T. cruzi (6,7) y la resistencia de los flagelados a la lisis mediada por el complemento (8), entre otras. Por ello, durante las últimas décadas, T. rangeli ha sido objeto de estudio por parte de varios grupos de investigación que han encontrado en este parásito un importante modelo para conocer los procesos coevolutivos entre parásito-vector y para estudiar la dinámica de la transmisión de subpoblaciones de T. rangeli al hospedero vertebrado (9). De otra parte, existe interés en desarrollar métodos para diferenciar T. cruzi de T. rangeli, debido a que en la mayoría de los países de América Latina estas dos especies se encuentran infectando los mismos vertebrados y vectores, generando dificultades en el diagnóstico morfológico de las
Correspondencia: Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, Ibagué, Tolima, Colombia. A.A. No. 546. Telfax +(57) 8 2669176. gvallejo@ut.edu.co Recibido: 23/06/06; aceptado: 14/07/06

dos especies (10) o en el diagnóstico serológico de la infección en los vertebrados (6,7,11). La variabilidad de las poblaciones de T. rangeli se ha demostrado en las últimas décadas mediante estudios de minisatélites de ADN, los cuales mostraron diferencias genéticas entre las cepas de Santa Catarina y las aisladas en Honduras, Colombia y Venezuela (12). El análisis de polimorfismos del ADN mitocondrial mostró que el minicírculo de kDNA denominado KP1 se encontró asociado con las cepas de T. rangeli aisladas en Colombia, Honduras y Venezuela, pero no en las cepas aisladas en Santa Catarina al sureste de Brasil (13). Una divergencia genética similar entre estos dos grupos se demostró usando electroforesis de isoenzimas y AP-PCR (14). Una conclusión similar se obtuvo con el análisis del cariotipo molecular de varias cepas de T. rangeli, revelando la existencia de polimorfismo cromosómico (15). Utilizando amplificación del kDNA, en Colombia y en otros países de América Latina se han detectado dos grupos de T. rangeli molecularmente diferentes. Un grupo de cepas aisladas de Rhodnius prolixus presentan tres clases de minicírculos de kDNA denominados KP1, KP2 y KP3 (T. rangeli KP1+), mientras que las cepas aisladas de R. colombiensis presentan solamente dos clases denominadas KP2 y KP3 (T. rangeli KP1-) (9,16-18).

111

Vallejo G.A., Guhl F., Carranza J.C. et al

Biomédica 2007;27(supl. 1):110-8

Recientemente se caracterizaron 18 cepas de T. rangeli aisladas de glándulas salivares de R. colombiensis, R. pallescens y R. prolixus (18) utilizando dos marcadores independientes: kDNA (17) y el espaciador intergénico del gen mini-exón (19). Los autores observaron que el producto de 380 pb de amplificación del mini-exón siempre se presentó asociado con los productos obtenidos de los minicírculos KP2 Y KP3 de kDNA y el producto de 340 pb del mini-exón siempre se presentó asociado con los productos de los minicírculos KP1, KP2 Y KP3. Existen dos hipótesis alternativas sobre el origen de los dos grupos de T. rangeli; por un lado podría tratarse de grupos con evolución clonal, en la cual la reproducción sexual sería rara o inexistente, o se trataría de un proceso de especiación críptica. Se encontró asociación coevolutiva entre las cepas de T. rangeli KP1(-), las cuales circulan en la cordillera de los Andes en los vectores del grupo “pallescens”, representados por R. pallescens, R. colombiensis y R. ecuadoriensis, y las cepas de T. rangeli KP1(+), las cuales circulan al oriente de la cordillera de los Andes en los vectores del grupo “prolixus”, representados por R. prolixus y R. neglectus (9). Nuestro interés fue conocer el grado de divergencia genética existente entre los grupos de T. rangeli KP1(+) y T. rangeli KP1(-). Por esta razón, en el presente trabajo se analizaron las características morfológicas de los tripomastigotes sanguíneos y las características genéticas mediante análisis de RAPD en cepas de T. rangeli aisladas de R. pallescens, R. colombiensis, R. ecudoriensis y R. prolixus para verificar si los polimorfismos observados en las poblaciones de este parásito están asociados con los vectores que las transmiten, de manera que estos actuarían como filtros biológicos seleccionando las diferentes poblaciones del parásito. Materiales y métodos

ecuadoriensis domiciliado en el departamento de la Libertad en el norte del Perú; las cepas P53, Trs, Rcol, 2715 y 044 se aislaron de R. colombiensis silvestre en el departamento del Tolima, región central de Colombia; las cepas Gal 47, Gal 57, SO28, SO48 se aislaron de R. pallescens silvestre en el departamento de Sucre, norte de Colombia; la cepa 0401 se aisló de R. pallescens silvestre en el departamento del Tolima, Colombia; la cepa GMLLC se aisló de R. pallescens en Panamá; las cepas 444, 1545, 3123 se aislaron de R. prolixus domiciliado en el departamento de Boyacá, Colombia, y las cepas P19 y Choachí se aislaron de R. prolixus domiciliado en los departamentos de Norte de Santander y Cundinamarca, Colombia. Los tripomastigotes metacíclicos de las glándulas salivares de cada vector se inocularon intraperitonealmente en ratones ICR. Se efectuaron hemocultivos a partir de los ratones positivos en el quinto día posinoculación y las cepas aisladas se mantuvieron a 28°C mediante pasajes semanales en medio NNN con LIT suplementado con 10% de suero fetal bovino inactivado. Todas las cepas aisladas de R. ecuadoriensis , R. colombiensis y R. pallescens se caracterizaron como T. rangeli KP1(-), y las cepas aisladas de R. prolixus como T. rangeli KP1(+) mediante la amplificación de kDNA y del espaciador intergénico del gen min-iexón (17,19). Estudio morfológico de los tripomastigotes sanguíneos en ratones ICR
Grupos de tres ratones ICR machos de ±20 gramos se inocularon con 5x106 epimastigotes de las cepas de cultivo de T. rangeli KP1(-). Otros grupos de tres ratones ICR machos se inocularon con 400.000 tripomastigotes metacíclicos de cada cepa de T. rangeli KP1(+). Los ratones se examinaron a partir del tercer día de inoculación, se observó la parasitemia y se dibujaron en cámara lúcida 30 formas sanguíneas circulantes de cada una de las cepas en el quinto día posinoculación. En cada una de las formas dibujadas se midió la longitud total, la longitud del flagelo, las distancias del núcleo al extremo posterior y al extremo anterior, los índices nucleares y los índices del cinetoplasto (20,21). Se realizaron estimaciones de las medias de la longitud total

Aislamiento y cultivo de los parásitos
Se utilizaron 19 cepas de T. rangeli. Las cepas Perú 1, Perú 1A y Perú 2A se aislaron de las glándulas salivares naturalmente infectadas de R.

112

Biomédica 2007;27(supl. 1):110-8

Interacción tripanosoma-vector-vertebrado

de los tripomastigotes sanguíneos de las cepas de T. rangeli en el quinto día posinfección con los respectivos intervalos de 95% de confianza y se efectuó análisis multivariado de varianza (MANOVA) utilizando el programa STATISTICA V4.5.

Estudio morfológico de Trypanosoma rangeli en diferentes hospederos vertebrados
Para evaluar pleomorfismos de las formas sanguíneas se seleccionó la cepa P53 de T. rangeli KP1(-) para infectar dos individuos de Mus musculus, Didelphis marsupialis y Canis familiaris, a los que se les inocularon formas de cultivo que contenían 2x106 parásitos por gramo de peso corporal. Los tripomastigotes sanguíneos se aislaron de la sangre de cada uno de los mamíferos, concentrándolos por centrifugación en tubo capilar, extendiéndolos y coloreándolos con Giemsa. Se dibujaron 30 tripomastigotes sanguíneos circulantes en ratón, canino y didélfido durante el tercer día posinoculación. A cada una de las formas dibujadas se les efectuó la toma de las medidas morfométricas y se realizaron estimaciones de las medias de la longitud total de los tripomastigotes sanguíneos de la cepa P53 de T. rangeli en el tercer día posinfección en cada uno de los mamíferos utilizados con los respectivos intervalos de 95% de confianza; se efectuó análisis multivariado de varianza (MANOVA) utilizando el programa STATISTICA V4.5.

Purificación de ADN y obtención de RAPD
El ADN genómico se extrajo de los cultivos de parásitos mediante el método de fenol-cloroformo seguido de precipitación con etanol y acetato de sodio. La concentración del ADN se determinó por electroforesis mediante comparación con patrones de concentración conocidos. Para la obtención del ADN polimorfo amplificado aleatorio (RAPD) se ensayaron 12 iniciadores a partir de los cuales se seleccionaron OPBG-02 (5´GGAAAGCCCA-3´) y OPBG-013 (5´-GGTTGGGC CA-3´) (Operon Technologies, Inc.), los que permitieron obtener los patrones más discriminantes para analizar todas las cepas. Para las amplificaciones se utilizó un volumen final de reacción de 20 µl que contenía 2 ml de buffer de Taq Polimerasa 10X (INVITROGEN), una mezcla

de dNTPs 200 mM dNTPs, MgCl2 3,5 mM,, KCL 25 mM y 25 mM del iniciador ,1 unidad de Taq DNA polimerasa (INVITROGEN) y 10 ng de ADN. La reacción en cadena de la polimerasa (PCR) se corrió en una termociclador M.J. Research PTC150-16 y se sometió a 35 ciclos de amplificación. Los perfiles de temperatura para denaturación del ADN, hibridación y extensión del iniciador fueron 95°C por un minuto (con un tiempo inicial de 5 min), 30°C por un minuto y 72°C por un minuto, respectivamente, y una extensión final de 5 minutos. Los productos amplificados fueron separados en geles de poliacrilamida al 6% y coloreados con nitrato de plata (22). Los perfiles de RAPD se usaron para la construcción de una matriz binaria de acuerdo con la presencia (1) o ausencia (0) de las bandas. El análisis se efectuó con el programa RAPDPLOT versión 3.0 y se calculó la matriz de distancias a partir del índice de bandas compartidas (1-MATCH). El índice de bandas compartidas (M) se calculó usando la formula: M = NAB/NT, donde NAB es el número total de apareamientos entre los individuos A y B y NT es el número total de loci registrados (23). Con base en los resultados de los perfiles de RAPD se construyó un dendrograma por el método UPGMA (Unweighted Pair-Group Method with Arithmetic Means) utilizando un bootstrap con 100 pseudoréplicas. Las distancias entre los grupos de parásitos se obtuvieron con el programa RAPDIST, con el cual se compararon las distancias genéticas de Nei (24), y se comprobó la consistencia de los datos de RAPD que soportan las ramas del dendrograma usando análisis de bootstrap con 100 pseudoréplicas. Resultados

Morfología de los tripomastigotes sanguíneos en ratones ICR
Los resultados del estudio morfológico de 10 cepas de los tripomastigotes sanguíneos de T. rangeli en la sangre de ratones infectados experimentalmente mostró un elevado grado de polimorfismo de los parásitos en el quinto día de infección. Se observaron promedios en las longitudes totales de los tripomastigotes desde 32 hasta 39 µm mostrando diferencias significativas entre las diferentes cepas analizadas (figura 1).

113

Vallejo G.A., Guhl F., Carranza J.C. et al

Biomédica 2007;27(supl. 1):110-8

Morfología de Trypanosoma rangeli en diferentes hospederos vertebrados
Se observó que la cepa P53 de T. rangeli presentó diferencias estadísticamente significativas entre las tres especies de mamíferos. Los tripomastigotes sanguíneos fueron más cortos en ratón que en sangre de Didelphis y aun más cortos que los observados en sangre de perro (figura 2).

Obtención y análisis de RAPD
La figura 3 muestra uno de los geles de poliacrilamida al 6% con los productos amplificados y coloreados con nitrato de plata. Con base en los resultados de los perfiles de RAPD se construyó un dendrograma por el método UPGMA (Unweighted Pair-Group Method with Arithmetic Means) utilizando un bootstrap con 100 pseudoréplicas (figura 4). De acuerdo con el

Figura 1. Comparación de las medias de la longitud total de 30 tripomastigotes sanguíneos de cada una de cuatro cepas estudiadas en ratones ICR en el quinto día posinoculación. Se compararon las cepas Gal 57, aislada de R. pallescens, P53, aislada de R. colombiensis, Perú 1, aislada de R. ecuadoriensis, y P19, aislada de R. prolixus.

Figura 2. Comparación de las medias de la longitud total de 30 tripomastigotes snaguíneos de la cepa de T. rangeli P53 detectada en el tercer día posinoculación en ratón, zarigüeya y perro.

Figura 3. Perfiles de RAPD obtenidos a partir de 12 cepas de T. rangeli con el primer OPBG13. M corresponde al marcador de peso molecular. Las canaletas 1, 2 y 3 corresponden a las cepas de T. rangeli 444, 1545, 3123, respectivamente, aisladas de R. prolixus. Las canaletas 4, 5 y 6, corresponden a las cepas de T. rangeli Gal47, SO28 y SO48, respectivamente, aisladas de R. pallescens. Las canaletas 7, 8 y 9 corresponden a las cepas de T. rangeli Perú1, Perú1A y Perú2A, respectivamente, aisladas de R. ecuadoriensis. Las canaletas 10, 11 y 12 corresponden a las cepas de T. rangeli P53, TrS y Rcol, respectivamente, aisladas de R. colombiensis . La canaleta 13 corresponde a una cepa de T. cruzi I y la canaleta 14 corresponde a una cepa de T. cruzi II.

114

Biomédica 2007;27(supl. 1):110-8

Interacción tripanosoma-vector-vertebrado

dendrograma, las doce cepas de T. rangeli se agruparon en dos ramas. Las cepas 3123, 444, y 1545 aisladas de R. prolixus, caracterizadas como T. rangeli KP1(+), formaron una rama y las otras nueve cepas aisladas de las glándulas salivares del grupo “pallescens”, conformado por R. pallescens (SO28, Gal 47, SO48), R. colombiensis (Rcol, P53, Trs) y R. ecuadoriensis (Perú 2A, Perú 1A, Perú 1), caracterizadas como T. rangeli KP1(-), formaron una segunda rama con tres subramas que correspondieron exactamente a cada una a las cepas aisladas de R. pallescens, R. colombiensis y R. ecuadoriensis. La figura 5 muestra las distancias de Nei entre los grupos de parásitos obtenidas con el programa RAPDIST. Discusión La interacción entre las subpoblaciones de tripanosomas con diferentes especies de triatominos, así como los mecanismos que regulan la transmisión, son importantes elementos para la documentación de la epidemiología de la tripanosomiasis americana. A partir de este enfoque será posible establecer cuáles subpoblaciones de tripanosomas son transmitidas por los vectores en una determinada área geográfica. De otra parte será igualmente posible conocer si existen diferencias en la susceptibilidad a la infección de los hospederos vertebrados. Adicionalmente, los estudios de la interacción tripanosoma-triatomino permitirán identificar procesos coevolutivos para fortalecer las hipótesis

Figura 5. Dendrograma generado por RAPDDIST que muestra las distancias genéticas de Nei entre las cepas de T. rangeli aisladas de R. prolixus, R. pallescens, R. colombiensis y R. ecuadoriensis usando el algoritmo UPGMA y bootstrap de 100 seudoréplicas.

acerca de la filogenia y dispersión de los parásitos y de los vectores, contribuyendo así a aclarar la posición taxonómica de las especies semejantes a T. cruzi o a T. rangeli en América. Se ha demostrado que las cepas de T. rangeli aisladas de las especies de Rhodnius del grupo «pallescens» (R. pallescens, R. colombiensis y R. ecuadoriensis) denominadas (KP1-) son genéticamente divergentes de las cepas aisladas del grupo «prolixus» (prolixus, neglectus) denominadas (KP1+) (9,17,18), lo que indica una posible asociación evolutiva entre las subpoblaciones de T. rangeli y los grupos de especies de Rhodnius. La relación entre la diversidad genética del parásito y su transmisibilidad vectorial no está completamente entendida, pues se ha mostrado que las poblaciones de T. cruzi y T. rangeli difieren en su habilidad para sobrevivir, multiplicarse y diferenciarse en el insecto vector. También se ha mostrado que en una misma área geográfica existen diferencias significativas entre la proporción de genotipos de T. cruzi y T. rangeli detectados en los vectores y en los mamíferos. Estas diferencias podrían explicarse por la transmisión selectiva de algunos genotipos por parte de los vectores locales, que actuarían como filtros biológicos del parásito. Se ha demostrado que en Colombia R. colombiensis

Figura 4. Fenograma generado por UPGMA basado en los perfiles de RAPD de 12 cepas de Trypanosoma rangeli aisladas de Rhodnius prolixus (Rpro), R. pallescens (Rpall), R. colombiensis (Rcol) y R. ecuadoriensis (Recu) . Los números de la escala horizontal fueron derivados de la distancia calculada con el programa RAPDPLOT.

115

Vallejo G.A., Guhl F., Carranza J.C. et al

Biomédica 2007;27(supl. 1):110-8

puede infectarse con T. rangeli KP1(-) y KP1(+), pero sólo transmite a KP1(-) a través de la picadura y que R. prolixus se infecta con T. rangeli KP1(-) y KP1(+), pero solo transmite por picadura a la subpoblación KP1(+) (17,18). Estos resultados demuestran que R. prolixus es susceptible a la infección de T. rangeli KP1(+), pero presenta una respuesta refractaria a la invasión de cepas de T. rangeli KP1(-) aisladas de R. pallescens, R. colombiensis y R. ecuadoriensis. El comportamiento diferencial en la transmisión de estas dos subpoblaciones se relaciona con la activación de la respuesta inmune del vector, en la que factores intrínsecos como la producción de hemocitos, nódulos y factores tripanolíticos limitan la infección parasitaria (25). Recientemente se detectó en la hemolinfa de R. prolixus un factor tripanolítico contra las cepas de T. rangeli KP1(-) que corresponde a una proteína termolábil, la cual sería un factor inmunológico para que R. prolixus actúe como filtro biológico de subpoblaciones de T. rangeli KP1(-) (datos no publicados). En el presente trabajo se detectó un elevado polimorfismo de los tripomastigotes sanguíneos medidos en el quinto día posinoculación. El tamaño promedio de las cepas varió entre 32 y 39 µm, mostrando en general la existencia de grupos discretos (figura 1). Es interesante el hecho de que tres cepas aisladas de R. pallescens mostraron siempre tamaños promedios muy cercanos a los 40 µm (datos no mostrados), mientras que las cepas asiladas de R. colombiensis, R. ecuadoriensis y R. prolixus mostraron tamaños variables entre 32 y 39 µm. Esta observación sugiere la existencia de por lo menos dos grupos morfológicos de T. rangeli. Por otro lado, estos polimorfismos podrían ser el resultado de la transmisión selectiva de subpoblaciones del parásito, de manera que en las glándulas salivares del vector se desarrollaría cada vez una subpoblación con características morfológicas diferentes. Dentro de una misma especie de tripanosoma pueden encontrarse variaciones morfológicas significativas que pueden conducir a la separación de una misma especie en dos o más especies diferentes (21). Varios autores han señalado pleomorfismos o variaciones morfológicas de T.

rangeli cuando se infectan diferentes vertebrados con un mismo aislamiento. El pleomorfismo de los tripomastigotes sanguíneos detectado en el presente trabajo en ratón, Didelphis y perro al tercer día posinoculación revela que la longitud total de estas formas de T. rangeli sería dependiente del vertebrado en el cual se examina (figura 2). Estos resultados preliminares indican que probablemente el vertebrado también selecciona diferentes subpoblaciones del parásito, o que la morfología de T. rangeli sería dependiente de la respuesta inmune del hospedero vertebrado. El hallazgo de este carácter pleomorfico en T. rangeli podría contribuir a aclarar la posición taxonómica de los tripanosomas semejantes a T. rangeli, tales como T. (H.) mesnilbrimontí, T. (H.) preguici, T. (H.) myrmecophague, T. (H.) mycetae, T. (H.) diasi, T, (H.) cebus, T. (H.) saimiri, y T. (H.) advieri, entre otros, pues como se sabe, estos parásitos fueron clasificados como especies diferentes con base en diferencias de tamaño al ser comparados con cepas de T. rangeli aisladas de R. prolixus.
Los resultados de la caracterización molecular preliminar mediante RAPD de las cepas de T. rangeli (figura 4) muestran una clara divergencia entre el grupo de cepas KP1(+) y KP1(-), indicando la existencia de cuatro grupos de T. rangeli genéticamente divergentes y asociados con R. prolixus, R. pallescens, R. colombiensis y R. ecuadoriensis. Estos grupos difieren de los cuatro grupos de T. rangeli previamente detectados por Maia da Silva et al. (26), quienes utilizando análisis de RAPD encontraron un grupo formado por cepas de T. rangeli de Colombia, Venezuela, Honduras, la Isla de Marajó, Pará y Rondonia en Brasil, un segundo grupo formado por las cepas aisladas en Acre y Pará (Brasil), un tercer grupo formado por cepas aisladas en Panamá y el Salvador y un cuarto grupo formado por la cepa SC58 aislada en Santa Catarina (Brasil). Los resultados del presente trabajo, en conjunto con los de otros autores (26), indican que T. rangeli está formado por varios grupos genéticamente divergentes, probablemente asociados a diferentes especies de Rhodnius. Posteriores estudios filogenéticos en el grupo de cepas KP1(-), utilizando otros marcadores moleculares, podrían indicar si estas

116

Biomédica 2007;27(supl. 1):110-8

Interacción tripanosoma-vector-vertebrado

cepas evolucionaron de norte a sur en el mismo sentido que se propone la evolución del cline conformado por las especies de vectores del grupo “pallescens”. Por otro lado, los estudios filogenéticos en el grupo de T. rangeli KP1(+) podrían arrojar información sobre la evolución de los parásitos y sus vectores. Las distancias genéticas de Nei observadas por medio del análisis de isoenzimas en especies diferentes de un mismo género varían entre 0,162 y 0,3 en la mayoría de las especies (27). Las distancias obtenidas entre las subpoblaciones de T.rangeli en el presente trabajo (figura 5) indicaron que los grupos más próximos constituídos por las cepas aisladas de R. pallescens y R. colombiensis presentaron una distancia genética de Nei de 0,11110; sin embargo, las cepas aisladas de R. ecuadoriensis presentaron una distancia genética de 0,19955 con relación al grupo R.pallescens-R. colombiensis; por otro lado, el cálculo de la distancia genética de Nei entre poblaciones de T. rangeli con el empleo de RAPDIST mostró que las distancias entre T. rangeli KP1(-) y T. rangeli KP1(+) fueron de 0,30435, lo cual indica una gran divergencia genética entre estos dos grupos, semejante a la observada en especies diferentes de otros organismos (27). Los resultados de la presente investigación señalan que la interacción T. rangeli-vector es un importante modelo, en el cual cada vector del género Rhodnius transmite subpoblaciones del parásito fenotípica y genotípicamente divergentes y que, por lo tanto, los vectores actuarían como filtros biológicos de dichas subpoblaciones. Es posible que ocurran fenómenos semejantes en la transmisión del agente causal de la enfermedad de Chagas, pues recientemente se han descrito seis subpoblaciones de T. cruzi (T. cruzi I, T. cruzi IIa, IIb, IIc, IId y IIe) (28,29), que interactúan con más de 100 especies de triatominos en diferentes regiones de América Latina. Conflicto de intereses Los autores del presente artículo declaramos que no teníamos conflictos de intereses de orden académico, institucional u operacional en el momento de realización de la investigación.

Financiación El presente trabajo recibió financiación de las siguientes instituciones: Instituto Colombiano "Francisco José de Caldas" (Colciencias), proyecto 1105-05-16919; Chagas Disease Intervention Activities-European Community (CDIAEC), contrato No. ICA4-CT-2003-10049; SSA-EC: Trypanosomiasis Update y Fondo de Investigaciones de la Universidad del Tolima. Referencias
1. Marinkelle CJ. Pathogenicity of Trypanosoma rangeli for Rhodnius prolixus Stal in nature. J Med Entomol 1968;5:497-9. 2. Watkins R. Trypanosoma rangeli: effect on excretion in Rhodnius prolixus. J Invertebr Pathol 1971;17:67-71. 3. Watkins R. Histology of Rhodnius prolixus infected with Trypanosoma rangeli . J Invertebr Pathol 1971;17:59-66. 4. D’Alessandro-Bacigalupo A, Gore-Saravia N. Trypanosoma rangeli. En: Kreier JP, editor. Parasitic protozoa. London: Academic Press; 1992.p.1-54. 5. D’Alessandro-Bacigalupo A, Gore-Saravia N. Trypanosoma rangeli. En: Gilles HM, editor. Protozoal diseases. Oxford: Oxford University Press; 1999. p.398-412. 6. GuhI F, Hudson L, Marinkelle CJ, Morgan S, Jaramillo C. Antibody response to experimental Trypanosoma rangeli infection and its implications for immunodiagnosis of South American trypanosomiasis. Acta Trop 1985;42:311-8. 7. Guhl F, Hudson L, Marinkelle CJ, Jaramillo CA, Bridge D. Clinical Trypanosoma rangeli infection as a complication of Chagas’ disease. Parasitology 1987;94:475-84. 8. Guhl F, Vallejo GA. Trypanosoma (Herpetosoma) rangeli Tejera, 1920: an updated review. Mem Inst Oswaldo Cruz 2003;98:435-42. 9. Urrea DA, Carranza JC, Cuba CA, GurgelGonçalves R, Guhl F, Schofield CJ, et al. Molecular characterisation of Trypanosoma rangeli strains isolated from Rhodnius ecuadoriensis in Peru, R. colombiensis in Colombia and R. pallescens in Panama, supports a co-evolutionary association between parasites and vectors. Infect Genet Evol 2005;5:123-9. 10. Vallejo GA, Marinkelle CJ, Guhl F, De Sánchez N. Comportamiento de la infección y diferenciación morfológica entre Trypanosoma cruzi y T. rangeli en el intestino del vector Rhodnius prolixus. Rev Bras Biol 1988;48:577-87.

117

Vallejo G.A., Guhl F., Carranza J.C. et al

Biomédica 2007;27(supl. 1):110-8

11. Guhl F, Jaramillo C, Carranza JC, Vallejo GA. Molecular characterization and diagnosis of Trypanosoma cruzi and T. rangeli. Arch Med Res 2002;33:362-70. 12. Macedo AM, Vallejo GA, Chiari E, Pena SD. DNA fingerprinting reveals relationships between strains of Trypanosoma rangeli and Trypanosoma cruzi. En: Pena SD, Chakraborty R, Epplen JT, Jeffreys AJ, editors. DNA fingerprinting: state of the Science . Basel, Switzerland: Birkhauser Verlag: 1993. p.321-9. 13. Vallejo GA, Macedo AM, Chiari E, Pena SD. Kinetoplast DNA from Trypanosoma rangeli contains two distinct classes of minicircle with different size and molecular organization. Mol Biochem Parasitol 1994;67:245-53. 14. Steindel M, Dias-Neto E, Pinto CJ, Grisard E, Menezes C, Murta SM, et al . Randomly amplified polymorphic DNA (RAPD) and isoenzyme analysis of Trypanosoma rangeli strains. J Eukaryot Microbiol 1994;41:261-7. 15. Toaldo CB, Steindel M, Sousa MA, Tavares CC. Molecular karyotype and chromosomal localization of genes encoding 0-tubulina, cisteina proteinase, HSP 70 and actin in Trypanosoma rangeli. Mem Inst Oswaldo Cruz 2001;96:113-21. 16. Vallejo GA, Guhl F, Chiari E, Macedo AM. Specie specific detection of Trypanosoma cruzi and Trypansoma rangeli in vector and mammalian hosts by polymerase chain reaction amplification of kinetoplast minicircle DNA. Acta Trop 1999;72:203-12. 17. Vallejo GA, Guhl F, Carranza JC, Lozano LE, Sánchez JL, Jaramillo JC, et al. kDNA markers define two major Trypanosoma rangeli lineages in Latin America. Acta Trop 2002;81:77-82. 18. Vallejo GA, Guhl F, Carranza JC, Moreno J, Triana O, Grisard EC. Parity between kinetoplast DNA and miniexon gene sequences supports either clonal evolution or speciation in Trypanosoma rangeli strains isolated from Rhodnius colombiensis, R. pallescens and R. prolixus in Colombia. Infect Genet Evol 2003;3:39-45. 19. Grisard EC, Campbell DA, Romanha AJ. Mini-exon gene sequence polymorphism among Trypanosoma rangeli strains isolated from distinct geographical regions. Parasitology 1999;118:375-82. 20. Hoare CA. Herpetosoma from man and other mammals. En: The trypanosomes of mammals: a zoological

monograph. Oxford: Blackwell Scientific Publications; 1972.p.288-314 21. Ziccardi M, Lourenco-de-Oliveira R. Polymorphism in trypomastigotes of Trypanosoma (Megatrypanum ) minasense in the blood of experimentally infected squirrel monkey and marmosets. Mem Inst Oswaldo Cruz 1999;94:649-53. 22. Sanguinetti CJ, Dias-Neto E, Simpson AJ. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechniques 1994;17:914-21. 23. Black WC. Statistical analysis of arbitrarily primed PCR patterns in molecular taxonomic studies. En: Clap CL, editor. Methods in molecular biology. Species diagnostics protocols: PCR and other nucleic acid methods. Vol. 50. Totowa, NJ: Humana Press; 1995. p.39-55. 24. Nei M. Estimation of average heterozygocity and genetic distance from a small number of individuals. Genetics 1978;89:583-90. 25. Sánchez IP, Pulido XC, Carranza JC, Triana O, Vallejo GA. Inmunidad natural de Rhodnius prolixus (Hemiptera: Reduviidae: Triatominae) frente a la infección con Trypanosoma ( Herpetosoma ) rangeli KP1(-) aislados de Rhodnius pallescens , R. colombiensis y R. ecuadoriensis . Revista de la Asociación Colombiana de Ciencias Biológicas 2005;17:108-18. 26. Maia da Silva F, Rodrigues AC, Campaner M, Takata CS, Brigido MC, Junqueira AC, et al . Randomly amplified polymorphic DNA analysis of Trypanosoma rangeli and allied species from human, monkeys and other sylvatic mammals of the Brazilian Amazon disclosed a new group and a species-specific marker. Parasitology 2004;128:283-94. 27. Thorpe JP, Solé-Cava AM. The use of allozyme electrophoresis in invertebrate systematics. Zool Scr 1994;23:3-18 28. Brisse S, Barnabé C, Tibayrenc M. Identification of six Trypanosoma cruzi phylogenetic lineages by random amplified polymorphic DNA and multilocus enzyme electrophoresis. Int J Parasitol 2000;30:35-44. 29. Brisse S, Verhoef J, Tibayrenc M. Characterization of large and small subunit rRNA and mini-exon genes further supports the distinction of six Trypanosoma cruzi lineages. Int J Parasitol 2001;31:1218-26.

118

Biomédica 2007;27(supl. 1):119-29

Ciclo de vida de Rhodnius colombiensis y R. prolixus

ARTÍCULO ORIGINAL

Comparación del ciclo de vida de Rhodnius colombiensis Moreno, Jurberg & Galvão, 1999 y Rhodnius prolixus Stal, 1872 (Hemiptera, Reduviidae, Triatominae) en condiciones de laboratorio
Andrea Arévalo 1, Julio César Carranza 1, Felipe Guhl 2, Jairo Alfonso Clavijo 3, Gustavo Adolfo Vallejo 1
1

2

3

Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia. Centro de Investigaciones en Microbiología y Parasitología Tropical, Universidad de los Andes, Bogotá D.C., Colombia. Departamento de Matemáticas y Estadística, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia.

Introducción. Rhodnius colombiensis es un triatomino silvestre asociado a palmas de vino (Attalea butyracea) en la cuenca alta del río Magdalena (Colombia). La frecuente invasión de estos vectores al domicilio y las elevadas prevalencias de Trypanosoma cruzi en infecciones naturales constituyen un riesgo en la transmisión de la enfermedad de Chagas. Objetivo. Comparar la duración del ciclo de vida de R. colombiensis y R. prolixus en condiciones de laboratorio. Materiales y métodos. Se utilizaron 92 insectos de cada especie. Se estudió la duración de cada estadio, el número de comidas por estadio, el porcentaje de mortalidad, la causa de muerte, el promedio de huevos puestos por cada hembra, el número de huevos fértiles y la longevidad de los adultos. Resultados. Los promedios de duración de todos los estadios de desarrollo de R. colombiensis fueron mayores que en R. prolixus , presentando diferencias significativas en el tiempo transcurrido desde huevo hasta adulto. Los promedios de huevos puestos y huevos fértiles, presentaron diferencias significativas, siendo mayores en R. prolixus que en R. colombiensis. El porcentaje total de mortalidad de R. colombiensis fue de 31,5% y de 6,5% para R. prolixus. La longevidad en las hembras fue mayor en R. prolixus. Conclusiones. Los estadios de R. prolixus tienen menor duración, las ninfas en general realizan menor número de comidas que R. colombiensis , los adultos de R. prolixus toman mayor número de comidas y ovipositan mayor número de huevos fértiles, presentando hembras con mayor longevidad. Todos estos parámetros indican que R. prolixus presenta mejor éxito reproductivo que R. colombiensis, en las condiciones experimentales utilizadas. Los datos inéditos sobre el ciclo de vida de R. colombiensis serán de utilidad para el mantenimiento de las colonias en el laboratorio. Palabras clave: Rhodnius, etapas del ciclo de vida, longevidad, tasa de mortalidad. Comparison of the life cycles of Rhodnius colombiensis Moreno, Jurberg & Galvão, 1999 and R. prolixus Stal, 1872 (Hemiptera, Reduviidae, Triatominae) under laboratory conditions Introduction. Rhodnius colombiensis is a sylvatic triatomine associated with wine palm trees (Attalea butyracea) in the high basin of the Magdalena river (Colombia). The frequent invasion of these vectors into human dwellings and the high prevalences of natural infection with Trypanosoma cruzi of these insects suggest an important role in the transmission of Chagas disease. Objective. The length of the life cycles of R. colombiensis and R. prolixus under laboratory conditions were compared.

119

Arévalo A., Carranza J.C., Guhl F. et al

Biomédica 2007;27(supl. 1):119-29

Materials and methods. Ninety-two individuals for each species were studied. The mean duration time of each stage, the number of bloodmeals for each stage, the percentage of mortality, the cause of death, the mean of eggs laid by female, the number of fertile eggs and the longevity of adults were recorded. Results. The mean duration time of all stages of R. colombiensis was higher than in R. prolixus, producing significant differences in the overall time from egg to adult. The mean of total eggs and fertile eggs showed significant differences, being higher in R. prolixus than in R. colombiensis. The total mortality was 31.5% for R. colombiensis and 6.5% for R. prolixus. The longevity of females was higher in R. prolixus. Conclusions. The stages of R. prolixus are of relatively short duration. In general, the nymphs take fewer bloodmeals than R. colombiensis, the adults take more bloodmeals and oviposit a larger number of fertile eggs, and females have a greater longevity. These parameters indicated that R. prolixus has superior reproductive success in comparison with R. colombiensis under the experimental conditions used. These new life cycle data of R. colombiensis will be useful for maintenance of laboratory colonies. Key words: Rhodnius, life cycle stages, longevity, mortality rate.

Como consecuencia del aumento de la urbanización y la extensión de cultivos, durante las últimas décadas se han presentado intervenciones humanas en ecotopos naturales de los triatominos silvestres y los reservorios de Trypanosoma cruzi, lo cual ha favorecido la interacción de estas especies con el ciclo peridoméstico y doméstico de la enfermedad de Chagas (1,2). Por otro lado, los cambios climáticos pueden ocasionar modificaciones en la distribución geográfica de las especies e incremento en el número de comidas, lo cual implicaría un aumento en la probabilidad de infección y transmisión, una aceleración del ciclo biológico y un aumento de la densidad poblacional en los ciclos de transmisión (3).

Rhodnius colombiensis es una especie silvestre distribuida en la cuenca alta del río Magdalena, la cual incluye los departamentos de Cundinamarca, Tolima y Huila, en donde se encuentra asociada con palmas de vino ( Attalea butyracea ) en simpatría con R. prolixus domiciliado en esta misma región. El hábitat natural de R. colombiensis en algunos municipios del departamento del Tolima se ha intervenido sistemáticamente y se
Correspondencia: Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, A.A. 546, Ibagué, Colombia. Telefax (+57-8) 2669176. gvallejo@ut.edu.co Recibido: 23/03/06; aceptado: 08/09/06

ha sustituido por cultivos de cachaco (Musa balbisiana ). Estas actividades antrópicas al parecer han favorecido la adaptación de los insectos a ecotopos cercanos a las viviendas humanas (Vallejo GA, Lozano LE, Carranza JC, Sánchez JL, Jaramillo JC, Guhl F, et al. Ecología de los triatominos no domiciliados en Colombia con especial referencia a Rhodnius colombiensis en el departamento del Tolima. En: Vallejo GA, Carranza JC y Jaramillo JC editores. Curso Taller Internacional: Biología, Epidemiología y Control de la Tripanosomosis Americana y Leishmaniosis. Ibagué, Colombia 2000. p. 1-134). Por otro lado, se han encontrado ninfas de cuarto y quinto estadio, hembras y machos de R. colombiensis en viviendas y construcciones peridomiciliares de 14 municipios del departamento del Tolima, constituyendo un indicio de la invasión esporádica de esta especie al peridomicilio y domicilio humano (datos no publicados). De manera semejante, otras especies consideradas exclusivamente silvestres se han encontrado en infestaciones domiciliares y peridomiciliares, como es el caso de Panstrongylus geniculatus en el estado de Lara en Venezuela y en la cuenca del Amazonas en Brasil (4,5). En el departamento del Tolima también se han observado en R. colombiensis preva-lencias de T. cruzi y T. rangeli del 45 y 28,6%, respectivamente (datos no publicados), situación que configura un riesgo para la transmisión de T. cruzi por parte de este vector. El éxito de las estrategias de vigilancia y control de los triatominos no domiciliados en Colombia y

120

Biomédica 2007;27(supl. 1):119-29

Ciclo de vida de Rhodnius colombiensis y R. prolixus

en América Latina depende en parte del conocimiento de su biología, de su evolución y genética, puesto que estas especies constituyen un riesgo potencial en el desarrollo de procesos de domiciliación. Por este motivo, en el presente trabajo se describe el ciclo de vida de R. colombiensis, la mortalidad, el número de comidas de cada estadio de desarrollo y el número de huevos puestos por las hembras durante su vida, y se compara en las mismas condiciones experimentales con el ciclo de vida de R. prolixus, principal vector domiciliado en Colombia. Adicionalmente, los resultados inéditos de la bionomía de R. colombiensis serán de utilidad para el mantenimiento de las colonias en el laboratorio. Materiales y métodos Los especímenes de R. colombiensis se capturaron en palmas de Attalea butyracea y los de R. prolixus en domicilios humanos en el municipio de Coyaima, departamento del Tolima, Colombia. Las colonias de ambas especies se mantuvieron a 28 ± 1°C, 75 a 80% de humedad relativa y fotoperiodicidad de 12/12 horas en una incubadora automática B.O.D. Lab-Line. Los triatominos fueron alimentados con sangre de gallina semanalmente. Treinta y seis hembras y doce machos de cada especie se emplearon para obtener la descendencia con la cual se efectuó el estudio del ciclo de vida. Los huevos se colocaron individualmente en recipientes transparentes de 5 cm de altura y 3 cm de diámetro. Se estudió el desarrollo de 92 insectos de cada especie. A las N1 se les ofreció sangre de gallina diariamente hasta su primera comida y luego se les alimentó semanalmente con la misma fuente. Se revisaron diariamente para determinar la duración de cada estadio, y así mismo se determinó la mortalidad por estadio y la causa de muerte.

insectos. Para cada individuo se verificó el número de comidas necesarias para mudar de un estadio a otro. De los 92 R. prolixus estudiados, 86 alcanzaron el estadio adulto y de ellos se seleccionaron aleatoriamente 60 individuos para el análisis estadístico.

Promedio de huevos e índice de fertilidad
Se establecieron 32 matrimonios con adultos vírgenes de cada especie. Diariamente, y hasta la muerte de las hembras, se contabilizaron los huevos y se calculó el promedio de los índices de ovipostura, establecidos como la relación entre el número de huevos puestos por cada hembra durante el período de vida. También se calculó el promedio de los índices de fertilidad, o sea, la relación entre el número de huevos fértiles y el número total de huevos puestos por cada hembra.

Análisis estadístico
En cada una de las variables del estudio se hicieron estimaciones de medias con los respectivos intervalos de 95% de confianza. Se utilizó una técnica de análisis multivariado de varianza (MANOVA) para comparar los promedios de las diferentes variables entre las dos especies en cada uno de los estadios de desarrollo. Los softwares utilizados fueron STATISTICA V. 4,5 y ESM PLUS V. 8.2,0. Resultados

Duración del ciclo de vida
La duración desde huevo hasta adulto en R. colombiensis fue de 144,4 días con un mínimo de 96 y máximo de 268 días. Por otro lado, la duración del ciclo de vida de R. prolixus fue de 117,7 días en promedio, con un mínimo de 73 y máximo de 206 días. El tiempo promedio de incubación de los huevos de R. colombiensis fue de 16,2 días, mientras que el de R. prolixus fue de 15,4 días (cuadro 1). El tiempo de duración para cada uno de los estadios de desarrollo de R. colombiensis fue de 14,9 días para N1-N2, 18,5 días para N2-N3, 32,9 días para N3-N4, 29,4 días para N4-N5 y 32,5 días para el N5-adulto. Por su parte, los estadios de desarrollo de R. prolixus tuvieron un tiempo promedio de duración de 12,4 días para N1-N2,

Número de comidas en cada estadio de desarrollo
De los 92 R. colombiensis estudiados, 63 de ellos alcanzaron el estadio adulto, sin embargo, tres de ellos no realizaron ninguna comida durante su fase adulta y murieron por inanición, lo que explica que en los análisis estadísticos se utilizaran 60

121

Arévalo A., Carranza J.C., Guhl F. et al

Biomédica 2007;27(supl. 1):119-29

15,3 días para N2-N3, 19,8 días para N3-N4, 25,1 días para N4-N5 y 29,7 días para el N5-adulto. Todos los estadios mostraron diferencias significativas entre R. colombiensis y R. prolixus (figura 1). Las N1 de R. colombiensis demoraron en promedio 5,6 días, con un mínimo de 2 y un máximo de 13, para la toma de su primer alimento, mientras que las N1 de R. prolixus necesitaron 4,2 días en promedio, con un mínimo de 3 y un máximo de 8.

adulto. Para R. prolixus, el número promedio de comidas fue de 1,3 para N1; 1,9 para N2; 2,3 para N3; 2,9 para N4; 3,2 para N5, y 28,1 para el adulto (cuadro 2). Los promedios del número de comidas para los estadios N1, N3, N4 y adulto de ambas especies presentaron diferencias significativas. A excepción de los adultos, cada uno de los estadios de R. colombiensis presentó un mayor número promedio de comidas que los de R. prolixus (figura 2). Longevidad, fertilidad y mortalidad La longevidad del adulto de R. colombiensis presentó un promedio de 194,6 días, con un mínimo de 24 y máximo de 357. Para R. prolixus

Número de comidas por estadio
El promedio del número de comidas por estadio de R. colombiensis fue de 1,8 para N1; 2,1 para N2; 3,7 para N3; 3,4 para N4 y N5, y 19,9 para el

Cuadro 1. Ciclo de vida de 60 R. colombiensis y 60 R. prolixus desde huevo hasta adulto expresado en días. Desviación estándar (S) y varianza (S2). El nivel de significación es de 0,05. Las diferencias fueron significativas cuando p < 0,05. Especie Estadios H-N1 N1-N2 N2-N3 N3-N4 N4-N5 N5-adulto Total

R. colombiensis
Mínimo Máximo Promedio 15 11 11 17 17 25 96 19 22 41 67 59 60 268 16,2 14,9 18,5 32,9 29,4 32,5 144,4 S 0,7 3,1 4,4 13,4 9,9 6,3 S
2

R. prolixus
Mínimo Máximo Promedio 12 10 10 11 7 23 73 16 23 33 34 50 50 206 15,4 12,4 15,3 19,8 25,1 29,7 117,7 S 0,7 2,5 4,4 4,2 8,6 5,2 -

Comparaciones S2 0,5 6,2 19,8 17,9 74,2 27,6 Valor p 0,00000 0,00002 0,00042 0,00000 0,01096 0,00908 -

0,4 9,3 19,5 178,6 97,3 40,4 -

Figura 1. Comparación entre las medias del tiempo (días) de eclosión A (huevo-N1) y de muda de cada estadio de desarrollo (B: N1-N2, C: N2-N3, D: N3-N4, E: N4-N5 y F: N5-adulto) con sus respectivos intervalos de confianza de 95% para Rhodnius colombiensis y Rhodnius prolixus.

122

Biomédica 2007;27(supl. 1):119-29

Ciclo de vida de Rhodnius colombiensis y R. prolixus

Cuadro 2. Número de comidas de 60 R. colombiensis y 60 R. prolixus durante el ciclo de vida. Desviación estándar (S) y varianza (S2). El nivel de significancia es de 0,05. Las diferencias fueron significativas cuando p < 0,05. Especie Estadios N1 N2 N3 N4 N5 Adulto Total Mínimo 1 1 2 2 2 3 11

R. colombiensis
Máximo Promedio 3 5 8 8 6 44 74 1,8 2,1 3,7 3,4 3,4 19,9 34,3 S 0,6 0,6 1,8 1,4 0,7 8,1 S
2

R. prolixus
Mínimo Máximo Promedio 1 1 1 1 2 15 21 3 4 4 6 5 39 61 1,3 1,9 2,3 2,9 3,2 28,1 39,7 S 0,5 0,7 0,6 1,1 0,6 5,9 S
2

Comparaciones Valor p 0,00000 0,08032 0,00000 0,01746 0,12078 0,00000 -

0,3 0,3 3,1 2 0,5 65,9 -

0,2 0,5 0,3 1,1 0,3 35,1 -

Figura 2. Comparación entre las medias del número de comidas y los intervalos de confianza de 95% para cada uno de los estadios de desarrollo (A: N1, B: N2, C: N3, D: N4, E: N5, F: adulto) para R. colombiensis y R. prolixus.

el período de longevidad fue de 226,4 días, con un mínimo de 136 y máximo de 318, dándose diferencias significativas entre las dos especies. Se observó que el promedio de huevos ovipositados por R. colombiensis fue de 214,5, con un mínimo de 82 y máximo de 408, en un período de vida promedio de las hembras de 187,3 días (rango 101 a 357 días). Para R. prolixus el promedio de huevos fue de 574,1, con mínimo de 259 y máximo de 1.083, en un período de vida promedio de las hembras de 222,7 días (rango 136 a 287 días). El promedio de huevos fértiles para R. colombiensis fue de 183,6 (rango 41 a 332) y para R. prolixus fue de 514,1 (rango 250 a 903). Además, el promedio de huevos no fértiles

para R. colombiensis fue de 30,9 (rango 0 a 105) y de 59,9 (rango 0 a 202) para R. prolixus. El promedio del índice de ovipostura para R. colombiensis fue de 1,1 y para R. prolixus de 2,6. Por otro lado, el promedio del índice de fertilidad para R. colombiensis fue de 0,8 y de 0,9 para R. prolixus (cuadro 3). De los 92 insectos de R. colombiensis observados, 29 murieron sin completar el ciclo de vida (31,5%), presentándose el mayor porcentaje de mortalidad en el estadio N3 a N4 (18,2%), seguido por el estadio N5 a adulto, con 7,3%. En el estadio N1 a N2, ningún individuo murió. De los 92 insectos observados en R. prolixus, 6 (6,5%) murieron sin completar el ciclo de vida. En este caso, el mayor

123

Arévalo A., Carranza J.C., Guhl F. et al

Biomédica 2007;27(supl. 1):119-29

Cuadro 3. Promedio de huevos puestos; promedio de huevos fértiles y no fértiles; promedio del índice de ovipostura; fertilidad y promedio de longevidad de las hembras de R. colombiensis y R. prolixus. El nivel de significación es de 0,05. Especies Variables Promedios Huevos puestos Huevos fértiles Huevos no fértiles Índice de oviposturaa Índice de fertilidadb Longevidad de las hembrasc
a

R. colombiensis

R. prolixus

Valores p

214,5 183,6 30,9 1,1 0,8 187,3

574,1 514,1 59,9 2,6 0,9 222,7

0,00000 0,00000 0,01532 0,00000 0,09122 0,00342

Indice de ovipostura = __Número de huevos ovipositados por hembra_ Número de días de cada hembra (longevidad) b Indice de fertilidad = __Número de huevos fértiles por hembra__ Total de huevos ovipositados por hembra c Longevidad de las hembras = número de días

porcentaje de mortalidad lo presentó el quinto estadio ninfal con 4,4%. En los estadios N1 a N2 y N3 a N4 ningún individuo murió. De los 29 R. colombiensis muertos, el 83% murió atrapado en la exuvia o realizó ecdisis defectuosas, y el 17,2% murió por presentar problemas en la toma de alimento. De los seis R. prolixus muertos, el 33,3% murió por presentar problemas en la toma de alimento y el 66,7% atrapado en la exuvia o realizó ecdisis defectuosas. Discusión La presencia de T. cruzi en vectores, reservorios silvestres y en humanos se viene reportando en el departamento del Tolima desde la década de 1930 (6-8). Recientes estudios de serología en bancos de sangre mostraron en el departamento del Tolima una serorreactividad contra T. cruzi de 0,69% (9). Por otro lado, el 67% de las muestras de sangre de habitantes del municipio de Coyaima seropositivos para infección chagásica presentó PCR positivo para T. cruzi (Sánchez JL, Carranza JC, Vallejo GA, Lozano LE, Jaramillo JC, Guhl F. Diagnóstico molecular de Trypanosoma cruzi en reservorios y humanos en una área endémica del departamento del Tolima (Colombia). En: Vallejo GA, Carranza JC y Jaramillo JC editores. Curso Taller Internacional: Biología, Epidemiología y Control de la Tripanosomosis Americana y Leishmaniosis. Ibagué, Colombia 2000. p.1-134). R. colombiensis es una especie silvestre descrita

en 1999 (10); en el departamento del Tolima se encuentra en simpatría con R. prolixus domiciliado. Por tratarse de un especie silvestre, R. colombiensis se ha estudiado poco y los conocimientos sobre su biología son escasos. El hallazgo de ninfas de cuarto y quinto estadio, machos y hembras de R. colombiensis en el interior de viviendas humanas indicaría el inicio de su domiciliación, tal como se ha reportado para R. neivai, una especie silvestre limitada a zonas áridas de la región central y occidental de Venezuela y del norte de Colombia, en donde se han encontrado grupos de ninfas y adultos en las viviendas humanas (11,12). Los estudios sobre el ciclo de vida y comportamiento de R. colombiensis podrían contribuír a evaluar el riesgo de adaptación de esta especie al peridomicilio e intradomicilio y su potencial como vector de T. cruzi en esta región de Colombia.

Ciclo de vida
Este es el primer trabajo en el que se obtuvo el promedio del ciclo de vida de R. colombiensis (144,4 días, mínimo de 96 y máximo de 268), el cual supera en 26,7 días el promedio de vida de Rhodnius prolixus (117,7 días, mínimo de 73 y máximo de 206). Estos resultados reflejan el mayor vigor de las colonias de R. prolixus comparadas con las colonias de R. colombiensis bajo las mismas condiciones de laboratorio. Se ha señalado que el desarrollo de los triatominos varía de acuerdo a las especies estudiadas y a

124

Biomédica 2007;27(supl. 1):119-29

Ciclo de vida de Rhodnius colombiensis y R. prolixus

las condiciones experimentales de temperatura, humedad relativa y fuente de alimento (13,14). En consecuencia, es difícil comparar los resultados sobre ciclos de vida existentes en la literatura, debido a las variaciones experimentales de cada trabajo. Por ejemplo, para algunas especies de Rhodnius se han reportado promedios de 102 y 120 días, como es el caso de R. ecuadoriensis (15); de 101, 127 y 209,4 días para R. nasutus (16,17); de 104, 131, 154,2 y 177,1 días para R. neglectus (18,19); de 181,2, 118, 86,7 y 68,9 días para R. neivai (20,21); de 212 y 126 días para R. pallescens (22); de 190,7, 278 y 118 días para R. pictipes (20,23,24); de 114, 140 y 118 días para R. prolixus (20,25), y de 114 y 135 días para R. robustus (26). En otros géneros de triatominos se han observado promedios de 196,8 y 189,5 días para Meccus picturatus (27); de 230,3 días para Triatoma flavida (28), y de 180,1 días para T. rubrovaria (29). Con relación a la variación del ciclo de vida ocasionada por las diferencias en las fuentes de alimento, varios autores han comparado los ciclos de vida de al menos siete especies de triatominos, encontrando que fueron más cortos cuando se alimentaron sobre mamíferos (ratones) que cuando se alimentaron sobre aves (gallinas, pollos o palomas) (30-35). Sin embargo, el ciclo de vida reportado en R. neivai alimentado sobre conejos fue más prolongado que el de la misma especie alimentada sobre gallinas (36). Por otro lado, no se observaron diferencias significativas en cohortes de Meccus picturatus alimentadas sobre gallinas o sobre conejos (27). Los resultados anteriores probablemente son el reflejo de asociaciones específicas entre los vectores y diferentes especies de mamíferos o de aves que constituyen su principal fuente de alimento en condiciones naturales. Se han señalado otros factores de importancia que influyen en la duración del ciclo de vida de los triatominos como la temperatura y la humedad. Se ha reportado que las temperaturas elevadas, independientemente de la humedad asociada, pueden acelerar el ciclo biológico de la especie; sin embargo, también pueden afectar la sobrevivencia de las colonias, impidiendo su mantenimiento en el laboratorio (37). Por otro lado,

se ha observado la existencia de rangos de temperaturas y de humedades relativas propicias para el óptimo desarrollo de los triatominos (38). Es posible que otras variables, como la competencia entre individuos por la toma del alimento, puedan influir sobre los resultados. Por esta razón, las condiciones experimentales utilizadas en el presente trabajo fueron optimizadas para evitar la competencia de individuos durante el ofrecimiento y la toma del alimento de manera que los resultados no fueran afectados.

Días para tomar el alimento por primera vez
Las ninfas de primer estadio de R. colombiensis emplean más tiempo (5,6 días en promedio, con mínimo de 2 días y máximo de 13) en tomar su alimento por primera vez que las ninfas de primer estadio de R. prolixus (4,2 días en promedio, con mínimo de 3 días y máximo de 8). Probablemente el proceso de esclerotización de las N1 de R. colombiensis sea más demorado, aunque se han reportado otros factores que podrían dificultar la realización de la primera comida, como la fragilidad del aparato bucal, la dificultad para alcanzar el hospedero y alcanzar un capilar (39). Se ha reportado que las ninfas de primer estadio de R. pictipes presentan un promedio de 4,7 días, con un mínimo de 3 y máximo de 7, para comer por primera vez (23), dato que se asemeja al observado en el presente trabajo para R. prolixus.

Número de comidas realizadas en cada estadio de desarrollo
El número de comidas realizadas por los triatominos es de gran importancia desde el punto de vista epidemiológico, ya que cuanto más contactos ocurran entre vectores y hospederos, mayor será la probabilidad de infección o transmisión de T. cruzi (30,37). Resulta de gran interés que los estadios ninfales de R. colombiensis necesitaran mayor promedio de comidas (entre 1,8 y 3,4) para realizar la muda que los mismos estadios de R. prolixus (entre 1,3 y 3,2). Por otro lado, los adultos de R. prolixus presentaron un promedio de 28,1 alimentaciones y los de R. colombiensis un promedio de 19,9 (figura 2). De acuerdo a lo anterior, las ninfas de R. colombiensis infectadas con T. cruzi presentarían mayor probabilidad de

125

Arévalo A., Carranza J.C., Guhl F. et al

Biomédica 2007;27(supl. 1):119-29

transmisión que las ninfas de R . prolixus infectadas con T. cruzi. De otra parte, los adultos de R. prolixus infectados con T. cruzi tendrían mayor probabilidad de transmisión que los adultos de R. colombiensis infectados con el parásito. Algunos trabajos realizados con diferentes especies de triatominos han mostrado variabilidad en el promedio de comidas tanto en ninfas como en adultos. Así por ejemplo, en R. brethesi (40) las ninfas presentaron un promedio del número de comidas relativamente bajo (entre 1,57 y 1,73) comparado con los resultados de R. colombiensis y R. prolixus en el presente trabajo. En otros trabajos se han observado promedios semejantes, como en el caso de R. pictipes alimentados sobre ratones o artificialmente con membrana de silicona con sangre de carnero, presentando un promedio de alimentaciones de 1 a 3,9 en los estadios ninfales, y en adultos hembras y machos (39). En Meccus picturatus las ninfas alimentadas con sangre de gallina o conejo no superaron las 2,3 comidas en promedio (27). En T. flavida las ninfas presentaron un número promedio que no superó las 3,7 comidas (28). Resulta interesante la observación de los adultos de R. brethesi, los cuales presentaron un promedio de 7,52, muy por debajo de los adultos de R. colombiensis y R. prolixus observados en el presente trabajo (40). Las diferencias observadas en el número de comidas de las ninfas reflejaría diferencias en la capacidad de asimilación del alimento para promover la muda y alcanzar el estado adulto. De igual manera, las diferencias observadas en el número de comidas del adulto reflejaría la variabilidad de la capacidad de las hembras para la oviposición.

trabajo, R. colombiensis presentó mayor mortalidad (31,5%) que R. prolixus (6,5%). Estudios realizados por otros autores sugieren que las diferentes tasas de mortalidad podrían estar determinadas por la especie de triatomino estudiada y por las condiciones experimentales utlilizadas. Por ejemplo, se han reportado mortalidades de 16,3% para R. brethesi (40); de 19,2% para R. domesticus (41); de 38 y 33% para R. pictipes (20,23), y de 16% para R. prolixus (42). En el presente trabajo se observó en R. prolixus un mayor número de insectos que completaron exitosamente su ciclo de vida, el 93,5% (86/92 insectos). En contraste, el 68,5% (63/92 insectos) de los R. colombiensis completaron su ciclo de desarrollo. En estudios previos se ha observado que las causas de mortalidad durante el ciclo de vida son las mudas defectuosas y los problemas en la toma de alimento (20,23,27,28,37,41). En el presente trabajo también se observaron estas causas de muerte, destacándose que para R. colombiensis la principal causa de mortalidad fue la incapacidad para la muda, pues el 83% (24/29) murió atrapado en la exuvia. Igualmente, se ha observado la incapacidad para la muda en el ciclo de R. robustus como la principal causa de muerte (37).

Promedio de huevos
El promedio de huevos ovipositados por R. colombiensis fue de 214,5, con un mínimo de 82 y máximo de 408, en un período de vida promedio de 187,3 días (rango 101 a 357 días). El promedio del índice de fertilidad fue de 0,8 para R. colombiensis. El promedio de huevos para R. prolixus fue de 574,1 huevos, con un mínimo de 259 y máximo de 1.083, en un período de vida promedio de 222,7 días (rango 136 a – 287 días). El promedio del índice de fertilidad fue de 0,9 para R. prolixus. Se ha observado en R. domesticus un promedio de huevos de 335 (rango de 173 a 469) en un promedio de vida de 328 ± 73 días (41), superior al observado en R. colombiensis, pero inferior al de R. prolixus. En los triatominos, la fuente de alimento es un factor importante en la tasa reproductiva y en el

Porcentaje de mortalidad
Al comparar los datos de mortalidad de algunos estudios, se observa una extensa variabilidad entre diferentes especies e incluso dentro de la misma especie. La mortalidad de R. colombiensis y de R. prolixus presentó un patrón irregular en el que las N1 de ambas especies no presentaron mortalidad, las N2 presentaron baja mortalidad y las N3 de R. colombiensis y las N5 de R. prolixus presentaron la mayor mortalidad. Otros autores también han reportado patrones irregulares de mortalidad en T. flavida (28). En el presente

126

Biomédica 2007;27(supl. 1):119-29

Ciclo de vida de Rhodnius colombiensis y R. prolixus

índice de fertilidad. Se ha planteado que la sangre de gallina presenta mayor cantidad de nutrientes que la sangre de mamífero (43) y que la digestión de la sangre de gallina es más rápida para la producción de huevos en los insectos que la de la sangre de mamífero (44,45). En el presente trabajo se utilizó sangre de gallina, sin embargo, los resultados mostraron menores tasas de oviposición y fertilidad en R. colombiensis que en R. prolixus alimentados con sangre de gallina. Es posible que R. colombiensis se encuentre más adaptado a una fuente de alimento constituída por mamíferos silvestres, ya que con frrecuencia está asociado a los nidos de Didelphis marsupialis. Probablemente en condiciones naturales esta fuente de proteínas permita un ciclo de vida más eficiente con mayores tasas de oviposición y mayores índices de fertilidad. Conclusiones La extrapolación de datos de laboratorio a las poblaciones naturales es relativamente fácil en triatominos domiciliados como en el caso de R. prolixus, debido a que en el domicilio todas las etapas del ciclo de vida ocurren en un ambiente relativamente uniforme. Para el caso de los triatominos silvestres, como es el caso de R. colombiensis , la extrapolación de datos de laboratorio a poblaciones naturales es más difícil porque las etapas del ciclo de vida pueden ocurrir en ambientes heterogéneos, con variaciones climáticas significativas durante el día y con diferentes fuentes de alimento. Aunque el éxito reproductivo de R. colombiensis fue menor que el de R. prolixus en las condiciones experimentales utilizadas en el presente trabajo, se ha comprobado que R. colombiensis en condiciones naturales presenta altas densidades de poblaciones en ecotopos formados por las brácteas de Attalea butyraceae, asociada con nidos de Didelphis marsupialis en donde se han registrado promedios hasta de 39,5 insectos/nido, lo que sugiere éxito reproductivo en estos ecotopos (Vallejo GA, Lozano LE, Carranza JC, Sánchez JL, Jaramillo JC, Guhl F, et al. Ecología de los triatominos no domiciliados en Colombia con especial referencia a Rhodnius colombiensis en el departamento del Tolima. En: Vallejo GA, Carranza JC y Jaramillo JC editores. Curso Taller Internacional: Biología,

Epidemiología y Control de la Tripanosomosis Americana y Leishmaniosis. Ibagué, Colombia 2000. p.1-134). A manera de hipótesis se podría plantear que si R. colombiensis, que posee un ciclo de vida más largo y con mayor número promedio de comidas que las ninfas de R. prolixus en condiciones de laboratorio, presentara también características biológicas semejantes en los nidos de las palmas, podría depender más del huésped vertebrado para su desarrollo hasta el estadio adulto, lo cual explicaría la eficiencia de R. colombiensis en la transmisión de T. cruzi y T. rangeli a sus reservorios naturales en la cuenca alta del río Magdalena. Por ello sería de gran importancia explorar esta hipótesis estudiando la duración del ciclo de vida de R. colombiensis y su comportamiento cuando se alimenta sobre mamíferos didélfidos. Finalmente, es importante destacar que el presente estudio aporta datos inéditos de la bionomía para el mantenimiento de R. colombiensis en condiciones de laboratorio. Agradecimientos Los autores agradecen el análisis crítico y las valiosas sugerencias aportadas por dos evaluadores anónimos, las cuales mejoraron el manuscrito original. Conflicto de intereses Los autores del presente artículo declaramos que no teníamos conflictos de intereses de orden académico, institucional u operacional en el momento de realización de la investigación. Financiación Este trabajo recibió financiación del Instituto Colombiano "Francisco José de Caldas" (Colciencias), proyecto 105-05-279-99, y del Fondo de Investigaciones de la Universidad del Tolima. También recibió apoyo internacional de la Red ECLAT (European Community – Latin-American Network for Research on the Biology and Control of Triatominae). Referencias
1. Luitgards-Moura JF, Borges-Pereira J, Costa J, Zauza PL, Rosa-Freitas MG. On the possibility of autochthonous Chagas disease in Roraima, Amazon region, Brazil, 2000-2001. Rev Inst Med Trop Sao Paulo 2005;47:45-54.

127

Arévalo A., Carranza J.C., Guhl F. et al

Biomédica 2007;27(supl. 1):119-29

2. Vasquez AM, Samudio FE, Saldaña A, Paz HM, Calzada JE. Eco-epidemiological aspects of Trypanosoma cruzi, Trypanosoma rangeli and their vector (Rhodnius pallescens) in Panama. Rev Inst Med Trop Sao Paulo 2004;46:217-22. 3. Carcavallo RU. Climatic factors related to Chagas disease transmission. Mem Inst Oswaldo Cruz 1999;94 (Suppl. 1):367-9. 4. Feliciangeli MD, Carrasco H, Patterson JS, Suarez B, Martínez C, Medina M. Mixed domestic infestation by Rhodnius prolixus Stal, 1859 and Panstrongylus geniculatus Latreille, 1811, vector incrimination, and seroprevalence for Trypanosoma cruzi among inhabitants in El Guamito, Lara State, Venezuela. Am J Trop Med Hyg 2004;71:501-5. 5. Valente VC, Valente SA, Noireau F, Carrasco HJ, Miles MA. Chagas disease in the Amazon Basin: association of Panstrongylus geniculatus (Hemiptera: Reduviidae) with domestic pigs. J Med Entomol 1998;35:99-103. 6. Uribe PC. Infección del Rhodnius prolixus Stahl por Trypanosoma cruzi y Trypanosoma rangeli. Clásicos del INS. Biomédica 1996;16:87-92. 7. Marinkelle CJ. Colombian triatominae and their infestation with trypanosomatid flagellates. Mitt-Inst Colombo-Aleman Invest Cient 1972;6:11-30. 8. Corredor A, Santacruz M, Paez S, Guatame LA. Distribución de los triatominos domiciliarios en Colombia. Bogotá D.E.: Ministerio de Salud, Instituto Nacional de Salud; 1990. p.144. 9. Beltrán M, Bermúdez MI, Forero MC, Ayala M, Rodríguez MJ. Control de la infección por Trypanosoma cruzi en donantes de sangre de Colombia, 2003. Biomédica 2005;25:527-32. 10. Mejía JM, Galvão C, Jurberg J. Rhodnius colombiensis sp. N da Colômbia com quadros comparativos entre estruturas fàlicas do gênero Rhodnius Stal, 1859 (Hemiptera, Reduviidae, Triatominae). Entomol Vet 1999;6: 601-17. 11. Zeledon R. Vectores de la enfermedad de Chagas y sus características ecofisiológicas. Interciencia 1983;8:384-95. 12. Cabello DR. Resistance to starvation of Rhodnius neivai Lent, 1953 (Hemiptera: Reduviidae: Triatominae) under experimental conditions. Mem Inst Oswaldo Cruz 2001;96:587-91. 13. Schofield CJ. Population dynamics and control of Tríatoma infestans. Ann Soc Belg Med Trop 1985;65 (Suppl. 1):149-64. 14. Zarate LG. The biology and behavior of Triatoma barberi (Hemiptera: Reduviidae) in México. III. Completion of the life cycle adult longevity, and egg production under optimal feeding conditions. J Med Entomol 1983; 20: 485-97.

15. Silva IG, Silva HH. Influência da temperatura na biologia de triatomíneos. XV. Rhodnius ecuadoriensis Lent e Léon,1958. Rev Goiana Med 1990;36:49-54. 16. da Silva IG, da Silva HH. The influence of temperature on the biology of triatomine. IX. Rhodnius nasutus Stal, 1859 (Hemipetera, Reduviidae). Mem Inst Oswaldo Cruz 1989;84:377-82. 17. Soares MJ, dos Santos Filho PN, Bento DN. The developmental cycle of Rhodnius nasutus Stal, 1859 studied in the laboratory. Rev Soc Bras Med Trop 1995;28:113-6. 18. Silva IG, Silva HH. Influência da temperatura na biologia de triatomíneos.II. Rhodnius neglectus Lent, 1954. Rev Goiana Med 1988;34:29-37. 19. Rocha Dda S, Jurberg J, Carcavallo RU, Cunha V, Galvão C. Influence of the temperature and humidity on the biology of Rhodnius neglectus Lent, 1954 in laboratory conditions (Hemiptera, Reduviidae, Triatominae). Rev Soc Bras Med Trop 2001;34:357-63. 20. Lent H, Valderrama A. Observações em laboratório sobre o ciclo evolutivo de Rhodnius prolixus Stal, 1859, R. pictipes Stal, 1872 e R. neivai Lent, 1953. Rev Brasil Biol 1977;37:325-44. 21. Cabello DR. Effects of environmental temperature on life tables of Rhodnius neivai Lent, 1953 (Hemiptera: Reduviidae) under experimental conditions. Mem Inst Oswaldo Cruz 1999;94:709-14. 22. Jurberg J, Rangel EF. Ciclo biológico de Rhodnius pallescens Barber, 1932 (Hemiptera, Reduviidae, Triatominae) em laboratório. Mem Inst Oswaldo Cruz 1984;79:303-8. 23. Rocha Dda S, Galvão C, Jurberg J. Biology of Rhodnius pictipes Stal, 1872 under laboratory conditions (Hemiptera, Reduviidae, Triatominae). Mem Inst Oswaldo Cruz 1994;89:265-70. 24. Otero AMA, Carcavallo RU, Tonn RJ. Notas sobre la biología, ecología y distribución geográfica de Rhodnius pictipes Stal, 1872 (Hemiptera, Reduviidae). Bol Dir Malariol San Amb 1976;16:163-8. 25. Silva IG, Silva HH. Influência da temperatura na biologia de triatomíneos.VII. Rhodnius prolixus Stal, 1859. Rev Patol Trop 1988;14:145-55. 26. Silva IG, Silva HH. Influência da temperatura na biologia de triatomíneos. XI. Rhodnius robustus Larrousse, 1927. Rev Goiana Med 1988;34:145-54. 27. Martínez-Ibarra JA, Novelo Lopez M, Hernandez Robles Mdel R, Grant Guillen Y. Influence of the blood meal source on the biology of Meccus picturatus Usinger 1939 (Hemiptera: Reduviidae: Triatominae) under laboratory conditions. Mem Inst Oswaldo Cruz 2003;98:227-32. 28. Cabello DR, Lizano E. Biology of Triatoma flavida Neiva, 1911 (Hemiptera: Reduviidae) under laboratory conditions. Mem Inst Oswaldo Cruz 2001;96:879-81.

128

Biomédica 2007;27(supl. 1):119-29

Ciclo de vida de Rhodnius colombiensis y R. prolixus

29. Almeida CE, Folly-Ramos E, Agapito-Souza R, Magno-Esperança G, Pacheco RS, Costa J. Triatoma rubrovaria (Blanchard, 1843) (Hemiptera-ReduviidaeTriatominae) IV: bionomic aspects on the vector capacity of nymphs. Mem Inst Oswaldo Cruz 2005;100:231-5. 30. Juarez E. Behavior of Triatoma infestans under various laboratory conditions. Rev Saude Publica 1970;4:147-66. 31. Diotaiuti L, Dias JC. Comparative study of the development cycle of Rhodnius neglectus fed on pigeons or mice. Rev Soc Bras Med Trop 1987;20:95-9. 32. Gomes JE, Azambuja P, Garcia ES. Comparative studies on the growth and reproductive performances of Rhodnius prolixus reared on different blood sources. Mem Inst Oswaldo Cruz 1990;85:299-304. 33. Braga MV, Pinto ZT, Lima MM. Life cycle and reproductive patterns of Triatoma rubrofasciata (De Geer, 1773) (Hemiptera: Reduviidae), under laboratory conditions. Mem Inst Oswaldo Cruz 1998;93:539-42. 34. Guarneri AA, Diotaiuti L, Gontijo NF, Gontijo AF, Pereira MH. Comparison of feeding behaviour of Triatoma infestans, Triatoma brasiliensis and Triatoma pseudomaculata in different hosts by electronic monitoring of the cibarial pump. J Insect Physiol 2000;46:1121-7. 35. Guarneri AA, Pereira MH, Diotaiuti L. Influence of the blood meal source on the development of Triatoma infestans, Triatoma brasiliensis, Triatoma sordida, and Triatoma pseudomaculata (Heteroptera, Reduviidae). J Med Entomol 2000;37:373-9. 36. Cabello DR, Lizano E, Valderrama A. Vital statistics of Rhodnius neivai Lent, 1953 (Hemiptera: Reduviidae) under experimental conditions. Mem Inst Oswaldo Cruz 1987;82:511-24. 37. Rocha DS, Jurberg J, Carcavallo RU, Presgrave OA, Cunha V, Galvao C. Influence of temperature and

humidity on the nymphal development of Rhodnius robustus. Rev Saude Publica 2001;35:400-6. 38. Luz C, Fargues J, Grunewald J. Development of Rhodnius prolixus (Hemiptera: Reduviidae) under constant and cyclic conditions of temperature and humidity. Mem Inst Oswaldo Cruz 1999;94:403-9. 39. Rocha Dda Silva, da Fonseca AH, Costa FA, Jurberg J, Galvao C. Development of Rhodnius pictipes Stal, 1872 fed on mice and through a silicone membrane (Hemiptera, Reduviidae, Triatominae). Mem Inst Oswaldo Cruz 1997;92:553-8. 40. Rocha D da Silva, dos Santos CM, Cunha V, Jurberg J, Galvão C. Life cycle of Rhodnius brethesi Matta, 1919 (Hemiptera, Reduviidae, Triatominae), a potential vector of Chagas disease in the Amazon region. Mem Inst Oswaldo Cruz 2004;99:591-5. 41. Guarneri AA, Pinto CJ, Schofield CJ, Steindel M. Population Biology of Rhodnius domesticus Neiva & Pinto, 1923 (Hemiptera: Reduviidae) under Laboratory Conditions. Mem Inst Oswaldo Cruz 1998; 93: 273-6. 42. Carcavallo RU, Tonn RJ, Ortega R, Betancourt P, Carrasquero B. Notas sobre la biología, ecología y distribución geográfica de Rhodnius prolixus Stal, 1859 (Hemiptera: Reduviidae). Bol Dir Malariol San Amb 1978; XVIII:191-4. 43. Downe AE, Archer JA. The effects of different bloodmeal sources on digestion and egg production in Culex tarsalis Coq. (Diptera: Culicidae). J Med Entomol 1975;12:431-7. 44. Wigglesworth VB. The principles of insect Physiology. 7th ed. London: Chapman & Halla; 1974. p.827. 45. Nayar JK, Sauerman DM. The effects of nutrition on survival and fecundity in Florida mosquitoes. Part 4. Effects of blood source on oocyte development. J Med Entomol 1977;14:167-74.

129

Hoyos R., 2007;27(supl.Agudelo L.A. et al Biomédica Pacheco L., 1):130-6

Biomédica 2007;27(supl. 1):130-6

COMUNICACIÓN BREVE

Seroprevalencia de la enfermedad de Chagas y factores de riesgo asociados en una población de Morroa, Sucre
Richard Hoyos 1, Lisandro Pacheco 1, Luz Adriana Agudelo 2, German Zafra 3, Pedro Blanco 1, Omar Triana 2
1 2 3

Grupo de Investigaciones Biomédicas, Universidad de Sucre, Sincelejo, Sucre, Colombia. Grupo de Chagas, Universidad de Antioquia, Medellín, Colombia. Grupo de Inmunología y Epidemiología Molecular, Universidad Industrial de Santander, Bucaramanga, Colombia.

Introducción. La enfermedad de Chagas constituye un grave problema de salud pública en Latinoamérica; en Colombia existen en gran parte de su geografía las condiciones ecoepidemiológicas propicias para la transmisión activa de esta enfermedad. Objetivo. En este estudio fue evaluada una población del municipio de Morroa, departamento de Sucre, para identificar factores de riesgo y determinar la seroprevalencia a la enfermedad de Chagas. Materiales y métodos. A una muestra de 122 personas pertenecientes al área rural (n=76) y urbana (n=46), se les aplicó una encuesta epidemiológica y se les realizó un tamizaje serológico con la prueba Elisa, confirmación de seropositivos con hemoaglutinación indirecta (HAI) (Chagatest®) y reacción en cadena de la polimerasa (PCR) como prueba parasitológica confirmatoria. Resultados. Cuatro de las personas resultaron positivas para Elisa (3,28%); sin embargo, fueron negativas a HAI y PCR. La serología discordante fue definida con prueba de inmunofluorescencia indirecta (IFI), encontrándose una de las cuatro personas positivas. La población analizada mostró una baja presencia de anticuerpos anti–Trypanosoma cruzi. No fue posible determinar la presencia del parásito en sangre usando la prueba PCR. Los principales factores de riesgo presentes fueron casas con techos de palmas, piso de tierra, paredes de bahareque y madera, y la presencia de reservorios (animales domésticos). Conclusiones. Nuestros resultados indican que la zona estudiada presenta elementos de riesgo para el establecimiento de un ciclo de transmisión activa, se hace necesario verificar la presencia de triatominos en la zona de estudio y establecer medidas para prevenir la presencia de la enfermedad de Chagas en el área de Morroa, Sucre. Palabras claves: Trypanosoma cruzi, enfermedad de Chagas, serología, factores de riesgo, prueba de Elisa, epidemiología. Seroprevalence of Chagas disease and associated risk factors in a population of Morroa, Sucre Introduction. Chagas disease is a major public health problem in Latin America. In Colombia, a large area has the ecoepidemiological conditions which favor the active transmition of this infection. Objective. This study was undertaken in a population from the municipality of Morroa, Sucre Province, to evaluate risk factors and to determine the seroprevalence to Chagas disease. Materials and methods. A questionnaire was given to a sample population of 122 people classed as rural (n=76) or urban area (n = 46). A serological screening was undertaken by Elisa test, with confirmation of seropositives with IHA (Chagatest®) and parasitological confirmation by polymerase chain reaction (PCR). Results. Four people were positive by Elisa test (3.3%); however, they were negative by IHA and PCR. One of the four positives by Elisa was positive by indirect immuno flourescence (IFAT) as well. The sample showed a low presence of seropositives against Trypanosoma

130

Biomédica 2007;27(supl. 1):130-6

Seroprevalencia y factores de riesgo a T. cruzi

cruzi. However, the presence of parasite could not be confirmed by the PCR test.The main risk factors were houses thatched with palm roofs, clay floors, wood walls, and presence of domestic animal reservoirs. Conclusions. The study population presented risk factors for the establishment of active transmission. The presence of triatomines must be verified in this area and establishment of control measures are necessary for preventiving the resurgence of the Chagas disease in Morroa.
Key words: Trypanosoma cruzi, Chagas disease, serology, risk factors, Elisa test, epidemiology.

Trypanosoma cruzi , agente causal de la enfermedad de Chagas, es transmitido por insectos vectores de la subfamilia Triatominae. La fase crónica de la enfermedad se caracteriza por complicaciones cardíacas y digestivas (1). Los datos serológicos indican que alrededor de 17 a 24 millones de latinoamericanos se encuentran infectados y cerca de 120 millones están en riesgo de infectarse (2). En Colombia se ha estimado que un 5% de la población puede estar infectada y un 23% se encuentra en zona de alto riesgo (3).
Las principales condiciones para el establecimiento de la enfermedad de Chagas en las zonas de riesgo son la presencia del insecto vector, los animales silvestres que sirvan de reservorios, la circulación del parásito y las condiciones socioeconómicas de la región (tipo de vivienda, hacinamiento y presencia de animales domésticos que facilitan la transmisión activa de T. cruzi) (4). Las condiciones biológicas, ecológicas y ambientales del territorio nacional favorecen los ciclos ecoepidemiológicos del parásito, lo que hace necesario realizar encuestas serológicas para conocer la proporción de individuos infectados en las zonas geográficas del país. Para estos estudios epidemiológicos se utilizan los métodos serológicos convencionales: inmunoensayo ligado a una enzima (Elisa), hemoaglutinación indirecta (HAI) e inmunofluorescencia indirecta (IFI) para detectar la presencia de anticuerpos contra T. cruzi, (4,5).
Correspondencia: Richard Hoyos Lopez; Carrera 14 N° 16B – 32, Laboratorio de Investigaciones Biomédicas, Sincelejo, Sucre, Colombia. Teléfono: (055) 2820830; fax: (055) 2823867. richard_hoyoslopez@yahoo.com Recibido: 02/02/06; aceptado: 16/08/06

Cuando se desea determinar la presencia del parásito T. cruzi en sangre circulante, la reacción en cadena de la polimerasa (PCR) constituye una importante herramienta que de alguna manera reemplaza las técnicas de microscopía existentes (6). La presencia de vectores triatominos en el departamento de Sucre (7), la falta de datos relacionados con la epidemiología y los factores de riesgo para la enfermedad de Chagas en la región motivaron el presente estudio de una muestra poblacional del municipio de Morroa, Sucre, considerado de bajo riesgo (8), con el fin de determinar la seroprevalencia de la enfermedad de Chagas con métodos serológicos convencionales y evaluar los factores de riesgo asociados. Materiales y métodos

Localidad y población de estudio
El estudio se llevó a cabo en el municipio de Morroa (coordenadas geográficas: 9° 28' norte, 9° 18' sur, 75° 15' este y 75°21' oeste, departamento de Sucre), situado a 150 metros sobre el nivel del mar en la costa Atlántica de Colombia, con una temperatura promedio de 27°C y predominio de clima de sabana tropical y vegetación principalmente compuesta de palmas y áreas boscosas. La población es de 16.120 personas, de las cuales el 68% pertenece al área rural. La muestra poblacional fue calculada basándose en el programa estadístico Epi info 2003, utilizando un promedio de prevalencia de la enfermedad de Chagas del 5%, la población del municipio y un nivel de confianza del 95%.

Muestras
Las personas que participaron en el estudio debían pertenecer al área de Morroa y tener un periodo de permanencia en la zona mayor a cinco años,

131

Hoyos R., Pacheco L., Agudelo L.A. et al

Biomédica 2007;27(supl. 1):130-6

las personas que no cumplían con estos criterios no fueron tenidas en cuenta para la realización del estudio. Previa firma de consentimiento informado, las personas respondieron una encuesta epidemiológica y se extrajo una muestra de sangre que fue dividida en dos viales: uno para extracción de suero y uno con anticoagulante (EDTA – 0,2 M, pH = 8,0) para extracción de ADN. Las muestras de sangre y suero se recolectaron en el Laboratorio Clínico del Centro Médico de Salud San Blas del 2 de septiembre al 3 diciembre del 2004, y correspondieron a 122 personas asentadas en 117 viviendas del área rural y urbana.

(Sigma # catalogo 104) se adicionó a una concentración de 1 mg\ml para ser leída a una longitud de onda de 410 nm después de agregar 50 ul de NaOH 3N. Se consideraron muestras reactivas positivas aquellas cuya D.O fuera mayor al punto de corte (punto de corte = 0,300).

Hemoaglutinación indirecta
Esta prueba se realizó con el kit Chagatest® (Wiener Lab) y se consideraron reactivas las muestras con títulos iguales o mayores a 1:32.

Inmunofluorescencia indirecta
En esta prueba se utilizaron como antígeno proteínas formalizadas totales de epimastigotes de la cepa HA de T. cruzi de Colombia, y como anticuerpo, un anti IgG humano marcado con isotiocianato de fluoresceína (FITC), según el protocolo establecido en el laboratorio de Chagas de la Universidad de Antioquia (11). El punto de corte se estableció a partir de la segunda dilución (1:40).

Encuesta epidemiológica
Las variables tomadas en cuenta fueron el tipo de vivienda; el conocimiento sobre el vector, para lo cual a cada persona participante en el estudio se le mostraron ejemplares adultos y ninfales de Triatoma maculata; los lugares de avistamiento del insecto, los tipos de animales domésticos y el hacinamiento. Se realizó una búsqueda pasiva de vectores, para lo cual se distribuyeron viales plásticos rotulados estériles en el corregimiento de Las Flores. Estos datos se procesaron en el programa estadístico Epi Info 2003.

Extracción de ADN y PCR
El protocolo de extracción empleado es el descrito por Sambrook et al. (1989) (12): 500 µL de sangre se mezclaron con buffer de lisis 2X (Tris - HCl 10 mM PH = 7,4; EDTA 5M a pH = 8,0; SDS al 1%) y 10 µL de proteinasa K (20 mg/ml); se incubaron a 55°C por 1 hora y después toda la noche a 37°C; luego se inactivó la proteinasa K (5 minutos a 95°C) para centrifugar a 12.000 r.p.m por 40 minutos; el sobrenadante resultante se tomó para la extracción del ADN con sales de alta molaridad. El sobrenadante de ADN se resuspendió en 50 µL de buffer TE 1X, almacenándose luego a -20°C hasta su uso. En la prueba de PCR se usaron los iniciadores S35 (5‘AAA TAA TGT ACG GGT GAG ATG CAT G 3‘) y S36 (5‘GGG TTC GAT TGG GGT TGG TG 3‘), que amplifican un fragmento de 330 bp de las regiones variables de minicírculos del kDNA de T. cruzi. La reacción de amplificación se realizó según Moser et al. (1989) (13) así: 2 µL de buffer PCR (10X), 0,4 µL de dNTPs mezclados (200 mM), 1,2 µL de MgCl2 (1,5 mM), 1,2 µL de cada iniciador (0,6 mM), 0,2 µL de Taq polimerasa y 6 µL de ADN problema, para un volumen final de

Ensayos serológicos
La Organización Mundial de la Salud (OMS) recomienda que las muestras de suero sean clasificadas como positivas para la enfermedad de Chagas si son reactivas a dos de tres técnicas serológicas con metodologías diferentes (2). En este trabajo se utilizaron como pruebas diagnósticas Elisa, HAI e IFI. La prueba de Elisa se desarrolló de acuerdo al protocolo descrito por Gea et al. (1987) y Takasu et al. (1989) (9,10); el ensayo se realizó en microplacas Nunc – Immuno Plate (Maxisorp surface) y un lector de Elisa Biorad (model 550). El antígeno consistió en un extracto crudo de epimastigotes de T. cruzi (cepa Y), el cual se adicionó a una concentración de 1,22 ug\ml e incubado 24 horas en buffer carbonato (pH = 9,6). Los sueros se utilizaron en diluciones de 1:800 y como conjugado enzimático se utilizó antiinmunoglobulina G ligada a fosfatasa alcalina en dilución de 1:1000. El sustrato p – nitrofenilfosfato

132

Biomédica 2007;27(supl. 1):130-6

Seroprevalencia y factores de riesgo a T. cruzi

25 µL. La PCR se llevó a cabo en un termociclador PCR – Express (Hybaid) en las siguientes condiciones: 1 ciclo a 94°C (5 minutos), 35 ciclos a 94°C (1 minuto) 65°C (1 minuto) 72 °C (1 minuto), y una extensión final a 72°C (10 minutos). Los productos amplificados se sometieron a una electroforesis en gel de agarosa al 1,8% y se visualizaron bajo luz U.V después de la tinción con bromuro de etidio.

vectores en el corregimiento de Las Flores fue negativa. El análisis por Elisa reveló cuatro personas seropositivas, un hombre y tres mujeres que se encontraban en el grupo de edad entre los 14 y 45 años. A los sueros seropositivos se les realizó una prueba de HAI con el estuche Chagatest® (Wiener Lab) con resultados negativos. Dada la discrepancia que existía en cuanto al estado serológico de estos cuatro individuos (Elisa +, HAI -), se definió la seropositividad con el ensayo de IFI, el cual dio resultado positivo en una de las cuatro muestras, con un título de 1:40. La amplificación del kDNA de T. cruzi por PCR en las muestras de sangre pertenecientes a individuos seropositivos por Elisa y positivos para IFI fue negativa. Discusión En el ciclo silvestre los triatominos están ubicados en ecotopos con unas características particulares dependiendo del género Triatominae al que pertenezcan; así, las especies pertenecientes a Rhodnius se han encontrado asociadas principalmente a palmas (14,15); Panstrongylus sp. se encuentra en cavidades y huecos de palmas, en árboles y también en madrigueras de vertebrados silvestres (16); Triatoma sp. frecuentemente se localiza en hábitats rocosos y madrigueras de roedores (16). Los diferentes nichos ecológicos colonizados por las especies Triatominae se distribuyen de acuerdo a la asociación que presentan en el ambiente silvestre y las preferencias de sustrato se reflejan en los sitios infestados por los triatominos dentro de las casas (14); por esta razón, se considera que uno de los factores de riesgo mas relevantes es el tipo de construcción de los domicilios. En la población estudiada, la mayor parte de las viviendas presentaban por lo menos un elemento estructural de riesgo para la infestación por triatominos (50,9%), y otro porcentaje (30,3%) presentaba todos los elementos estructurales de riesgo para la infestación por vectores de la enfermedad de Chagas, ya que las viviendas con paredes de bahareque y techos de palma presentan los micrositios (fisuras) y microclimas que permiten una domiciliación acelerada de

Consideraciones éticas
El Comité de Investigaciones de la Facultad de Educación y Ciencias de la Universidad de Sucre aprobó este estudio. Resultados La encuesta epidemiológica reveló que en la muestra poblacional estudiada (n = 122), las condiciones socioeconómicas de la vivienda fueron uno de los factores de riesgo encontrados con mayor frecuencia. Los tipos de vivienda correspondieron principalmente a tres categorías: la combinada (62 viviendas, 50,9%), que presenta por lo menos un elemento estructural de riesgo para la infestación por triatominos; en segundo lugar tenemos el “rancho“(37 viviendas, 30,3%), que presenta todos los elementos estructurales de riesgo para la infestación por vectores de la enfermedad de Chagas y, por último, la casa de material (18,8%). Los animales domésticos encontrados en la mayoría de las viviendas de la población encuestada fueron perros ( Canis familiaris, 57,2%), gallinas (Gallus gallus, 44,4%) y cerdos (Sus scropha, 36,7%), presentándose convivencia de diferentes especies dentro de la misma casa. El hacinamiento fue un factor presente en el 83,6% de los domicilios encuestados, ya que presentaban cinco o más personas por habitación en el domicilio. Las personas que manifestaron conocer el vector después de ver ejemplares adultos y ninfales de T. maculata fueron 54 (44,2%), siendo las paredes de las habitaciones el lugar más frecuente de observación y los dormitorios el sitio predilecto para la alimentación de los triatominos (34 y 44%, respectivamente). La búsqueda pasiva de

133

Hoyos R., Pacheco L., Agudelo L.A. et al

Biomédica 2007;27(supl. 1):130-6

triatominos por tener una temperatura y humedad similares a las de los silvestres (17). Aunque se considera que las casas con elementos materiales sólidos (bloque, cemento y tejas de asbesto-cemento, presentes en un 18,8%) no presentan ningún tipo de riesgo, se ha observado que algunas especies como T. maculata y T. dimidiata, presentes en Colombia y la Costa Atlántica (14,15,18), tienen una presencia ligada al hacinamiento y no a estructuras de riesgo, considerándose la presencia de estas especies vectoras un factor de riesgo para cualquier tipo de vivienda (15,19). El hacinamiento fue del 83,6%, lo que indica que había casas con dos habitaciones y cinco o más habitantes; además, las características de higiene asociadas con el hacinamiento se consideran como de riesgo para la transmisión vectorial (19,20), la infestación, y también para la picadura de los triatominos a individuos, ya que facilitan una mayor concentración de fuentes de alimentos en un mínimo de espacio. Los principales animales domésticos encontrados coinciden con los reservorios caracterizados para T. cruzi y con otras experiencias epidemiológicas, en las que se han encontrado fuertes asociaciones entre cerdos y la especie Panstrongylus geniculatus (21), y entre gallinas y T. dimidiata, T. maculata y Rhodnius prolixus (3,15, 22). Hay que resaltar que existen reportes que asocian la presencia de especies de triatominos infectados con tripanosomas en los municipios del departamento de Sucre (7,23,24). Los perros son los reservorios principales para T. cruzi y los tres principales géneros de Triatominae tienen como fuente fundamental de alimento a esta especie. La presencia de posibles fuentes de alimentos susceptibles de ser reservorios está ligada a altas densidades de animales domésticos que duermen en el intradomicilio y peridomicilio, además de la presencia de diferentes especies de animales en la vivienda, como se observó en la muestra poblacional estudiada, en la que además de los tres reservorios antes mencionados, se encontraron patos (Anas sp), pavos (Meleagris gallipavo), gatos (Felis catus), burros ( Equus asinus ), vacas ( Bos taurus ), lo que

aumenta la densidad de animales en los domicilios estudiados y facilita a los insectos vectores la obtención de alimento. Se realizó una búsqueda pasiva en los domicilios del corregimiento de Las Flores (Morroa, Sucre), después de realizar actividades de educación sobre los peligros de la enfermedad de Chagas y el vector Triatominae ; esta búsqueda arrojó resultados negativos, pues no se encontraron ejemplares de triatominos, aunque sí hay antecedentes de infestación años atrás, según informaciones anecdóticas de los moradores de este corregimiento. No se descarta la presencia de vectores en el área de este municipio, debido a que el principal tipo de vegetación son las palmas en el peri y extradomicilio, y en el departamento de Sucre, Poyet (1995) (24) y Agudelo (2005) (Agudelo L. Experiencias epidemiológicas del Grupo de Chagas, Universidad de Antioquia. En: Jaramillo N, Parra G, Triana O, Moreno J, editores. Memorias del VIII Curso Internacional sobre la Ecoepidemiología de la Enfermedad de Chagas y sus Métodos de Estudio. Medellín: Editorial Gráficas; 2005) reportan infestación con triatominos (R. pallescens , T. dimidiata y P. geniculatus) en palmas del género Attalea (Attalea butyracea, “palma de vino”), Scheelea y Cocos (Cocos nucifera, “palma de coco”). Las pruebas serológicas constituyen importantes herramientas que permiten estimar los niveles de infección por T. cruzi y evaluar medidas de control epidemiológico y vectorial (20). Sin embargo, la persistencia de resultados falsos debidos a la gran cantidad de reacciones cruzadas con anticuerpos de individuos que padecen otras enfermedades parasitarias relacionadas (4) ha llevado a la OMS a recomendar el uso de por lo menos dos técnicas serológicas con fundamentos metodológicos diferentes (2,4,5). En nuestro estudio, la prueba Elisa para detectar niveles de IgG anti–T. cruzi fue lo suficientemente sensible en los sueros de la población estudiada, discriminando cuatro muestras reactivas cuya densidad óptica fue mayor al punto de corte y no se ubicaron dentro de la zona gris (0,270 a 0,330). Al realizar la prueba de HAI con el estuche Chagatest®, las cuatro muestras resultaron

134

Biomédica 2007;27(supl. 1):130-6

Seroprevalencia y factores de riesgo a T. cruzi

negativas, resultado similar al obtenido por Cárdenas et al.(2002), quien obtuvo seis muestras reactivas por Elisa y todas negativas por Chagatest®, lo que demuestra la discordancia entre esta prueba y Elisa (25). Hay que destacar que el kit Chagatest® utiliza antígeno citoplasmático liofilizado de cepas argentinas, por lo que podría explicarse que las muestras no reaccionen debido a la posible diferencia en determinantes antigénicos entre las cepas del cono sur y las cepas de T. cruzi colombianas. Esta hipótesis es expuesta por Enciso et al. (2004), quienes, para explicar las discordancias que existen al tamizar muestras por Elisa y estuches de HAI foráneos, además proponen aspectos relacionados con el estadio del parásito utilizado como antígeno, su preparación, el ciclo de transmisión al que pertenece la cepa aislada, así como el huésped o reservorio de origen (26). Estos sueros también se analizaron con la técnica de IFI, y se confirmó una de las cuatro muestras como positiva para T. cruzi, encontrándose el primer caso autóctono de la enfermedad de Chagas en un municipio considerado de bajo riesgo, en el cual no se ha reportado la presencia de individuos infectados por T. cruzi. La PCR se realizó con el objetivo de detectar la presencia del parásito en sangre; tres muestras fueron negativas por ausencia de infección (positivos para Elisa, negativos para Chagatest® e IFI), y una muestra fue negativa por ausencia de parasitemia en sangre periférica (positivo para Elisa e IFI, negativo para Chagatest®); este resultado es consistente con el de personas en estado latente o crónico de la enfermedad de Chagas, que presentan serología positiva pero escasa presencia de parásitos en sangre (6,27); otras posibles causas que pueden incidir en los resultados son el tipo de extracción de ADN utilizado y el volumen de sangre usado en la extracción. Marcon et al (2002) desarrollaron una PCR anidada para detectar T. cruzi en pacientes en estado crónico de la enfermedad (28); sin embargo, la alta sensibilidad encontrada con esta técnica es consecuencia de la alta parasitemia de las cepas procedentes de las áreas endémicas brasileñas, característica diferente a la de los aislamientos colombianos. En este sentido,

Morroa es considerada un área de bajo riesgo no endémica para la enfermedad de Chagas. En conclusión, la zona de estudio presentó los elementos de riesgo estructurales con los ecotopos artificiales propicios para la infestación de triatominos; la convivencia con diferentes tipos de animales domésticos facilita una fuente de alimento estable y reservorios para el desarrollo de colonias domiciliadas de triatominos y, en consecuencia, la transmisión activa de T. cruzi. Por la prevalencia de 1,22% encontrada en la muestra estudiada se recomienda realizar estudios para ubicar la presencia de vectores triatominos y su índice de infección natural en los corregimientos y veredas pertenecientes al municipio de Morroa, así como establecer el estado seroepidemiológico de poblaciones pertenecientes al corregimiento de Tumbatoro (Morroa, Sucre), sitio de origen del individuo positivo por Elisa e IFI en este estudio. Conflicto de intereses Los autores manifiestan no tener conflictos de intereses con respecto a los resultados de esta investigación. Financiación Este trabajo de investigación pertenece a la línea de investigaciones biomédicas de la Universidad de Sucre y fue financiado parcialmente por el proyecto 1102-04 -12901 registrado en Colciencias, así como con recursos del Laboratorio de Investigaciones Biomédicas de la Universidad de Sucre y el Grupo de Chagas de la Universidad de Antioquia. Referencias
1. Atias A. Parasitología médica. Santiago de Chile: Publicaciones Técnicas Mediterráneas Ltda.: 1999. p. 251-64. 2. World Health Organization. Control of Chagas disease. Second Report of the WHO Expert Committee. Technical reports series 905. Geneva: WHO; 2002. 3. Moncayo A. Chagas disease: current epidemiological trends after the interruption of vectorial and transfusional transmission in the southern cone countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 4. Cannova D, Aguilar M, Pacheco M, Simona M, Medina M. Validación del inmunoensayo enzimático

135

Hoyos R., Pacheco L., Agudelo L.A. et al

Biomédica 2007;27(supl. 1):130-6

(Elisa) y hemoaglutinación indirecta (HAI) para el serodiagnóstico de la enfermedad de Chagas. Salus 2002;6:4-9. 5. Gutierrez R, Angulo VM, Tarazona Z, Britto M, Fernandez O. Comparison of four serological tests for the diagnosis of Chagas disease in a Colombian endemic area. Parasitology 2004;129:439-44. 6. Kirchhoff LV, Votava JR, Ochs DE, Moser DR. Comparison of PCR and microscopic methods for detecting Trypanosoma cruzi . J Clin Microbiol 1996;34:1171-5. 7. Molina JA, Gualdron LE, Brochero HL, Olano VA, Barrios D, Guhl F. Distribución actual e importancia epidemiológica de las especies de triatominos (Reduviidae: Triatominae) en Colombia. Biomédica 2000;20:344-60. 8. Guhl F, Restrepo M, Angulo VM, Antunes CM, Campbell-Lendrum D, Davies C. Lessons from a national survey of Chagas disease transmission risk in Colombia. Trends Parasitol 2005;21:259-62. 9. Gea S, Rodriguez P, Vottero–Cima E. Characterization of Trypanosoma cruzi antigens recognized by sera from patients with chronic Chagas disease. Int Archs Allergy Appl Immun 1987;84:410-3. 10.Takasu N, Masuko T, Hojo H, Hashimoto Y. A microplate-immunofluorescence assay for antiTrypanosoma cruzi antibodies. Tohoku J Exp Med 1989;159:307-12. 11. Agudelo L. Ecoepidemiología de la enfermedad de Chagas en la cuenca del Río Palomino, Sierra Nevada de Santa Marta. (Tesis de maestría) Medellín: Universidad de Antioquia; 2006. 12. Sambrook J, Fritsh E, Maniatis T. Molecular cloning. A laboratory manual. New York: Cold Spring Harbor Laboratory; 1989. p.223-45. 13. Moser D, Kirchhoff L, Donelson J. Detection of Trypanosoma cruzi by DNA amplification using the polymerase chain reaction. J Clin Microbiol 1989;27:1477-82. 14. Lent H, Wigodzinsky P. Revision of the Triatominae (Hemiptera, Reduviidae), and their significance as vectors of Chagas disease. Bull Am Mus Nat Hist 1979;163:123-520. 15. Márquez J, Palencia J. Detección de Trypanosoma cruzi en una población de triatominos ( Triatoma maculata) en Córdoba, Bolívar. (Tesis de grado). Sincelejo: Universidad de Sucre; 2004. 16. Gaunt M, Miles M. The ecotopes and evolution of Triatomine bugs (Triatominae) and their associated trypanosomes. Mem Inst Oswaldo Cruz 2000;95:557-65. 17. Pizarro JC, Romaña C. Variación estacional de una población silvestre de Rhodnius pallescens

(Heteroptera: Triatominae) BARBER 1932 en la costa Caribe colombiana. Bull Inst Fr Etudes Audines 1998;27:309-25. 18. Cortés L, Suárez H. Triatominos ( Reduviidae: Triatominae) en un foco de enfermedad de Chagas en Talaigua Nuevo (Bolívar, Colombia). Biomédica 2005;25:568-74. 19. Segura E, Escobar-Mesa A, Grupo de Estudio Sobre la Enfermedad de Chagas. Epidemiología de la enfermedad de Chagas en el estado de Veracruz. Salud Pública Méx 2005;47:201-8. 20. Sanmartino M, Crocco L. Conocimientos sobre la enfermedad de Chagas y factores de riesgo en comunidades epidemiologicamente diferentes de Argentina. Rev Panam Salud Pública 2000;7:173-8. 21. Valente VC, Valente SA, Noireau F, Carrasco HJ, Miles MA. Chagas disease in the amazon basin: association of Panstrongylus geniculatus (Hemíptera, Reduviidae) with domestic pigs. J Med Entomol 1998;35:99-103. 22. D’Alessandro A, Barreto P, Thomas M. Nuevos registros de triatominos domiciliarios y extradomiciliarios en Colombia. Colombia Médica 1981;12:75-85. 23. Corredor A, Santacruz M, Gomez S, Guatame L. Distribución de los triatominos domiciliados en Colombia. Bogotá: Instituto Nacional de Salud; 1990. 24. Poyet G. Contexte écologique de Rhodnius pallescens (Heteroptera: Reduviidae) vecteur de la maladie de Chagas, dans son biotope natural, le palmera Attalea butyraceae: peuplement de l’entomofaune associée et estratégies adaptatives Rhodnius pallescens. Mémoire de maítrise de biologie des organismos et des populations. Paris: Université Pierre et Marie Curie; 1995. 25. Cárdenas J, Mazariego M. Anticuerpos anti– Trypanosoma cruzi en pacientes con cardiomiopatía dilatada. Rev Med IMSS 2003;41:111-4. 26. Enciso C, Montilla M, Santacruz M, Nicholls S, Rodríguez A, Mercado M, et al. Comparación de la prueba de inmunofluorescencia indirecta, un inmunoensayo enzimático y la prueba comercial Chagatek® para la detección de anticuerpos antiTrypanosoma cruzi. Biomédica 2004;24:104-8. 27. Guhl F, Jaramillo C, Carranza JC, Vallejo GA. Molecular characterization and diagnosis of Trypanosoma cruzi and T. rangeli . Arch Med Res 2002;33:362-70. 28. Marcon GE, Andrade PD, de Alburquerque DM, Wanderley Jda S, de Almeida EA, Guariento ME, et al. Use of a nested polymerase chain reaction (N– PCR) to detect Trypanosoma cruzi in blood samples from chronic chagasic patients and patients' doubtful serologies. Diagn Microbiol Infect Dis 2002;43:39-43.

136

Biomédica 2007;27(supl. 1):137-42

Nitroforinas de Rhodnius colombiensis y R. prolixus

COMUNICACIÓN BREVE

Patrones electroforéticos de hemoproteínas salivares (nitroforinas) de Rhodnius colombiensis y Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae)
Andrea Arévalo 1, Julio César Carranza 1, Felipe Guhl 2, Gustavo Adolfo Vallejo
1

1

2

Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia. Centro de Investigaciones en Microbiología y Parasitología Tropical, Universidad de los Andes, Bogotá D.C., Colombia.

Introducción. La electroforesis de hemoproteínas salivares en geles de almidón es una técnica de reciente aplicación para diferenciar especies del género Rhodnius que poseen gran similaridad fenotípica o para diferenciar subpoblaciones de la misma especie, separadas geográficamente. De las 15 especies de Rhodnius descritas en latinoamérica, por lo menos ocho han sido reportadas en el territorio colombiano. Objetivo. Utilizar la electroforesis de hemoproteínas salivares para diferenciar R. prolixus de R. colombiensis, dos especies con similaridad fenotípica cuyos ciclos doméstico y selvático se superponen en la cuenca alta del río Magdalena en la región Central de Colombia. Materiales y Métodos. El contenido de las glándulas salivares de cada insecto se sometió a electroforesis en gel de almidón utilizando buffer de glicina y revelado de las bandas con 3,3’,5,5’-tetrametilbenzidina. Los patrones de bandeo fueron registrados fotográficamente. Resultados. Usando esta técnica se observaron los perfiles electroforéticos de las hemoproteínas salivares de R. prolixus y R. colombiensis los cuales permitieron su inequívoca diferenciación. Conclusión. Estos resultados demuestran la utilidad de la técnica para la diferenciación entre R. prolixus y R. colombiensis en adición a métodos morfométricos y moleculares previamente utilizados para diferenciar estas dos especies. Palabras clave: Rhodnius, Triatominae, saliva, Colombia. Electrophoretic patterns of salivary hemeproteins (nitrophorines) of Rhodnius colombiensis and R. prolixus (Hemiptera, Reduviidae, Triatominae) Introduction. Salivary hemeprotein electrophoresis in starch gels is a recent technique used for differentiation of Rhodnius species with great phenotypic similarity. Furthermore, populations of the same species can be differentiated from geographically separated locales. Of the 15 described Rhodnius species in Latin America, at least eight have been reported in Colombia. Objective. To use the salivary hemeproteins electrophoresis for R. prolixus and R. colombiensis identification. These two species are phenotypically similar and have overlapping domestic and sylvatic cycles where they occur in the upper basin of the Magdalena river, Central Colombia. Material and methods. The content of salivary glands of each insect was subjected to starch gel electrophoresis using glycine buffer, and the bands were revealed with 3,3’,5,5’tetramethylbenzidine. Band patterns were photographically recorded. Results. Electrophoretic patterns of salivary hemeproteins of R. prolixus and R. colombiensis were able to unequivocally differentiate the two species. Conclusion. The usefulness of the starch gel technique for distinguishing between R. prolixus and R. colombiensis was demonstrated as an additional tool to the morphometric and molecular methods already in use for differentiation of these two species. Key words: Rhodnius, Triatominae, saliva, Colombia.

137

Arévalo A., Carranza J.C., Guhl F., Vallejo G.A.

Biomédica 2007;27(supl. 1):137-42

La saliva de los insectos hematófagos presenta sustancias anticoagulantes, antihistamínicas, vasodilatorias y antiplaquetarias que facilitan el proceso de alimentación sobre el huésped vertebrado (1-4). En los triatominos se han encontrado varias sustancias relacionadas con estas funciones. En el caso del género Rhodnius, hasta el momento se han reportado ocho proteínas salivares: tres factores que contrarrestan la agregación plaquetaria, llamados inhibidores de agregación de R. prolixus (RPAI 1-3) (proteínas lipocalinas) (4,5); una apirasa que se encarga de hidrolizar el ADP bloqueando la agregación plaquetaria (4,6), y, por último, las nitroforinas (NPs), un grupo de cuatro hemoproteínas denominadas NP1 a NP4 según su relativa abundancia en las glándulas salivares (7). Las nitroforinas se pueden agrupar en dos conjuntos con base en las relaciones de sus secuencias de aminoácidos; es así como NP1 y NP4 son idénticas en un 90%, y NP2 y NP3 son idénticas en un 80% (4,7,8). Para Cimex lectularius de la familia Cimicidae se ha reportado otra nitroforina que, aun cuando no es significativamente similar a las de R. prolixus (familia Reduviidae), revelaría una evolución convergente entre estas hemoproteínas (9,10). En Rhodnius , las NP transportan óxido nítrico e histamina a través de su grupo hemo (Fe III), el cual es el sitio de enlace para ambas moléculas (4,11-14). El óxido nítrico permite la vasodilatación e inhibe la agregación plaquetaria (4,11,15). Por su parte, la unión de la histamina a las NP impide la respuesta de inflamación en el huésped vertebrado (4,12,13). La NP2 o prolixin-S se encarga de bloquear la cascada de coagulación, ya que evita que el factor X se convierta en el factor Xa (4,13,16). Por otro lado, se ha comprobado que las NP en R. prolixus son estadio específicas, es decir, que puede presentarse una o faltar otra de un estadio a otro. Es así como la NP2 está presente desde el primer
Correspondencia: Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima, Ibagué, Colombia. Fax (+57-8) 2669176. gvallejo@ut.edu.co Recibido: 23/03/06; aceptado: 08/09/06

estadio ninfal (N1) hasta el adulto. En el primer estadio se han purificado, además, dos hemoproteínas salivares, la NP5 y la NP6, cuya cantidad va disminuyendo en las glándulas salivares con las mudas sucesivas hasta ausentarse en la fase adulta. En el segundo estadio (N2) aparece la NP4. En el tercer estadio ninfal (N3) se presenta la NP1. Por ultimo, en el quinto estadio ninfal (N5) aparece la NP3, y a partir de este momento ya están presentes las cuatro nitroforinas, NP1 a NP4, que perduran en el adulto (17). En el género Rhodnius existen varias especies epidemiológicamente importantes para la transmisión de los parásitos T. cruzi y T. rangeli. Según las características biológicas, ecológicas y etológicas de estos vectores, que suelen variar de una zona geográfica a otra, pueden considerarse como vectores primarios o secundarios, o estar en proceso de alcanzar este último nivel. Algunas especies del género Rhodnius suelen ser fenotípicamente similares y, además, ser simpátricas en algunas zonas geográficas. En los estudios de la epidemiología y la biología de los vectores y de los ciclos de transmisión de los parásitos T. cruzi y T. rangeli, así como en las encuestas entomológicas y en las campañas de control y prevención vectorial, se han utilizado diferentes tipos de técnicas que han permitido distinguir la mayoría de las especies pertenecientes a este género, entre ellos la morfología (18-20), las isoenzimas (21-23), la morfometría cuantitativa (23), el análisis cuantitativo de patrones de sensilias antenales (24), el análisis de secuencias de ADN mitocondrial (25,26) y el análisis de genitalia masculina (20,27); sin embargo, algunas veces no suelen ser muy efectivas, ya que no generan diferencias y, además, algunas son dispendiosas y muy costosas. Mediante la electroforesis de hemoproteínas salivares es posible diferenciar especies fenotípicamente similares o poblaciones de una misma especie separadas por áreas geográficas (28,29). Además, los perfiles electroforéticos de las hemoproteínas pueden reflejar distancias biogeográficas entre poblaciones y revelar relaciones filogenéticas entre las especies (28).

138

Biomédica 2007;27(supl. 1):137-42

Nitroforinas de Rhodnius colombiensis y R. prolixus

Estas diferencias son considerablemente importantes para la epidemiología de los vectores de T. cruzi (30) y T. rangeli, y ayudan a identificar las especies relacionadas en el ciclo de transmisión de un área geográfica específica. Trabajos previos han mostrado que la diferenciación morfológica de R. colombiensis y R. prolixus no es fácil, tanto así que durante varios años a la especie R. colombiensis se le denominó R. prolixus “forma Tolima” (31); posteriormente, a partir de estudios de isoenzimas, genitalia y genes ribosomales, se concluyó que se trataba de una especie diferente hoy denominada como R. colombiensis (20, 32). En el presente trabajo se detectaron diferencias por medio de los patrones electroforéticos de hemoproteínas entre las especies R. colombiensis y R. prolixus, dos especies fenotípicamente similares y simpátricas, ya que sus ciclos selvático y doméstico se traslapan en la cuenca alta del Río Magdalena. Estas especies se han considerado vectores importantes para la transmisión de T. cruzi y T. rangeli en esa zona geográfica. R. colombiensis presenta prevalencias de T. cruzi y T. rangeli del 45 y 28,6%, respectivamente (datos no publicados), situación que configura un riesgo para la transmisión de T. cruzi por parte de este vector en la región central de Colombia. Materiales y métodos

siguiendo la metodología descrita por Jaramillo et al. 2001 (32).

Preparación de la muestra y electroforesis
Se disectaron 13 insectos adultos de R. prolixus y 13 de R. colombiensis y sus glándulas salivares fueron lavadas en solución salina estéril al 0,9%. Las glándulas salivares de cada insecto se maceraron y homogeneizaron con 10 ml de buffer de corrido (glicina 0,15 M/NaOH, pH 9,5). Una vez homogeneizadas, el contenido de las glándulas fue absorbido en hilos de algodón estériles de 0,9 cm y colocados en las canaletas del gel de almidón al 8% preparado con buffer de corrido (glicina 0,15M/NaOH, pH 9,5) diluido 1:10. La electroforesis se llevó a cabo a 300 voltios por cuatro horas. Para el revelado, los geles se sumergieron en una solución de 0,3 mg/ml de 3,3’,5,5’-tetrametilbenzidina en una mezcla de etanol, ácido acético y agua en proporción 1:1:1. Luego se transfirieron a una solución de peróxido de hidrógeno al 2% hasta la aparición de las bandas (28,29). Con fines comparativos, se examinaron los patrones electroforéticos de las hemoproteínas de dos adultos de R. pallescens. El número de bandas generado en cada carril del gel fue determinado en el momento inicial en que se desarrolla la coloración, pues a medida que transcurre el tiempo, las bandas pierden resolución. A partir de las fotografías y del número de bandas observadas al inicio de la coloración se obtuvieron diagramas que representan el número de bandas en cada carril.

Insectos
Los triatominos fueron recolectados en el municipio de Coyaima, departamento del Tolima, Colombia. Los adultos de R. colombiensis fueron capturados en siete palmas de vino (Attalea butyraceae) y los de R. prolixus dentro de 10 viviendas humanas de las veredas Totarco Dinde y Chenche Cucal del municipio de Coyaima. Los insectos se mantuvieron a 28 ± 1°C, con humedad relativa de 75 a 80% y una fotoperiodicidad de 12/12 horas en una incubadora automática B.O.D. Lab-Line, y fueron alimentados semanalmente sobre gallinas. Para la determinación de las especies se utilizó la clave taxonómica de Lent & Wygodzinsky (1979) (18) y se realizó amplificación por reacción en cadena de la polimerasa (PCR) de genes ADNr

Análisis de datos
De conformidad con el análisis propuesto por Soares et al . (29), se calculó el índice de polimorfismo de hemoproteínas (P) para cada especie, p = 1- Σ(X2), donde X es igual a la frecuencia absoluta de cada perfil de hemoproteínas en la especie sobre el número total de insectos examinados. Resultados El número de perfiles y el patrón de bandeo obtenido a través de la electroforesis de hemoproteínas salivares en geles delgados de almidón para R. colombiensis y R. prolixus

139

Arévalo A., Carranza J.C., Guhl F., Vallejo G.A.

Biomédica 2007;27(supl. 1):137-42

permitió establecer una clara diferencia entre las dos especies (figura 1 y 2). R. prolixus presentó cinco perfiles en el corrido electroforético, designados desde la A hasta la E en las figuras 1 y 2; por otro lado, R. colombiensis mostró tres perfiles (A, B y C) (figuras 1 y 2)

R. prolixus presentó un promedio de 3,1 bandas, con un máximo de cinco y un mínimo de dos; en R. colombiensis solamente se observaron dos bandas en todos las insectos examinados (figuras 1 y 2). Además, se observó que las hemoproteínas salivares de R. colombiensis tienen polaridad negativa, pues corrieron hacia el polo positivo. En R. prolixus, las hemoproteínas presentan carga positiva y negativa, pues en el corrido electroforético fue evidente una atracción hacia ambos polos (figura 1 y 2).
El índice de polimorfismo de las hemoproteínas salivares (p) para las dos especies estudiadas fue de p = 0,7577 en R. prolixus y en R. colombiensis de p = 0,6156. Discusión
Figura 2. Electroforesis en gel delgado de almidón al 8% de hemoproteínas salivares de R. prolixus (canaletas 1 a 7) y R. colombiensis (canaletas 8 a 14). El panel inferior de la figura corresponde a un diagrama que representa las bandas del panel superior.

R. prolixus presentó un índice de polimorfismo de hemoproteínas (p) alto (p = 0,7577) con respecto a R. colombiensis, que presentó un índice inferior

Figura 1. Electroforesis en gel delgado de almidón al 8% de hemoproteínas salivares de R. prolixus (canaletas 1 a 6), R. pallescens (canaletas 7 y 8) y R. colombiensis (canaletas 9 a 14). El panel inferior de la figura corresponde a un diagrama que representa las bandas del panel superior.

(p = 0,6156). Para Soares et al., (29) el índice de polimorfismo de R. prolixus presentó un valor p = 0,7300, inferior en 0,0277 al valor obtenido para esta especie (p = 0,7577) en el presente trabajo. Es probable que esta diferencia se deba a la procedencia de ambas poblaciones, ya que la población utilizada por Soares et al. (29) era originaria de Venezuela, mientras que los R. prolixus utilizados en el presente estudio se recolectaron en la región central de Colombia. Por otro lado, los perfiles electroforéticos de las hemoproteínas pueden reflejar distancias biogeográficas entre las poblaciones estudiadas (28). El valor (p) de R. colombiensis (p = 0,6156) se acerca mucho al índice de polimorfismo de R. pallescens (p = 0,6524) (29), especies éstas morfológicamente similares (20,31). Estos valores estarían reflejando el parentesco filogenético entre estas dos especies pertenecientes al grupo “pallescens”, conformado por R. pallescens, R. colombiensis y R. ecuadoriensis que representa un cline evolutivo desde el norte de Colombia hasta el sur de la cordillera de los Andes, en donde finalmente se originó R. ecuadoriensis en el Ecuador y norte del Perú (31).

140

Biomédica 2007;27(supl. 1):137-42

Nitroforinas de Rhodnius colombiensis y R. prolixus

La electroforesis de hemoproteínas salivares es una técnica fácil y rápida que permite diferenciar especies del género Rhodnius, al cual pertenecen especies epidemiológicamente significativas en la transmisión de los parásitos T. cruzi y T. rangeli en muchas regiones de Colombia. Además, la técnica podría ser útil en casos en que no se pueda diferenciarlas debido a la similitud morfológica de las especies. Por otro lado, podría ser una herramienta útil para los trabajos de encuestas entomológicas y en los programas de control y prevención vectorial, pues mediante ella se podrían identificar las especies de una manera fácil y rápida cuando se encuentren circulando en los ciclos de transmisión silvestre o doméstico en una región geográfica específica. Ello también sería útil cuando se van a emplear estrategias de control vectorial, ya que pueden existir especies silvestres que estén invadiendo las viviendas, como en el caso de R. colombiensis en la cuenca alta del río Magdalena (región central de Colombia), cuyas ninfas de cuarto, quinto estadio, hembras y machos han sido encontradas durante trabajos previos en viviendas y construcciones peridomiciliares de zonas en donde se adelantan programas de control tendientes a eliminar a R. prolixus , el principal vector domiciliado en Colombia (datos no publicados). La técnica de electroforesis de hemoproteínas es una herramienta que permite diferenciar especies de triatominos de una forma fácil, sin embargo, es importante durante el procedimiento de coloración registrar inmediatamente el número original de las bandas, pues la intensidad de las mismas va disminuyendo con el tiempo. En conclusión, estos resultados demuestran la utilidad de la técnica para la diferenciación entre R. prolixus y R. colombiensis y como complemento de métodos morfométricos y moleculares previamente utilizados para diferenciarlas. Conflicto de intereses El primer autor y los coautores del presente artículo declaramos que no teníamos conflictos de intereses de orden académico, institucional u operacional en el momento de realización de la investigación.

Financiación Este trabajo recibió financiación del Instituto Colombiano "Francisco José de Caldas" (Colciencias), proyecto 105-05-279-99, y del Fondo de Investigaciones de la Universidad del Tolima. También recibió apoyo internacional de la Red ECLAT (European Community–Latin-American Network for Research on the Biology and Control of Triatominae). Referencias
1. Stark KR, James AA. The salivary glands of disease vectors. En: Beaty BJ, Marquardt WC, editors. The biology of disease vectors. Colorado: Colorado University Press; 1996. p. 333-48. 2. Ribeiro JM. Role of saliva in blood feeding by arthropods. Annu Rev Entomol 1987;32:463-78. 3. Law JH, Ribeiro JM, Wells MA. Biochemical insights derived from diversity in insects. Annu Rev Biochem 1992;61:87-111. 4. Montfort WR, Weichsel A, Andersen JF. Nitrophorins and related antihemostatic lipocalins from Rhodnius prolixus and other blood-sucking arthropods. Biochim Biophys Acta 2000;1482:110-8. 5. Francischetti IM, Ribeiro JM, Champagne D, Andersen J. Purification, cloning, expression and mechanism of action of a novel platelet aggregation inhibitor from salivary gland of the blood-sucking bug, Rhodnius prolixus. J Biol Chem 2000;275:12639-50. 6. Sarkis JJ, Guimarães JA, Ribeiro JM. Salivary apyrase of Rhodnius prolixus. Kinetics and purification. Biochem J 1986;233:885-91. 7. Champagne DE, Nussenzveig RH, Ribeiro JM. Purification, partial characterization and cloning of nitric oxide-carrying hemeproteins (nitrophorins) from salivary glands of the blood-sucking insect Rhodnius prolixus. J Biol Chem 1995;270:8691-5. 8. Andersen JF, Montfort WR. The crystal structure of Nitrophorin 2. A trifunctional antihemostatic protein from the saliva of Rhodnius prolixus . J Biol Chem 2000;275:30496-503. 9. Valenzuela JG, Walker FA, Ribeiro JM. A salivary nitrophorin (nitric-oxide-carrying hemoprotein) in the bedbug Cimex lectularius. J Exp Biol 1995;198:1519-26. 10. Valenzuela JG, Ribeiro JM. Purification and cloning of the salivary nitrophorin from the hemipteran Cimex lectularius. J Exp Biol 1998;201:2659-64. 11. Ribeiro JM, Hazzard JM, Nussenzveig RH, Champagne DE, Walker FA. Reversible binding of nitric oxide by a salivary heme protein from a bloodsucking insect. Science 1993;260:539-41.

141

Arévalo A., Carranza J.C., Guhl F., Vallejo G.A.

Biomédica 2007;27(supl. 1):137-42

12. Ribeiro JM, Walker FA. High affinity histamine-binding and antihistaminic activity of the salivary nitric oxidecarrying heme protein (nitrophorin) of Rhodnius prolixus. J Exp Med 1994;180:2251-7. 13. Ascenzi P, Nardini M, Bolognesi M, Montfort WR. Nitrophorins. Lipocalin-based heme proteins transporting nitric oxide. Biochem Mol Biol Educ 2002;30:68-71. 14. Walker FA. Nitric oxide interaction with insect nitrophorins and thoughts on the electron configuration of the {FeNO} 6 complex. J Inorg Biochem 2005;99: 216-36. 15. Moncada S, Radomski MW, Palmer RM. Endotheliumderived relaxing factor: identification as nitric oxide and role in the control of vascular tone and platelet function. Biochem Pharmacol 1988;37:2495-501. 16. Ribeiro JM, Schneider M, Guimarães JA. Purification and characterization of prolixin S (nitrophorin 2), the salivary anticoagulant of the blood-sucking bug Rhodnius prolixus. Biochem J 1995;308:243-9. 17. Moreira FM, Coelho HS, Zingali RB, Oliveira PL, Masuda H. Changes in salivary nitrophorin profile during the life cycle of the blood-sucking bug Rhodnius prolixus. Insect Biochem Mol Biol 2003;33:23-8. 18. Lent H, Wygodzinsky P. Revision of Triatominae (Hemiptera, Reduviidae), and their significance as vectors of Chagas’ disease. Bull Am Mus Nat Hist 1979;163:123-520. 19. Carcavallo R, Galíndez I, Jurberg J, Lent H. Atlas of Chagas’ disease vectors in the Americas. Río de Janeiro: Editora Fiocruz; 1998. p.53-72. 20. Moreno J, Galvão C, Jurberg J. Rhodnius colombiensis sp. n. da Colômbia com quadros comparativos entre estructuras fálicas do género Rhodnius Stal. 1859 (Hemiptera, Reduviidae, Triatominae). Entomol Vect 1999;6:601-17. 21. Harry M, Galíndez I, Cariou ML. Isoenzyme variability and differentiation between Rhodnius prolixus , R. robustus and R. pictipes, vectors of Chagas disease in Venezuela. Med Vet Entomol 1992;6:37-43. 22. Chavez T, Moreno J, Dujardin JP. Isoenzyme electrophoresis of Rhodnius species: a phenetic approach to relationships within the genus. AnnTrop Med Parasitol 1999;93:299-307.

23. Dujardin JP, Chavez T, Moreno JM, Machane M, Noireau F, Schofield CJ. Comparison of izoenzyme electrophoresis and morphometric analysis for phylogenetic reconstruction of the Rhodniini (Hemiptera: Reduviidae: Triatominae). J Med Entomol 1999;36:653-9. 24. Catalá S, Schofield C. Antennal sensilla of Rhodnius. J Morphol 1994;219:193-203. 25. Stothard JR, Yamamoto Y, Cherchi A, Garcia AL, Valente SA, Schofield CJ, et al. A preliminary survey of mitochondrial sequence variation in Triatominae (Hemiptera: Reduviidae) using polymerase chain reaction-based single strand conformational polymorphism (SSCP) analysis and direct sequencing. Bull Entomol Res 1998;88:553-60. 26. Lyman DF, Monteiro FA, Escalante AA, CordonRosales C, Wesson DM, Dujardin JP, et al. Mitochondrial DNA sequence variation among triatomine vectors of Chagas disease. Am J Trop Med Hyg 1999;60:377-86. 27. Jurberg J. Uma abordagem filogenética entre os Triatomineos baseada nas estruturas fálicas. In: Schofield CJ, Dujardin JP, Jurberg J, editors. Proceedings of the International Workshop on Population Biology and Control of Triatominae, Santo Domingo de los Colorados, Ecuador. Mexico D.F: INDRE; 1996. p.45-50. 28. Soares RP, Gontijo NF, Romanha AJ, Diotaiuti L, Pereira MH. Salivary heme proteins distinguish Rhodnius prolixus from Rhodnius robustus (Hemiptera: Reduviidae: Triatominae). Acta Trop 1998;71:285-91. 29. Soares RP, Sant’Anna MR, Gontijo NF, Romanha AJ, Diotaiuti L, Pereira MH. Identification of morphologically similar Rhodnius species (Hemiptera: Reduviidae: Triatominae) by electrophoresis of salivary heme proteins. Am J Trop Med Hyg 2000;62:157-61. 30. WHO. Control of Chagas’ disease. Geneve: World Health Organ Tech Rep Ser. 811; 1991. p.95. 31. Schofield CJ, Dujardin JP. Theories on the evolution of Rhodnius. Actualidades Biológicas 1999;21:183-97. 32. Jaramillo C, Montaña MF, Castro LR, Vallejo GA, Guhl F. Differentiation and genetic analysis of Rhodnius prolixus and Rhodnius colombiensis by rDNA and RAPD amplification. Mem Inst Oswaldo Cruz 2001;96:1043-8.

142

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

REVISIÓN DE TEMA

Actualización de la distribución geográfica y ecoepidemiología de la fauna de triatominos (Reduviidae: Triatominae) en Colombia
Felipe Guhl, Germán Aguilera, Néstor Pinto, Daniela Vergara
Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT), Facultad de Ciencias, Universidad de los Andes, Bogotá, Colombia. La información de 10 departamentos del total de 31 que contempla este manuscrito, ha sido publicada en “Memorias Primer Taller Internacional Sobre Control de la Enfermedad de Chagas. Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas, Bogotá; 2005. p.25-41.

La presente publicación recopila la información de registros de triatominos y datos sobre infección natural con tripanosomátidos a nivel departamental y municipal, publicada hasta la fecha así como la reportada por los servicios departamentales de salud e institutos de investigación. Se presentan figuras elaboradas de acuerdo a la información suministrada por los registros y una clasificación de la fauna triatomínica de acuerdo a las condiciones ecoepidemiológicas del país, teniendo en cuenta la altitud como factor determinante en la distribución de estos insectos. Teniendo en cuenta la frecuencia con que se reportan en el domicilio y peridomicilio, se consideran las siguientes especies como las de mayor riesgo de transmisión en Colombia: Rhodnius prolixus, Triatoma dimidiata, Triatoma maculata y Triatoma venosa. Se resalta la importancia de la vigilancia entomológica como herramienta indispensable para reforzar las estrategias de control de la transmisión de la enfermedad de Chagas, permitiendo también la evaluación del riesgo que representan las especies de triatominos silvestres en Colombia. Palabras clave: Triatominae, ecología de vectores, ubicaciones geográficas, enfermedad de Chagas, control vectorial. Updated geographical distribution and ecoepidemiology of the triatomine fauna (Reduviidae: Triatominae) in Colombia Information concerning triatomine records from provinces and municipalities was accumulated— including data indicating natural infections with trypanosomatides—that has been previously published or reported by Colombian provincial health services and research institutes. Altitude appeared to be the main factor responsible for the distribution of the insects. Illustrations summarize the information provided by the above records. A triatomine fauna classification is presented that corresponds to the eco-epidemiological conditions of the country, considering altitude as the factor determining the geographical distribution of these vectors. Rhodnius prolixus, Triatoma dimidiata, Triatoma maculata and Triatoma venosa are considered the major transmission risk species in Colombia, according to the frequency in which they are reported inside dwellings and peridomiciliary areas. Entomological surveillance providess a necessary tool to reinforce the control strategies for Chagas disease. This also allows the evaluation of transmission risk that the sylvatic triatomines represent in Colombia. Key words: Triatominae; ecology, vector; geographic locations; Chagas disease; vector control.

143

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

La tripanosomiasis americana es una zoonosis muy compleja; el parásito Trypanosoma cruzi presenta una gran variedad de cepas e infecta a través de los triatominos vectores a 150 especies de 24 familias de animales domésticos y silvestres (1). La existencia de la enfermedad de Chagas humana es un hecho puramente accidental. En la medida en que el hombre fue entrando en contacto con los focos naturales y provocó desequilibrios ecológicos, forzó a los triatominos silvestres infectados a ocupar viviendas humanas, llevándose a cabo el proceso de domiciliación, ya que allí no solamente encuentran refugio, sino también suficiente alimento en la sangre humana y de animales domésticos. De esta manera, el hombre entra a formar parte activa de la cadena epidemiológica de la enfermedad de Chagas (Guhl F, Aguilera G, Pinto N, Vergara D. Distribución geográfica de las especies de triatominos en los departamentos endémicos para la enfermedad de Chagas en Colombia. En: Felipe Guhl. Memorias Primer Taller Internacional Sobre Control de la Enfermedad de Chagas. Curso de Diagnóstico, Manejo y Tratamiento de la enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas, Bogotá; Corcas Editores, 2005. p. 25-41). La enfermedad, asociada con la pobreza y las malas condiciones de vivienda, además de por los insectos triatominos, se transmite a través de transfusiones de sangre contaminadas por el parásito y también congénitamente de madre infectada a hijo. Son de especial importancia epidemiológica aquellos vectores que se encuentran domiciliados y los que están en proceso de domiciliación (1). El estimativo de la prevalencia de la infección humana por Trypanosoma cruzi en Colombia es de 1’300.000 habitantes; alrededor de 3’500.000 individuos están bajo riesgo de adquirir la infección de acuerdo a la distribución geográfica de los
Correspondencia: Felipe Guhl, Departamento de Ciencias Biológicas, Universidad de los Andes, Bloque A (Of.201), A.A. 4976, Carrera 1ª N° 18A -10 Bogotá, Colombia. Tel/Fax: +57 1 3324540. fguhl@uniandes.edu.co Recibido: 10/02/06; aceptado: 26/06/06

insectos vectores. Si se tiene en cuenta que el principal mecanismo de transmisión de la enfermedad de Chagas es a través del contacto del hombre y los animales reservorios con los insectos vectores, el conocimiento de la distribución de los triatominos es de gran importancia para poder encaminar de manera adecuada las medidas de control y prevención (2). Factores ecoepidemiológicos que determinan la distribución de los triatominos Hay dos factores importantes en la distribución de los Triatominae: primero, el grupo es principalmente tropical y subtropical, y segundo, está restringido al hemisferio occidental y a la región oriental, encontrándose completamente ausente de las regiones paleártica y etiópica, sin considerar a Triatoma rubrofasciata, especie dispersada por el hombre que toca marginalmente la región australiana. Las regiones tropicales y subtropicales de Sur América son el centro de la diversidad de la subfamilia (3). Dos terceras partes del territorio de Colombia están ubicadas en la zona intertropical o ecuatorial que se caracteriza por dos épocas de lluvia y dos épocas secas en un mismo año. La duración de la radiación solar es prácticamente igual durante todo el año. La conformación montañosa derivada de la trifurcación andina, que se extiende a través de todo el país desde el suroeste hasta el noreste abarcando el territorio montañoso con sus valles interandinos de diferentes alturas y climas, ofrece un ambiente muy favorable para la domiciliación de varias especies de triatominos. Esta región también se caracteriza por ser la zona más densamente poblada del país. Distribución de las especies de triatominos adaptadas al hábitat humano de acuerdo a las condiciones ecoepidemiológicas La ubicación de Colombia y su orografía determinan las diferencias en el clima y los ecosistemas, generando seis grandes regiones biogeográficas que se caracterizan por su fisiografía, vegetación y suelos, lo que se relaciona con la presencia y distribución de los triatominos (Guhl F, Pinto N, Aguilera G. Distribución y ecoepidemiología de los triatominos vectores de

144

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

la enfermedad de Chagas en Colombia. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical, Biomédica. 2005; 25:76-9). A continuación se hace una primera aproximación a la distribución de los principales triatominos adaptados al hábitat humano de acuerdo con las condiciones geográficas y teniendo en cuenta que su distribución en Colombia está determinada por factores altitudinales (4) (la cota que limita su distribución es de 2.000 msnm). 1. Las llanuras del Caribe, con clima ambiental que va desde semihúmedo hasta árido. Allí se encuentran ampliamente distribuidas Triatoma maculata (en vías de domiciliación) y Rhodnius pallescens (especie de hábitos silvestres). 2. La costa del Pacífico, con clima ambiental húmedo y superhúmedo, no representa una región que permita albergar especies de triatominos de importancia epidemiológica. 3. La región Andina, que presenta sub-regiones con diferentes cinturones horizontales y verticales de clima, vegetación y suelos, incluye los valles interandinos y constituye la región de mayor densidad de asentamientos humanos del país. Aquí se encuentran ampliamente distribuidas las principales especies de triatominos domiciliados, Rhodnius prolixus, Triatoma dimidiata y T. venosa; en los valles interandinos a lo largo del río Magdalena se encuentran ampliamente distribuidas especies silvestres como Rhodnius colombiensis. 4. Los llanos de la Orinoquía se caracterizan por extremos de sequía y humedad durante el año. Las especies domiciliadas predominantes son R. prolixus, T. dimidiata y T. maculata. Varios reportes demuestran la existencia de R. prolixus silvestre asociado a palmas tanto silvestres (Attalea butyracea, Maximiliana elegans y Mauritia flexulosa) como de cultivos agroindustriales (Elaeis guineensis). 5. La selva de la Amazonía colombiana presenta un clima frecuentemente húmedo y caluroso durante todo el año y registra muy pocos triatominos domiciliados. Rhodnius brethesi,

R. prolixus y R. pictipes son las especies silvestres de mayor distribución. Solamente se ha reportado un caso de R. prolixus domiciliado.
6. En la Sierra Nevada de Santa Marta, que comprende todos los pisos térmicos hasta las nieves perpetuas, se encuentran bien distribuidos R. prolixus y T. dimidiata domiciliados. Hay registros de T. maculata y T. dimidiata silvestres. La figura 1 muestra la distribución de las especies de triatominos más adaptadas al hábitat humano en Colombia según las zonas descritas.

Vectores de la enfermedad de Chagas en Colombia
De las 24 especies de triatominos presentes en Colombia, 15 se han encontrado con infecciones naturales por T. cruzi (cuadro 1): Panstrongylus geniculatus, Panstrongylus lignarius, Panstrongylus rufotuberculatus, T. dimidiata, Triatoma dispar, T. maculata, T. venosa, R. brethesi, R. colombiensis, R. pallescens, R. pictipes, R. prolixus, Eratyrus cuspidatus, Eratyrus mucronatus, Cavernicola pilosa. La presencia de Trypanosoma rangeli en áreas endémicas para T. cruzi constituye un factor epidemiológico de importancia, dado que comparten algunos insectos vectores y huéspedes mamíferos, incluido el hombre. A pesar de que T. rangeli se ha considerado como no patógeno para el huésped mamífero, su ciclo de vida aún no se conoce y su presencia tanto en las heces de los triatominos como en la sangre de los mamíferos puede constituir una fuente de error en el diagnóstico. Desde el punto de vista epidemiológico es importante conocer su distribución dado que sí es patógeno para los insectos vectores que infecta. De las 24 especies de triatominos presentes en Colombia, siete se han encontrado con infecciones de T. rangeli (37): R. colombiensis, Rhodnius dalessandroi , R. pallescens , R, prolixus , R. robustus, T. dimidiata y E. mucronatus. Las principales especies que transmiten T. cruzi en Colombia son R. prolixus y T. dimidiata, las

145

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

cuales presentan un ciclo epidemiológico muy complejo que no sólo involucra una distribución en el domicilio sino también en el peridomicilio y en hábitats silvestres. Las poblaciones de insectos no domiciliadas causan dificultad en el control, pues pueden ser fuente de infestación o de reinfestación de las viviendas ya intervenidas con insecticidas y, por lo tanto, hay posibilidad de que se reinicíe el ciclo de transmisión a los humanos.

F. Memorias Primer Taller Internacional Sobre Control de la Enfermedad de Chagas. Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas, Bogotá; Corcas Editores: 2005. p.25-41). Estos hallazgos merecen consideraciones similares a las ya expuestas para R. prolixus. Las especies que no representan riesgo de transmisión al hombre, y que conservan hábitos silvestres específicos, pueden resumirse de la siguiente forma: Psamolestes arthuri en nidos de aves, palmas o debajo de la corteza de árboles muertos; Panstrongylus lignarius en nidos de aves; Cavernicola pilosa en cuevas o árboles y palmas donde habitan murciélagos; Belminus rugulosus en palmas; R. colombiensis en palmas; T. dispar en zonas boscosas, y Microtriatoma trinidadensis bajo de la corteza de árboles muertos. En el cuadro 1 se presenta el resumen de la recopilación de toda la información actualizada sobre los registros de las especies de triatominos presentes en Colombia y su infección natural con tripanosomátidos a nivel departamental y municipal según actualización y modificación de Molina J et al. (4). Distribución geográfica de los triatominos en Colombia En los últimos años se ha hecho evidente el interés de los grupos de investigación en la epidemiología de la enfermedad de Chagas en Colombia. De igual manera, el personal de los servicios de salud ha adquirido un mayor conocimiento sobre la fauna de triatominos y la importancia de los programas de vigilancia y control. Estos hechos han permitido aumentar el registro de nuevas especies de triatominos en el país y aumentar de manera considerable el número de registros en nuevas localidades a nivel nacional. Teniendo en cuenta esta información se presentan mapas que indican la distribución de los triatominos por departamento y municipio (figuras 2-11). Las figuras 4, 6, 7, 9 y 11 corresponden a los departamentos que conforman la región andina;

R. prolixus se ha adaptado extremadamente bien a los domicilios humanos; sin embargo, estudios recientes adelantados en el departamento de Casanare han mostrado poblaciones abundantes de R. prolixus silvestres asociadas a palmas nativas, A. butyracea, y a palmas introducidas en cultivos agroindustriales, E. guineensis. Los índices de infección natural por T.cruzi encontrados en los insectos capturados en estas especies de palmeras fueron de 67 y 41%, respectivamente, y los índices de colonización, de 92,8 y 100%, respectivamente.
Estos hallazgos indican la necesidad de instaurar programas de vigilancia entomológica muy activos encaminados a evaluar el riesgo epidemiológico que representan estas poblaciones de insectos silvestres (Guhl F, Pinto N, Marín D, Herrera C, Aquilera G, Naranjo JM, Vallejo G. Primer reporte de Rhodnius prolixus Stal, en Elaeis guineensis, variedad Papúa, en plantaciones agroindustriales de Villanueva, Casanare. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical, Biomédica 2005;25:158-59 y Pinto N, Marín D, Herrera C, Vallejo G, Naranjo JM, Guhl F. Comprobación del ciclo silvestre de Rhodnius prolixus Stal en reductos de Attalea butyracea en el departamento de Casanare. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2005;25:159). De igual manera es importante anotar que también se han reportado poblaciones silvestres de T. dimidiata en algunos municipios del departamento de Boyacá, al igual que en la Sierra Nevada de Santa Marta (Guhl F, Aguilera G, Pinto N, Vergara D. Distribución geográfica de las especies de triatominos en los departamentos endémicos para la enfermedad de Chagas en Colombia. En: Guhl

146

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

Cuadro 1. Registro por departamentos y municipios de las especies de triatominos presentes en Colombia y su infección natural con tripanosomátidos. Departamento Amazonas Especie Municipio El Calderón (Leticia) (5), Leticia (a), (b), Tarapacá (A) El Calderón (Leticia) (5), Leticia (a) ,(b), Puerto Nariño (A, 5), (b) Tarapacá (A) Leticia (A), Puerto Nariño (b) San Carlos (c) Apartadó (B), Chigorodó (B), San Carlos (B, c) San Carlos (c) Amalfi (B) (6) Anori (B), Arboletes (B), Campamento (B) Caracolí (B), Cisneros (B), Cocorna (B), Dabeiba (B), Hispania (B), La pintada (B), Maceo (B), Medellín (7, 8), Murindó (B), Nariño (B), Peque (B), Puerto Berrío (B, b), Puerto Triunfo (B), San Carlos (B,b), San Francisco (B), San Juan de Urabá (B), San Luis (B), San Pedro de Urabá (B), San Rafael (B), San Roque (B), Sonsón (B), Támesis (B), Taraza (B), Urabá (d), Uramita (B), Valdivia (B), Vegachí (B, 9, 10), Yalí (B), Yolombó (B) Puerto Berrío (B, e), San Carlos (c, e), Vegachí (e) Anori (B), Puerto Berrío (B, e), San Carlos (c, e), Vegachí (B, e) Amalfi (B), Anori (B), Arboletes (B), Chigorodo (B), Maceo (B), Necoclí (B), Puerto Berrío (B, 4), Puerto Nare (B), Remedios (B), San Carlos (c, e), San Juan de Urabá (B), San Pedro de Urabá (B), Tarazá (B), Turbo (B, f), Vegachí (B, c), Yalí (B), Yondo (B), Zaragoza(B) Necoclí (B, 9, 10) Apartadó (B), Chigorodó (B), Necoclí (B), Turbo (B) Amalfi (B), Cocorná (B), Dabeiba (B, d, 11), Murindó (B), San Francisco (B) Concepción (B), Nariño (B), San Francisco (B), San Luis (B), Puerto Nare (B, g) Saravena (C) (C, 9, 10), Arauca (I) (C) Arauca (C) Arauca (C), Tame (C), Arauca (I) Arauca (I) Arauca (I) (9, 10, 12) Talaigua Nuevo (B), Cantagallo(B), Santa Catalina (B), Santa Rosa del Sur (B) María la Baja (B), Mompós (B), Morales (B), San Juan Nepomuceno (B), Santa Rosa del Sur (B), Turbacó (B, 9, 10) Las Boquillas (Mompós) (A) (13) Cantagallo (B), Córdoba (B), Mompós (B), Santa Catalina (B), San Juan Nepomuceno (B), Santa Rosa del Sur (B), Talaigua Nuevo (B) Páez (D), San Pablo de Borbur (D, d, 10, h) Páez (D, h) Berbeo (D), Boavita (D), La Victoria (D), Maripí (D), Puerto Boyacá (D), San Pablo de Borbur (D), San Eduardo (D), Santa María (D), Soatá (D), Susacón (D), Zetaquirá (D) Miraflores (D), San Pablo de Borbur (D), Zetaquirá (D) Garagoa (D, h) Almeida (D), Berbeo (D), Boavita (D), Campo Hermoso (D), Chiquinquirá (13, 14), Chitaraque (D), Chivor (D), Covarachía (D), Cubará (D), Garagoa (D, 7, 13), Guateque (D, 7, 13, 14), Guayatá (D, 13, 14), Labranza Grande (D), La Capilla (D), La Uvita (D), Macanal (D), Miraflores (7, 13), Moniquirá (D, 7, 13, 14), Otanche (D, 13), Pachavita (D), Páez (D), Pajarito (13), Pauna (13),

P. geniculatus* R. pictipes* R. prolixus° R. robustus° B. E. E. P. rugulosus¨ cuspidatus¨ mucronatus¨ geniculatus*+

Antioquia

P. humeralis° P.rufotuberculatus° R. pallescens*

R. prolixus° T. dimidiata+ T. dispar* T. venosa*
Arauca

E. mucronatus° R. prolixus¨ R. robustus° T. dimidiata° T. maculata°¨ P. arthuri¨ C. pilosa° T. maculata° E. cuspidatus¨ P. geniculatus¨ R. pallescens¨ R. prolixus° R. robustus° T. maculata¨

Atlántico Bolívar

Boyacá

E. cuspidatus° E. mucronatus° P. geniculatus°

P. rufotuberculatus° R. pictipes° R. prolixus*·+

147

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Departamento

Especie

Municipio Paya (D), Pisba (D), Puerto Boyacá (D), Ramiriquí (13), Rondón (D), San Eduardo (D), San Luis de Galeno (D), San Mateo (D), Santa María (D), Sátiva Norte (D), Soatá (D, c, 13, 14, 15), Somondoco (D), Susacón (D), Sutatenza (D), Tenza (D), Tinjacá (13), Tipacoque (D), Togui (D), Zetaquirá (D, 9, 10, h) Boavitá (D), Campo Hermoso (D), Chiscas (D), Chitarque (D), Guayatá (13), La Uvita (D), Miraflores (13), Moniquirá (D), Páez (D), Pisba (D), Puerto Boyacá (D), San Eduardo (D), San Mateo (D), Sátiva Norte (D), Soatá (D, 7, 13, 14), Susacón (D), Sutatenza (D), Tipacoque (D), Zetaquirá (D, 9, 13, h) Cubará (D), Páez (D), Paya (D, h) Boavita (D), Campo Hermoso (D), Chinavitá (D), Chivor (D), Garagoa (D), Guateque (D, 13), Guayatá (D, 13), La Capilla (D), La Victoria (D), Macanal (D), Moniquirá (D), Munantá (4), Pachavitá (D), Páez (D), Pisba (D), Ramiriquí (4), San Pablo de Borbu r (D), Santa María (D), Sátiva Norte (D), Soatá (D), Somondoco (D), Susacón (D), Sutatenza (D), Tenza (D), Tinjacá (13), Tipacoque (D), Zetaquirá (9, 10, h) Samaná (A) Belén de los Andaquíes (A), Solano (16, 17) Tres Esquinas (13, g) Doncella (A), Florencia (c, 13, 14), Maguareño (A), Puerto Rico (A), Santa Helena (A, 9, 10) Yopal (G) Nunchía (D), Sabanalarga (D), Tauramena (D), Villanueva (D) Nunchía (D), Poré (D), Villanueva (D), (G) Hato Corozal (D), Sabanalarga (D), Tauramena (D), Villanueva (D, G) Yopal (G) Monterrey (D, G), Paz de Ariporo (D), Villanueva (D) Aguazul( D), Hato Corozal (D), Maní (13, 14), Monterrey (D), Nunchía (D), Orocué (D), Paz de Ariporo (D), Poré (D), Recetor (D), Sabanalarga (D), San Luis de Palenque (D), Támara (D), Tauramena (D), Trinidad (D), Villanueva (D), Yopal (D, G, 9, 10, 14) La Salina (D, G, 9, 10), Sácama (D) Aguazul (D), Hato Corozal (D, g), Monterrey (D), Nunchía (D), Paz de Ariporo (D), Poré (D), San Luis de Palenque (D), Tauramena (D), Villa Nueva (D), Yopal (D, G) Gorgona (9, 10 , 15, 16) El Tambo ver. La Playa (18) Santander de Quilichao (13, e, 17) San Alberto (C), San Martín (C) San Alberto (C), San Diego (C) Aguachica (C), Chiriguaná (C), Agustín Codazzi (C), Chimichagua (C), Curumaní (C), El Paso (C) Gamarra (C), La Paz (C), Pailitas (C), Pelaya (C), Río de Oro (C), San Alberto (C), San Diego (C) Valledupar (C) La Paz (C), San Alberto (C), Valledupar (C, 9, 10) Caserío Los Pajaritos (g), Chimichagua (C), Chiriguana (C), Agustín Codazzi (C), Curumaní (C), Gamarra (C), La Paz (C), Pailitas (C), Pelaya (C), San Martín (C), Tamalameque (C) Chiriguaná (13), El Paso (13), La Jagua (C), Río de Oro (9, 10), San Alberto (C), Valledupar (C) Aguachica (C), Chiriguana (C), Agustín Codazzi (C), Curumaní (C), La Jagua (C), La Paz (C), Pailitas (C), Pueblo Bello (C), Río de Oro (C), San Diego (C), Valledupar (C, g) Astrea (C), Becerri l(C), Agustín Codazzi (C), El Copey (C), El Paso (C), La Jagua (C), La Paz (C), San Diego (C), San Juan del Cesar (9, 10, 12, 19), Valledupar (C)

T. dimidiata*·+

T. maculata° T. venosa*

Caldas Caquetá

R. pallescens° P. geniculatus* R. pictipes¨ R. prolixus* C. pilosa° E. cuspidatus° E. mucronatus° P. geniculatus° P. lignarius° Ps. arthuri° R. prolixus*·

Casanare

T. dimidiata*· T. maculata*+

Cauca

P. geniculatus° T. nigromaculata P. rufotuberculatus* B. herreri° E. cuspidatus° P. geniculatus°

Cesar

R. neivai° R. pallescens¨

R. prolixus*· T. dimidiata¨

T. maculata°

148

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

Departamento Chocó

Especie

Municipio Quibdó (7, 8, 13) (20) San José del Palmar (16) (D) Buenavista (B) Moñitos (B), Planeta Rica (B), Sahún (B), San Andrés Sotavento (B), San Antero (B) Canalete (B), Chinu (B), Cienaga de Oro (B), Los Córdobas (B), Moñitos (B), Planeta Rica (B), Sahún (B), San Carlos (B), San Pelayo (B), Valencia (B) Girardot (13), Tocaima (13), Villeta (9, 10) Medina (D) Medina (D) Agua de Dios (D), Caparrapí (D), La Mesa (D), La Palma (D), Medina (D), Nilo (D), Pacho (D), Paime (D), Paratebueno ( D), San Antonio del Tequendama (D), Tibacuy (D), Tocaima (D), Viotá (D), Yacopí (D, 9, 10) (D) Guayabetal (D), Nilo (D), Pacho (D) Apulo (A), Nilo (A), Viotá (D) Yacopí (D) Medina (i) Agua de Dios (D), Anapoima (D, 7, 13), Anolaima (7, 13, 14), Apulo (7, 13, 14), Cáqueza (7, 13), Choachí (7, 13, 14), El Peñón (D), Fómeque (7, 13, 14), Fosca (D), Fusagasugá (7, 13, 14), Gachalá (D, 9), Gachetá (7, 13), Girardot (7, 13, 14), Guachetá (13), Guaduas (13, 14), Guayabal (13), La Mesa (D, 13, i), La Palma (13, 14, 21), La Unión (Fómeque) (7, 13, 14), La Vega (7, 13, 14), Machetá (7, 13) , Manta (7, 13, 14), Medina (D), Mesitas del Colegio (7, 13), Nariño (7, 13, 14), Nilo (D, 7, 13, 14), Pacho (D, 7, 13, 14, 22), Pandi (13), Paratebueno (D), Puerto Salgar (13, 14), San Antonio de Tena (13, 14, 21), San Antonio del Tequendama (D), Tibacuy (D), Tibiritá (7, 13, 14), Tocaima (D, 13, 14), Ubalá (D), Ubaque (13, 14, 21), Villeta (13), Viotá (7, 10, 13), Yacopí (D, 9, 10) Viotá (i) Guachetá (13), Machetá (9, 10, 13) El Peñón (D), Manta (D), Paime (D), Tibiritá (D), Villagómez (D) Barranco Mina (23, j), Inírida (23, j) Cacahual (24), Inírida (j), Puerto Colombia (24) Barranco Mina (23, j) San José del Guaviare (H) San José del Guaviare (H), San José del Guaviare (H) La Plata (9, 10, 13, 16) Altamira (13), Baraya (7, d), Campoalegre (7, 13), El Hobo (7, 13), Garzón (13), Gigante (7, 13, 14) Neiva (7, 13, 14), Planadas (9, 10, 13) Altamira (13), Garzón (7, 13), Neiva (9, 10) La Plata (16) (19) Maicao (19) Maicao (19) Manaure (14, 21), Rioacha (9, 10, 14) Perijá (g) Barrancas (C), El Molino (C), Fonseca (C), Hato Nuevo (C), Maicao (19), San Juan (C), Urbilla (C, 9, 10, 12, 19), Villanueva (C) El Banco (B, F), Guamal (A, B, F), Santa Marta (D, E, F) Ariguani (B), Cienaga (A, B), El Banco (B, F) Fundación (B), Guamal (A, B)

P. geniculatus° R. pallescens* T. dispar° T. venosa° E. cuspidatus* P. geniculatus° R. pallescens*

Córdoba

Cundinamarca

C. pilosa* E. cuspidatus° E. mucronatus° P. geniculatus°

P. lignarius° P. rufotuberculatus° R. colombiensis° R. pallescens° R. pictipes° R. prolixus*·

R. robustus° T. dimidiata¨ T.venosa°
Guainía

P. geniculatus° R. brethesi* R. prolixus° P. geniculatus R. pictipes R. prolixus P. geniculatus° R. prolixus*· T. dimidiata* T. dispar°

Guaviare

Huila

La Guajira

E. cuspidatus° P. geniculatus° R. neivai° R. prolixus* T. dimidiata· T. maculata° E. cuspidatus° P. geniculatus*

Magdalena

149

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Departamento

Especie

Municipio Pueblo Viejo (B), Santa Marta (B, E, F), Sierra Nevada de Santa Marta (E, F) Santa Marta (B, D, E, F) El Banco (A, B, F), Fundación (B), Guamal (A, F) Pijiño del Carmen (B), San Sebastián (F) Santa Marta (B, D, E, F), Sierra Nevada de Santa Marta (E) Sierra Nevada de Santa Marta (E, F) Aracataca (B), Fundación (B), Pivijay (14, 21), Santa Marta (A, g), Sierra Nevada de Santa Marta (E, F) Aracataca (B), Cienaga (B), Fundación (B), Santa Marta (9, 10, g), Sierra Nevada de Santa Marta (E, F) Guamal (B, F), Pijiño del Carmen (B), San Sebastián de Buenavista (B), Santa Ana (B), Santa Marta (A, E, F, g) El Porvenir (Puerto Gaitán) (24), Granada (9, 10) Puerto Gaitan (D) (9, 10) San Martín (9, 10 ) Acacias (D), El Porvenir (24),Granada (D), La Macarena (D, k), Restrepo (D), Villavicencio (D) El Porvenir (d, 13, g, 24) El Calvario (D, 9) El Porvenir (d, 13, g, 24) San Martín (9, 10, 25) Acacias (D), Cumaral (A), Fuente de Oro (D), Granada (D), Guamal (D), La Macarena (D, k), La Uribe (D), Lejanías (A, D), Mesetas (D), San Carlos de Guarda (D), San Martín (9, 10, 26), Villavicencio (D) Acacias (13, 14), Barranca de Upía (D), Cumaral (13), El Porvenir (12, 24), Fuente de Oro (D), Granada (D), Guamal (13, 14), Guape (Granada) (10), La Macarena (D), Lejanías (D), Mesetas (D), Puerto Gaitán (D), Puerto Lleras (D), Puerto López (13, 14), Restrepo (7, 13, 14), San Antonio (13), San Carlos de Guarda (D), San Juan de Arama (D), San Martín (7, 13), Villavicencio (7, 9, 10, 12, 14), Vista Hermosa (14) Cumaral (27), Restrepo (27) El Porvenir (24) Inda (28), Tumaco (A) (9, 10) Acarí (C), Convención (C), Cúcuta (C), El Carmen (C), Los Patios (C), San Cayetano (C), Santiago (C), Sardinata (C), Teorema (C, 9, 10) Arboledas (C), Cúcuta (C), Durania (C), El Carmen (C), El Zulia (C), Santiago (C), Sardinata (C), Teorema (C), Tibú (14), Villa del Rosario (16). (9, 10) La Esperanza (C) (C) Convención (C), Cúcuta (C, 7, 13, 14), Cucutilla (l), Chinácota (7, 13, 14), Gramalote (13, 14), San Cayetano (13, 14), Santiago (13, 14), Tibú (7, 13, 14), Toledo (13, 14), Villa del Rosario (13, 14), Zulia (9, 10, 14) Cúcuta (C), El Zulia (C). (9, 10) El Carmen C, Toledo (9, 10) Puerto Asís (m), Valle del Guamuez (m, 9, 10) Puerto Asís (m), Puerto Guzmán (m), Puerto Leguízamo (m, 9, 10) Puerto Asís (g, m), Puerto Guzmán (m), Orito (9, 10, g), Villa Garzón (m) Pueblo Rico (16) Sector Aguamansa (D) (n) El Carmen (C), San Vicente de Chucurí (C) Curití (C), Galán (C), San Gil (C), Socorro (C)

P. rufotuberculatus° R. pallescens*+ R. neivai R. prolixus*· T. dimidiata* T. maculata¨
Meta

C. pilosa*+ E. cuspidatus° E. mucronatus° M. trinidadensis° P. geniculatus* P. lignarius* P. rufotuberculatus° Ps. arthuri¨ R. dalessandroi· R. pictipes*

R. prolixus*·+

T. dimidiata° T. maculata¨
Nariño

T. dispar*

Norte de SantanderE. cuspidatus° E. mucronatus*·

P. geniculatus*

R. pallescens° R. pictipes° R. prolixus*·

R. robustus· T. dimidiata°
Putumayo

P. geniculatus° R. pictipes* R. prolixus*+ P. geniculatus° T. dimidiata B. herreri° C. pilosa°

Risaralda San Andrés y Providencia Santander

150

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

Departamento

Especie

Municipio Bolívar (C), El Carmen (C), Pinchote (C), San Gil (C), San Vicente de Chucurí (C), Socorro (C) Barichara (29), Capitanejo (C), Contratación (29), Curití (29), El Carmen (29), El Playón (C), Enciso (C), Málaga (C, 6), Pinchote (29), San Gil (o), San José de Miranda (C), San Vicente del Chucurí (29), Simácota (29), Socorro (9, 10, o) El Carmen (29), San Vicente del Chucurí (29) El Carmen (29), San Vicente de Chucurí (29) Bolívar (C), Contratación (29), El Carmen (29), El Peñón (C), El Playón (C), San Gil (29), San Vicente de Chucurí (29), Socorro (29), Sucre (C) Barbosa (13, 14, 21), Betulia (C), Bolívar (C), Bucaramanga (8, 13), Capitanejo (C), El Carmen (29), Charalá (13, 29), Chimá (29), Cimitarra (9), Coromoro (29), Curití (13, 29), El Peñón (C), Enciso (C), Gambita (29), Guadalupe (29), Guapotá (29), Guavatá (13), Güenza (13, 14), Güepsa (13), Macravita (C), Málaga (7, 13, 14), Miranda (7, 13, 14), Mogotes (13, 29), Molagavita (C), Ocamonte (29), Oiba (7, 13, 14, 29), Onzaga (13, 14, 29), Páramo (29), Piedecuesta (7, 13, 14), Pinchote (13), Puente Nacional (7, 13, 14), Rionegro (7, 13, 14), San Gil (7, 13, 14, 29), San Joaquín (13, 14, 29), San Miguel (C), San Vicente de Chucurí (7, 13, 29), Simácota (29), Socorro (7, 13, 14, 29), Suaita (29), Sucre (C), Valle de San José (13, 29), Vélez (7, 9, 10, 14) (10, 13) Capitanejo (C), Charalá (29), Curití (29), El Carmen (29), El Hato (29), Enciso (C), Guacamayo (C), Guadalupe (C), Macaravita (C), Málaga (13), Mogotes (13, 29), Molgavita (C), Onzaga (13, 14, 29), San Gil (29), San Joaquín (13, 29, 30), San José de Miranda (C), San Miguel (C), San Vicente de Chucurí (29), Socorro (o), Suaita (9, 10, 29) Capitanejo (C) Bolívar (C), Contratación (29), El Carmen (29), Florian (C), Gambita (C), Matanza (C), Onzaga (13), San Gil (29), San Joaquín (13), San Vicente de Chucurí (9, 10, 29), Socorro (29), Suaita (29) Galeras (C, c, d, 9, 10) Coloso (B), Corozal (B), Ovejas (B), San Marcos (B),San Onofre (B), Since (B), Sincelejo (B), Toluviejo (B, d, 10) Caimito (B), Galeras (C, 9, 31), Guaranda (C) , La Unión (C) , San Benito Abad (c), San Marcos (C), San Onofre (C, d, 10, 32) Galeras (9, d, 20) Guamo (13), Honda (d, 10, 33, p) Casablanca (D), Dolores (D), Falan (D), Fresno (D), Iconazo (D), Prado (D), Purificación (D, d, 9, 10, p) Alvarado (D, q), Carmen de Apicalá (D, q), Chaparral (4), Coello (D, q), Coyaima (D, 20, q 34, r, 35), Guamo (D, q), Ibagué (D, q), Icononzo (q) Lerida (D, q) Libano (D, q), Melgar (D), Ortega (D c, 13, q) Prado (D, q) Purificación (D, q) San Luís (D, q) Santa Isabel (D, q) Alvarado (7, 13), Carmen de Apicalá (13), Coello (13, 21), Coyaima (D, c, r, 31), Espinal (13, 14, 21), Flandes (13), Guamo (13), Honda (7, 13), Ibagué (7, 13), Lérida (13), Líbano (13), Mariquita (7, 13), Melgar (7, 13), Natagaima (D, 13), Ortega (7, 13), Prado (7, 13, 14, 22), Saldaña (13, 14), San Antonio Suárez (d, 10) Coyaima (13, p) Villahermosa (D) Palmira (13), Restrepo (9, 10) Buenaventura (9, 10, 16) Buenaventura (9, 13, 16, 35) Cali (13) Buenaventura (16, 36), Calima (15, 16, 28) Caserío Bajo Calima (s)

E. cuspidatus° P. geniculatus°

P. humeralis° P. rufotuberculatus° R. pallescens° R. prolixus*·

R. robustus° T. dimidiata*·

T. maculata° T. venosa*

Sucre

E. cuspidatus* P. geniculatus+ R. pallescens+* T. dimidiata*

Tolima

C. pilosa* P. geniculatus° R. colombiensis*·+

R. prolixus*·

R. robustus*· T. venosa°
Valle del Cauca

C. pilosa* P. geniculatus° P. rufotuberculatus° R. proluxus° T. dispar*

151

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Departamento Vaupés

Especie

Municipio Mitú Mitú Mitú Mitú (A) (A) (A) (A)

E. mucronatus° P. geniculatus° R. pictipes° R. prolixus° P. lignarius° R. prolixus¨ T. maculata°

Vichada

(13, e) (13, e) (13, e, h)

* Presencia de T. cruzi; . presencia de T. rangeli; + presencia de Trypanosoma sp; ° sin datos disponibles; ¨ negativos para T. cruzi, T. rangeli y Trypanosoma sp. A Material identificado por el Instituto Nacional de Salud (INS) B Material identificado en el Instituto Colombiano de Medicina Tropical (ICMT) de Medellín. C Material identificado en el Centro de Investigaciones Tropicales (CINTROP) de la Universidad Industrial de Santander. D Material identificado en el Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT) de la Universidad de los Andes, Bogotá. E Material identificado en La Fundación Salud Para el Trópico (FSPT) F Material identificado en el Laboratorio Departamental de Salúd Pública del Magdalena (LDSP). G Material identificado por Grupo ETV, Secretaría de Salud de Casanare. H Material identificado por la Secretaria de Salud del Guaviare (Primer informe de la presencia de vectores de la tripanosomiasis americana o enfermedad de Chagas en el departamento del Guaviare. Fajardo, Torres). I Material identificado por el Laboratorio de Salud Pública Fronterizo – Unidad Administrativa Especial de Salud de Arauca. a. Gualdrón LE, Brochero HL, Arévalo C, Pérez L, Suárez M, Olano VA. Hallazgo de algunos vectores de la enfermedad de Chagas en el departamento del Amazonas. Resúmenes, XXVI Congreso Sociedad Colombiana de Entomología, Santafé de Bogotá; 1999. p.72. b. Rodríguez MH. Etnoconocimiento de los vectores de la enfermedad de Chagas de las comunidades indígenas Ticuna y Huitoto del trapecio amazónico, departamento del Amazonas, Colombia. P. 71-8. En Guhl F, Schofield CJ Editores. Proceedings of the ECLAT-AMCHA International Workshop on Chagas disease surveillance in the Amazon region, Palmari, Brazil. Bogotá; 2004. p.75-82). c. Moreno J. Recientes estudios epidemiológicos de tripanosomiasis americana en diferentes áreas de Colombia. Biomédica 1991;11:43-4. d. Moreno J. Estudios epidemiológicos sobre la enfermedad de Chagas en algunas regiones de Colombia. En: Guhl F, editor. Memorias del curso de postgrado, Genetica poblacional de Triatominos aplicada al Control vectorial de la Enfermedad de Chagas. Santafé de Bogotá: Corcas Editores Ltda.1997. p.35-41. e. Ospina S. Situación actual de la enfermedad de Chagas. En: OPS/OMS/Ministerio de Salud, Dirección de Campañas Directas. III reunión de investigadores de malaria y otras enfermedades tropicales. Rionegro, Antioquia: Ministerio de Salud; 1991. p.69-70. f. Londoño E, Isaza D. Rhodnius pallescens (Barber, 1932) y Trypanosoma cruzi en Urabá. Biomédica 1997;17:66-7. g.Guhl F, Marinkelle CJ, Becerra W, Romero C. Nuevos registros de triatominos en Colombia. Biomédica 1991;11:901. h. Pinto N, Molina J, Zipa N, Cuervo R, Guhl F. Determinación de la distribución de triatominos en el departamento de Boyacá. Resúmenes, XXVI Congreso Sociedad Colombiana de Entomología, Santafé de Bogotá; 1999. p.69. i. Guhl F, Pinto N, Molina J. Nuevos registros de Rhodnius pictipes y Rhodnius robustus (Reduviidae: Triatominae) en Cundinamarca, Colombia. Biomédica 1997;17:152. j. Villegas ME, Manotas LE, Molina J, Guhl F. Primer reporte de la presencia de Rhodnius brethesi Matta, 1919 en Colombia; Resúmenes XXVI Congreso Socolen. Bogotá; 1999. p.68. k. Molina JA, Guhl F, Marinkelle CJ. Primer registro de Rhodnius pictipes y Panstrongylus geniculatus (Reduviidae: Triatominae) En PNN Tinigua, La Macarena, Colombia. Biomédica 1995;15:86. l. Duque S, Peláez D, Gualdrón LE, Villareal E, Corredor A. Aislamiento de tripanosomas a partir de material fecal de Rhodnius prolixus. Biomédica 1986;6:37-9. m. Barreto M, Burbano M.E, Barreto P. Nuevos datos sobre la distribución de Triatominae (Hemiptera: Reduviidae) en el departamento de Putumayo, Colombia. Memorias XI Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2003;23:1:101. n. Guhl F, Cano A, Aguilera G, Pinto N. Primer reporte insular de Triatoma dimidiata (Latreille): isla de Providencia, Colombia. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical, Biomédica 2005;25:103-4. o. Angulo VM, Tarazona A, Arismendi MJ; Joya MI, Sandoval CM. Distribución de triatomineos (Hemiptera: Reduviidae) domiciliarios en 27 municipios de Santander. Biomédica 1997;17:81.

152

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

p. Vallejo G, Jaramillo JC, Silva JC, Castañeda N, Gualtero D, Lozano LE, et al. Implementación de un programa de control de la trasmisión vectorial de la enfermedad de Chagas, municipio de Coyaima, Tolima. Biomédica 1997;17:94-6. q. Carranza J.C, Lozano L, Vallejo G. Distribución y Dinámica Poblacional de Rhodnius colombiensis en la Cuenca alta del Río Magdalena En: Memorias Curso Taller Internacional Sistemas de Información Geográfica, Sensores Remotos y Genética Poblacional de Vectores y Parásitos Aplicados al Control de la Enfermedad de Chagas. Universidad de los Andes, Bogotá; 2002. p.165-9. r. Ospina S. Estudio preliminar de un foco de tripanosomiasis americana en el municipio de Coyaima, departamento de Tolima. En: OPS/OMS/Ministerio de Salud, Dirección de Campañas Directas. III Reunión de investigadores de malaria y otras enfermedades tropicales. Rionegro, Antioquia: Ministerio de Salud. 1991. p.71. s. Barreto M, Burbano ME, Barreto P. Actividad de Triatoma dispar (Hemiptera: Reduviidae) en Hanz, Bajo Calima, Buenaventura, Valle, Colombia. Memorias XI Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2003;23:101-2. ( ) Entre paréntesis aparecen el número y la letra en minúscula de la referencia bibliográfica correspondiente.

Figura 1. Distribución de los principales triatominos asociados al hábitat humano según las zonas biogeográficas.

153

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

la figura 5 contiene la información para la costa Pacífica (departamento del Chocó) e incluye los departamentos de Caldas y Risaralda; la figura 3 corresponde a los departamentos de la región de la llanura del Caribe, incluida la Sierra Nevada de Santa Marta y la isla de Providencia; la figura 2 muestra la distribución de los triatominos en los departamentos de la Amazonia, y las figuras 8 y 10 corresponden a los departamentos de Meta, Casanare y Arauca. Se destaca el nuevo registro de Triatoma nigromaculata, especie recientemente descrita para el departamento del Cauca (27). Molina et al. en el año 2000 (4) predijeron la aparición de esta especie con base en su presencia en países vecinos, en los cambios ambientales y el aumento en las migraciones poblacionales. Los nuevos registros de R. prolixus silvestres infectados con T. cruzi en los departamentos de Casanare, Magdalena y Arauca (figuras 3 y 10) ponen de manifiesto la importancia de reforzar los programas de vigilancia entomológica, sobre todo si se tienen en cuenta sus altos índices de infección natural con el parásito. El departamento de Arauca muestra datos de los especímenes recolectados e identificados por el personal del Laboratorio de Salud Pública Fronterizo, Unidad Administrativa Especial de Salud de Arauca, que indican un aumento considerable en el registro de la fauna triatomínica, incluidos nuevos registros de Ps. arthuri y de R. prolixus silvestre (figura 10) De igual manera, se destaca el primer reporte insular de T. dimidiata en la isla de Providencia (departamento de las islas de San Andrés y Providencia) (Guhl F, Pinto N, Aguilera G. Distribución y ecoepidemiología de los triatominos vectores de la enfermedad de Chagas en Colombia. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2005;25:76-9.). Al compararlos morfométricamente con ejemplares capturados en el interior del país, los ejemplares capturados en un domicilio de la isla corresponden fenotípicamente a ejemplares centroamericanos. Esto indica un alto grado de dispersión humana, comprobándose una vez más

el efecto de la dispersión pasiva en triatominos (figura 3). Por otra parte, los reportes de ejemplares de T. dimidiata (figuras 3, 6 y 11) capturados en hábitats de palmas y cuevas en los departamentos de Santander, Boyacá y Magdalena (Guhl F, Pinto N, Aguilera G. Distribución y ecoepidemiología de los triatominos vectores de la enfermedad de Chagas en Colombia. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica 2005;25:76-9) demuestran la importancia de fortalecer los programas de vigilancia entomológica para que futuros trabajos centren su interés en las especies silvestres como un elemento fundamental en la epidemiología de la enfermedad de Chagas. Los departamentos de Santander, Norte de Santander, Boyacá, Casanare, Tolima y Meta (figuras 4, 6, 8, 10 y 11) continúan siendo las zonas de mayor importancia en cuanto al número de registros. Se confirma igualmente que R. prolixus es la especie con la mayor distribución en el país, seguida por especies del género Triatoma como T. dimidiata, T. maculata y T. venosa. Los nuevos registros de la fauna triatomínica en la Amazonia (figura 2) (Rodríguez MH. Etnoconocimiento de los vectores de la enfermedad de Chagas de las comunidades indígenas Ticuna y Huitoto del trapecio amazónico, departamento del Amazonas, Colombia. En: Guhl F, Schofield CJ. Proceedings of the ECLAT-AMCHA International Workshop on Chagas disease surveillance in the Amazon region, Palmari, Brazil. Bogotá: Corcas Editores; 2004. p.75-82) han contribuido en la implementación de la reciente iniciativa de los países amazónicos. Al igual que las ya existentes (del Cono sur, Andina, Centroamericana y de México), esta iniciativa, creada en el año 2.004 por los Ministerios de Salud de los nueve países amazónicos, pretende fijar políticas y estrategias de vigilancia epidemiológica y control efectivas en la cuenca amazónica. La amplia distribución de P. geniculatus, especie de hábitos eminentemente silvestres, debe tenerse en cuenta de manera especial en los programas de vigilancia, ya que existen reportes de su domiciliación en el municipio de Amalfi,

154

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

Antioquia, (Gualdrón LE, Brochero HL, Arévalo C, Pérez L, Suárez M, Olano VA. Hallazgo de algunos vectores de la enfermedad de Chagas en el departamento del Amazonas. Santafé de Bogotá; Resúmenes XXVI Congreso Sociedad Colombiana de Entomología: 1999. p.72). Igualmente, la demostración del proceso de domiciliación de T. maculata en Santa Marta (Guhl F, Aguilera G, Pinto N, Vergara D. Distribución geográfica de las especies de triatominos en los departamentos endémicos para la enfermedad de Chagas en Colombia. En: Felipe Guhl. Memorias Primer Taller Internacional Sobre Control de la Enfermedad de Chagas. Curso de Diagnóstico, Manejo y Tratamiento de la Enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el Control de la Enfermedad de Chagas, Bogotá; Corcas Editores: 2005. p.25-41), pone de manifiesto la importancia de mantener bajo estricta vigilancia

estas especies, originalmente consideradas como de hábitos silvestres. Los índices de infección natural en 15 de las 24 especies de triatominos registradas en Colombia, la presencia de R. prolixus en 21 departamentos, sumada a la continua acción antrópica sobre los ambientes silvestres que sirven de hábitat a los triatominos selváticos, así como el desplazamiento masivo de poblaciones humanas, constituyen factores determinantes en la aceleración de los procesos de domiciliación de los triatominos. Se espera que la información aquí presentada sirva como herramienta para reforzar las estrategias de control de la enfermedad de Chagas, permitiendo también la evaluación del riesgo que representan las especies de triatominos silvestres en Colombia.

Figura 2. Distribución de las diferentes especies de triatominos en los departamentos que conforman la región de la Amazonia y la Orinoquia.

155

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Figura 3. Distribución de las diferentes especies de triatominos en los departamentos que conforman la región de la llanura del Caribe, incluida la Sierra Nevada de Santa Marta y la isla de Providencia (perteneciente al departamento de San Andrés y Providencia).

Figura 4. Distribución de las diferentes especies de triatominos en los departamentos de Cauca, Huila, Nariño, Tolima y Valle.

156

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

Figura 5. Distribución de las diferentes especies de triatominos en los departamentos de Chocó, Caldas y Risaralda.

Figura 6. Distribución de las diferentes especies de triatominos en los departamentos de Norte de Santander y Santander.

157

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Figura 7. Distribución de las diferentes especies de triatominos en el departamento de Cundinamarca.

Figura 8: Distribución de las especies de triatominos en el departamento del Meta.

158

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

Figura 9. Distribución de las diferentes especies de triatominos en el departamento de Antioquia.

Figura 10. Distribución de triatominos en los departamentos de Arauca y Casanare.

159

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Figura 11. Distribución de las diferentes especies de triatominos en el departamento de Boyacá.

Adendo
Al cierre de esta edición se ha reportado una nueva especie para Colombia, recientemente descrita que corresponde a Belminus corredori (38). Los ejemplares fueron capturados en una vivienda de buena calidad, ubicada en la vereda Puente Tierra en el municipio de San Gil, departamento de Santander. La región se caracteriza por la presencia de bosque montano seco a una altura de 1.810 metros sobre el nivel del mar. Con este nuevo registro se completan 25 especies de triatominos en Colombia. Conflicto de Intereses Los autores declaran no tener conflicto de intereses con el contenido del manuscrito. Financiación Este estudio se realizó con el apoyo financiero del Fondo de Investigaciones y Posgrados de la Facultad de Ciencias de la Universidad de los Andes y el CDIA- EC - Chagas Disease Intervention Activities - Contract N° ICA4CT-200310049.

Referencias
1. Schofield CJ, Diotaiuti L, Dujardin JP. The process of domestication in triatominae. Mem Inst Oswaldo Cruz 1999;94(Suppl.1):375-8. 2. Padilla J, Guhl F, Soto J, Alvarez G. Diagnóstico y terapéutica de las enfermedades transmitidas por vectores en Colombia. Santafé de Bogotá: Servi Offset Ltda; 1999. 3. Gorla DE, Dujardin JP, Schofield CJ. Biosystematics of Old World Triatominae. Acta Trop 1997;63:127-40. 4. Molina JA, Gualdrón LE, Brochero HL, Olano VA, Barrios D, Guhl F. Distribución e importancia epidemiológica de las especies de triatominos (Reduviidae: Triatominae) en Colombia. Biomédica 2000;20:344-60. 5. Gualdrón LE, Brochero HL, Arévalo C, Pérez LP, Suárez MC, Olano VA. Hallazgo de algunos vectores de la enfermedad de Chagas en el departamento del Amazonas y sus implicaciones en salud pública. Revista Colombiana de Entomología 2001;27:121-7. 6. Wolf M, Arboleda JJ, Gonzalez C, Manotas LE, Rueda AM. Estudio tripanosomiasis americana, municipio de Amalfi, vereda Montebello, 1994. Boletín Epidemiológico de Antioquia 1994:29:302-5. 7. Ucros H. Distribución de los triatominae en Colombia. Rev Fac Med Bogotá 1960;28:181-9.

160

Biomédica 2007;27(supl. 1):143-62

Distribución y ecoepidemiología de triatominos en Colombia

8. Dunn LH. Notes on some insects and other arthropods affecting man and animals in Colombia. Am J Trop Med 1929;9:493-508. 9. D’Alessandro A, Barreto P. Colombia. En: Carvallo RU, Ravinovich JE, Tonn RJ, editores. Factores biológicos y ecológicos de la enfermedad de Chagas. Tomo II. Buenos Aires: Centro Panamericano de Ecología Humana y Salud, Organización Panamericana de la Salud/ Organización Mundial de la Salud; 1985. p.377-99. 10. D’ Alessandro A, Barreto P, Thomas M. Nuevos registros de triatominos domiciliarios y extradomiciliarios en Colombia. Colombia Med 1981:12:75-85. 11. Restrepo M, Morales A, Ferro C. Presencia del Triatoma dispar Lent, 1950. Colombia. Boletín Epidemiológico de Antioquia 1989;14:109. 12. Barreto M, Barreto P. Aves y pitos en Colombia. Cespedesia 1984;13:93-6. 13. Marinkelle CJ. Colombian triatominae an their infestation with trypanosomatid flagellates. Mitt Inst Colombo-Alemán Invest Cient 1972;6:13-29. 14. Ucros H, Rocha H, Duque M. Distribución de triatominae en Colombia. Antioquia Médica 1971;8:707-17. 15. Hernández C. Infección natural del Triatoma capitata Usinger 1939 por el Trypanosoma cruzi. Revista de la Facultad de Medicina 1947;15:465-80. 16. Barreto P, Barreto M, Hurtado C. Nuevos hallazgos en Colombia de Panstrongylus geniculatus (Latreille, 1811) y Triatoma dispar Lent 1950 (Hemiptera: Reduviidae). Colombia Med 1988;19:64-7. 17. Minter-Goedbloed E, Mister DM, Cadena A, Howells RE. First record of Trypanosoma (Schizotrypanum) cruzi from western Amazon basin, Caquetá, Colombia. Trans R Soc Trop Med Hyg 1987;81:612. 18. Vasquez LR, Galvão Cleber, Pinto N, Granados H. Primer registro de Triatoma nigromaculata (Stål, 1859) (Hemiptera, Reduviidae, Triatominae) para Colombia. Biomédica 2005;25:417-21. 19. Morales A, Ferro C, Isaza de Rodrguez C, Cura E. Encuesta sobre artrópodos de interés médico en La Guajira, Colombia, Suramérica. Biomédica 1987;7:87-94. 20. Moreno J. Estudio de vectores y reservorios de Trypanosoma cruzi en algunas regiones de Colombia. En: Vallejo GA, Carranza JC, Jaramillo JC. Biología, epidemiología y control de la tripanosomiasis americana y leishmaniosis. Ibagué; Lito Ediciones Tolima: 2000. p.19-22. 21. Ucros H, Escallón Al. Ampliación de la distribución de los triatominae en Colombia. Universitas Médicas 1967;4:47-9. 22. Uribe C. Infección del Rhodnius prolixus Stahl por Trypanosoma cruzi y Trypanosoma rangeli. Biomédica 1996;16:87-92.

23. Villegas M, López A, Manotas L, Molina J, Guhl F. Distribución de triatominos (Hemiptera: Reduviidae) en el departamento de Guainía y su papel en la transmisión de Trypanosoma cruzi . Revista Colombiana de Entomología 2001:27:115-120. 24. D’ Alessandro A, Barreto P, Saravia N, Barreto M. Epidemiología de Trypanosoma cruzi en los Llanos Orientales de Colombia. Colombia Med 1985; 16:84-93. 25. Carvallo RU, Barreto P, Duarte CA. Una nueva especie de Rhodnius Stal (Hemiptera, Reduviidae, Triatominae) de Colombia. Biol Dir Malariol San Amb 1976;16:176-83. 26. D’ Alessandro A, Barreto P, Duarte CA. Distribution of triatomine-transmitted trypanosomiasis in Colombia and new records of the bugs and infections. J Med Entomol 1971;8:159-72. 27. Castro AT. Soroprevalencia e conditionantes para doença de Chagas (tripanossomiase americana) regiao de sope da cordilheira Oriental, Estado de Meta, Colombia (Tesis) Sao Paulo: Universidad de Sao Paulo;1993. 28. Loyola EG, Freyre JL, Holguín AF, Sanchez A, Gonzales A, Barreto M. Trypanosoma cruzi infections in sylvatic hosts on the Pacific coast of Colombia. Trans R Soc Trop Med Hyg 1987;81:760. 29. Angulo VM, Gutiérrez R, Rubio I, Joya M, Arismendi M, Esteban L, et al . Triatomineos domiciliados y silvestres: impacto en la transmisión de la enfermedad de Chagas en Santander. En: Angulo VM, editor. Control y manejo de la tripanosomiasis americana. Bucaramanga: Gráficas Trijaimes;1999. p.72-6. 30. Marinkelle CJ. Triatoma dimidiata capitata, a natural vector of Trypanosoma rangeli in Colombia. Rev Biol Trop 1968;15:203-5. 31. López G, Moreno J. Genetic variability and differentiation between populations of Rhodnius prolixus and R. pallescens , vectors of Chagas disease in Colombia. Mem Inst Oswaldo Cruz 1995;90:353-7. 32. Romaña CA, Pizarro JC, Rodas R, Guilbert E. Palm trees as ecological indicators of risk areas for Chagas disease. Trans R Soc Trop Med Hyg 1999;93:594-5. 33. Marinkelle CJ. Developmental stages of Trypanosoma cruzi-like flagellates in Cavernicola pilosa. Rev Biol Trop 1982;30:107-11. 34. Moreno MJ, Galvao C, Jurberg J. Rhodnius colombiensis sp. n. da Colombia, com quiadros comparativos entre estructuras fálicas do genero Rhodnius Stahl, 1859 (Hemiptera, Reduviidae, Triatominae). Entomol Vect 1999;6:601-17. 35. Vallejo GA, Lozano LE, Carranza JC, Sánchez JL, Jaramillo JC, Guhl F, et al. Ecología de los triatominos no domiciliados en Colombia con especial referencia a

161

Guhl F., Aguilera G., Pinto N., Vergara D.

Biomédica 2007;27(supl. 1):143-62

Rhodnius colombiensis en el departamento del Tolima. En: Vallejo GA, Carranza JC, Jaramillo JC. Biología, epidemiología y control de la tripanosomosis americana y leishamniosis. Ibagué: Lito Ediciones Tolima; 2000. p.22-8.
36. Barreto M, Bareto P. Triatoma dispar (hemiptera: Reduviidae), a new record for Colombia. J Med Entomol 1984;21:750.

37. Guhl F, Vallejo GA. Trypanosoma (Herpetosoma) rangeli Tejera, 1920: an updated review. Mem Inst Oswaldo Cruz 2003;98:435-42. 38. Galvao C, Angulo VM. Belminus corredori, a new species of Bolboderini ( Hemiptera: Reduviidae: Triatominae ) from Santander, Colombia. Zootaxa 2006;1241:61-8.

162

Instrucciones para los autores
Biomédica es la revista del Instituto Nacional de Salud de Colombia cuyo fin primordial es la difusión de trabajos originales que contribuyan a ampliar los conocimientos en biomedicina.
una breve descripción del contenido, algunas referencias claves, su probable extensión y el número aproximado de ilustraciones. · La revisión debe incluir un resumen con énfasis en el significado de los hallazgos recientes, una introducción al tema señalando hitos pasados y desarrollos presentes, y los encabezamientos del texto con el objeto de hacer más provechosa su lectura. La revisión debe incluir un análisis crítico de la literatura y datos propios de los autores. El desarrollo del tema queda a discreción del autor pero se aconseja que incluya tablas, esquemas y figuras que hagan ágil el texto y ofrezcan una comprensión más rápida de su contenido. Imágenes en biomedicina: es un trabajo ilustrado con fotografías que muestran y explican de manera didáctica un concepto, una estructura, una enfermedad o un diagnóstico biomédico. Debe incluir un comentario corto que resalte la importancia del tema ilustrado. Haga usted el diagnóstico: pretende retar la capacidad diagnóstica de los lectores, utilizando ilustraciones o fotografías de casos clínicos o de hallazgos microscópicos. Consta de dos partes, la presentación clínica y los hallazgos correspondientes y el diagnóstico correcto; este último aparece en página aparte y debe acompañarse de un comentario actualizado sobre la entidad que se pretende ilustrar. Presentación de casos: son ejemplos de casos clínicos de enfermedades que destacan alguna particularidad llamativa o señalan un hallazgo especial de las mismas, con una revisión breve de la literatura pertinente. Cartas al editor: los lectores pueden solicitar aclaraciones o presentar comentarios sobre el material publicado en la revista. La decisión sobre la publicación de las cartas recibidas queda a discreción del Comité Editorial. Comentarios bibliográficos: son escritos críticos breves sobre libros de biomedicina.

Información general
Biomédica publicará trabajos científicos, escritos en español o en inglés, en las siguientes categorías:
Artículo original: trabajo inédito derivado de una investigación biomédica que aporta información nueva sobre aspectos específicos y contribuye de manera relevante al conocimiento científico. Comunicación breve: es el informe de resultados parciales o finales de una investigación cuya divulgación rápida es de gran importancia o cuyo contenido no satisface los requisitos para considerarlo como un artículo original. Nota técnica: describe en detalle una técnica de laboratorio novedosa o modificaciones realizadas a una técnica ya establecida, enfatizando las ventajas que tiene el procedimiento o la innovación desarrollados. Ensayo: es un manuscrito filosófico, literario o científico que presenta la opinión sustentada del autor sobre un tema específico o de actualidad. Comentario: manuscrito sobre un artículo publicado en la revista. Reseña histórica: es un manuscrito que destaca personajes o sucesos y su contribución al desarrollo de las ciencias biomédicas. Revisión de tema: presenta el estado actual del conocimiento sobre un tema; incluye dos categorías: · · solicitado directamente por el Comité Editorial a personas expertas en el tema; presentado por profesionales interesados en un tema particular; en este caso, se debe enviar una propuesta en la que se indique porqué el tema escogido es pertinente para los lectores de Biomédica, el cual debe incluir

601

Información general sobre los manuscritos
Todo material propuesto para publicación en Biomédica será revisado por el Comité Editorial y enviado para evaluación externa a dos evaluadores o pares científicos; para facilitar este paso, los autores deben enviar el nombre y la dirección de cuatro posibles evaluadores. Los editores informarán al autor principal que su trabajo ha sido recibido; posteriormente, le harán llegar los comentarios de los evaluadores y le harán conocer la decisión final sobre la publicación de su manuscrito. Los autores deben incluir una carta en la que expresen si existen conflictos de interés o si no los hay; de la misma forma, deben incluir una nota sobre la fuente de financiación de la investigación adelantada. La revista Biomédica se reserva el derecho de aceptar o rechazar los artículos y hará sugerencias que tiendan a mejorar su presentación. Una vez que el autor reciba los comentarios de los evaluadores, deberá proceder a contestarlos punto por punto y a incorporar las modificaciones correspondientes en el texto. Si en el transcurso de las 6 semanas siguientes, Biomédica no ha recibido las respuestas de las evaluaciones, se retirará el manuscrito. Una vez aceptado el manuscrito para publicación el Comité Editorial no aceptará modificaciones sobre su contenido. Los originales de los artículos aceptados para publicación permanecerán en los archivos de la revista hasta por un año. Preparación del manuscrito Por favor, cíñase a las indicaciones del International Committee of Medical Journal Editors que se encuentran publicadas como "Uniform requirements for manuscripts submitted to biomedical journals" en Ann Intern Med 1997;126:36-47 o en http://www.icmje.org/index.html. La versión en español se puede consultar en el portal de la revista Acta Médica Colombiana (Acta Med Colomb 1997;22:199-211) o en http:// www.actamedica.com o en la Revista 602

Panamericana de Salud Pública (Rev Panam Salud Pública 2004;15:41-57).
Después de realizadas la edición y la corrección de estilo, los autores recibirán las galeradas del artículo, las cuales deben ser cuidadosamente revisadas y devueltas al Editor en un término máximo de 48 horas. Una vez realizada la publicación, el autor principal recibirá, libre de costo, 5 ejemplares de la revista. El manuscrito debe incluir las siguientes secciones: Hoja de presentación: además del título del trabajo y del título corto para los encabezamientos de las páginas, esta sección debe incluir los nombres completos de los autores, su afiliación y el nombre de la institución donde se llevó a cabo el trabajo. Además, se debe anotar el nombre del autor responsable de la correspondencia con su dirección completa, número telefónico y de fax y dirección electrónica. Resúmenes y palabras clave: el trabajo debe presentar un resumen estructurado (objetivo, métodos, resultados y conclusión) en español y otro en inglés, cada uno de no más de 250 palabras. No se permite el uso de referencias ni se recomienda la inclusión de siglas o acrónimos. Se requiere listar de 6 a 10 palabras clave en cada idioma; consulte los Descriptores en Ciencias de la Salud (DeCS) del índice de la Literatura Latinoamericana y del Caribe en Ciencias de la Salud (LILACS) en la última versión publicada en disco compacto o en http://decs.bvs.br; para verificar las de inglés, consulte los Medical Subject Headings (MeSH) del Index Medicus en http:/ /www.nlm.nih.gov/mesh/meshhome.htm. Texto: todo el manuscrito, incluso la página del título, los resúmenes, las referencias, los cuadros y las leyendas de figuras y cuadros, debe estar escrito a doble espacio, por un solo lado de la hoja, sin dejar espacios extras entre párrafo y párrafo; deje un solo espacio después del punto seguido o aparte. Use la fuente Arial de tamaño 12 y no justifique el texto. Use letra bastardilla o

cursiva para los términos científicos, por favor, no los subraye. Formato electrónico: envíe el manuscrito en Word Perfect o MS Word como procesador de palabra. Las gráficas elaboradas en PowerPoint, MS Word o Word Perfect son de baja resolución; sirven para el proceso de impresión únicamente si son imágenes de líneas, no tienen sombras, ni grises ni colores y se ha enviado una copia impresa en láser de alta calidad; por lo tanto, no incluya en formato electrónico este tipo de imágenes. Las ilustraciones se imprimen en una columna (75 mm) o en dos columnas (153 mm); por consiguiente, se deben enviar las ilustraciones del tamaño en que van a quedar impresas. Si las ilustraciones son en color y las remite en formato electrónico, se deben enviar en archivos CMYK en formato .eps (Encapsulated Postscript); la resolución óptima para los archivos CMYK es de 300 dpi si la imagen no tiene texto incluido; si incluye texto, la resolución recomendada es de 600 dpi y si son de blanco y negro, de 1.200 dpi. La fuente preferida para las gráficas es Helvética. Si sus archivos son de Macintosh, conviértalos a uno de los formatos mencionados. No olvide incluir una lista de los archivos enviados y anotar el programa en que fueron hechos. Referencias bibliográficas: por favor, observe estrictamente las indicaciones de los Requisitos uniformes para manuscritos del área biomédica. Asígnele un número a cada referencia citada del texto, los cuadros y las figuras en orden ascendente. Anote los números de las referencias entre paréntesis y no como índice (superscript). Las comunicaciones personales, los datos sin publicar, los manuscritos en preparación o sometidos para publicación y los resúmenes de trabajos presentados en congresos se deben citar en el cuerpo del artículo entre paréntesis. Consulte la lista de publicaciones periódicas del Index Medicus (http://www.nlm.nih.gov/tsd/serials/ lji.html) para la abreviatura exacta de la revista citada; si la revista no aparece, escriba el título

completo de la revista. Transcriba únicamente los seis primeros autores del artículo, seguidos de et al. Se recomienda la inclusión de referencias nacionales y latino-americanas para lo cual puede consultar Lilacs, Latindex, Sibra, el índice de Colciencias y otras fuentes bibliográficas pertinentes. Cuadros y figuras: elabore los cuadros usando el programa del procesador de palabra que aparece como 'utilidad de cuadros'; absténgase de preparar archivos en columnas o tabulados en el texto mismo del manuscrito. Recuerde que debe enviar una página con los nombres de los archivos. Para las figuras (diagramas, dibujos o ilustraciones) en blanco y negro, envíe el original y dos copias de la ilustración correspondiente. Si son fotografías en blanco y negro, se deben enviar tres copias de excelente calidad; si son transparencias, envíe la diapositiva original y no una copia, junto con dos impresiones en papel (fotocopia o por escáner) de la misma imagen para facilitar el envío de este material a los evaluadores del manuscrito. En las preparaciones de microscopio, recuerde que debe mencionar la coloración y el aumento según el objetivo utilizado, pero no incluya el valor del ocular.

Remisión del manuscrito
El manuscrito debe ser remitido con una carta firmada por todos los autores en la que conste que todos conocen y están de acuerdo con su contenido. Se debe mencionar, igualmente, que el manuscrito no ha sido publicado anteriormente ni se ha sometido a publicación en otra revista. El documento original y las dos copias exigidas deben ser remitidos a los editores a la siguiente dirección: Revista Biomédica Instituto Nacional de Salud Avenida Calle 26 No.51-60 Bogotá, D.C., Zona 6, Colombia, S.A. o Apartado aéreo 80334 u 80080 Bogotá, D.C., Zona 6, Colombia, S.A.

603

BIOMÉDICA

Lista de verificación
Con el fin de comprobar que se han cumplido todas las instrucciones correspondientes a las normas de publicación de la revista Biomédica, le solicitamos nos devuelva debidamente diligenciada esta lista de verificación junto con su manuscrito corregido. Categoría Artículo original ______ Revisión de tema______ Comentario Presentación de caso Carta al editor ______ ______ ______ Comunicación breve______ Reseña histórica______ Nota técnica______ Ensayo ______ ______ ______ ______

Imágenes en biomedicina Haga usted el diagnóstico Reseña bibliográfica

1- Presentación: ___ Texto escrito a doble espacio en fuente Arial de 12 puntos de tamaño, en una sola cara de la hoja, tamaño carta. ___ Páginas numeradas consecutivamente en la esquina inferior derecha. ___ Se remiten 3 copias impresas del artículo y una en medio magnético y se especifican los programas utilizados y las versiones, además de los nombres de archivo. 2- Título: ___ Se incluyen los títulos en español e inglés (máximo 165 caracteres). ___ Se incluye el título abreviado en español (máximo 50 caracteres). ___ Los autores aparecen sólo con su afiliación institucional, sin mencionar cargos ni títulos académicos. ___ El autor de la correspondencia suministró los datos completos: nombre, apellidos, dirección, teléfono, fax y correo electrónico. 3- Resumen: ___ Se incluye el resumen estructurado en español e inglés, con una extensión máxima de 250 palabras y con los siguientes subtítulos: introducción, objetivos, materiales y métodos, resultados y conclusiones. El resumen estructurado es sólo para artículos originales y comunicaciones breves. 4- Palabras clave: ___ De 6 a 10 por artículo en cada idioma. ___ Se incluyen las palabras clave en español e inglés (keywords), indexadas en los Descriptores en Ciencias de la Salud (DeCS), http://decs.bvs.br/E/homepagee.html. 5- Estructura del artículo original: Se incluyen los siguientes apartados: ___ Página de presentación: título en español, título en inglés, título abreviado en español, presentación de los autores y datos completos del autor de correspondencia.

604

___ ___ ___ ___ ___ ___ ___ ___ ___

Resúmenes: en español e inglés. Materiales y métodos. Resultados. Discusión. Agradecimientos. Declaración de conflicto de intereses. Fuente de financiación. Referencias. Cuadros y figuras con sus respectivas leyendas.

6- Figuras: ___ Se incluye cada una en página aparte. ___ Se incluyen las leyendas correspondientes en hoja aparte. 7- Cuadros: ___ Se adjuntan en hoja aparte, elaborados en el modelo más sencillo de tablas del programa Word y las copias en impresora láser. ___ Se ordenan secuencialmente. ___ Se incluye el título correspondiente. 8- Fotografías: ___ Se adjuntan tres copias. ___ Se señala la identificación de la misma y la orientación al respaldo. ___ Se acompañan del correspondiente pie de foto en hoja aparte. 9- Referencias: ___ Las citas se numeran según orden de aparición en el texto. ___ Se ordenan secuencialmente y en el formato adecuado, tal y como lo indican las normas de Biomédica en las instrucciones a los autores (http://www.icmje.org/index.html). ___ Cuando se citan referencias en los cuadros, éstas deben seguir el orden con el que se venía en el texto. 10- Abreviaturas y siglas: ___ Se anota entre paréntesis después de la primera vez cuando debe aparecer en formacompleta y en el idioma original. 11- Nomenclatura: ___ ___ Los nombres de género y especie están escritos en letra cursiva. Los nombres de microorganismos se escriben completos la primera vez que se citan, incluso en el título y en el resumen, y luego se usa la solamente inicial del género y permanece el nombre completo de la especie.

12- Consideraciones generales: ___ Carta firmada por todos los autores. ___ Incluye autorización del Comité de Ética para la experimentación en humanos. ___ Incluye autorización del Comité de Ética para la experimentación en animales. ___ Los autores deben certificarle al Comité Editorial que la (s) persona (s) mencionada (s) en los agradecimientos tiene (n) conocimiento y está (n) de acuerdo con aparecer en ellos. ___ Todos los manuscritos deben incluir declaración de conflicto de intereses y fuente de financiación. ___ Los decimales en español deben separarse de los enteros por comas, no por puntos. ___ Se envían los nombres de 4 evaluadores con sus respectivos datos.

605

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->