Crecemos Contigo

Sistema de Universidad Abierta
DOCENTES : Luis Alberto Sánchez Angulo José Luis Gutierrez Aponte ATENCIÓN AL ALUMNO TELEFAX : : 043-327846


Edición Universidad Católica Los Ángeles de Chimbote. Leoncio Prado 453. Chimbote (Perú) Reservados todos los derechos. No se permite reproducir, almacenar en los sistemas de recuperación de la información ni trasmitir alguna parte de esta publicación, cualquiera que sea el medio empleado -electrónico, mecánico, fotocopia, grabación, etc.- sin el permiso previo de los titulares de los derechos de la propiedad intelectual.

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Presentación …………………………………………… …………………………………… xiii

LA BIOLOGÍA Y LOS SERES VIVOS Campos de estudio de la biología ………………………………………………………… Ramas relacionadas de la biología ……………………………………………………….. Aplicación de la biología …………………………………………………………………… Los seres vivos ……………………………………………………………………………… Características de los seres vivos ………………………………………………………… Los virus ¿organismos vivos o muertos? ………………………………………………….. Niveles de organización de los seres vivos ……………………………………………… Clasificación de los seres vivos …………………………………………………………… Mapa conceptual: La materia viva y su organización …………………………………. COMPONENTES QUÍMICOS DE LA MATERIA VIVIENTE Bioelementos: primarios, secundarios y terciarios ……………………………………… Biomoléculas ………………………………………………………………………………… Biomoléculas inorgánicas …………………………………………………………….... El agua ……………………………………………………………………………….. Estructura ………………………………………………………………………… Propiedades ……………………………………………………………... . Funciones ………………………………………………………………………… Sales minerales ……………………………………………………………………... Tipos de sales …………………………………………… ………………………. Biomoléculas orgánicas ………………………………………………………………. Los carbohidratos …………………………………………………………………... Monosacáridos ………………………………………………………………….. Disacáridos ………………………………………………………………………. Polisacáridos …………………………………………………………………….. Mapa conceptual: Los bioelementos y las biomoléculas ……………… ………….…… Mapa conceptual: Los carbohidratos ……………………………………………............. Los lílipos ………………………………………………………………………… …. Las grasas neutras se componen de glicerol y ácidos grasos …………….. Los fosfolípidos, componentes de las membranas celulares ……………… Clasificación de los fosfolípidos ………………………………………………. . Lípidos saponificables ……………………………………………………… Lípidos simples …………………………………………………………. Glicéridos (acilglicéridos) …………………………………………... Céridos ……………………………………………………………….. Lípidos complejos ………………………………………………………. Fosfolípidos …………………………………………………………. Glicerofosfolípidos ………………………………………………
Universidad Católica los Ángeles de Chimbote - ULADECH

01 03 03 04 05 07 08 10 14 15 17 17 17 17 18 19 20 20 21 21 21 22 23 25 26 27 27 29 29 29 29 29 30 30 30 30

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Esfingofosfolípidos ……………………………………………... Glucolípidos ………………………………………………………… Lípidos no saponificables …………………………………………………. Mapa conceptual: Los lípidos ……………………………………………………………… Las proteínas ………………………………………………………………………... Características generales ……………………………………………………… Estructura proteica ……………………………………………………………… Estructura primaria ………………………………………………………….. Estructura secundaria ……………………………………………………… . Hélice alfa ………………………………………………………………... Hélice de colágeno ……………………………………………………… Beta láminas o láminas plegadas ……………………………………... Estructura terciaria .................... ............................................................ Estructura cuaternaria ........................................................................... Aminoacidos .............................................................................. ............ Aminoácidos no proteicos ................................................................ Clasificación de los aminoácidos ..................................................... Desnaturalización de las proteínas .......... ............................................. Como la desnaturalización afecta a los distintos niveles ...................... Propiedades de las proteínas …………………………………………….. Funciones generales ………………………………………………………. Péptidos, polipéptidos y proteínas ……………………………………….. Mapa conceptual: Las proteínas ………………………………………………………….. Las enzimas ………………………………………………………………………... Características generales …………………………………………………….. Propiedades de las enzimas ………………………………………………….. Especificidad de las enzimas …………………………………………………. Constitución química de las enzimas y modo de actuación ………………. Mapa conceptual: La actividad enzimática y la función hormonal …………………….. Ácidos nucleicos …………………………………………………………………… Características generales …………………………………………………….. El enlace fosfodiester …………………………………………………………. El ácido desoxirribonucleico (ADN o DNA) ………………………………… Estructrura del ADN ………………………………………………………... Estructura primaria del ADN ………………………………………………. Estructura secundaria del ADN …………………………………………… Estructura terciaria del ADN en las células eucariotas ………………… Niveles superiores de empaquetamiento ………………………………... Tipos de ADN ……………………………………………………………….. El ácido ribonucleico (ARN o RNA) ………………………………………… Clases de ARN …………………………………………………………….. El ADN y el ARN diferencias a nivel químico ……………………………… Mapa conceptual: El ADN porta dor de la información genética ………………………

30 30 30 31 32 32 33 33 33 33 33 33 33 34 35 37 37 40 40 41 42 42 44 45 45 46 48 49 51 52 52 57 59 59 59 60 63 63 65 65 65 66 67

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

LA CITOLOGÍA O BIOLOGÍA CELULAR Introducción ………………………………………………………… ………………………. Reseña histórica y aportes ……………………………………………………… ………… Campos de estudio …………………………………………………………………… ……. Teoría celular …………………………………………………………………………… ...… La célula ………………………………………………………… …………………………... Clasificación: Célula procariota y célula eucariota …………………………………… Forma y tamaño ……………………………………………… …………………………. Origen de las células …………………………………………………………… ……… Diferencias entre céulas animales y vegetales …………………………………….. Mapa conceptual: La célula unidad estructural y funcional ……………………………. LA MEMBRANA CITOPLASMÁTIC A Composición química ……………………………………… ………………………………. Estructura ………………………………………………………………………………… …. Funciones …………………………………………………………….... ............................. Mapa conceptual: La membrana citoplasmática ………………………………………... EL CITOPLASMA Características generales ………………………………………………………………..… Citoesqueleto ……………………………………………………………... .............. . El citoesqueleto eucariota ……………………………………………………………… Microfilamentos (actina y miosina) ……………………………………………… .. Filamentos intermedios ……………………………………………………………. Organización citológica ………………………………………………………… Farmacología …………………………………………………………………... Microtúbulos ……………………………………………………………… .........….. Mapa conceptual: Las envolturas celulares, el citoplasma y el centrosoma ………… ORGANELOS CELULARES Características generales ………………………………………………………………..... Clasificación ………………………….…… ………………………………………………… Orgánulos autogenéticos ……………………………………………............. ............. Orgánulos endosimbióticos ……………………………………………………………. Estructura de una célula eucariota ……………………………………………….…. .. Retículo endoplasmático ………………………………………………………………….. Características generales ……………………………………………………………… Clasificación: Retículo endoplasmático rugoso y liso………………………………… . Retículo endoplasmático rugoso ....................................................................... Funciones del retículo endoplasm ático rugoso ………………………………. Retículo endoplasmático liso …………………………………………... ................ Funcioes del retículo endoplasmático liso ……………………………………. Aparato de Golgi ……………………………………………………… ………………….... Características generales ………………………………………………………… …... Partes del aparato de Golgi: Cara cis y trans ………………………………………. Funciones generales del aparato de Golgi …………………………………………..
Universidad Católica los Ángeles de Chimbote - ULADECH

69 69 70 70 72 72 75 77 77 79 80 81 82 83 84 84 84 84 85 86 86 86 87 88 88 88 89 89 89 89 89 90 90 91 91 92 92 92 93

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Lisosomas …………………………………………………………………………………... Características generales ………………………………………………………… …... El proceso de digrestión celular: Endocitosis y autofagia …………………………. Peroxisomas ……………………………………………………………… ………………… Características generales …………………………………………………………….. Estructura ……………………………………………………… ………………………. Función ……………………………………………………………… ………………….. Mitocondria ………………………………………………………… ……………………….. Características generales ……………………………………………………… ……... Estructura y composición ……………………………………………………………... Morfología y función ……………………………………………………… …………… Orígenes ……………………………………... .............................................. ............. Ribosoma ................................................................................ .................................... Características generales ..................................................................... ............... Diferencias entre ribosoma eucariota y procariota ............................................... Vacuola ................................................................ ....................................................... Características generales ..................................................... ................................ Vesícula ....................................................... .................................................... ............ Características generales ..................................................................................... Cilio …………………………………………… ………………………………………..……. Características generales …………………………………………………… …….…. Flagelo ……………………………………….. ................................................................. Características generales ………………………………………… ………………….. Mapa conceptual: Los orgánulos celulares (membranosos) …………………………… Mapa conceptual: Los orgánulos celulares (energéticos) …………………………… .. Núcleo celular ………………………………………………… …………………………….. Caracaterísticas generales ………………………………………………… ………… Forma, tamaño y posición ……………………………………………………………. Número …………………………………………………………………………………. Estructura …………………………………………………………………… …………. Envoltura nuclear …………………………………………………… ……………... Cromatina ………………………………………………………… ………………… Nucleoplasma ………………………………………………………………………. Nucleolo ………………………………………………………... ............................ Funciones ……………………………………………… ………………………………. Envoltura nuclear …………………………………………… ………………………… Constitución ………………………………………………………………………… Funciones ………………………………... .......................................................... Dinámica ……………………………………………………………… ……………. Cromatina ………………………………………… ……………………………………. Características generales …………………………………………………………. Formas de la cromatina ……………………………… ....................................... Heterocromatina ………………………….................................................... . Constitutiva ………………………………………………………………….. Facultativa ………………………………………………………………….. Eucromatina …………………………………………………………………….. Nucleoplasma ………………………………………………………… ………………..
Universidad Católica los Ángeles de Chimbote - ULADECH

93 93 94 95 95 95 95 96 96 96 97 97 97 97 98 98 98 99 99 99 99 100 100 101 102 103 103 103 103 103 103 104 104 104 104 104 104 105 105 105 105 106 106 107 107 107 107

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Nucleolo ………………………………………………………………………………… Ultraestructura ……………………………………………………………………… Mapa conceptual: El núcleo y los cromosomas …………………………………………. LA RESPIRACIÓN CELULAR Y FERMENTACIÓN Características generales ………………………………………………………………….. Tipos de respiración celular ……………………………………………………………….. Respiración celular aeróbica …………………………………………………………... El adenosin trifosfato “ATP” ………………………………………………………... ATP y metabolismo …………………………………………………………………. ¿Porqué tienen los enlaces del ATP tanta tendencia a hidrolizarse …………... Nicotinamida Adenin Dinucleótido “NAD” ………………………………………… Flavin Adenina Dinucleótido “FAD” ………………………………………………. .. Reacciones de oxido reducción ……………………………………………………. Reacciones químicas de la respiración aeróbica de la glucosa ……………….. Glucólisis …………………………………………………………………………. Formación de acetilcoenzima A ………………………… …………………….. Ciclo del ácido cítrico …………………………………………………………… Cadena de transporte de electrones y quimiosmósis ………………………. En la glucólisis la glucosa se convierte en dos piruvatos …………………... El piruvato se convierte en acetilcoenzima A ………………………………... El ciclo del ácido cítrico oxida la acetilcoenzima A ………………………….. La cadena de transporte de electrones genera de ATP ……………………. La respiración aeróbica de la glucosa genera de 36 a 38 ATP ……………. Lanzadera a través de la membrana mitocondrial …………………………... La fermentación o respiración celular anaeróbica …………………………………... Usos o beneficios de la fermentación ………………………………………………… Mapa conceptual: El metabolismo celular: anabolismo …………………… …………… Mapa conceptual: El metabolismo de las biomoléculas ………………………………... CICLO CELULAR, MITOSIS Y MEIOSIS CICLO CELULAR Características generales ………………………………………………………………….. Periodos que comprende ………………………………………………………………….. Regulación del ciclo celular ………………………………………………………………... Importancia del ciclo celular ……………………………………………………………….. Interfase “no división celular” ……………………………………………………………… Fase G1 (Growth 1) …………………………………………………………………….. Fase S (Sybthesis) …………………………………………………………………… … Fase G2 (Growth 2) …………………………………………………………………….. Fase M “división celular” ……………………………………………………………….. La cariocinésis “división del n úcleo” ………………………………………………….. LA MITOSIS Características generales ………………………………………………………………….. Importancia ………………………………………………………………………………….. Fases de la mitosis …………………………………………………………………………. Profase ……………………………………………………………………………………
Universidad Católica los Ángeles de Chimbote - ULADECH

107 107 109 110 112 112 113 113 114 114 114 114 115 115 115 115 115 118 121 122 127 129 130 131 132 133 134

135 135 137 138 138 139 139 139 139 140 140 141 141 141

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Metafases ……………………… ………………………………………………………... Anafase …………………………………………………………………………………... Telofase ………………………………………………………………………………….. Citocinésis …………………………………………………………………………………… El cáncer …………………………………………………………………………………….. Definiciones semejantes al cáncer ……………………………………………………. Nomenclatura del cáncer ………………………………………………………………. LA MEIOSIS Definición …………………………………………………………………………………….. Objetivos de la meiosis …………………………………………………………………….. Importancia de la meiosis ………………………………………………………………….. Interfase premeiótica ……………………………………………………………………….. Meiosis I (división reduccional) ………………………………………………………... Profase I ……………………………………………………………………………… Preleptonema (preleptoteno) …………………………………………………… Leptonema (leptoteno) ………………………………………………………….. Cigonema (zigoteno) ……………………………………………………………. Paquinema (paquiteno) …………………………………………………………. Diplonema (diploteno) …………………………………………………………… Diacinesis ………………………………………………………………………… Metafase I ……………………………………………………………………………. Anafase I …………………………………………………………………………….. Telofase I …………………………………………… ………………………………. Intercinesis ………………………………………………………………………….. Meiosis II (división ecuacional) ……………………………………………………….. Profase II …………………………………………………………………………….. Metafase II ……………………………………………………………… ……………. Anafase II …………………………………………………………………………….. Telofase II ……………………………………………………………………………. Meiosis y ciclo vital ……………………………………………………………………… Variabilidad genética ……………………………………………………………………. Anomalías cromosómicas …………………………………………………………………. Monosomía ………………………………………………………………………………. Trisomía ………………………………………………………………………………….. Mapa conceptual: El ciclo celular …………………………………………………………. EL FLUJO DE LA INFORMACIÓN GENÉTICA LA REPLICACIÓN DEL ADN El Principio transformador …………………………………………………………………. ¿En qué consistió el experimento de Frederick Griffith? ……………………… ....... El problema que quería investigar con su experimento …………………………… . ¿Por qué utilizó células muertas? ………………………………………………… ..... ¿Qué transformación experimentan las cepas al estar en contacto con células muertas? ……………………………………………………………………………… ..... Conclusiones …………………………………………………………………………….. Naturaleza química del principio transformador …………………………………….. El experimento de Meselson y Stahl (la replicación semiconservadora) ……………… Teorías que tratabanm de explicar la replicación del ADN …………………………
Universidad Católica los Ángeles de Chimbote - ULADECH

141 141 142 142 144 145 146 147 147 147 148 149 149 149 149 150 150 150 150 151 151 152 152 152 152 152 153 153 155 157 157 158 158 159

160 161 162 162 162 162 163 163 166

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La replicación del ADN …………………………………………………………………….. Características del proceso replicativo ……………………………………………….. Etapas del proceso de la replicación del ADN ………………………………………. Iniciación ……………………………………………………………………………… Elongación (alargamiento) …………………………………………………………. Terminación ……………………………………………………………………… ...... Mapa conceptual: La replicación del ADN ……………………………………………….. EL PROCESO DE LA TRANSCRIPCIÓN O SÍNTESIS DEL ARN MENSAJERO Introducción …………………………………………………………………………………. El proceso de la transcripción …………………………………………………………….. Diferencias entre el ADN y ARN ………………………………………………………….. Mecanismo de la síntesis del ARN ………………………………………………………. . La ARN polimerasa ……………………………………………………………………… .… Etapas del proceso de la transcripción …………………………………………………... Iniciación …………………………………………………………………………………. Elongación (alargamiento) ……………………………………………………………... Terminación …………………………………… ………………………………………… Modificaciones post – transcripcionales …………………………………………………. Modificaciones de los extremos de la molécula de ARNm ………………………… Procesamiento del ARNm (remoción de los intrones) ……………………………… Mapa conceptual: El ARN y la expresión del mensaje genético ………………………. EL PROCESO DE LA TRADUCCIÓN O BIOSÍNTESIS DE PROTEÍNAS Introducción …………………………………………………………………………………. Importancia biomédica ……………………………………………………………………... La información genética fluye del ADN al ARN y de este último a la proteína ………. Tres son los tipos de ARN que se forman ……………………………………………….. El ARNm (mensajero) …………………………………………………………………... El ARNr (ribosómico) …………………………………………………………………… El ARNt (transferencia) …………………………………………………………………. Las etapas de la síntesis proteica ………………………………………………………… Iniciación …………………………………………………………………………………. Elongación (alargamiento) ……………………………………………………………... Reconocimiento ……………………………………………………………………… Transferencia ………………………………………………………………………… Translocación ………………………………………………………………………... Terminación ……………………………………………………………………………… EL CÓDIGO GENÉTICO Introducción …………………………………………………………………………………. El código genético es inequívoco, no traslapante, sin puntuación, degenerado y universal ……………………………………………………………………………………... Hay 61 codones para codificar 20 amin oácidos y por lo tanto hay codones sinónimos ……………………………………………………………………………………. El codón de iniciación es el AUG y el de terminación UAG, UAA y UGA ……………. LA REGULACIÓN GENÉTICA
Universidad Católica los Ángeles de Chimbote - ULADECH

168 169 169 169 170 171 174

175 175 176 177 178 178 178 179 179 180 180 181 182

183 183 184 185 185 185 186 186 186 187 187 187 187 188 190 191 193 193


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Introducción …………………………………………………………………………………. El sistema de operones ……………………………………………………………………. Introducción ……………………………………………………………………………… Clases de genes de los operones …………………………………………………….. Regiones reguladoras de un operón …………………………………………….……. Operones inducibles (operón lactosa), operón represible (operón triptófano) …… La inducción enzimática (operón lactosa) ……………………………………………. El inductor se une a la proteína represora ……………………………………….. Los represores se unen dentro de los promotores e impiden la inserción de la Inserción de la ARN polimerasa …………………………………………………… La represión enzimática (operón triptófano) …………………………………………. Mecanismo del operón ………………………………………… ……………………

195 196 196 197 197 197 198 199 199 199 200

GENÉTICA Introducción ………………………………………………………… ………………………. Definición …………………………………………… ……………………………………….. Historia de la genética …………………………………………………………………… … Aplicaciones de la genética ………………………………………………………………... Conceptos básicos ………………………………………………………… ………………. Generación paterna (P) ………………………………………………… …………………. Generación filial (F) ……………………………………………… ………………………… La molécula hereditaria: el ADN …………………………………………………………... Cromosoma ………………………………… ………………………………………………. Gen …………………………………………………………………………………………… Alelos (genes alelomorfos) …………… …………………………………………………… Genotipo ……………………………………………………………………………………... Genotipo homocigoto o puro …………………………………………………………... Genotipo heterocigoto o híbrido ………………………………………………………. Fenotipo ……………………………………………………………………………………… GENETICA MENDELIANA Principios y leyes de Mendel ……………………………………… ………………………. Los siete caracteres estudiados por Mendel en Phisum sativum …………………….. Principio de la uniformidad y la reciprocidad (Principio de la dominancia) ………….. Ley de la segregación y pureza de los gametos ……………………………………….. Ley de la distribución independiente de los caracteres ………………………………… Mapa conceptual : Genética Mendeliana y humana ……………………………… .. . Mapa conceptual: Mutación y evolucion …………………………………………………. GENÉTICA POSTMENDELIANA CITOGENÉTICA GENERAL Y HUMANA Genética postmendeliana ………………………………………………………………….. Introducción …………………………………………………………………… …………. Dominancia incompleta (herencia intermedia) …………………… …………………... Alelos letales …………………………………………………………………... ..............
Universidad Católica los Ángeles de Chimbote - ULADECH

203 203 203 205 206 207 207 207 208 209 209 209 209 210 210 210 211 211 212 214 218 219

220 220 220 221

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

CITOGENÉTICA GENERAL Definición ………………………………………………………………….. ......................... La célula es una unidad genética ………………………………………………………… Los cromosmas eucarióticos …………………………………………………………….... Constancia del número de cromosomas ………………………….…… ………………... Cromosomas sexuales ……………………………………………………………………. Forma de los cromosomas ………………………………………………………………… Metacéntricos …………………… ………………………………………………………. Submetacéntricos ……………………………………………………………………….. Acrocéntricos ……………………………………………… ………………………......... Telocéntricos ……………………………………………………… .............................. Cariotipo ……………………………………… …………………....................................... Cariotipo clásico ……………………………………… …................................................ BIOTECNOLOGÍA E INGENIERÍA GENÉTICA Biotecnología moderna ……………………………………………………………… …….. Introducción ……………………………………………………… …………………………. Reseña histórica de la biotecnología …………………………………………………….. Los inicios de la transformación de alimentos ……………………………………….. La protección contra las enfermedades …………………………………………….. .. La conservación de alimentos ………………………………………………………… . El nacimiento de la lucha contra las enfermedades ………………………………… El surgimiento de la genética ………………………………………………………….. El papel del ADN en la herencia ………………………………………… ……………. Las fermentaciones industriales ……………………………………………………… . Nueva agricultura ……………………………………………………………… ……….. Plantas de laboratorio ………………………………………………………… ………... La llegada de la ingeniería genética ……………………… ………………………….. La primera compañía biotecnológica …………………………………………………. La biotecnología moderna y la industria ……………………………………………… La biotecnología moderna entra a nuestras vidas …………………………………... Pasos hacia la medicina del futuro ................................................ ......................... Más avances en genética ........................................................................... ............ Tipos de biotecnología ................................................................................... ............. Biotecnología tradicional ................................................................ ........................ Biotecnología moderna ..................................................... ..................................... INGENIERÍA GENÉTICA Características generales ....................................................... ..................................... Tecnología del ADN recombinante ............................................................................. Etapas de la tecnología del ADN recombinante …………………………………….. Plásmidos ………………………………………………………………………………... Bacteriófagos ………………… …………………………………………………………. Cósmicos ………………………………………………………………………………… Métodos de introducción del vector …………………………………………………… Enzimas de restricción …………………………………………………………………. La reacción en cadena de la polimerasa (PCR) …………………………………………. Introducción ………………………………………………… ……………………………
Universidad Católica los Ángeles de Chimbote - ULADECH

222 222 223 223 223 224 224 224 224 224 225 225 227 227 227 227 227 228 228 228 229 229 229 230 230 231 231 231 232 232 233 233 233 233 233 234 235 236 236 237 237 241 241

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Fundamento e importancia ………………………………………………… …………... Reactivos ………………………………………………………………………………… Ciclo de amplificación …………………………………………………………………... Inicialización (desnaturalización) …………………………………………………. Alineamiento (unión al cebador) ………………………………………………….. Extensión (elongación de la cadena) …………………………………………….. Aplicaciones ………………………………………………………… ………………….. Investigación ………………………………… ……………………………………… Medicina ………………………………………………………... ............................ Guerra de patentes ……………………………………………… ……………………... LA TRANSGÉNIA Introducción …………………………………………… ……………………………………. Alimentos transgénicos, estado actual …………………………………………………… ¿Para qué se obtienen vegetales transgénicos? ………………………………........ Microorganismos transgénicos ……………………………………………………………. Desarrollo de un microorganismo transgénico ………………………………………. Aplicaciones de los microorganismos transgénicos ………………………………… Animales transgénicos ……………………………… ……………………………………... TERAPIA GÉNICA Introducción …………………………………………………………………… ……………. Insertar genes nuevos ……………………………………………………………………… EL PROCESO DE LA CLONACIÓN Características generales ………………………………………………………………….. ¿Para que serviría la clonación de los animales? …………………………………… …. La clonación humana ……… ………………………………………………………………. La clonación humana con “fines terapéuticos”: el descubrimiento de las células Madre embrionarias ………………………………………………………………………… ¿En qué consiste la propuesta de la clonación humana con fines terapéuticos …….. Preguntas de repaso de Biología Celular y Molecular …………………………………. I Unidad: Las bases biológicas y químicas de los seres vivos …………………… II Unidad: Estructura y fisiología celular ……………………………………………... III Unidad: Genética, biotecnología e ingeniería genética ………………………….. Glosario de términos ……………………………………………………………………….. Referencias bibliográficas y webgrafías ………………………………………………….

241 242 243 243 244 245 245 245 245 246 246 246 247 249 249 250 251 252 252 253 254 255 256 257 259 259 263 270 275 289

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El presente texto proporciona conocimientos fundamentales sobre la Biología Celular y Molecular y podrá ser utilizado por los estudiantes de la Facultad de Ciencias de la Salud de la Universidad Católica “Los Ängeles” de Chimbote. El curso de Biología Celular y Molecular tiene por objetivo general que los alumnos conozcan los fenómenos biológicos a nivel c elular y molecular en los seres vivos. A nivel de objetivos específicos, el curso pretende proporcionar a los estudiantes los conocimientos básicos sobre las bases biológicas y químicas de los seres vivos. Así mismo, busca que ellos comprendan la estructura y fisiología celular. Y, finalmente tiene como objetivo que los estudiantes comprendan los principios de la genética, biotecnología moderna e ingeniería genética. De esta manera y siguiendo los objetivos trazados en el curso, el texto está dividido en tres grandes unidades : Las bases biológicas y químicas de los seres vivos, Estructura y fisiología celular y Genética, biotecnología e ingeniería genética. Además el texto brinda una base sólida para que el estudiante de la Facultad de Ciencias de la Salud pueda afrontar sin ning ún contratiempo el desarrollo de los cursos cuyo prerrequisito es Biolog ía Celular y Molecular. Así mismo, se debe destacar que el texto ha sido elaborado tomando en cuenta las informaciones más recientes sobre los temas que aquí se desarrollan. Esperamos que esta modest a contribución satisfaga las expectativas de los estudiantes que utilizarán este documento en el desarrollo del curso; así como de docentes de nuestra casa superior de estudios, a quie nes les solicitamos observaciones y sugerencias al presente texto. Estam os seguros que en las próximas ediciones se mejorará la presentación y el contenido hasta convertirse en un libro texto, que trate con mayor profundida y amplitud los conocimientos de la Biología Celular y Molecular , de tal manera que se contribuya a una m ejor formación académica de los estudiantes de la Facultad de Ciencias de la Salud.

Los autores

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La BIOLOGÍA (del griego «βιος» bios, vida, y «λογος» logos, estudio) es una de las ciencias naturales que tiene como objeto de estudio a los seres vivos y, más específicamente, su origen, su evolución y sus propiedades: génesis, nutrición, morfogénesis, reproducción, patogenia, etc. Se ocupa tanto de la descripción de las características y los comportamientos de los organismos individuales como de las especies en su conjunto, así como de la reproducción de los seres vivos y de las interacciones entre ellos y el entorn o. De este modo, se ocupa de la estructura y la dinámica funcional comunes a todos los seres vivos con el fin de establecer las leyes generales que rigen la vida orgánica y los principios explicativos fundamentales de ésta.

La biología estudia los seres vivos

Desde que el ser humano se construyó en un individuo para sí, ha ido resolviendo una serie de interrogantes. En el campo biológico tales interrogantes han abarcado la naturaleza misma de la vida, su origen y evolución, funciones vitales, reproducción, genética, cultivo de plantas, enfermedades, etc. Actualmente las ciencias biológicas se abocan al estudio de la filogenia, clonación de seres humanos, b iotecnología molecular aplicada a problemas de salud, control de plagas y mejoramiento de la productividad.
Universidad Católica los Ángeles de Chimbote - ULADECH 1

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los primeros naturalistas estudiaban a los animales y a alas plantas; con la acumulación de conocimiento la Biología fue dividida en ramas cada vez más específicas. Cabe indicar que las ramas de la Biología no son absolutamente independientes, sino que se relacionan unas con otras. Sin una visión del conjunto naturaleza, sociedad y pensamiento, el investigador pierde contexto general, sus trabajos son incompletos e inclusive investiga aspectos que no son importantes, ya que no satisfacen las necesidades reales de la población. En este problema suelen caer los investigadores neopositivistas que además no analizan la raiz principal de los problemas. Se especializan en su campo natal punto que pierden la perspectiva y caen en un mercado academicismo realizando investigaciones intrascendentes. La investigación especializada es importante, pero siempre enm arca dentro de objetivos gene rales de desarrollo social. La Biología no solo debe describir y e xplicar fenómenos, debe predecir y aplicar los conocimientos obtenidos para mejorar la calidad de vida de la población. A continuación estudiaremos los campos de la Biología a los que hemos dividido bajo los siguientes criterios: De acuerdo a la materia estudiada. De acuerdo al tipo de organismo estudiado . De acuerdo a nivel en el que se estudia la materia viva . DE ACUERDO A LA MATERIA ESTUDIADA: Ramas más generales de la Biología: o Morfología: estudia la forma de los seres vivos y las diversas estructuras que los están constituyendo. o Fisiología: estudia el funcionamiento de los seres vivos, las funciones de nutrición, relación y de reproducción. o Genética: estudia la herencia biológica. Cuando se hace a nivel de células, se denomina citogenética. o Evolución: estudia el proceso de transformación de los seres vivos. o Taxonomía: se encarga de la clasificación de los seres vivos así como de la nomenclatura. o Ecología: estudia las relaciones de los seres vivos con el medio y, con otros seres vivos. DE ACUERDO AL TIPO DE ORGANISMO ESTUDIADO Tomando en cuenta las particularid ades de las especies de organismos tenemos: o Microbiología: Estudia los microorganismos, seres viv os que no son visibles a simple vista; haciéndose uso del microscopio para su obse rvación. Bacteriología: estudio de las bacterias. Micología: estudio de los hongos. Virología: estudio de los virus. Cabe indicar que los virus no son se res vivos. Protozoología: estudio de los protozoarios. o Botánica: estudio de las plantas. Ficología: estudio de las algas. Botánica criptogámica: estudio de los musgos y helechos, plantas con órganos reproductores pequeños. Botánica fanerogámica: estudio de las plantas con órganos reproductores grandes. Carpología: se encarga del estudio del fruto. Palinología: estudia los granos de polen.
Universidad Católica los Ángeles de Chimbote - ULADECH 2

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o Zoología: estudio de los animales. Helmintología: estudio de los gusanos (tenias, nemátodos, etc .). Entomología: estudio de los insectos. Malacología: estudio de los moluscos. Ictiología: estudio de los peces. Anfibiología: estudio de los anfibios. Herpetología: estudio de los reptiles. Ornitología: estudio de las aves. Mastozoología: estudio de los mamíferos. DE ACUERDO AL NIVEL EN EL QUE SE ESTUDIA LA MATERIA VIVA. Tomando en cuenta los niveles de organización de los seres vivos tenemo s: o Biología molecular: estudia principalmente la estructura, expresión y regulación del gen. o Biología celular: estudio de la célula, sus característic as, estructura y fisiología. La biología celular es la rama de la biología que persigue la comprensión de las funciones de la célula, unidad estructural básica de los seres vivos. Atendiendo a su organización celular, los seres vivos se clasificarán en acelulares (virus, viroides) y celulares, siendo estos a su vez clasificados en eucariotas y procariotas. o Histología: Estudio de los tejidos. o Organología u organografía: Estudio de los órganos. o Biología de los organismos: Estudia a los individuos, tanto unicelulares como pluricelulares.

En su desarrollo, la Biología ha requerido de otras ciencias, dando lugar a diversas rama s particulares del conocimiento: o Bioquímica, aplicación de la química a la b iología. o Biofísica, integra las leyes de la física al conocimiento de los seres vivos. De ella derivan la biomecánica y bioenergética. o Bioética, integra la biología con los juicios de valor. Actualmente se discute si es moral o inmoral la clonación de humanos. o Biogeografía, estudio de la distribución de los organismos en la Tierra. Se subdivide en fitogeografía, estudio de la distribución de las plantas; y zoogeografía, estudio de la distribución de los animales. o Paleontología, estudio de los fósiles. Incluye a la paleobotánica, estudi o de los fósiles vegetales, la paleozoología, estudio de los fósiles animales y la paleoecología, estudio de los ecosistemas del pasado. o Geología, estudio de tectónica de placas. o Estratigrafía, estudio de aquellos estratos constituidos por suelos rocosos. o Hidrología, estudio del ciclo del agua, los tipos y sus características.

o La Agronomía. Se encarga de aplicar los conocimientos al cultivo de la tierra. o La Ganadería: Se encarga de la crianza de animales. El arte de cría, mejoramiento y multiplicación de animales domésticos se denomina z ootecnia e incluye: La Apicultura. crianza de abejas. La Sericultura. crianza del gusano de seda. La Lombricultura. crianza de lombrices de tierra.
Universidad Católica los Ángeles de Chimbote - ULADECH 3

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La Porcinocultura: crianza de cerdos. La Avicultura: crianza de aves. La Piscicultura: crianza de peces. La Cunicultura: crianza de cuyes y conejos. La Bobinotecnia: crianza de ganado vacuno. La Ovinotecnia: crianza de ovejas. La Equinotecnia: crianza de ganado yeguarizo o La medicina humana. Tratamiento y prevenció n de enfermedades que afectan al ser humano. o La medicina veterinaria. Tratamiento y prevenc ión de enfermedades de los animales. o La biotecnología moderna: Manipulación genética de los seres vivos.

Un ser vivo, también llamado organismo , es un conjunto de átomos y moléculas que forman una estructura material muy or ganizada y compleja, en la que intervienen sistemas de comunicación molecular, que se relaciona con el medio ambiente con un intercambio de materia y energía de una forma ordenada y que desempeña las funciones básicas de la vida que son la nutrición, la relación y la reproducción, de tal manera que los seres vivos actúan y funcionan por sí mismos sin perder su nivel estructural. La materia que compone los seres vivos está formada en un 95% por cuatro átomos que son el carbono, hidrógeno, oxígeno y nitrógen o, a partir de los cuales se forman las moléculas: Moléculas orgánicas o biomoléculas: ácidos nucleicos, las proteín as, los glúcidos y los lípidos. Moléculas inorgánicas: Agua, Sales minerales y gases. Estas moléculas se repiten constantemente dentro de los seres vivos, por lo que el origen de la vida procede de un antecesor común hace muchos millones de años sobre la Tierra.

La tierra el habitad de los seres vivos
Universidad Católica los Ángeles de Chimbote - ULADECH 4

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Todos los seres vivos están constitu idos por células. En el interior de estas se realizan las secuencias de reacciones químicas necesarias para la vida.

La vida puede definirse según algunas propiedades básicas de los seres vivos, que nos permiten diferenciarlos del resto de la materia inorgánica: 1. Organización.- Las unidades básicas de un organismo son las células. Un organismo puede estar compuesto de una sola célula (unicelular) o por muchas (pluricelular).

Las bacterias organismos unicelulares los perros organismos pluricelulares

2. Homeostasis.- Los organismos mantienen un equilibrio interno, por ejemplo, controlan activamente su presión osmótica. Homeostasis (Del griego homeo que significa "similar", y estasis, en griego στάσις, "posición", "estabilidad"). Definición que hace referencia a ciertas propiedades de los sistemas, en tanto son consideradas como un conjunto integrado de procesos y funciones (biológicas y/o artificiales) que permiten autoajustar, medir o tomar en cuenta algo por comparación o deducción, con el fin de mantener la constancia en la composición, propiedades, estructura y/o rutinas del medio interno de un organismo o sistema influido por agentes exteriores. También se entiende como homeostasi s al mantenimiento de la constancia del medio interno por la acción coordinada de los procesos fisiológicos. La homeostasis y la regulación del medio interno constituye uno de los preceptos fundamentales de la fisiología, puesto que un fallo en la homeosta sis deriva en un mal fundamentado de los diferentes órganos. 3. Irritabilidad.- Es una reacción ante estímulos externos. Una respuesta puede ser de muchas formas, por ejemplo, la contracción de un organismo unicelular cuando es tocado o las reacciones complejas que implican los sentidos en los animales superiores. La irritabilidad es la capacidad de un organismo o de una parte del mismo para identificar un cambio en el medio ambien te y poder reaccionar. La irritabilidad es la capacidad que tienen los seres vivos de responder ante estímulos. Esta característica les permite sobrevivir y, eventualmente, adaptarse a los cambios que se producen en el ambiente. Existen dos tipos de estímulos o "señales", externos si es que provienen desde el exterior o el ambiente donde se desarrolla un organismo, o internos, si se producen dentro del mismo organismo. Ante un estímulo determinado un organismo responde de una forma particular, que depende tanto del estímulo como del nivel de complejidad del ser vivo.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

4. Movimiento.- Es el desplazamiento de un organismo o parte de él, con respecto a un punto de referencia. Por ejemplo, las hojas de una planta que se orientan hacia el sol o un animal que persigue a su presa. 5. Metabolismo.- Los organismos consumen energía para convertir los nutrientes en componentes celulares (anabolismo) y liberan energía al descomponer la materia orgánica (catabolismo). El metabolismo es el conjunto de reacciones y procesos físico -químicos que ocurren en una célula. Estos complejos procesos interrela cionados son la base de la vida a nivel molecular, y permiten las diversas actividades de las células: crecer, reproducirse, mantener sus estructuras, responder a estímulos, etc.

Los vegetales son considerados organismos autótrofos por realizar la fotosíntesis

Los animales son considerados organismos heterótrofos

6. Desarrollo.- Los organismos aumentan de tamaño al adquirir y procesar los nutrientes. Muchas veces este proceso no se limita a la a cumulación de materia sino que implica cambios mayores. El desarrollo es en biología el proceso por el que un organismo evoluciona desde su origen hasta alcanzar la condición de adulto. En sentido estricto el desarrollo no abarca sólo el período de maduración, las fases embrionaria y juvenil, sino también las fases adulta y senil, pero este uso más amplio del término es infrecuente. Son cambios cuantitativos que van ocurriendo simultáneamente y a la diversificación de complejidad creciente que dichos sistemas van adquiriendo a lo largo del ciclo de vida. 7. Reproducción.- Es la habilidad de producir nuevos organismos, tanto asexualmente desde un único progenitor, como sexualmente a partir de al menos dos progenitores.
Universidad Católica los Ángeles de Chimbote - ULADECH 6

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La reproducción es un proceso biológico que permite la producción de nuevos organismos, siendo una característica común de todas las formas de vida conocidas. Las dos modalidades básicas se agrupan en dos tipos, que reciben los nombres de “asexual” o vegetativa y de “sexual” o generativa.

La fecundación

8. Adaptación.- Las especies evolucionan y se adaptan al ambiente. El proceso de adaptación biológica mejora las posibilidades de supervivencia de los individuos que muestran una determinada característica .

El ser humano se adapta a las condiciones ambientales

Los virus ¿organismos vivos o muertos?
Los virus cumplen con algunas de estas características (materia organizada y compleja, reproducción y evolución), pero no tienen metabolismo. Hay cierto consenso en no considerarlos formas vidas aunque aún hay quien discrepa sobre la cuestión. Sin embargo, si consideramos que la característica básica de un ser vivo es tener descendencia y evolucionar, también los virus podrían considerarse seres vivos. Como se ve todo depende de qué se considera a la hora de definir la vida.
Universidad Católica los Ángeles de Chimbote - ULADECH 7

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los virus organismos vivos o muertos

La biología se ocupa de analizar jerarquías o niveles de organización que van desde la célula a los ecosistemas. Este concepto implica que en el universo existen diversos niveles de complejidad. Por lo tanto es posible estudiar biología a muchos niveles, d esde un conjunto de organismos (comunidades) hasta la manera en que funciona una célula o la función de las moléculas de la misma. En orden creciente se mencionarán los principales niveles de organización: 1. Moléculas, elementos, átomos, y partículas subat ómicas.- los niveles funcionales fundamentales de la bioquímica. 2. Organelos.- una subunidad de la célula. Un organelo se encuentra relacionado con una determinada función celular por ejemplo la mitocondria (el sitio principal de generación de ATP en eucariotas). 3. Célula.- la más pequeña unidad estructural de los seres vivos capaz de funcionar independientemente. Cada célula tiene un soporte químico para la herencia (ADN), un sistema químico para adquirir energía etc. 4. Tejido.- (en organismos multicelulares). Un grupo de células que realizan una determinada función. Por ejemplo el tejido muscular cardíaco. 5. Órganos.- (en organismos multicelulares). Grupo de células o tejidos que realizan una determinada función. Por ejemplo el corazón, es un órgano que bom bea la sangre en el sistema circulatorio. 6. Sistema.- (en organismos multicelulares). Grupo de células, tejidos y órganos que están organizados para realizar una determinada función, p or ejemplo el sistema circulatorio. 7. Individuo (organismo).- Una o más células caracterizadas por un único tipo de información codificada en su ADN. Puede ser unicelular o multicelular. Los individuos multicelulares muestran tipos celulares especializados y división de funciones en tejidos, órganos y sistemas. 8. Poblaciones.- Grupos de individuos similares que tienden a aparearse entre sí en un área geográfica limitada. Esto puede ser tan sencillo como un campo con flores separado de otro campo por una colina sin flores.
Universidad Católica los Ángeles de Chimbote - ULADECH 8

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Niveles de organización de los seres vivos

9. Especie.- Grupo de individuos similares que tienden a aparearse entre sí dando origen a una cría fértil. Muchas veces encontramos especies descriptas, no por su reproducción (especies biológicas) sino por su forma (especies anatómicas). 10. Comunidad.- Es la relación entre grupos de diferentes especies. Por ejemplo, las comunidades del desierto pueden consistir en conejos, coyotes, víboras, ratones, aves y plantas como los cactus. La estructura de una comunidad puede ser alterada por cosas tales como el fuego, la actividad humana y la sobrepoblación.
Universidad Católica los Ángeles de Chimbote - ULADECH 9

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

11. Ecosistema.- La relación entre un grupo de organismos entre sí y su medio ambiente. Los científicos a menudo hablan de la interrelación entre los organi smos vivos. Dado, que de acuerdo a la teoría de Darwin los organismos se adaptan a su medio ambiente, también deben adaptarse a los otros organismos de ese ambiente. 12. Biosfera.- La suma de todos los seres vivos tomados en conjunto con su medio ambiente. En esencia, el lugar donde ocurre la vida, desde las alturas de nuestra atmósfera hasta el fondo de los océanos o hasta los primeros metros de la superficie del suelo (o digamos mejor kilómetros sí consideramos a las bacterias que se pueden encontrar hasta una profundidad de cerca de 4 Km. de la superficie). Dividimos a la Tierra en atmósfera (aire), litosfera (tierra firme), hidrosfera (agua), y biosfera (vida).

Luego de la publicación del Sistema Natural de Linneo en 175 8, y durante muchos años, se reconocían sólo dos ramas en la sistemática: la zoología y la botánica . El evolucionista alemán Ernst Haeckel propuso, a finales del siglo pasado, la c onstrucción de un tercer reino , el de los Protistas, constituido por microo rganismos. Haeckel reconoció que algunos de estos microorganismos carecían de núcleo celular y los denominó Monera. Posteriormente, las bacterias fueron reconocidas, en 1956, por Herbert Copeland como reino Monera, independiente de los Protistas. Los hongo s, fueron los últimos organismos que merecieron la creación de un reino y su fundador, R. Whittaker propuso, en 1959, una clasificación general de los seres vivos que contenía cinco reinos: Monera (bacterias), Protista (protozoos), Fungi (hongos), Animalia (animales) y Plantae (plantas). Posteriormente, en 1978, Whittaker y Margulis, propusieron una modificación, conservando el número de reinos e incluyendo dentro del antiguo grupo Protistas a las algas. Este nuevo reino fue denominado Protoctista; sin embargo, gran parte de la literatura científica aún utiliza la denominación Protista. Así, esta nueva clasificación de cinco reinos consiste en Procariota (bacterias), Protoctista o Protista

Organización de los seres vivos
Universidad Católica los Ángeles de Chimbote - ULADECH 10

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los cinco reinos de los seres vivos

(algas, protozoos, mohos del limo, y otros organismos acuáticos y parásitos menos conocidos), Fungi (líquenes y hongos), Animal ia (animales vertebrados e invertebrados) y Plantae (musgos, helechos, coníferas y plantas con flor). Hasta 1977, el reino se consideraba la categoría sistemática más inclusiva. Sin embargo, la secuenciación de moléculas universales que cambian a tasas ex tremadamente bajas (como en el caso del rRNA) llevaron a Carl Woese y sus colaboradores a la construcción de un árbol filogenético único en el cual se diferencian tres linajes evolutivos principales o dominios.

La estructura filogenética más profundad de la diversidad biológica obtenida por Carl Woese a partir de la secuenciación de rRNA.
Universidad Católica los Ángeles de Chimbote - ULADECH 11

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En la clasificación de la figura anterior, claramente se distinguen tres grupos monofiléticos distintos que corresponden a los dominios Bacteria, Arch aea y Eucarya.Woese propuso entonces la categoría de dominio para cada uno de estos linajes, o grupos monofiléticos, y los denominó Bacteria, Archaea y Eucarya. El cambio propuesto por Woese resalta las diferencias, hasta ahora ocultas, entre organismos pr ocariotas. De este modo, Monera es un grupo parafilético § que debería descartarse de la clasificación biológica. En el sistema de Woese, Archaea y Bacteria son dominios distintos de organismos procariotas y el primero contiene al menos dos reinos nuevos: Crenarchaeota y Euryarchaeota. El dominio Eucarya agrupa, según esta clasificación, a los restantes reinos de organismos eucariotas. La clasificación de Woese, como cu alquier clasificación, se basa en el orden de ramificación de los linajes durante el curso evolutivo. Sin embargo, no todos los taxónomos acuerdan con este principio clasificatorio y las disidencias se acentúan cuando se trata de los taxa más inclusivos de la clasificación biológica. La propuesta alternativa de Margulis, centrada en los recur rentes procesos de simbiosis, como la de Cavallier -Smith en la que propone la categoría de imperio en lugar de dominio, representan las principales propuestas evolucionistas alternativas a la cladística de Woese.
Reino Características

Procariota (bacterias) Protista o Protoctista

Células de vida libre; algunas son multicelulares. Diferenciación celular incipiente en algunos grupos. Incluye a todas las bacterias. Células eucariotas. Flagelo u ndulipodio de estructura 9+2 en algún momento de su ciclo de vida. La distinción entre unicelularidad y multicelularidad es irrelevante. Es un grupo definido por exclusión, es decir, no son animales, plantas, hongos ni procariotas. Contiene aproximadamente 27 phyla incluyendo a protozoos y algas como los organismos más comunes. Células eucariotas. Formación de esporas y ausencia de undulipodio (amastigotas). Las esporas haploide germinan generando hifas que por un proceso de septación más o menos incompleto da lugar a la formación de células. El citoplasma pu ede fluir en mayor o menor grado a través de la hifa. Al conjunto de hifas se le llama micelio y constituye la estructura visible de la mayor parte de los hongos. Las hifas adyacentes pueden compartir núcleos por conjugación dando lugar a una célula hetero cariótica cuyos núcleos se dividen por mitosis y originan una hifa dicariótica. En la reproducción sexual, ambos núcleos se fusionan y forman una célula cigótica diploide que se dividirá por meiosis y formará las nuevas esporas haploides. Organismos multicelulares eucariotas desarrollados a partir de un embrión que no produce una blástula. Las células eucariotas de la mayor parte de las plantas poseen plásticos fotosintéticos, sin embargo, ésta no es una característica exclusiva ni general de las plantas. A diferencia de los animales -cuyas células son en su mayoría diploides y fungi -cuyas células son haploides o dicarióticas - las plantas alternan de manera ordenada un estadio haploide o de gametofito -donde se producen gametas por mitosis - y otro diploide o de esporofito -donde se producen gametas por meiosis -. En las plantas con flores, el esporofito domina el ciclo de vida y el gametofito, en lugar de producir una nueva planta independiente, se reduce a unas pocas células dentro de la flor del esporofito. Del mismo modo, en los helechos, el esporofito es la forma que domina el ciclo de vida y el gametofito, a pesar de tener una fase de vida libre, no es visible a simple vista. Organismos multicelulares eucariotas desarrollados a partir de un embrión que pasa por un estadio de blástula. Aunque la multicelularidad ha surgido independientemente en todos los reinos, en los animales es característica ya que las células están unidas por complejas estructuras como losdesmosomas, uniones denomi nadas "gap" y septadas. A diferencia de las plantas, en los animales la meiosis es gamética, es decir, a la reducción cromosómica le sigue inmediatamente la formación de gametas sin posibilidad de originar individuos haploides como el gametofito. 12




Universidad Católica los Ángeles de Chimbote - ULADECH

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Caracteres generales que define a cada uno de los 5 reinos
Dominio Características

Bacteria Organismos:Termotogales, flavobacterias, cianobacterias, bacterias púrpuras, bacterias gram-positivas, bacterias verdes no sulfurosas. Archaea Organismos: Pyrodictium, Thermoproteo us, termococales, metanococales, metanobacterias, metanomicrobiales, halófilos extremos. Eucarya Organismos: Animales, protozoos ciliados, protozoos flagelados, plantas, hongos, diplomonas, algas rojas, euglenoides, microsporidias.

Células procarióticas. Membranas lipídicas compuestas principalmente por diésteres de diacil glicerol. El RNA ribosomal de la subunidad pequeña de los ribosomas (16S-rRNA) es del tipo eubacteriano. Células procarióticas. Membranas lipídicas compuestas principalmente por diéteres de glicerol isoprenoides o tetraéteres de diglicerol. El RNA ribosomal de la subunidad pequeña de los ribosomas (16S-rRNA) es del tipo arqueobacteriano. Células eucarióticas. Membranas lipídicas co mpuestas principalmente por diésteres de acil -glicerol. El RNA ribosomal de la subunidad pequeña de los ribosomas (18S-rRNA) es del tipo eucariota..

Caracteres que definen a los tres dominios

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


T B M H C G O L A D S R E V I N U Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los bioelementos son los elementos químicos que constituyen los sere s vivos. De los aproximadamente 100 elementos químicos que existen en la naturaleza, unos 70 se encuentran en los seres vivos. De estos sólo unos 22 se encuentran en todos en cierta abundancia y cumplen una cierta función. Los bioelementos se clasifican en :

Los bioelementos primarios, secundarios y terciarios

Bioelementos primarios: C, H, O, N, P y S. Representan en su conjunto el 96,2% del total. El hecho de que los bioelementos primarios sean tan abundantes en los seres vivos se debe a que presentas ciertas características que los hacen idóneos para formar las moléculas de los seres vivos. Así: Sus compuestos presentan polaridad por lo que fácilmente se disuelven en el agua, lo que facilita su incorporación y eliminación. El C y el N presentan la misma afinidad para unirse al oxígeno o al hidrógeno, por lo que pasan con la misma facilidad del estado oxidado al reducido. Esto es de gran importancia, pues los procesos de oxidación-reducción son la base de muchos procesos químicos mu y importantes y en particular de los relacionados con la obt ención de energía como la fotosíntesis y la respiración celular. El C, el H, el O y el N son elementos de pequeña masa atómica y tienen variabilidad de valencias, por lo que pueden formar entre s í enlaces covalentes fuertes y estables. Debido a esto dan lugar a una gran variedad de moléculas y de gran tamaño. De todos ellos el
Universidad Católica los Ángeles de Chimbote - ULADECH 15

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

carbono es el más importante. Este átomo es la base de la química orgánica y de la química de los seres vivos.

Bioelementos secundarios: Na+1, K+1, Ca+2, Mg+2, Cl-1, Fe+3. Aunque se encuentran en menor proporción que los primarios, son también imprescindibles para los seres vivos. En medio acuoso se encuentran siempre io nizados. Se encuentran formando parte de las biomoléculas inorgánicas como las sales minerales o bien en forma de iones monoatómicos disueltos o asociados a biomoléculas orgánicas. Bioelementos terciarios (oligoelementos): Cu+1, Co+3, I-1, F-1, B+1, Mo+2, Mn+2, Se-2. Son aquellos bioelementos que se encuentran en los seres vivos en un porcentaje menor del 0.1%. Algunos, los indispensables, se encuentran en todos los seres vivos, mientras que otros, variables, solamente lo s necesitan algunos organismos.

Presencia de los bioelementos primarios en las principales biomoléculas
Universidad Católica los Ángeles de Chimbote - ULADECH 16

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los bioelementos se unen entre sí para formar moléculas que llamaremos biomoléculas: Las moléculas que constituyen los seres vivos. Estas moléculas se han clasificado tradicionalmente en los diferentes principios inmediatos, llamados así porque podían extraerse de la materia viva con cierta facilidad, inmediatamente, por métodos físicos sencillos, como: evaporación, filtración, destilación, disolución, etc. Entre las principales biomoléculas tenemos: INORGANICAS H2O CO2 Sales minerales ORGANICAS
Carbohidratos Lípidos Proteínas Acidos nucleicos Enzimas

El agua, una molécula simple y extraña, puede ser considerada como el líquido de la vida. Es la sustancia más abundante en la biosfera, dónde la encontramos en sus tres estados y es además el componente mayoritario de los seres vivos, pues entre el 65 y el 95% del p eso de de la mayor parte de las formas vivas es agua. El agua fue además el soporte donde surgió la vida. Molécula con un extraño comportamiento que la convierten en una sustancia diferente a la mayoría de los líquidos, posee una manifiesta reaccionabilidad y posee unas extraordinarias propiedades físicas y químicas que van a ser responsables de su importancia biológica. Durante la evolución de la vida, los organismos se han adaptado al ambiente acuoso y han desarrollado sistemas que les permiten aprovech ar las inusitadas propiedades del agua.

La molécula de agua está formada por dos átomos de H unidos a un átomo de O por medio de dos enlaces covalentes. La disposición tetraédrica de los orbitales sp3 del oxígeno determina un ángulo entre los enlaces H-O-H , aproximadamente de 104'5º, además el oxígeno es más electronegativo que el hidrógeno y atrae con más fuerza a los electrones de cada enlace.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El resultado es que la molécula de agua aunque tiene una carga total neutra (igual númer o de protones que de electrones), presenta una distribución asimétrica de sus electrones, lo que la convierte en una molécula polar, alrededor del oxígeno se concentra una densidad de carga negativa, mientras que los núcleos de hidrógeno quedan desnudos, d esprovistos parcialmente de sus electrones y manifiestan, por tanto, una densidad de carga positiva. Por eso en la práctica la molécula de agua se comporta como un dipolo. Así se establecen interacciones dipolo -dipolo entre las propias moléculas de agua, formándose enlaces o puentes de hidrógeno, la carga parcial negativa del oxígeno de una molécula ejerce atracción electrostática sobre las cargas parciales positivas de los átomos de hidrógeno de otras moléculas adyacentes. Aunque son uniones débiles, el hecho de que alrededor de cada molécula de agua se dispongan otras cuatro molécula unidas por puentes de hidrógeno permite que se forme en el agua (líquida o sólida) una estructura de tipo reticular, responsable en gran parte de su comportamiento anómalo y de la peculiaridad de sus propiedades físicoquímicas.

1. Acción disolvente El agua es el líquido que más sustancias disuelve, por eso decimos que es el disolvente universal. Esta propiedad, tal vez la más importante para la vida, se debe a su capacidad para formar puentes de hidrógeno con otras sustancias que pueden presentar grupos polares o con carga iónica (alcoholes, azúcares con grupos R-OH, aminoácidos y proteínas con gr upos que presentan cargas + y -, lo que da lugar a disoluciones m oleculares Fig.7. También las moléculas de agua pueden disolver a sustancias salinas que se disocian formando diso luciones iónicas (Fig.6).

Fig. 06

Fig. 07

En el caso de las disoluciones iónicas (fig.6) los iones de las sales son atraídos por los dipolos del agua, quedando "atrapados" y recubiertos de moléculas de agua en forma de iones hidratados o solvatados. La capacidad disolvente es la responsable de dos funciones : 1. Medio donde ocurren las reacciones del metabolismo . 2. Sistemas de transporte.
Universidad Católica los Ángeles de Chimbote - ULADECH 18

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

2. Elevada fuerza de cohesión Los puentes de hidrógeno mantienen las moléculas de agua fuertemente unidas, formando una estructura compacta que la convierte en un líquido casi incom prensible. Al no poder comprimirse puede funcionar en algunos animales como un esqueleto hidrostático, como ocurre en algunos gusanos perforadores capaces de agujerear la roca mediante la presión generada por sus líquidos internos. 3. Elevada fuerza de adhesión Esta fuerza está también en relación con los puentes de hidrógeno que se establecen entre las moléculas de agua y otras moléculas polares y es responsable, junto con la cohesión del llamado fenómeno de la capilaridad. Cuando se introduce un capilar en un recipiente con agua, ésta asciende por el capilar como si trepase agarrándose por las paredes, hasta alcanzar un nivel superior al del recipiente, donde la presió n que ejerce la columna de agua , se equilibra con la presión capilar. A este fenómeno se debe en parte la ascensión de la savia bruta desde las raíces hasta las hojas, a través de los vasos leñosos. 4. Gran calor específico También esta propiedad está en relación con los puentes de hidrógeno que se forman entre las moléculas de agua. El agua puede absorber grandes cantidades de "calor" que utiliza para romper los h. por lo que la temperatura se eleva muy lentamente. Esto permite que el citoplasma acuoso sirva de protección ante los cambios de temperatura. Así se mantiene la temperatura constante. 5. Elevado calor de vaporización Sirve el mismo razonamiento, también los h. son los responsables de esta p ropiedad. Para evaporar el agua, primero hay que romper los puentes y posteriormente dotar a las moléculas de agua de la suficiente energía cinética para pasar de la fase líquida a la gaseosa. Para evaporar un gramo de agua se precisan 540 calorías, a una temperatura de 20 ºC.

Las funciones del agua se relacionan íntimamente con las propiedades anteriormente descritas. Se podrían resumir en los siguientes puntos : Soporte o medio donde ocurren las reacciones metabólicas . Amortiguador térmico. Transporte de sustancias. Lubricante, amortiguadora del roce entre órganos . Favorece la circulación y turgencia . Da flexibilidad y elasticidad a los tejidos. Puede intervenir como reactivo en reacciones del metabolismo, aportando hidrogeniones o hidroxilos al medio.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Además del agua existen otras biomoléculas inorgánicas como las sales minerales. En función de su solubilidad en agua se distinguen dos tipos: insolubles y solubles en agua. 1. Sales insolubles en agua Forman estructuras sólidas, que suelen tener función de sostén o protectora, como: o Esqueleto interno de vertebrados, en el que encontramos : fosfatos, cloruros, y carbonatos de calcio. o Caparazones de carbonato cálcico de crustáceos y moluscos. o Endurecimiento de células vegetales, como en gramíneas (impregnación con sílice). o Otolitos del oído interno, formados por cristales de carbonato cálcico (e quilibrio). 2. Sales solubles en agua Se encuentran disociadas en sus iones (cationes y aniones ) que son los responsables de su actividad biológica. Desempeñan las siguientes funciones: o Funciones catalíticas: Algunos iones, como el Cu+, Mn2+, Mg2+, Zn+,. ..actúan como cofactores enzimáticos. o Funciones osmóticas: Intervienen en los procesos relacionados con la distribución de agua entre el interior celular y el medio donde vive esa célula. Los iones de Na, K, Cl y Ca, participan en la generación de gradient es electroquímicos, imprescindibles en el mantenimiento del potencial de m embrana y del potencial de acció n y en la sinapsis neuronal. o Función tamponadora: Se lleva a cabo por los sistemas carbonato – bicarbonato y también por el monofosfato – bifosfato.

Son compuestos orgánicos los compuestos de carbono. Esto es, aquellos en, los que el átomo de carbono es un elemento esencial en la molécula y forma en ella la cadena básica a la que están unidos los demás elementos químicos. Los seres vivos contienen compuestos orgánicos. Son éstos los que caracterizan a la materia viva y la causa de las peculiares funciones que realiza. La gran variedad de compuestos orgánicos que contienen los seres vivos no se clasifican des de un punto de vista químico, sino a partir de criterios muy simples, tales como su solubilidad o no en agua, u otros. Siguiendo estos criterios se clasifican en: o Carbohidratos o Lípidos o Proteínas o Acidos nucleicos o Enzimas Las funciones que cumplen esta s sustancias en los seres vivos son muy variadas, así tenemos: 1. Glúcidos y lípidos tienen esencialmente funciones energéticas y estructurales. 2. Las proteínas: enzimáticas y estructurales. 3. Los ácidos nucleicos son los responsables de la información genétic a. 4. Algunas sustancias son de gran importancia para los seres vivos pero estos las necesitan en muy pequeña cantidad y nunca tienen funciones energéticas ni estructurales. Por esta causa reciben el nombre de biocatalizadores. Son biocatalizadores las vitam inas, las enzimas y las hormonas.
Universidad Católica los Ángeles de Chimbote - ULADECH 20

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los glúcidos, también llamados azúcares o sacáridos , son un grupo de biomoléculas orgánicas muy abundantes en la naturaleza. Azúcares, almidones y celulosa son carbohidratos. Los azúcares y los almidones sirven como fuentes de energía para las células, en tanto que la celulosa es el componente estructural principal de las paredes que rodean a las células vegetales. Los carbohidratos se componen de átomos de carbono, hidrógeno y oxígeno en proporción aproximada de un átomo de carbono por dos de hidrógeno y uno de oxígeno (CH2O)n. El término carbohidrato (que significa hidrato de carbono o “carbono con agua”) refleja la proporción de 2:1 de hidrógeno y oxígeno, que es la misma del agua (H 2O). Los carbohidratos contienen una unidad de azúcar (monosacáridos), dos unidades (disacáridos) o muchas unidades (polisacáridos). Los monosacáridos por lo general contienen tres a siete átomos de carbono. En un monosacárido, todos los carbonos excepto uno están unidos a un grupo hidroxilo; el otro carbono forma un doble enlace con un átomo de oxígeno, con lo que constituye un grupo carbonilo. Si este grupo está en el extremo de la cadena, el monosacárido es un aldehído; sí está en cualquier otra posición, se trata de una cetona. Por convención, el esqueleto de carbono de un azúcar comienza a numerarse en el grupo carbonilo terminal (o en el carbono más cercano a él) de la cadena abierta. La gran cantidad de grupos hidroxilo polares, más el grupo carbonilo, dan a los monosa cáridos propiedades hidrofílicas. Los carbohidratos más sencillos son los azúcares de tres carbonos (triosas): gliceraldehído y dihidroxiacetona. La ribosa y la desoxirribosa son pentosas comunes, o sea azúcares de cinco átomos de carbono, y forman parte de los ácidos nucleicos, como ADN, ARN. Glucosa, fructosa, galactosa de seis átomos de carbono se denominan hexosas. (Nótese que los nombres de os carbohidratos suelen terminar en “osa”).

La glucosa (C 6H12O6), el monosacárido más abundante, es u tilizado por la mayor parte de los organismos como fuente de energía; su importancia en el metabolismo es tal que su concentración se mantiene cuidadosamente en valores homeostáticos (relativamente constantes) en la sangre de los seres humanos. La glucosa y la fructosa son isómeros estructurales, o sea que poseen fórmula molecular idéntica, pero sus átomos están dispuestos de manera distinta. Debido a tales diferencias, estos dos azúcares tiene n propiedades químicas distintas. Por ejemplo, la fructosa es má s dulce que la glucosa.
Universidad Católica los Ángeles de Chimbote - ULADECH 21

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los disacáridos (“dos azúcares”) consta de dos monosacáridos anulares (en forma de anillo) unidos por un enlace glucosídico, consiste en un oxígeno central enlazado en forma covalente a dos carbonos, uno en cada anillo. El enlace glucosídico de un disacárido por lo general se forma entre el carbono 1 de una molécula y el carbo no 4 de la otra. La maltosa (azúcar de malta) es un disacárido que resulta de la unión covalente de dos unidades de glucosa. La sacarosa, o azúcar de mesa, consta de una unidad de glucosa combinada con otra de fructosa. La lactosa, azúcar presente en la leche, se compone de una molécula de glucosa y otra de galactosa. Los disacáridos son susceptibles de hidrólisis, o sea separación al agregar agua , en dos monosacáridos. Durante la digestión, la maltosa se hidroliza y forma dos moléculas de glucosa. De igual manera, la sacarosa se hidroliza para formar glucosa y fructosa. Los carbohidratos más abundantes son los polisacáridos, grupo que incluye alm idones, glucógeno y celulosa. Un polisacárido es una macromolécula consistente en unidades repetitivas de azúcares simples, por lo general glucosa.. Aunque el número preciso de estas unidades varía, por lo general hay miles en una sola molécula. El polisac árido puede ser una cadena larga sencilla o ramificada. Dado que se componen de diferentes isómeros y que las unidades pueden disponerse de distintas maneras, los polisacáridos varían en sus propiedades. Los que pueden descomponerse con facilidad en sus su bunidades son adecuados para almacenamiento de energía, en tanto que la arquitectura tridimensional macromolecular de otros los hace particularmente aptos para formar estructuras estables.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Formación de la maltosa, disacárido reductor, mediante la unión de dos moléculas de glucosa. Se obtiene por hidrólisis de almidón y del glucógeno. Aparece en la germinación de la cebada empleada en la fabricación de la cerveza.

La sacarosa está formada por la unión de una molécula de glucosa y una molécula de fructosa. No es un azúcar reductor. Es el azúcar de mesa. Se encuentra en la caña de azúcar y en la remolacha.

La lactosa está formada por la unión de una molécula de glucosa y una molécula de galactosa. Es un azúcar reductor. Se encuentra en la leche de los mamíferos.

Los polisacáridos, son los carbohidratos más complejos y entre los cuales se pueden mencionar el almidón, que forma parte habitual del carbohidrato empleado para almacenamiento de energía en las plantas, es un polímero consistente en s ubunidades de alfa-glucosa. El almidón tiene dos formas, amilosa (no ramificada) y amilop ectina (ramificada). Los seres humanos que comen alimentos vegetales cuentan con enzimas para realizar dicha hidrólisis.
Universidad Católica los Ángeles de Chimbote - ULADECH 23

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El glucógeno (a veces llamado almidón animal) es la forma en que se almacena la glucosa en los tejidos animales, es muy hidrosoluble. El glucógeno s se almacena sobre todo en las células de hígado y músculos. La celulosa es la sustancia que más abunda en este grupo, e s un carbohidrato estructural. Casi la mitad de la madera es celulosa, y el algodón al men os 90% de celulosa. Las células vegetales están rodeadas por paredes celulares de sostén resist ente, formadas en su mayor parte de celulosa. Muchos derivados de monosacáridos son moléculas biol ógicas importantes. Algunos son componentes estructurales de importancia. Los aminosacáridos , galactosamina y glucosamina son azúcares en los cuales un grupo amino ( -NH2) sustituye al grupo hidroxilo (-OH). La galactosamina forma parte del cartílago, un constituyente del sistema óseo de los vertebrados, en tanto que la N-acetilglucosamina (NAG), unida por enlaces glucosídicos, es la unidad molecular de la quitina, principal componente del esqueleto externo de insectos, cangrejos y otros artrópodos, así como las parede s celulares de los hongos. Los carbohidratos también se combinan con las prot eínas y forman glucoproteínas, compuestos presentes en la superficie externa de muchas células eucariotas. Algunas de estas cadenas de carbohidratos permiten a las células adheri rse entre sí, mientras que otras dan protección. La mayor parte de las proteínas secretadas por las células son glucoproteínas. Así mismo, los carbohidratos pueden combi narse con los lípidos y formar glucolípidos, compuestos presentes en la superficie de las células animales y que se piensa permiten a dichas células reconocerse e interactuar entre sí.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular



Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 26

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los lípidos son un grupo heterogéneo de compuestos que se definen no por su estructurasino por el hecho de que son solubles en solventes no polares (éter, cloroformo, etc.) y relativamente insolubles en el agua. Las moléculas lipídicas tienen estas propiedades porque consisten principalmente en carbono e hidrógeno, co n pocos grupos funcionales que contengan oxígeno. Los átomos de oxígeno son caracterís ticos de los grupos funcionales hidrofílicos, de modo que los lípidos, con poco oxígeno, tienden a ser hidrófobos. Entre los grupos de lípidos de importancia biológica están grasas neutras, fosfolípidos, carotenoides (pigmentos vegetales amarillos y anaranjados), esteroides y ceras. Algunos lípidos se emplean para alma cenamiento de energía, otros son componentes estructurales de membranas celulares, y algunos más son hormonas de importancia.

Las grasas neutras se componen de glicerol y ácidos garsos
Los lípidos más abundantes en los seres vivos son las grasas neutras. Estos compuestos son una forma económica de almacenamiento de reserva de energía, ya que liberan el doble de energía por gramo, en comparación con los carbohidratos. Estos últimos y las proteínas pueden transformarse en grasas por acción enzimática y alma cenarse en las células del tejido adiposo de los animales. Una grasa neutra consiste en una molécula de glicerol unida a una, dos o tres ácidos grasos. El glicerol es un alcohol de tres carbonos que contiene igual número de grupos hidroxilo ( -OH). Un ácido graso es una cadena larga no ramificada de hidrocarbur o con un grupo carboxilo(-COOH) en un extremo. Hay alrededor de 30 ácidos grasos distintos en los lípidos, y por lo general tienen número par de átomos de carbono. Por ejemplo, el ácido butírico, pres ente en la mantequilla rancia, tiene cuatro átomos de carbono. El ácido oleico, que es el ácido graso de distribución más amplia en la naturaleza, posee 18 átomos de carbono y se encuentra en la mayor parte de las grasas animales y vegetales. Los ácidos grasos saturados son aquellos cuyos átomos de carbono están unidos entre sí por un sólo enlace o enlace simple, conteniendo el núm ero máximo posible de átomos de hidrógeno. Las grasas ricas en estos ácidos, como la grasa animal y la m anteca vegetal, tienden a ser sólidas a temperatura. No hay un requerimient o alimentario de ácidos grasos saturados.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Algunos ácidos grasos de importancia biológica

Los ácidos grasos insaturados tienen uno o más pares d e átomos adyacentes unidos por enlaces dobles, de modo que no están por completo satura dos por hidrógenos. Los ácidos grasos con un doble enlace se llaman ácidos grasos monoins aturados, y los que tienen más de un doble enlace se denominan ácidos grasos poliinsatur ados. Las grasas que contienen una elevada proporción de ácidos grasos monoinsaturados o poliinsaturados tienden a ser líquidas a la temperatura ambiente. Al menos dos ácidos g rasos insaturados, linoleico y araquidónico, son nutrientes esenciales que deben estar incluí dos en los alimentos, dado que el cuerpo humano no puede sintetizarlos.

Cuando una molécula de glicerol se combina químicamente con otra de ácido graso, se forma un monoacilglicerol (a veces denominado monoglicérido). Los diaci lgliceroles (o diglicéridos) y triacilgliceroles (o triglicéridos) contienen dos o tres ácidos grasos, respectivamente. En cada reacción de condensación se extrae el equivalente a una molé cula de agua cuando uno de los grupos hidroxilo del glicerol reacciona con el grupo carboxilo de un ácido graso, formandose un enlace éster.
Universidad Católica los Ángeles de Chimbote - ULADECH 28

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los fosfolípidos son componentes de las membranas celulares
Los fosfolípidos pertenecen a un grupo de lípidos, llamados líp idos anfipáticos, en los cuales un extremo de cada molécula es hidrofílico, y el otro, hid rófobo. Los dos extremos de una molécula de fosfolípido difieren en sus propiedades físicas y qu ímicas. Un fosfolípido consiste en una molécula de glicerol unida por un extremo a dos ácidos grasos y, por el otro, a un grupo fosfato, enlazado a su vez a un compues to orgánico, por ejemplo la colina (alcohol superior). El compuesto orgánico suele contener nitrógeno (debe hacerse notar que en las grasa neutras no hay fósforo ni nitrógeno). La proporción de la mol écula correspondiente al ácido graso (que contiene las dos “colas” de hidrocarburo) es hidrófoba e insoluble en agua. Sin embargo, la porción formada por glicerol, grupo fosfa to y la base orgánica (alcohol superior), que es la cabeza de la molécula, está bastante ionizada y es muy hidrosoluble. La s propiedades anfipáticas de estas moléculas lipídicas las h acen bastante excepcionalmente adecuadas para construir membranas celulares.

Clasificación de los fosfolípidos
Los lípidos han sido clasificcados en “ saponificables” y “no saponificables”. Dentro de los saponificables se tiene a los lípidos simples y a los lípidos complejos. Dentro de los no saponificables a los esteroides, isoprenoides, las prostaglandinas y las vitaminas liposolubles.

Lípidos saponificables
Son los que presentan ácidos al descomponerse, liberan ácidos grasos y alcoholes. Lípidos simples.- Constituídas por un alcohol y ácidos grasos, unidos entre sí mediante enlaces éster. Dentro de los lípidos simples se encuentran a los glicéridos y a los céridos (ceras). Glicéridos (acilglicéridos).- Compuestos formados por un alcohol glicerol y 1 a 3 ácidos grasos unidos mediante enlaces éster. No se disuelven en agua; se les llama grasa. Estas pueden ser sólidas, semisólidas o líquidas. o Las grasas sólidas son glicéridos constituídos por glicerol y ácidos grasos saturados, el sebo del ganado vacuno es un ejemplo de grasa sólida. o Las grasas semisólidas son glicéridos constituídos por glicerol y ácido grasos que sometidos a un proceso de hidrogenación se han saturado, siendo inicialmente insaturados, la margarina es una grasa semisólida. o Las grasa líquidas son glicéridos constituídos por glicerol y ácidos grasos
Universidad Católica los Ángeles de Chimbote - ULADECH 29

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

insaturados o polinsaturados, los aceites vegetales (de olivo, algodón y maíz) son grasas líquidas. Céridos.- Son lípidos simples constituíd os por un alcohol de elevado peso molecular monohidroxílico (que presenta un sólo hidroxilo) y un ácido graso saturado. Los céridos son llamados comúnmente ceras y se caracterizan por ser insolubles en agua; moldeables cuando son calentadas y duras en frío . Entre los principales céridos destacan: el palmitato de miricilo, la lanolina la cutina y la suberina. Lípidos complejos.- Biomoléculas constituídas por un alcohol, ácidos grasos y otros grupos químicos. Los lípidos complejos se clasifican en fosfolípid os y glucolípidos. Los fosfolípidos son los que presentan ácido fosfórico como grupo funcional y los glucolípidos son los que presentan azúcares como sustancia adicional. Los lípidos complejos son moléculas anfipáticas (del griego amphi = en ambos lados, y pátheia = sentir) que presentan dos regiones bien definidas. Una cabeza polar hidrofílica y una cola apolar hidrofóbica. Fosfolípidos.- Lípidos constituídos por ácidos grasos, un alcohol, ácido fosfórico y otras moléculas (generalmente nitrogenadas). So n moléculas anfipáticas; la cabeza hidrofílica está constituída por ácido fosfórico y una molécula nitrogenada, mientras que la cola hidrofílica está constituída por dos ácidos grasos y un alcohol que puede ser glicerol o la esfingosina. Son importantes co mo componentes de las membranas celulares. Los fosfolípidos pueden ser clasificados en glicerofosfolípidos y esfingofosfolípidos. o Los glicerofosfolídos.- Son los fosfolípidos que tienen como alcohol al glicerol. Dentro de este grupo se encuentran las leci tinas, las cardiolipinas, las cefalinas, los plasmalógenos, la fosfatidilserina y los lisofosfolípidos, muchos de los que componen las membranas celulares. o Los esfingofosfolípidos.- Son los fosfolípidos que tiene como alcohol a la esfingosina, dentro de este grupo se encuentran las esfingomielinas y las ceramidas. Glucolípidos.- Lípidos constituídos por un ácido graso, un alcohol llamado esfingosina y un carbohidrato que puede ser monosacárido, disacárido o un monosacárido derivado. Dentro de los glucolípidos se encuentran los cerebrósidos, los gangliósidos y los sulfátidos.

Lipidos no saponificables
Son los que al descomponerse no liberan ácidos gra sos, ni alcoholes, también son llamados lípidos derivados. Dentro de este tipo de lípidos s e consideran a los esteroides, (el colesterol del cual se pueden derivar: las hormona s sexuales estrona, estradiol, progesterona, androsterona y testosterona; otras hormonas como la ecdisona, cortisona, la aldosterona la corticosterona y el cortisol, los ácidos biliares y vitaminas como la D), los isoprenoides, las prostaglandinas y las vitaminas liposolubles (vitaminas A, E y K).

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


L A D S R E V I N U T B M H C G O Universidad Católica los Ángeles de Chimbote - ULADECH 31

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Caracteristicas generales
El nombre proteína proviene de la palabra griega : “proteios”, que significa lo primero. Entre todos los compuestos químicos, ciertamente hay que considerar a las proteínas como las más importantes, puestos que son las sustancias de la vida. Las proteínas ocupan un lugar de máxima importancia entre las molé culas constituyentes de los seres vivos. En los vertebrados, las proteínas son los compuestos orgánicos más abundantes, pues representan alrededor del 50% del peso seco de los tejidos. Prácticamente todos los procesos biológicos dependen de la presencia y/ o actividad de este tipo de sustancias. Bastan algunos ejemplos para dar idea de la variedad y trascendencia de funciones a ellas asignadas. Son proteínas casi todas las enzimas, catalizadores de reacciones químicas en organismos vivientes; muchas hormonas , reguladores de actividades celulares; la hemoglobina y otras moléculas con funciones de transporte en la sangre; anticuerpos, encargados de acciones de defensa natural contra infecciones o agentes extraños; los receptores de las células, a los cuales se fijan moléculas capaces de desencadenar una respuesta determinada; la actina y la miosina, responsables finales del acortamiento del músculo durante la contracción; el colágeno, integrante de fibras altamente resistentes en tejidos de sostén. Estas son macromoléculas compuestas por carbono, hidrógeno, oxígeno y nitrógeno. La mayoría también contienen azufre y fósforo. Las mismas están formadas por la unión de varios aminoácidos, unidos mediante enlaces peptídicos. El orden y disposición de los aminoácidos en una proteína depende del código genético, ADN, de la persona. Por hidrólisis, las moléculas proteínicas son escindidas (divididas) en numerosos compuestos relativamente simples, de pequeño peso, que son las unidades fundamentales constituyentes de la macromolécula. Estas unidades son los aminoácidos, de los cuales existen veinte especies diferentes y se unen entre sí mediante enlaces peptídicos. Cientos y miles de estos aminoácidos pueden participar en la formación de la gran molécula polimérica de una proteína.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las proteínas son moléculas específicas que marcan la individualidad de cada ser vivo. Son además de una gran importancia porque a través de ellas se va a expresar la información genética, de hecho el dogma central de la genética molecular nos dice:

DNA Estructura proteica



Presentan una disposición característica en condiciones ambientales, si se cambia la presión, temperatura, pH, etc., pierde la conformación y su función. La función dep ende de la conformación y ésta viene determinada por la secuencia de aminoácidos. En el estudio de la estructura de las cadenas polipeptídicas podemos distinguir hasta cuatro niveles de organización estructural: 1. La estructura primaria corresponde con la secuencia de aminoácidos que forman la cadena polipeptídica. La estructura primaria de las proteínas, se refiere a la secuencia de aminoácidos. Los aminoácidos están unidos por enlaces peptídicos que son los únicos que se dan en este nivel. El orden de ami noácidos le da su especificidad y también influye en la conformación final y en su función. Este orden es consecuencia de la información del material genético: Cuando se produce la traducción del RNA se obtiene el orden de aminoácidos que van a dar lugar a la proteína. Se puede decir, por tanto, que la estructura primaria de las proteínas no es más que el orden de aminoácidos que la conforman. 2. La estructura secundaria es la disposición espacial del esqueleto de la cadena polipeptídica, sin incluir las cadenas laterales de los aminoácidos. La estructura secundaria de las proteínas es el plegamiento que la cadena polipeptídica adopta gracias a la formación de enlaces de hidrógeno entre los átomos que forman el enlace peptídico. Los puentes de hidrógeno se establecen entre los estables. Hélice alfa: En esta estructura la cadena polipeptídica se enrolla en espiral sobre sí misma debido a los giros producidos en torno al carbono alfa de cada aminoácido. Esta estructura se mantiene gracias a los enlaces de hidró geno intercatenarios formados entre el grupo -NH de un enlace peptídico y el grupo -C=O del cuarto aminoácido que le sigue. Hélice de colágeno: Es una variedad particular de la estructura secundaria es la que forma el colágeno, que esta presente en tendon es y tejidos conectivos, y posee una estructura particularmente rígida. Beta láminas o de láminas plegadas: Algunas proteínas conservan su estructura primaria en zigzag y se asocian entre sí estableciendo uniones mediante enlaces de hidrógeno intercatenarios. Todos los enlaces peptídicos participan en este enlace cruzado, confiriendo así gran estabilidad a la estructura. La forma en beta es una conformación simple formada por dos o más cadenas polipeptídicas paralelas (que corren en el mismo sentido) o an típaralelas (que corren en direcciones opuestas) y se adosan estrechamente por medio de puentes de hidrógeno y diversos arreglos entre los radicales libres de los aminoácidos. Esta conformación tiene una estructura laminar y plegada, a la manera de un acor deón. 3. La estructura terciaria es la disposición tridimensional de la cadena polipeptídica completa. Es el modo en que esa cadena polipeptídica se pliega en el espacio, es decir, a cómo se arrolla una determinada proteína globular. Es la disposición de los dominios en el espacio.
Universidad Católica los Ángeles de Chimbote - ULADECH 33

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La estructura terciaria se realiza de manera que los aminoácidos apolares se sitúan hacia el interior y los polares hacia el exterior. Está estabilizada por enlaces covalentes entre Cys, puentes de hidrógeno entre cadenas laterales , interacciones iónicas entre cadenas laterales, interacciones hidrofóbicas entre cadenas laterales y las interacciones de Van der Waals.

Niveles de organización de las proteínas

4. La estructura cuaternaria aparece en las proteínas formadas por más de una cadena polipeptídica, y describe cómo están asociadas dichas cadenas para constitu ir la proteína activa. Es el nivel que afecta a la disposición de varias cadenas polipeptídicas en el espacio. Afecta solo a la relación entr e cadenas. Es similar a la terciaria. Generalmente está dado por interacción de las cadenas de proteínas con iones metálicos como en la hemoglobina. Es el nivel más complejo, por lo cual lo tienen las proteínas complejas como las enzimas y los anticuerpos.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Niveles de organización de las proteínas

Los aminoácidos
Un aminoácido es una molécula que contiene un grupo carboxilo ( -COOH) y un grupo amino ( NH2) libres. Los alfa-aminoácidos pueden representarse en general por NH2 -CHR-COOH, siendo R un radical o cadena lateral característica de cada aminoácido. Estos grupos R son muy variados químicamente. Muchos aminoácidos forman proteínas (aminoácidos proteicos), mientras otros nunca se encuentran en ellas. En todos los aminoácidos qu e componen proteínas -excepto la glicina- el carbono alfa es un carbono asimétrico. (El carbono alfa es el adyacente al grupo carboxilo.)
Universidad Católica los Ángeles de Chimbote - ULADECH 35

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Estructura de los aminoácidos

Existen aproximadamente 20 aminoácidos distintos componiendo las proteínas. L a unión química entre aminoácidos en las proteínas se produce mediante un enlace peptídico.

Formación del enlace peptídico

El enlace peptídico se define como la unión del carbono del grupo carboxilo de un aminoácido con el nitrógeno del grupo amino del otro aminoácido consecutivo, liberándose una molécula de agua (el OH del grupo carboxilo y el hidrógeno del grupo amino). A los aminoácidos que necesitan ser ingeridos por el cuerpo para obtenerlos se les llama esenciales, la carencia de estos aminoácidos en la dieta limita el desarrollo del organismo, ya que no es posible reponer las células de los tejidos que mueren o crear tejidos nuevos, en el caso del crecimiento. Estos son: 1. 2. 3. 4. 5. 6. 7. 8. 9. Valina (Val) Leucina (Leu) Isoleucina (Ile) Fenilalanina (Phe) Metionina (Met) Treonina (Thr) Lisina (Lys) Triptófano (Trp) Histidina (His)

Universidad Católica los Ángeles de Chimbote - ULADECH

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

A los aminoácidos que pueden ser sintetizados por el cuerpo se les conoce como No Esenciales y son: 10. Arginina (Arg) 11. Alanina (Ala) 12. Prolina (Pro) 13. Glicina (Gly) 14. Serina (Ser) 15. Cisteina (Cys) 16. Asparagina (Asn) 17. Glutamina (Gln) 18. Tirosina (Tyr) 19. Ácido aspártico (Asp) 20. Ácido glutámico (Glu)

Aminoácidos no proteicos
Hay aminoácidos que no se consideran proteicos y aparecen en algunas proteínas. Son derivados de otros aminoácidos, es decir, se incorporan a la proteína como uno de los aminoácidos proteicos y, después de haber sido formada la proteína, se modifican químicamente; por ejemplo, la hidroxiprolina. Algunos aminoácidos no proteicos se utilizan como neurotrans misores, vitaminas, etc. Por ejemplo, la beta-alanina o la biotina.

Clasificacion de los aminoácidos
Dado que los diferentes aminoácidos difieren unos de otros por su cadena lateral, podemos clasificarlos según el tipo de cadena lateral que posean :

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Desnaturalización de las proteinas
Si la forma de la proteína es alterada por algún factor externo (por ejemplo, aplicándole calor, ácidos o álcalis), no es capaz de cumplir su función celular. Éste es el proceso llamado desnaturalización.

Cómo la desnaturalización afecta a los distintos niveles
o En la desnaturalización de la estructura cuaternaria, las subunidades de proteínas se separan o su posición espacial se corrompe. o La desnaturalización de la estructura terciaria implica la interrupción de: Enlaces covalentes entre las cadenas laterales de los aminoácidos (como los puentes disulfuros entre las cisteínas). Enlaces no covalentes dipolo-dipolo entre cadenas laterales polares de aminoácidos. Enlaces dipolo inducidos por fuerzas de Van Der Waals entre cadenas laterales no polares de aminoácidos. o En la desnaturalización de la estructura secundaria las proteínas pierden todos los patrones de repetición regulares como l as alfa-hélices y adoptan formas aleatorias. o La estructura primaria, la secuencia de aminoácidos ligados por enlaces peptídicos, no es interrumpida por las desnaturalización. La mayoría de las proteínas biológicas pierden su función biológica cuando est án desnaturalizadas, por ejemplo, las enzimas pierden su actividad catalítica, porque los sustratos no pueden unirse más al sitio activo, y porque los residuos del aminoácido implicados en la estabilización de los sustratos no están posicionados para hacer lo. En muchas proteínas (distinto a lo que pasa con la proteína de la clara de huevo), la desnaturalización es reversible (las proteínas pueden recuperar su estado nativo cuando se quita la influencia que las desnaturaliza). Esto fue importante históricam ente, porque condujo a la noción que toda la información necesaria por la proteína para asumir su forma nativa, se encuentra codificada en la estructura primaria de la proteína, y por lo tanto en el ADN que la codifica. Cuando se cocina el alimento, algun as de sus proteínas se desnaturalizan. Esta es la razón por la cual los huevos hervidos llegan a ser duros y la carne cocinada llega a ser firme. Un ejemplo clásico de desnaturalización de proteínas se da en la clara de los huevos, que son en gran parte albúminas en agua. En los huevos frescos, la clara es transparente y líquida; pero al cocinarse se torna opaca y blanca, formando una masa sólida intercomunicada. Esa misma desnaturalización puede producirse a través de una desnaturalización química, por ejemplo volcándola en un recipiente con acetona. Otro ejemplo es la nata (nombre que proviene de la desnaturalización), que se produce por calentamiento de la lactoalbúmina de la leche (y que no tiene nada que ver con la crema) . Los agentes que provocan la desnaturalización de una proteína se llaman agentes desnaturalizantes. Se distinguen agentes físicos (calor) y químicos (detergentes, disolventes orgánicos, pH, fuerza iónica). Como en algunos casos el fenómeno de la desnaturalización es reversible, es posible precipitar proteínas de manera selectiva mediante cambios en: 1. la polaridad del disolvente, 2. la fuerza iónica,
Universidad Católica los Ángeles de Chimbote - ULADECH 40

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

3. el pH, 4. la temperatura.

Desnaturalización irreversible de la proteína de la clara huevo y pérdida de solubilidad, causadas por la alta temperatura (mientras se la fríe)

Cuando la temperatura es elevada aumenta la energía cinética de las moléculas con lo que se desorganiza la envoltura acuosa de las proteínas, y se desnaturalizan. Asimismo, un aumento de la temperatura destruye las interacciones débiles y desorganiza la estructura de la proteína, de forma que el interior hidrofóbico interacciona con el medio acuoso y se produce la agregación y precipitación de la proteína desnaturalizada.

Propiedades de las proteinas
Las funciones principales de las proteínas son: 1. Ser esenciales para el crecimiento. Las grasas y carbohidratos no las pueden sustituir, por no contener nitrógeno. 2. Proporcionan los aminoácidos esenciales fundamentales para la síntesis tisular. 3. Son materia prima para la formación de los jugos digestivos, hormonas, proteínas plasmáticas, hemoglobina, vitaminas y enzimas. 4. Funcionan como amortiguadores, ayudando a mantener la reacción de diversos medios como el plasma. 5. Actúan como catalizadores biológicos acel erando la velocidad de las reacciones químicas del metabolismo. Son las enzimas. 6. Actúan como transporte de gases como oxígeno y dióxido de carbono en sangre. (hemoglobina). 7. Actúan como defensa, los anticuerpos son proteínas de defensa natural contra inf ecciones o agentes extraños. 8. Permiten el movimiento celular a través de la miosina y actina (proteínas contráctiles musculares). 9. Resistencia. El colágeno es la principal proteína integrante de los tejidos de sostén.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Funciones generales:
Las proteínas están entre las sustancias que realizan las funciones más importantes en los seres vivos. De entre todas pueden destacarse las siguientes: o De reserva. En general las proteínas no tienen función de reserva, pero pueden utilizarse con este fin en algunos cas os especiales como por ejemplo en el desarrollo embrionario: ovoalbúmina del huevo, caseína de la leche y gliadina del trigo. o Estructural. Las proteínas constituyen muchas estructuras de los seres vivos. Las membranas celulares contienen proteínas. En el o rganismo, en general, ciertas estructuras -cartílago, hueso- están formadas, entre otras sustancias, por proteínas. o Enzimática. Todas las reacciones que se producen en los organismos son catalizadas por moléculas orgánicas. Las enzimas son las moléculas qu e realizan esta función en los seres vivos. Todas las reacciones químicas que se producen en los seres vivos necesitan su enzima y todas las enzimas son proteínas. o Transporte, de gases, como es el caso de la hemoglobina, o de lípidos, como la seroalbúmina. Ambas proteínas se encuentran en la sangre. Las permeasas, moléculas que realizan los intercambios entre la célula y el exterior, son también proteínas. o Movimiento. Actúan como elementos esenciales en el movimiento. Así, la actina y la miosina, proteínas de las células musculares, son las responsables de la contracción de la fibra muscular. o Homeostática. Ciertas proteínas mantienen el equilibrio osmótico del medio celular y extracelular. o Hormonal. Las hormonas son sustancias químicas que regulan procesos v itales. Algunas proteínas actúan como hormonas, por ejemplo: la insulina, que regula la concentración de la glucosa en la sangre. o Inmunológica. Los anticuerpos, sustancias que intervienen en los procesos de defensa frente a de los agentes patógenos, son pr oteínas.

Péptidos, polipéptidos y proteínas
Cuando se unen dos aminoácidos mediante un enlace peptídico se forma un dipéptido. A cada uno de los aminoácidos que forman el dipéptido les queda libre o el grupo amino o el grupo carboxilo. A uno de estos grupos se le podrá unir otro aminoácido formándose un tripéptido. Si el proceso se repite sucesivamente se formará un polipéptido. Cuando el número de aminoácidos unidos es muy grande, aproximadamente a partir de 100, tendremos una proteína. 2 aminoácidos 3 aminoácidos 4 a 10 aminoácidos 10 a 100 aminoácidos más de 100 aminoácidos = Dipéptido = Tripéptido = Oligopéptido = Polipéptido = Proteína

Toda cadena polipeptídica tendrá en uno de sus extremos un aminoácido con el grupo amino libre. Este será el aminoácido amino terminal (H-). En el otro extremo quedará libre el grupo carboxilo del último aminoácido, aminoácido carboxilo terminal ( -OH). Toda cadena proteica tendrá por lo tanto una polaridad indicada mediante una H- y un -OH. Ejemplo: H– Ala–Gly– Tyr–Glu–Val–Ser –OH.
Universidad Católica los Ángeles de Chimbote - ULADECH 42

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Formación de un polipéptido

Muchas sustancias naturales de gran importancia son péptidos; por ejemplo: ciertas hormonas, como la insulina, que regula las concentraciones de glucosa en la sangre y que e stá formada por dos cadenas de 21 y 30 aminoácidos unidas por puentes disulfuro; la encefalina (5 aminoácidos) que se produce en las neuronas cerebrales y elimina la sensación de dolor o las hormonas del lóbulo posterior de la hipófisis: vasopresina y oxit ocina (9 aa) que producen las contracciones del útero durante el parto; también son péptidos algunos antibióticos como la gramicidina.
Universidad Católica los Ángeles de Chimbote - ULADECH 43

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


T B M H C G O L A D S R E V I N U Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

LAS ENZIMAS Características generales
Los enzimas son proteínas que catalizan reacciones qu ímicas en los seres vivos. Los enzimas son catalizadores, es decir, sustancias que, sin consumirse en una reacción, aumentan notablemente su velocidad. No hacen factibles las reacciones imposibles, sino que sólamente aceleran las que espontáneamente podría n producirse. Ello hace posible que en condiciones fisiológicas tengan lugar reacciones que sin catalizador requerirían condiciones extremas de presión, temperatura o pH. Prácticamente todas las reacciones químicas que tienen lugar en los seres vivos está n catalizadas por enzimas. Los enzimas son catalizadores específicos: cada enzima cataliza un solo tipo de reacción, y casi siempre actúa sobre un único sustrato o sobre un grupo muy reducido de ellos. En una reacción catalizada por un enzima: 1. La sustancia sobre la que actúa el enzima se llama sustrato. 2. El sustrato se une a una región concreta de la enzima, llamada centro activo . El centro activo comprende es un sitio de unión formado por los aminoácidos que están en contacto directo con el sustrato y un sitio catalítico, formado por los aminoácidos directamente implicados en el mecanismo de la reacción 3. Una vez formados los productos el enzima puede comenzar un nuevo ciclo de reacción .

Energía de activación de una reacción química

Las enzimas son moléculas de proteínas que tienen la capacidad de facilitar y acelerar las reacciones químicas que tienen lugar en los tejidos vivos, disminuyendo el nivel de la "energía de activación" propia de la reacción. Se entiende por "energía de activación" al valor de la energía que es necesario aplicar (en forma de calor, electricidad o radiación) para que dos moléculas determinadas colisionen y se produzca una reacción química entre ellas. Generalmente, las enzimas se nombran añadiendo la terminación "asa" a la raíz del nombre de la sustancia sobre la que actúan (sustrato). Las enzimas no reaccionan químicamente con las sustancias sobre las que actúan (que se denominan sustrato), ni alteran el equilibrio d e la reacción. Solamente aumentan la velocidad con que estas se producen, actuando como catalizadores. La velocidad de las reacciones enzimáticas dependen de la concentración de la enzima, de la concentración del sustrato (hasta un límite) y de la temperatura y el pH del medio.
Universidad Católica los Ángeles de Chimbote - ULADECH 45

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las enzimas son sustancias de naturaleza proteica que catalizan reacciones químicas siempre que sea termodinámicamente posible. En estas reacciones, las moléculas sobre las que actúa la enzima en el comienzo del proceso son llamadas sustratos, y estas los convierten en diferentes moléculas, los productos. Casi todos los procesos en las células necesitan enzimas para que ocurran en tasas significativas. Debido a que las enzimas son extremadamente selectivas con sus sustratos y su ve locidad crece solo con algunas reacciones de entre otras p osibilidades, el conjunto de enzimas sintetizadas en una célula determina el metabolismo que ocurre en cada célula. A su vez, esta síntesis depende de la regulación de la expresión génica. Como todos los catalizadores, las enzimas funcionan disminuyendo la energía de activación para una reacción, así se acelera substancialmente la tasa de la reacción. La gran mayoría de las reacciones de las enzimas son millones de veces más rápidas que las reaccion es no catalizadas. Al igual que ocurre con los catalizadores, las enzimas no son consumidas por las reacciones que ellas catalizan, ni alteran su equilibrio químico. Sin embargo, las enzimas difieren de otros catalizadores por ser más específicas. Las enz imas catalizan alrededor de 4.000 rea cciones bioquímicas distintas. No todas los catalizadores bioquímicos son proteínas, pues algunas moléculas de ARN son capaces de catalizar reacciones (como el fragmento 16S de los ribosomas en el que reside la activida d peptidil transferasa). La actividad de las enzimas puede ser afectada por otras moléculas. Las inhibidoras son moléculas que disminuyen la actividad de las enzimas; mientras que las activadoras son moléculas que incrementan la actividad. Asimismo, gran cantidad de enzimas requieren de cofactores para su actividad. Muchas drogas o pociones son moléculas inhibidoras. La actividad es afectada por la temperatura, el pH, y la concentración del sustrato. Algunas enzimas son usadas comercialmente, por ejemplo, en la síntesis de antibióticos. Además, algunos productos para hogares usan enzimas para acelerar las reacciones bioquímicas.

Propiedades de las enzimas
Las propiedades de los enzimas derivan del hecho de ser proteínas y de actuar como catalizadores. Como proteínas, poseen una conformación natural más estable que las demás conformaciones posibles. Así, cambios en la conformación suelen ir asociados en cambios en la actividad catalítica. Los factores que influyen de manera más directa sobre la actividad d e un enzima son: 1. pH 2. temperatura 3. cofactores o EFECTO DEL pH SOBRE LA ACTIVIDAD ENZIMÁTICA .- Los enzimas poseen grupos químicos ionizables (carboxilos -COOH; amino -NH2; tiol -SH; imidazol, etc.) en las cadenas laterales de sus aminoácidos. Según el pH del medio, estos grupos pueden tener carga eléctrica positiva, negativa o neutra. Como la conformación de las proteínas depende, en parte, de sus cargas eléctricas, habrá un pH en el cual la conformación será la más adecuada para la actividad catalítica. Este es el llamado pH óptimo. La mayoría de los enzimas son muy sensibles a los cambios de pH. Desviaciones de pocas décimas por encima o por debajo del pH óptimo pueden afectar drásticamente su actividad.
Universidad Católica los Ángeles de Chimbote - ULADECH 46

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Así, la pepsina gástrica tiene un pH óptimo de 2, la ureasa lo tiene a pH 7 y la arginasa lo tiene a pH 10. Como ligeros cambios del pH pueden provocar la desnaturalización de la proteína, los seres vivos han desarrollado sistemas más o menos complejos para mantener estable el pH intracelular: Los amortigua dores fisiológicos. o EFECTO DE LA TEMPERATURA SOBRE LA ACTIVIDAD ENZIMÁTICA .- En general, los aumentos de temperatura aceleran las reacciones químicas: por cada 10ºC de incremento, la velocidad de reacción se duplica. Las reacciones catalizadas por enzima s siguen esta ley general. Sin embargo, al ser proteínas, a partir de cierta temperatura, se empiezan a desnaturalizar por el calor. La temperatura a la cual la actividad catalítica es máxima se llama temperatura óptima. Por encima de esta temperatura, el aumento de velocidad de la reacción debido a la temperatura es contrarrestado por la pérdida de actividad catalítica debida a la desnaturalización térmica, y la actividad enzimática decrece rápidamente hasta anularse.

Efecto de la temperatura sobre la actividad del pH

o EFECTO DE LOS COFACTORES SOBRE LA ACTIVIDAD ENZIMÁTICA .- A veces, un enzima requiere para su función la presencia de sustancias no proteicas que colaboran en la catálisis: los cofactores. Los cofactores pueden ser iones i norgánicos como el Fe++, Mg++, Mn++, Zn++ etc. Casi un tercio de los enzimas conocidos requieren cofactores. Cuando el cofactor es una molécula orgánica s e llama coenzima. Cuando los cofactores y las coenzimas se encuentran unidos covalentemente a la enzima se llaman grupos prostéticos. La forma catalíticament e activa del enzima, es decir, la enzima unida a su grupo prostético, se llama holoenzima. La parte proteica de un holoenzim a (inactiva) se llama apoenzima. Las enzimas son proteínas o asociaciones de proteínas y otras moléculas orgánicas o inorgánicas que actúan catalizando los procesos químicos que se dan en los seres vivos. Esto es, actúan facilitando las transformaciones químicas; acelerando considerablemente las reacciones y disminuyendo la energ ía de activación que muchas reacciones requieren. Así, por ejemplo: o La descomposición del agua oxigenada (peróxido de hidrógeno) en agua y oxígeno, según la reacción: 2 H2O2 ---------> 2 H2O + O2 Es una reacción que puede transcurrir espontáneamente per o es extraordinariamente lenta. En condiciones normales se descomponen 100 000 moléculas cada 300 años por cada mol de H2O2 (6,023x1023 moléculas). Sin embargo, en presencia de una enzima que hay en nuestras células, la catalasa, el proceso se desarrolla c on extraordinaria rapidez (el burbujeo que se produce al echar agua oxigenada en una herida es debido a esto).
Universidad Católica los Ángeles de Chimbote - ULADECH 47

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Energía de activación de las enzimas

Las enzimas, como catalizadores que son, no modifican la constante de equilibrio y tampoco se transforman, recuperándose intactas al final del proceso. La rapidez de actuación de las enzimas y el hecho de que se recuperen intactas para poder actuar de nuevo es la razón de que se necesiten en pequeñísimas cantidades. ESPECIFICIDAD DE LAS ENZIMAS Es de destacar que las enzimas son específicas. Esto es, una enzima puede actuar sobre un substrato o un grupo de substratos relacionados (especificidad de substrato) pero no sobre otros; por ejemplo: la sacarasa, que hidroliza la sacarosa. Otras enzimas, sin embargo, tienen especificidad de acción al realizar una acción determinada pero sobre múltiples substratos; por ejemplo: las lipasas que hidrolizan los enlaces éster en los lípidos. Debido a esta especificidad de las enzimas existen en la célula miles de enzimas diferentes. La especificidad de las enzimas ha llevado a comparar a éstas con llaves y a los substratos con cerraduras (modelo de la llave y la cerradura).

Complejo enzima – sustrato (ES)

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Constitución química de las enzima y modo de actuación
En el pasado las enzimas se conocían con el nombre de fermentos, porque los primeros enzimas estudiados fueron los fermentos de las levaduras y de las bacterias. En la actualidad el término fermento se aplica únicamente a las enzimas que las bac terias, hongos y levaduras vierten al exterior para realizar determinadas trasformaciones: las fermentaciones. Las enzimas son, en general, prótidos. Algunas son proteínas en sentido estricto. Otras poseen una parte proteica (apoenzima) y una parte no pro teica, ambas están más o menos ligadas químicamente. La conformación espacial de la parte proteica es la responsable de la función que realiza la enzima. Para ello la sustancia o sustancias que van a reaccionar y transformarse se unen a la enzima en una zona que llamaremos centro activo y son las interacciones químicas entre los restos de los aminoácidos presentes en el centro activo y el substrato o los substratos las responsables de la transformación; ya que estas interacciones producen reordenamientos d e los electrones que debilitan ciertos enlaces y favorecen la formación de otros desencadenando la transformación química.

La parte proteica o apoenzima es también, y por las mismas razones, la que determina la especificidad de la enzima. Así, la sacarasa actúa sobre la sacarosa por ser esta la única molécula que se adapta al centro activo. Muchas enzimas precisan para su actuación la presencia de otras sustancias no proteicas: los cofactores. Químicamente son sustancias muy variadas. En algunos casos se trata de simples iones, cationes en particular, como el Cu+ + o el Zn++ . En otros, son sustancias orgánicas mucho más complejas, en cuyo caso se llaman coenzimas. Muchas vitaminas son coenzimas o
Universidad Católica los Ángeles de Chimbote - ULADECH 49

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

forman parte de coenzimas.

Las coenzimas son imprescindibles para que la enzima actúe. Suelen, además, ser las responsables de la actividad química de la enzima. Así, muchas reacciones de oxidación precisan del NAD++, que es el que capta los electrones y sin su presencia la enzima no pued e actuar. Otro ejemplo lo tenemos en las reacciones que necesitan energía en las que actúa como coenzima el ATP.

Por último, indicar que las enzimas se nombran añadiendo la terminación asa, bien al nombre del substrato sobre el que actúan ( sacarasa), al tipo de actuación que realizan (hidrolasas), o ambos (ADN polimerasa).

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 51

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


ACIDOS NUCLEICOS Caracteristicas generales
Los ácidos nucleicos son macromoléculas, polímeros formados por la repetición de monómeros llamados nucleótidos, unidos mediante enlaces fosfodiéster . Los enlaces 3', 5' fosfodiéster son los que unen a los mononucleótidos. Estos enlaces son los que unen al gr upo 5'-hidroxilo de la desoxirribosa de un nucleótido con el grupo 3' -hidroxilo de la unidad azúcar de otro nucleótido mediante un grupo fosfato). Se forman así largas cadenas o polinucleótidos. Pueden alcanzar tamaños gigantes (millones de nucleótidos), s iendo las moléculas más grandes que se conocen.

El ácido desoxirribonucleico (DNA) y el ácido ribonucleico (RNA)

Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos (son polinucleótidos). Los ácidos nucleicos son compuestos de elevado peso molecular, esto es, son macromoléculas. El descubrimiento de los ácidos nucleicos se debe a Miescher que en la década de 1860 aisló de los núcleos de las células una sustancia ácida a la que llamó nucleína, nombre que posteriormente se cambió a ácido nucleico. Existen dos tipos de ácidos nucleicos, ADN (ácido desoxirribonucleico) y ARN (ácido ribonucleico), que se diferencian en:
Universidad Católica los Ángeles de Chimbote - ULADECH 52

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

1. El azúcar (pentosa) que contienen: la desoxirribosa en el ADN y la ribosa en el ARN. 2. Las bases nitrogenadas que contienen: adenina, guanina, citosina y timina en el ADN; y adenina, guanina, citosina y uracilo en el ARN. 3. En los eucariotas la estructura del ADN es de doble cadena, mientras que la estructura del ARN es monocatenaria aunque puede presentarse en forma extendida como el ARNm o en forma plegada como ARNt y ARNr. 4. La masa molecular del ADN es generalmente mayor que la del ARN.

La estructura de los nucleótidos de los aminoácidos

Las unidades que forman los ácidos nucleicos son los nucleótidos. Cada nucleótido es una molécula compuesta por la unión de tres unidades: 1. Un monosacárido (una pentosa), 2. una base nitrogenada (purínica (adenina, guani na) o pirimidínica (citosina, timina o uracilo) y, 3. un grupo fosfato (ácido fosfórico).

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las pentosas.- la desoxirribosa del DNA y la ribosa del RNA

La desoxirribosa y la ribosa

Las bases nitrogenadas
Universidad Católica los Ángeles de Chimbote - ULADECH 54

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las bases puricas

Las bases pirimidicas

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las bases nitrogenadas

El grupo fosfato

Tanto la base nitrogenada como los grupos fosfato están unidos a la pentosa. La unión formada por la pentosa y la base nitrogenada se denomina nucleósido.

Desoxirribonucleótido y ribonucl eótico

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El enlace fosfodiester
El ADN es bicatenario, está constituido por dos cadenas polinucleotídicas unidas entre sí en toda su longitud. Esta doble cadena puede disponerse en forma lineal (ADN del núcleo de las células eucarióticas) o en forma circular (ADN de las células procarióticas, así como de las mitocondrias y cloroplastos eucarióticos). La molécula de ADN porta la información necesaria para el desarrollo de las características biológicas de un individuo y contiene los mensajes e instrucciones para que las células realicen sus funciones. El ARN difiere del ADN en que la pentosa de los nucleótidos constituyentes, en lugar de desoxirribosa es ribosa, y en que en lugar de las cuatro bases A, G, C, T aparece A, G, C, U (es decir, uracilo en lugar de timina). Las cadenas de ARN son más cortas que las de ADN. El ARN está constituido casi siempre por una única cadena (es monocatenario). Mientras que el ADN contiene la información, el ARN actúa de mensajero de dicha información , para dar lugar a la síntesis de proteínas.

El DNA y el RNA Los ácidos nucleicos, llamados así porque en un principio fueron localizados en el núcleo celular, son las moléculas de la herencia y por lo tanto van a participar en los mecanismos mediante los cuales la información genética se almacena, replica y transcribe. Los nucleótidos son los monómeros que constituyen los ácidos nucleicos. Se forman cuando se unen el ácido fosfórico y un nucleósido. NUCLEÓSIDO: El azúcar y la base nitrogenada se unen entre sí como se indica en las figuras formando un nucleósido. El enlace se forma entre el carbono anomérico del azúcar y uno de los
Universidad Católica los Ángeles de Chimbote - ULADECH 57

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

nitrógenos de la base nitrogenada, en conc reto, el indicado en las figuras. En la unión se forma una molécula de agua. Este enlace recibe el nombre de enlace N - glicosídico.

Las cadenas nucleotídicas de los ácidos nucleicos

Los nucleótidos están formados por: una base nitrogenada (BN), un azúcar (A) y ácido fosfórico (P); unidos en el siguiente orden: P – A – BN. En la formación de los nucleótidos se produce una unión fosfoéster entre un OH del ácido fosfórico y el OH situado en el carbono 5 del azúcar, con formación (liberación) de una molécula de agua. Según el azúcar sea la ribosa o la desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos. La timina nunca forma parte de los ribonucleótidos y el uracilo no forma parte de los desoxirribonucleótidos.
Universidad Católica los Ángeles de Chimbote - ULADECH 58

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Es de destacar que en toda cadena de polinucleótidos el nucleótido de uno de los extremos tendrá libre el OH del azúcar en posición 3, éste será el extremo 3' de la cadena. El ácido fosfórico del nucleótido que se encuentre en el extremo opuesto también estará libre, éste será el extremo 5'. Esto marca un sentido en la cadena de polinucleótidos.

El acido desoxirribonucleico (ADN o DNA)
Químicamente son polinucleótidos constituidos por d -AMP, d-GMP, d-CMP y d-TMP. Los nucleótidos del ADN no tienen ni uracilo, ni ribosa. Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons. Así, por ejemplo: el genoma humano está formado por 3 x 109 pares de nucleótidos. Esto hace que sean moléculas de una gran longitud; por ejemplo: 1,7 um en el caso del virus de la poliomielitis y 2,36 m si sumamos todo el ADN de todos los cromosomas de una célula humana. El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empezó a conocer su estructura. Se encuentra en el núcleo de las células eucario tas asociado a proteínas (histonas y otras) formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la información genética. También hay ADN en ciertos orgánulos celulares (por ejemplo: plastos “cloroplastos” y mi tocondrias).

Estructura del ADN
Se pueden distinguir 3 niveles estructurales: o Estructura primaria: La secuencia de los nucleótidos. o Estructura secundaria: La doble hélice. o Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado. En las células eucariotas, a partir de la estructura 30, se dan otros niveles de empaquetamiento de orden superior.

Estructura primaria del ADN
Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotíd ica.

Estructura primaria (secuencia de nucleótidos)

La posibilidad de combinar cuatro nucleótidos diferentes y la gran longitud que pueden tener las cadenas polinucleotídicas, hacen que pueda ha ber un elevado número de polinucleótidos posibles, lo que determina que el ADN pueda contener el mensaje biológico o información genética y explica la diversidad del mensaje genético de todos los seres vivos.
Universidad Católica los Ángeles de Chimbote - ULADECH 59

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Estructura secundaria del ADN

Estructura secundaria del ADN

Datos preliminares: A. A finales de los años 40 Erwin CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados: o La concentración de bases varía de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo. o Tejidos diferentes de la misma especie tienen la misma composición en bases. o La composición en bases del ADN de una misma especie no varía con la edad del organismo ni con su estado nutricional ni con las variaciones ambientales. o Las densidades y viscosidades corresponden a la existencia de enlaces de hidrógeno entre los grupos NH y los grupos CO. o La concentración de Adenina es igual a la de Timina, y la de Citosi na a la de Guanina. Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas.

Puentes de Hidrógeno: G con C y A con T Universidad Católica los Ángeles de Chimbote - ULADECH 60

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

B. Por medio del método analítico de difracción de rayos X, FRANKLIN y WILKINS observaron una estructura fibrilar de 20 Aº (Amstrongs) de diámetro con repeticiones cada 3,4 Aº y una mayor cada 34 Aº.

Estructura del ADN

C. WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hélice. Este modelo, además de explicar cómo era el ADN, sugería los mecanismos que explicaban su función biológica y la forma como se replicaba. Según el modelo de la doble hélice de WATSON y CRICK: El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice. Ambas cadenas serían antiparalelas, una iría en sentido 3' -5' y la otra en sentido inverso, 5' – 3'. Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.
Universidad Católica los Ángeles de Chimbote - ULADECH 61

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La estructura del DNA

Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre sí y las bases de cada una de las hélices estarían apareadas con las de la otra aso ciándose mediante puentes de hidrógeno. El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la guanina y la citosina, por la otra. Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra , ambas cadenas serían complementarias. La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las células hijas. Ambas cadenas o hebras se pueden separar
Universidad Católica los Ángeles de Chimbote - ULADECH 62

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

parcialmente y servir de molde para la síntesis de una nueva cadena complementaria (síntesis semiconservativa).

Estructura terciaria del ADN en las células eucariotas
Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupando así menos espacio en el núcleo celular y además como mecanismo para preservar su transcripción. Como hemos visto, en las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: nucleoproteínas, formando la cromatina. En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no está más empaquetado aún, fo rma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Según el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.

Niveles superiores de empaquetamiento
Los siguientes niveles de empaquetamiento no están aún aclarados del todo pero, parece ser, que cada fibra se volvería a enrollar formando un bucle (cada bucle t endría 50 millones de pares de bases), seis bucles se empaquetarían asociándose a un "esqueleto nuclear" produciéndose un rosetón, 30 rosetones formarían una espiral y 20 espirales formarían una cromátida. Todo ello produciría un gran acortamiento de las l argas cadenas de ADN.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Empaquetamiento de los nucleosomas según el modelo del solenoide Cromosoma

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Diferentes niveles de condensación de ADN. (1) Hebra simple de ADN. (2) Hebra de cromatina (ADN con histonas, "cuenta de collar"). (3) Cromatina durante la interfase con centrómero (color rojo). (4) Cromatina condensada durante la profase (Dos copias de ADN están presentes). (5) Cromosoma durante la metafase.

En los espermatozoides el ADN se encuentra aún mucho más e mpaquetado, se dice que tiene "estructura cristalina". Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tan complejas y no están asociados a histonas, aunque sí están asociados a otras proteínas.

Tipos de ADN:
Según su estructura se distinguen los siguientes tipos de ADN: Monocatenarios o de una cadena; por ejemplo los de algunos virus. Bicatenarios, con dos hebras o cadenas (algunos virus, las bacterias y los eucariotas). A su vez, y en ambos casos, el ADN puede ser: Lineal, como por ejemplo el del núcleo de las células eucariotas y el de algunos virus. Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.

El ácido ribonucleico “ARN o RNA ”
El ARN, ácido ribonucleico, es un polirribonucleótido que, a diferencia del ADN, no contiene ni desoxirribosa ni timina, pero sí ribosa y uracilo. El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja.

Clases de ARN
Por su estructura y su función se distinguen tres clases de ARN: 1. El ARNm (ARN mensajero): es un polirribonucleótido constituido por una única cadena sin ninguna estructura de orden superior. Su masa molecular suele ser elevada. Este ARN se sintetiza en el núcleo celular y pasa al citoplasma transportando la información para la síntesis de proteínas. La duración de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rápidamente por enzimas específicas. 2. El ARNt (ARN de transferencia): transporta los aminoácidos para la síntesis de proteínas. Está formado por una sola cadena, aunque en ciertas zonas se encuentra replegada y asociada internamente mediante puentes de hidrógeno entre bases complementarias. Su peso molecular es del orden de 25.000 da. Está formado por entre 70 y 90 nucleótidos y constituye el 15 % del total del ARN de la célula. Se sintetiza en el núcleo y sale hacia el citoplasma para realizar su función. En el ARNt podemos distinguir un brazo aceptor de aminoácidos abierto y un b ucle anticodon. 3. El ARNr (ARN ribosomal): es el ARN que forma parte de las subunidades de los de los ribosomas. 4. Los ARN víricos. Algunos virus tienen como material genético ARN bicatenario.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El ADN y el ARN diferencias a nivel químico
El ADN (ácido desoxirribonucleico) sus nucleótidos tienen desoxirribosa como azúcar y no tiene uracilo. El ARN (ácido ribonucleico) tiene ribosa y no tiene timina.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular



Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La citología o biología celular es la rama de la biología que estudia las células en lo que concierne a su estructura, sus funciones y su importancia en la complejidad de los seres vi vos. Citología viene del griego κγτοs cavidad. Con la invención del microscopio óptico fue posible observar estructuras nunca antes vistas por el hombre, las células. Esas estructuras se estudiaron más detalladamente con el empleo de técnicas de citoquímica y con la ayuda fundamental del microscopio electrónico. La biología celular se centra en la comprensión del funcionamiento de los sistemas celulares, de cómo estas células se regulan y la comprensión del funcionamiento de sus estructuras. Una disciplina af ín es la biología molecular. La célula es la unidad esencial que tiene todo ser vivo. Es además la estructura funcional fundamental de la materia viva según niveles de organización biológ ica, capaz de vivir independientemente como entidad unicelular, o bien, formar parte de una organización mayor, como un organismo pluricelular. La célula presenta 2 modelos básicos: la procarionte y eucarionte. Su organización general comprende: membrana plasmática, citoplasma y ADN.

La primera referencia al concepto de célula data del siglo XVII cuando el inglés Robert Hooke utilizó este término (por su parecer a las habitaciones de los sacerdotes llamados Celdas) para referirse a los pequeños huecos poliédricos que constituían la estructura de ciertos tejidos vegetales como el corcho. No obstante hasta el siglo XIX no se desarrolla este concepto considerando su estructura interior. Es en este siglo cuando se desarrolla la teoría celular, que reconoce la célula como la unidad básica de estructura y función de todos los seres vivos, idea que constituye desde entonces uno de lo pilares de la Biología moderna. Fue esta teoría la que desplazó en buena medida las investigaciones biológicas al terreno microscópico pues no son visibles a simple vista. La unidad de medida utilizada es el mi crómetro (μm) existiendo células de entre 2 y 20 μm.
Universidad Católica los Ángeles de Chimbote - ULADECH 69

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La investigación microscópica pronto daría lugar al descubrimiento de la estructura celular interna incluyendo el núcleo, los cromosomas, el aparato de Golgi y otros orgánulos celulares así como la identificación de la relación existente entre la estructura y la función de los orgánulos celulares. Ya en siglo XX la introducción del microscopio electrónico reveló detalles de las ultraestructura celular y la aparición de la histoquímica y de la citoquímica . También se descubrió la base material de la herencia con los cromosomas y el ADN con la aparición de la citogenética. Atendiendo a su organización celular, los seres vivos se clasificarán en acelulares (virus, viroides) y celulares, siendo estos a su v ez clasificados en eucariotas y procariotas.

Para alcanzar sus objetivos, los biólogos celulares se ven obligados a estudiar los componentes de la célula a nivel molecular (biología molecular). Componentes principales del estudio celula r: membrana plasmática, citoesqueleto, núcleo celular, ribosomas, retículo endoplásmico, aparato de Golgi, mitocondrias, cloroplastos, lisosomas, peroxisomas, vacuolas, pared celular, tráfico intracelular de membranas.

La teoría celular es una parte fundamental de la Biología que explica la constitución de la materia viva a base de células y el papel que éstas juegan en la constitución de la vida. Robert Hooke había observado ya en el siglo XVII que el corcho y otras materias vegetales apar ecen constituidas de células (literalmente, celdillas). Dos científicos alemanes, Theodor Schwann, histólogo y fisiólogo, y Jakob Schleiden, botánico, se percataron de cierta comunidad fundamental en la estructura microscópica de animales y plantas, en particular la presencia de núcleos, que el botánico británico Robert Brown había descrito recientemente (1827). Publicaron juntos la obra Investigaciones microscópicas sobre la concordancia de la estructura y el crecimiento de las plantas y los animales ( Mikroskopische Untersuchungen über die Übereinstimmung in der Struktur und dem Wachstum der Tiere und Pflanzen, Berlin, 1939). Asentaron el primer principio de la teoría celular histórica: “Todo en los seres vivos está formado por células o produ ctos secretados por las células”.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Otro alemán, el médico Rudolf Virchow, interesado en la especificidad celular de la patología (sólo algunas clases de células parecen implicadas en cada enfermedad) explicó lo que debemos considerar el segundo principio: “Toda célula se ha originado a partir de otra célula, por división de ésta ”.

Ahora estamos en condiciones de añadir que la división es por bipartición, porque a pesar de ciertas apariencias, la división es siempre, en el fondo, bin aria. El principio lo popularizó Virchow en la forma de un aforismo creado por Francois -Vincent Raspail, «omnis cellula e cellula». Virchow terminó con las especulaciones que hacían descender la célula de un hipotético blastema. Su postulado, que implica l a continuidad de las estirpes celulares, está en el origen de la observación por August Weismann de la existencia de una línea germinal, a través de la cual se establece en animales (incluido el hombre) la continuidad entre padres e hijos y, por lo tanto, del concepto moderno de herencia biológica. La teoría celular fue debatida a lo largo del siglo XIX, pero fue Pasteur el que, con sus experimentos sobre la multiplicación de los microorganismos unicelulares, dio lugar a su aceptación rotunda y definitiva. Se puede resumir el concepto moderno de teoría celular en los siguientes principios: 1. Todo en los seres vivos está formado por células o por sus productos de secreción. La célula es la unidad anatómica de la materia viva, y una célula puede ser suficient e para constituir un organismo. 2. Todas las células proceden de células preexistentes, por división de éstas (Omnis cellula e cellula). 3. Las funciones vitales de los organismos ocurren dentro de las células, o en su entorno inmediato, controladas por sustan cias que ellas secretan. En una célula caben todas las funciones vitales, de manera que basta una célula para tener un ser vivo (que será un ser vivo unicelular). Así pues, la célula es la unidad fisiológica de la vida. 4. Cada célula contiene toda la inform ación hereditaria necesaria para el control del desarrollo y el funcionamiento de un organismo de su especie y para la transmisión de la información a las siguientes generaciones celulares. Así que la célula también es la unidad genética.
Universidad Católica los Ángeles de Chimbote - ULADECH 71

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La célula es la unidad esencial de todo ser vivo. Es además la estructura funcional fundamental de la materia viva según niveles de organización biológica , capaz de vivir independientemente como entidad unicelular, o bien, formar parte de una organización mayo r, como un organismo pluricelular. La célula presenta 2 modelos básicos: la procarionte y eucarionte. Su organización general comprende: membrana plasmática, citoplasma y ADN (núcleo). La teoría celular es la base sobre la que se sustenta gran parte de l a biología. Si excluimos los virus, todos los seres vivos que forman los reinos biológicos están formados por células. El concepto de célula como unidad funcional de los organismos surgió en los años 1830 y 1880. Las investigaciones se vieron retrasadas po r el poco avance de los microscopios ópticos.

Comparación entre la célula eucariota animal y la procariota. En la célula procariota, la cápsula no siempre se presenta.

CLASIFICACIÓN Existen dos tipos básicos de células: procariotas y eucariotas. Las células procariotas son estructuralmente simples. Conformaron a los primeros organismos del tipo unicelular. Éstos tenían un ADN cerrado circular, el cual se encontraba disperso en el citoplasma ausente de núcleo. La célula no tenía organelos –a excepción de ribosomasni estructuras especializadas. Como no poseen mitocondrias, los procariotas obtienen energía del medio mediante mesosomas o invaginaciones en la membrana. Sus mayores representantes son las bacterias.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las células eucariotas son más complejas que las procariotas. Su rgieron de las células procariontes. Tienen mayor tamaño y su organización es más compleja, con presencia de organelos, lo que permite la especialización de funciones. El ADN está contenido en un núcleo permeable rodeado de membranas. A este grupo pertenec en protozoos, hongos, plantas y animales.

Diferencias entre una célula Eucariota y Procariota
ESTRUCTURA PROCESOS Nucleo Membrana nuclear ADN EUCARIOTAS Verdadero o definido Presente PROCARIOTAS Falso, primitivo o no definido Ausente

Combinado con proteínas Desnudo y circular. Ubicado en la (histonas) forman la cromatina región nuclear o nucleoide. Único Fisión binaria Ausentes:

Cromosomas Múltiples División celular Mitocondria Mitosis o Meiosis Presentes (con ribosomas 70S)


Los procesos bioquímicos Presentes en células vegetales equivalentes tienen lugar en la membrana (con ribosomas 70S) citoplasmática. 80S (a 60S subunidades) Presente: y 40S sus 70S (a 50S subunidades) y 30S sus

Ribosomas Pared celular

Presente, constituida por mureína

Universidad Católica los Ángeles de Chimbote - ULADECH

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o péptidoglicano. Vegetales (por celulosa) Hongos (quitina, glucanos) mananos y

Artropodos (exoesqueleto:quitina) Nucléolos Presentes Ausentes Ausente

Retículo Presente endoplásmico Órganos de locomoción

Cilios y flagelos que al corte Flagelos sin estructura 9+2 transversal presentan una distribución característica de microtúbulos: 9 + 2

Diferencias estructurales entre una célula animal (a) y una célula vegetal (b) Universidad Católica los Ángeles de Chimbote - ULADECH 74

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La forma de la célula es variada y relacionada a la función que realizan en los diferentes tejidos, algunas tienen formas típica, como las neuronas (células del tejido nervioso), son mas largas que anchas y otras, como las del parénquima (un tipo de célula de las plantas) y eritrocitos (glóbulos rojos de la sangre), son equidimensionales; otras, como los leucocitos, son de forma cambiante. Muchas células cuando se encuentran en medio líquido tienden a tomar la forma esférica y, cuando están agrupadas en grandes masas forma poliédrica.

El tamaño de la célula está en relación con su función. La mayor parte de las células eucariotas sólo son visibles con el microscopio estando su diámetro comprendido entre 10 y 100 micrones (salvo excepciones). Por lo general el tamaño resulta constante p ara cada tipo celular e independiente del tamaño del organismo, es decir una célula del riñón de un caballo es del mismo orden que la de un ratón. La diferencia en el tamaño del órgano se debe al número de células y no al tamaño de las mismas. Los huevos (o, por usar la palabra latina, ova) son muy grandes, a menudo son las células mas grandes que produce un organismo (no en todos los casos, algunos organismos ponen "su huevo en una sola canasta" mientras que otros ponen una plétora de pequeños huevos). El gran tamaño de muchos huevos es en realidad una excepción, hecho relacionado con el proceso de desarrollo que ocurre luego que el óvulo es fertilizado, cuando el contenido (del ahora cigoto) es usado en una serie de rápidas divisiones celulares, que requieren una tremenda cantidad de energía obtenida de las reservas de la célula huevo. Mas tarde el organismo adquirirá su propia energía pero, en el principio tiene un "fondo energético acumulado”.
Universidad Católica los Ángeles de Chimbote - ULADECH 75

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular



Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

ORIGEN DE LAS CÉLULAS: Se cree que todos los organismos que viven sobre la Tierra, proceden de una única célula primitiva nacida hace varios miles de millones de años. Las similitudes entre todos los seres vivos parecen tan acusados que no se puede explicar de otra manera. Las células vivas surgieron probablemente en la Tierra gracias a la agregación espontánea de moléculas, hace aproximadamente 3500 millones de años. Conociendo los organismos actuales y las moléculas que contienen, parece que debieron producirse por lo menos tres etapas antes de que surgiera la primera célula. Debieron formarse polímeros de ARN capaces de dirigir su propia replicación a través de interacciones de apareamiento de bases compleme ntarias. Debieron desarrollarse mecanismos mediante los cuales una molécula de ARN pudiera dirigir la síntesis de una proteína. Tuvo que ensamblarse una membrana lipídica para rodear a la mezcla autoreplicante de ARN y moléculas proteicas. En alguna fa se posterior del proceso evolutivo, el ADN ocupó el lugar del ARN como material hereditario. Hace unos 1.500 millones de años se produjo la transición desde células pequeñas con una estructura interna relativamente sencilla (células procariotas), hasta cé lulas más grandes, más complejas como las que componen los animales y las plantas (células eucariotas). o Diferencias entre animales y vegetales Vegetales Poseen un pigmento verde, que constituye la clorofila indispensable para la fotosíntesis. Como nutrientes utilizan el dióxido de carbono, agua con sales disueltas y energía solar para que por medio de la fotosíntesis puedan sintetizar compuestos orgánicos. Por realizar la fotosíntesis tienen nutrición autótrofa, al elaborar sus propios alimentos. Almacenan almidón. En cuanto a la célula: o Membrana celular con pared celular celulósica, que es de naturaleza rígida. o Carecen de lisosomas (vegetales superiores). o Carecen de centrosomas. o Las células de los tejidos se comunican mediante aberturas finísimas denominadas
Universidad Católica los Ángeles de Chimbote - ULADECH

Animales Carecen de clorofila.

Los animales y los hongos utilizan como alimento compuestos orgánicos portadores de energía química elaborados por las plantas. Por los compuestos orgánicos ya preparados que utilizan, tienen nutrición heterótrofa. Almacenan glucógeno. En cuanto a la célula: o Sólo con membrana celular.

o Poseen lisosomas para secreción de enzimas digestivas. o Poseen centrosomas para la reproducción de la célula. o Las células en los tejidos se relacionan mediante barreras

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

plasmodesmos. Los vegetales son seres fijos.

La irritabilidad (sensibilidad) es respondida con mucha lentitud y a través de simples movimientos de orientación (tropismos). El crecimiento en longitud es ilimitado, teniendo lugar en el ápice y en los extremos de los órganos (yemas y raíces), durante la vida del organismo. Los principales órganos de la planta son externos (raíz, tallo, hojas, etc.) y de una organización simple. La conformación externa de los vegetales es muy ramificada.

intracelulares para la difusión, denominadas desmosomas. Los animales tienen movimiento espontáneo al desplazarse en la búsqueda del alimento; a excepción de esponjas y corales. Los animales responden con mayor rapidez, con respuestas más complicadas y visibles, por que la mayoría tienen sistema nervioso. El crecimiento es limitado.

Los principales órganos son internos y protegidos dentro de cavidades. Estos órganos son de estructura compleja. En los animales al ramificación de los órganos es interna, y es entre la masa orgánica del cuerpo.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 79

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La membrana celular, citoplasmática o plasmática es una estructura laminar que envuelve el citoplasma de todas y cada una de las células, además de los orgánulos. Es una bicapa lipídica que sirve de "contenedor" para los contenidos de la célula, así como protecci ón mecánica. Esta formada principalmente por lípidos y proteínas. Esta barrera presenta una permeabilidad selectiva, lo cual le permite "seleccionar" las moléculas que entran y salen de la célula. Tiene un grosor aproximado de 75 Å. Vista al microscopio electrónico presenta entre dos capas oscuras una central más clara. En las células procariotas y en las de eucariotontes osmótrofos como plantas y hongos, se sitúa bajo otra capa, denominada pared celular.

Estructura de la membrana celular

La membrana plasmática está compuesta por proteínas, lípidos y glúcidos, cuyas masas guardan proporciones aproximadas de 50%, 40% y 10% respectivamente. Las moléculas más numerosas son las de lípidos, ya que se cree que por cada 50 lípidos hay una proteína. Sin embargo, las proteínas, debido a su mayor tamaño, representan aproximadamente el 50% de la masa de la membrana. Entre las proteínas, el 80% son intrínsecas, mientras que el 20% restantes son extrínsecas. De las proteínas se pueden encontrar las translocadoras o las enzimas asociadas a membrana, entre otras. Los lípidos de la membrana son anfipáticos. Esto quiere decir que presentan un lado hidrófilo (que da la cara al agua) y un lado hidrofóbico (que no se junta con el agua). De entre los lípidos, los más importantes son los fosfolípidos y esfingolípidos, que se encuentran en todas las células; le siguen los glucolípidos, así como esteroides, como el colesterol. Estos últimos no existen o son escasos en las membran as plasmáticas de las células procariotas.
Universidad Católica los Ángeles de Chimbote - ULADECH 80

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Su modelo estructural es conocido como mosaico fluido, El "mosaico fluido" es un término acuñado por S.J. Singer en 1971. Este consiste en una bicapa lipídica complementada con diversos tipos de proteínas. La estructura básica se mantiene unida mediante uniones no covalentes.

Esquema de una membrana citoplasmática según el modelo del mosaico fluido

Las proteínas de la membrana plasmática se pueden clasificar según cómo se dispongan en la bicapa lipídica. Proteínas integrales: Embebidas en la bicapa lipídica, atraviesan la membrana una o varias veces, asomando por una o las dos caras (proteínas transmembrana); o bien mediante enlaces covalentes con un lípido o a un glúcido de la membrana. Su aislamiento requiere la ruptura de la bicapa. Proteínas periféricas: A un lado u otro de la bicapa lipídica, pueden estar unidas débilmente por enlaces no covalentes. Fácilmente separables de la bicapa, sin provocar su ruptura. Los glúcidos se hallan asociados mediante enlaces covalentes a lípidos, proteínas y generalmente forman parte de la matriz extracelular. Otras sustancias pueden estar asociadas a esta estructura básica como diversos tipos de glúcidos que pueden unirse de forma covalente a lípidos ( glucolípidos) o a proteínas (glucoproteínas). Las cadenas de estos glúcidos se disponen hacia el medio extracelular por la cara externa de la membrana y constituyen el glucocálix o matriz extracelular. Esta estructura general -modelo unitario- se presenta también en las membranas de diversos orgánulos del interior de la célula: los del sistema de endomembranas, tales como retículo endoplasmático, aparato de Golgi y envoltura nuclear, y los de otros orgánulos, como las mitocondrias y los plastos, que proceden de endosimbiosis.
Universidad Católica los Ángeles de Chimbote - ULADECH 81

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La función básica de la membrana plasmática reside en ma ntener el medio intracelular diferenciado del entorno. Esto es posible gracias a la naturaleza aislante en medio acuoso de la bicapa lipídica y a las funciones de transporte que desempeñan las proteínas. La combinación de transporte activo y transporte pas ivo hacen de la membrana plasmática una barrera selectiva que permite a la célula diferenciarse del medio. Los esteroides, como el colesterol, tienen un importante papel en la regulaci ón de las propiedades, es decir que su rol es muy importante físico -químicas de las membranas regulando su resistencia y fluidez. En el componente proteico reside la mayor parte de la funcionalidad de la membrana, las proteínas realizan funciones específic as y podemos clasificarlas según su función en: Estructurales: estas proteínas hacen de "eslabón clave" uniéndose al citoesqueleto y la matriz extracelular. Receptores de membrana : que se encargan de la recepción y transducción de señales químicas. Transportadoras a través de membrana : mantienen un gradiente electroquímico mediante el transporte de diversos iones. Estas a su vez pueden ser: Proteínas transportadoras: Son enzimas con centros de reacción que sufren cambios conformacionales. Proteínas de canal: Dejan un canal hidrofílico por donde pasan los iones. En el transporte transmembrana podemos hablar de: Transporte pasivo: Se produce sin consumo de energía y a favor de gradiente electroquímico. Transporte activo: Se produce con consumo de energía y en contra de gradiente electroquímico. El componente glucídico forma el glucocáliz, con funciones de cierta protección ante agresiones mecánicas y químicas, y la que parece más importante ya que permite diferenciar el exterior celular permitiendo un reconocimiento intercelular.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 83

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El citoplasma es la parte del protoplasma que en una célula eucariota se encuentra entre el núcleo celular y la membrana plasmática. Consiste en una emulsión coloidal muy fina de aspecto granuloso, el citosol o hialoplasma, y en una diversidad de organelos celulares que desempeñan diferentes funciones. Su funció n es mantener flotando los organelos celulares y al mismo tiempo ayuda al movimiento de los mismos. El citosol es la sede de muchos de los procesos metabólicos que se dan en las células. Los cloroplastos (en las células vegetales) se encuentran en el citoesqueleto del citoplasma alrededor del citosol sublingual. El citoplasma se divide en ocasiones en una región externa gelatinosa, cercana a la membrana, e implicada en el movimiento celular, que se den omina ectoplasma; y una parte interna más fluida que recibe el nombre de endoplasma y donde se encuentran la mayoría de los orgánulos. El citoplasma se encuentra en las células procariotas así como en las eucariotas y en él se encuentran varios nutrientes que lograron atravesar la membrana plasmática, llegando de esta forma a los orgánulos de la célula. El citoplasma de las células eucariontas está subdividido por una red de membranas conocidas como retículo endoplasmático (liso y rugoso) que sirven como su perficie de trabajo para muchas de sus actividades bioquímicas. El retículo endoplasmático rugoso está presente en todas las células eucariontas y predomina en aquellas que fabrican grandes cantidades de proteínas para exportar. Es continuo con la membrana externa de la envoltura nuclear, que también tiene ribosomas adheridos.

El citoesqueleto es un entramado tridimensional de microtúbulos y microfilamentos que proveen el soporte interno para las células, anclan las estructuras internas de la misma e intervienen en los fenómenos de movimiento celular y en su división. Es una estructura dinámica que mantiene la forma de la célula, facilita la movilidad celular (usando estructur as como los cilios y los flagelos), y desempeña un importante papel tanto en el transporte intracelular (por ejemplo, los movimientos de vesículas y orgánulos) y en la división celular.

El citoesqueleto eucariota
Las células eucariotas tienen tres tipos de filamentos citoesqueléticos : Microfilamentos (Actina y Miosina) De unos 7 - 5 nm (nanómetros) de diámetro. Están formadas por una p roteína globular llamada actina que puede presentarse de dos formas: -Actina no polimerizada: la actina se encuentra asociada a la profilina que evita su polimerización. Representa la mitad de la actina de la célula y es utilizada para polimerizar microfilamentos cuando es necesario.
Universidad Católica los Ángeles de Chimbote - ULADECH 84

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

-Actina polimerizada: es una doble hélice dextrógira de dos hebras de actina no polimerizada. Esta actina se puede encontrar asociada a otras proteínas: - Proteínas estructurales: que permiten la unión de los filamentos de actina . - Proteínas reguladoras: la más importante es la miosina que permite la contracción muscular al permitir que la actina se desplace sobre ella. Las funciones de los microfilamentos de actina son la contracci ón muscular, la formación de pseudópodos, el mantenimiento de la morfología celular y, en la citocinesis de células animales, forma un anillo contráctil que divide la célula en dos.

Filamentos intermedios Son filamentos de proteína fibrosa de un os 12 nm de diámetro, son los componentes del citoesqueleto más estables, dando soporte a los orgánulos (por sus fuertes enlaces), y heterogéneos. Las proteínas que conforman estos filamentos, la citoqueratina, vimentina, neurofilamentos, desmina y la proteína fibrilar acídica de la glía , dependen del tejido en el que se hallen. Su función principal es la organización de la estructura tridimensional interna de la célula (por ejemplo, forman parte de la envuelta nuclear y de los sarcómeros). También participan en algunas uniones intercelulares ( desmosomas). Las células eucariotas tienen tres tipos de filamentos citoesqueléticos:

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Organización citológica:
Los microtúbulos se nuclean y organizan en los centros organizadores de microtúbulos (MTOCs), como pueden ser el centrosoma o los cuerpos basales de los cilios y flagelos. Estos MTOCs pueden poseer centríolos o no. Además de colaborar en el citoesqueleto, los microtúbulos intervienen en el tránsito de vesículas (véase la dineína o la kinesina), en la for mación del huso mitótico mediante el cual las células eucariotas segregan sus cromátidas durante la división celular, y en el movimiento de cilios y flagelos.

Existen drogas que afectan a la estabilidad de los microtúbulos: El taxol, útil en los cánceres de ovario, a concentraciones bajas se une a los microtúbulos y los estabiliza, inhibiendo su acortamiento. La colchicina, o su derivado colcemida, se une a los dímeros de tubulina con alta afinidad, pero reversiblemente, lo que facilita que lo s dímeros envenenados se adhieran al extremo de un microtúbulo en crecimiento, impidiendo el agregado o pérdida de nuevas unidades. Así, el microtúbulo queda estabilizado. La colchicina se emplea ampliamente para sincronizar células, puesto que detiene la mitosis en metafase. Microtúbulos Los microtúbulos son estructuras tubulares de 25 nm de diámetro que se originan en los centros organizadores de microtúbulos y que se extienden a lo largo de todo el citoplasma. Se pueden polimerizar y despolimerizar según las necesidades de la célula. Se hallan en las células eucariotas y están formados por la polimerización de un dímero de dos proteínas globulares, la alfa y la beta tubulina. Cada microtúbulo está compuesto de tres protofilamentos formados por los dímeros de tubilina. Intervienen en diversos procesos celulares que involucran desplazamiento de vesículas de secreción, movimiento de orgánulos, transporte intracelular de sustancias, así como en la división celular (mitosis y meiosis). Además, constituyen la es tructura interna de los cilios y los flagelos. Los microtúbulos son más flexibles pero más duros que la actina.
Universidad Católica los Ángeles de Chimbote - ULADECH 86

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular



Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En biología celular, se denominan orgánulos llamados también organelas, organelos o mejor elementos celulares, a las diferentes estructuras suspendidas en el citoplasma de una célula eucariota, que tienen una forma y unas funciones especializadas bien definidas y diferenciadas. La célula procariota normalmente carece de orgánulos. No todas las células eucariotas contienen todos los orgánulos al mismo tiempo, aparecen en determinadas células de acuerdo a sus funciones.
Principales organelos eucarioticos Orgánulo cloroplasto Función fotosíntesis Estructura posee membrana Organismos doble- plantas, protistas Notas contiene algunos genes

síntesis y embalaje de puede asociarse con retículo proteínas y ciertos ribosomas en su eucariotes endoplasmático lípidos membrana aparato de Golgi mitocondria vacuolas sacos aplanados en las plantas se transporte y embalaje la mayoría de rodeado por membrana conocen como de proteínas eucariotes citoplasmática dictiosomas producción de energía almacenamiento, transporte homeostasis y compartimiento doble membrana de la mayoría de contiene algunos eucariotes genes y

sacos de membrana plantas vesicular hongos


mantenimiento de ADN rodeado por membrana todos los contiene y ARN, y expresión doble eucariotes genoma genética


Atendiendo a su génesis, los orgánulos se clasifican en d os grupos: 1. Orgánulos autogenéticos, desarrollados filogenética y ontogenéticamente de la complejización de estructuras previas. 2. Orgánulos de origen endosimbiótico, procedentes de la simbiosis con otros organismos.

Orgánelos autogenéticos
Las células eucariotas tienen un citoesqueleto complejo y dinámico. En esto se basa su capacidad para sostener estructuras membranosas complejas, así como para realizar desplazamientos internos y cambios de localización, orientación o forma de sus partes. Sistema de endomembranas. Es un conjunto de estructuras organulares basadas en vesículas o vacuolas como el retículo endoplasmático, liso o rugoso, los dictiosomas del aparato de Golgi o los lisosomas. La parte fundamental de la envoltura nuclear se interpreta como una vesícula del retículo endoplasmático y debe considerarse en este capítu lo. Estructuras especializadas del citoesqueleto. En este capítulo entran los centriolos y los relacionados corpúsculos basales, así como el axonema de los cilios y de los flagelos.
Universidad Católica los Ángeles de Chimbote - ULADECH 88

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Orgánulos endosimbióticos
Son orgánulos incorporados a la célula eucariota inicialmente como bacterias endosimbiontes. Los orgánulos de origen endosimbiótico tienen su propio genoma, su propia maquinaria de síntesis proteica, incluidos ribosomas, y se multiplican por bipartición, de manera que si se extirpan experimentalmente de una célula no pueden volver a formarse. Mitocondrias.- Todos los eucariontes conocidos tienen mitocondrias, orgánulos derivados de ellas, como los hidrogenosomas, o al menos restos de genes mitocondriales incorporados al genoma nuclear. Plastos.- Hay dos clases de plastos, los primarios derivan de cianobacterias por endosimbiosis y los secundarios por endosimbiosis de células eucariotas ya dotadas de plasto. Éstos últimos son mucho más complejos. Los plastos se han designado muy a menudo con otros nombres en función de su pigmentación o del grupo en que se presenta. La denominación cloroplasto es usada habitualmente como nombre genérico para todos ellos.

Estructura de una célula eucariota
Las células eucariotas están formadas por diferentes orgánulos que desarrollan diversas funciones como son: Nucléolo. Núcleo celular. Ribosoma. Vesículas de secreción. Retículo endoplasmático rugoso. Aparato de Golgi. Citoesqueleto. Retículo endoplasmático liso. Mitocondria. Vacuola. Citoplasma. Lisosoma. Centríolo (Solo en la célula animal). Membrana citoplasmática. Cloroplasto (Solo en la célula vegetal y de las algas). Pared celular (Solo en la célula vegetal, de hongos y protistas). Las células procariotas tienen el material genético disperso por el citoplasma y no en un núcleo diferenciado.

El retículo endoplásmico, es una red de membranas interconectadas que forman cisternas, tubos aplanados y sáculos comunicados entre sí, que intervienen en funciones relacionadas con la síntesis protéica, metabolismo de lípidos y algunos esteroides, así como el transporte intracelular. Se encuentra en la célula animal y vegetal pero no en la célula procariota. El retículo endoplasmatico rugoso se encuentra unido a la membrana nuclear externa mientras que el retículo endoplasmatico liso es una prolongación del retículo endoplasmatico rugoso. El retículo endoplasmático rugoso tiene esa apariencia debido a los numerosos ribosomas adheridos a su membrana mediante unas proteínas denominadas "ribofo rinas". Tiene unos sáculos más redondeados cuyo interior se conoce como "luz del reticulo" o "lumen" donde caen las proteínas sintetizadas en él. Está muy desarrollado en las células que por su función ceben realizar una activa labor de síntesis, como las células hepáticas o las células del páncreas. El retículo endoplasmático liso no tiene ribosomas y participa en el metabolismo de lípidos.
Universidad Católica los Ángeles de Chimbote - ULADECH 89

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Retículo endoplasmático rugoso
El retículo endoplasmático rugoso (RER) , también llamado Retículo Endoplasmátic o Granular, Ergastoplasma o Retículo Endoplásmico Rugoso, es un orgánulo que se encarga de la síntesis y transporte de proteínas en general. Existen retículos sólo en las células eucariontes. En las células nerviosas es también conocido como Cuerpos de Nissl.

El término Rugoso se refiere a la apariencia de este orgánulo en las microfotografías electrónicas, la cual es resultado de la presencia de múltiples ribosomas en su superficie. El RER está ubicado junto a la envoltura nuclear y se une a la misma de manera que puedan introducirse los ácidos ribonucleicos mensajeros que contienen la información para la síntesis de proteínas. Está constituido por una pila de membranas que en su pared exterior prese ntan adosados los ribosomas. Funciones del Retículo Endoplasmático Rugoso Circulación de sustancias que no se liberan al citoplasma. Síntesis y transporte de proteínas producidas por los ribosomas adosados a sus membranas, pueden ser, proteínas de membrana, proteínas lisosomales o proteínas de secreción. Glicosilación de proteínas. Las proteínas de secreción producid as, serán luego empaquetadas por el [aparato de Golgi] y serán liberadas al exterior de la célula para cumplir sus funciones (hormonales, enzimáticas, etc.). Las proteínas lisosomales también serán empaquetadas por el aparato de Golgi y terminaran formando un lisosoma listo para cumplir sus funciones metabólicas intracelulares. Entre las enzimas producidas, se encuentran las lipasas, lasfosfatasas, las DNAasas, RNAsas
Universidad Católica los Ángeles de Chimbote - ULADECH 90

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

y otras. Las proteínas de membrana pasarán a formar parte de la membrana plasmática o de la membrana de algún orgánulo. El reticulo endoplasmático rugoso suele estar muy desarrollado en las células con alta actividad secretora de proteínas como son los plasmocitos, las células pancreáticas, etc. Al evitar que las proteínas sean liberadas al hialoplasma, el retículo endoplasmático rugoso, consigue que estas no interfieran con el funcionamiento de la célula y sean liberadas solo cuando sean necesario, de otra manera, si por ejemplo quedaran libres en la célula proteínas enzimáticas que se encargan de la degradación de sustancias, las mismas destruirían componentes vitales de la célula.

Retículo endoplasmático liso
Conjunto de membranas que participan en el transporte celular y síntesis de triglicéridos, fosfolípidos y esteroides. También dispone de enzimas detoxificantes, que metabolizan el alcohol y otras sustancias químicas. En realidad los retí culos endoplasmáticos lisos tienen diferentes variantes funcionales que sólo tienen en común su aspecto: los ribosomas están ausentes. Las cisternas del retículo endoplasmático liso son tí picamente tubulares y forman un sistema de tuberías que se incurvan en el citoplasma. Funciones del Retículo Endoplasmático liso En gónadas y corteza suprarrenal realizan la síntesis de hormonas esteroideas. En el hígado detoxifican varios tipos de compuestos orgánicos como barbitúricos o etanol. La detoxificación tiene lugar por una serie de enzimas oxigenasas entre las que se encuentra la citocromo P450 que dada su inespecificidad son capaces d e detoxificar miles de compuestos hidrófobos transformándolos en hidrófilos, más fáciles de excretar. Liberación de glucosa a partir de Glucosa 6 -fosfato via Glucosa 6-fosfatasa. También secuestran los iones calcio y lo liberan regularmente en algunas cé lulas (retícula sarcoplasmático). Funciones del Retículo endoplasmá tico Síntesis de proteínas123: La lleva a cabo el retículo endoplasmá tico rugoso mediante los ribosomas. Estas proteínas serán transportadas al Aparato de Golgi mediante vesículas de transición donde dichas proteínas sufrirán un proceso de maduración para luego formar parte de los lisosomas o de vesículas secretoras. Metabolismo de lípidos: El retículo endoplasmá tico liso, al no tener ribosomas le es imposible sintetizar proteínas pero sí sintetiza lípidos de la membrana plasmática, colesterol y derivados de éste como los ácidos biliares o las esteroideas. Detoxificación: Es un proceso que se lleva a cabo principalmente en las células del hígado y que consiste en la inactivación de productos tóxicos como drogas, medicamentos o los propios productos del metabolismo celular, por ser liposolubles (hepatocitos)

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Glucoxilación: Son reacciones de transferencia de un oligosacárido a las proteínas sintetizadas. Se realiza en la membrana del retículo endoplasmático. De este modo, la proteína sintetizada se transforma en una proteína periférica externa del glucocálix.

El Aparato de Golgi es un conjunto de dictiosomas (de 4 a 8 sáculos aplanados rodeados de membrana y apilados unos encima de otros). Funciona como una planta empaquetadora, modificando vesículas del retículo endoplasmático rugoso. El material nuevo de las membranas se forma en varias cisternas del Golgi. Se encuentra en el citoplasma de la célula. Dentro de las funciones que posee el aparato de Golgi se encuentran la glicosilación de proteínas, selección, destinación, glicosilación de lípidos y la síntesis de polisacáridos de la matriz extracelular. Debe su nombre a Camilo Golgi, Premio Nobel de Medicina en 1906 junto a Santiago Ramón y Cajal.

Se pueden diferenciar diferentes partes: Cara externa, proximal o cis: Es la más próxima al retículo. De él recibe las vesículas de transición, que son sáculos con proteínas que han sido sintetizadas en la membrana del retículo endoplasmático rugoso (RER), introducidas dentro de sus cavidades y transportadas por el lúmen hasta la parte más externa del retículo. Estas vesículas de transición son el vehículo de dichas proteínas que serán transportadas a la cara externa del aparato de Golgi. Cara interna, distante o trans: Es la que se encuentra más cerca de la membrana citoplasmática, de hecho sus membranas, ambas unitarias, tienen una composición similar. En el interior de los sáculos del dictiosoma la proteína puede sufrir una serie de modificaciones hasta su composición final. Cuando llega a la zona interna se transforma en una vesícula de secreción pudiéndose unir a otras formando un gránulo de secreción para salir mediante exocitosis al espacio extracelular.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Funciones generales
El aparato de Golgi también llamado complejo o cuerpo de Golgi, se encarga de la distribución y el envío de los productos químicos de la célula. Modifica proteínas y lípidos (grasas) que han sido sintetizados previamente tanto en el retículo endoplasmático rugoso como en el liso y los prepara para expulsarlos fuera de la célula. Modifica sustancias sintetizadas en el RER: En el aparato de Golgi se transforman las sustancias procedentes del RER. Estas transformaciones pueden ser agregaciones de restos de carbohidratos para conseguir la estructura definitiva o sufren la proteolisis lo que les confiere la forma activa. Ej: en el RER de las células acinosas del páncreas se sintetiza la proinsulina que debido a las transformaciones que sufre en el aparato de Golgi, tomará la forma o conformación definitiva de la insulina. Secreción celular: Las sustancias atraviesan todos los sáculos del aparat o de Golgi y cuando llegan a la cara trans del dictiosoma, en forma de vesículas de secreción, será transportada a su destino fuera de la célula, atravesando la membrana citoplasmática por exocitosis. Producción de membrana citoplasmática: Los gránulos de secreción cuando se unen a la membrana en la exocitosis pasan a formar parte de esta. Participa en la síntesis de carbohidratos , como la celulosa. Forma los lisosomas primarios. Forma el acrosoma de los espermios.

Los lisosomas son vesículas relativamente grandes formadas por el retículo endoplasmático rugoso y luego empaquetados por el complejo de Golgi que contienen enzimas hidrolíticas y proteolíticas que sirven para digerir los materiales de origen externo o interno que llegan a ellos. El pH en el interior de los lisosomas es de 4,8 (bastante menor que el del citosol, que es neutro) debido a que las enzimas proteolíticas funcionan mejor con un pH ácido . La membrana del lisosoma estabiliza el pH bajo bombeando protones (H+) desde el cit osol, y asimismo, protege al citosol y al resto de la célula de las enzimas degradantes que hay en el interior del lisosoma. Las enzimas lisosomales son capaces de digerir bacterias y otras sustancias que entran en la célula por fagocitosis, u otros proces os de endocitosis. Los lisosomas utilizan sus enzimas para reciclar las diferentes organelas de la célula, englobándolos, digiriéndoles y liberando sus componentes en el citosol. De esta forma los
Universidad Católica los Ángeles de Chimbote - ULADECH 93

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

orgánulos de la célula se están continuamente reponiendo. E l proceso de digestión de los orgánulos se llama autofagia. Por ejemplo, las células hepáticas se reconstituyen por completo una vez cada dos semanas. Las enzimas más importantes en el lisosoma: Lipasa, que digiere lípidos, Glucosilasas, que digiere carbohidratos (azúcares), Proteasas, que digiere proteínas, Nucleasas, que digiere ácidos nucleicos.

El lisosoma, sólo está presente en células animales. Proceso de digestión celular: La célula utiliza estos lisosomas para degradar biomoléculas complejas. Utiliza dos métodos: la endocitosis y la autofagia. En la endocitosis los materiales son recogidos del exterior celular y englobados mediante endocitosis por la membrana plasmática que forma un fagosoma. El lisosoma se une al fagosoma formando un fagoliso soma y vierte su contenido en este, degradando las sustancias del fagosoma. Una vez hidrolizadas las moléculas utilizables pasan al interior de la célula para entrar en rutas matabólicas y lo que no es necesario para la célula se desecha fuera de esta por exocitosis. En la autofagia la célula digiere estructuras propias que no es necesario. El material queda englobado por vesículas que provienen del retículo endoplásmico y del aparato de Golgi formando un autofagosoma. Al unirse al lisosoma primario forma u n autofagolisosoma y sigue el mismo proceso que en el anterior caso .

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los peroxisomas son orgánulos citoplasmáticos muy comunes en forma de vesículas que contienen oxidasas y catalasas. Estas enzimas cumplen funciones de detoxificación ce lular. Como todos los orgánulos, los peroxisomas solo se encuentran en células eucariotas. Estructura: Los peroxisomas están envueltos por una membrana citoplasmática semipermeable. Se forman por gemación al desprenderse del retículo endoplasmático liso, aunque por sí mismos pueden abulatar cierta porción de su membrana produciendo nuevos peroxisomas sin derramar su contenido en el citoplasma. Dicha membrana protege la célula de los efectos dañinos del interior del peroxisoma. Las particulas de su interior suelen estar cristalizadas. Función: En los peroxisomas se degradan las purinas y otros compuestos. En las plantas son el asiento de una serie de reacciones conocidas como fotorrespiración. En los peroxisomas se produce agua oxigenada (H 2O2, un producto tóxico del metabolismo celular) compuesto que es degradado rápidamente por una enzima oxidativa dentro del peroxisoma. Contienen una enzima llamada catalasa que participa en la degradación del peróxido de oxígeno a agua y oxígeno por intermedio de ciertas s ustancias orgánicas (en la ecuación la variable R'). H2O2 + R'H 2 R' + 2H 2O

También tienen otras enzimas (catalasas) que utilizan este mismo peróxido para reacciones de oxidación, como por ejemplo, la oxidación de sustancias tóxicas como los fenoles, etanol, formaldehído, entre otros, las cuales van a ser posteriormente eliminadas. Tal es el mecanismo de detoxificación realizada por el hígado y los riñones, por ejemplo. Debido a que los peroxisomas necesitan usar e l peróxido, se han dotado de enzimas que la sintetizan a partir de oxigeno y removiendo hidrógeno de sustratos orgánicos específicos (en la ecuación la variable R). RH2 + O2 R + H 2O2

La beta oxidación también ocurre dentro de los peroxisomas, en la cual los ácidos grasos son comúnmente degradados a Acetil -CoA la cual es reciclada por la célula. Ciertas deficiencias involucran a peroxisomas ineficaces, tales como la enfermedad de Zellweger.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las mitocondrias son los orgánelos que se encuentran en prácticamente todas las células eucariotas (también hay en células gaméticas), encargados de suministrar la mayor parte de la energía necesaria para la actividad celular; actúan por tanto, como centrales ene rgéticas de la célula y sintetizan ATP por medio de la fosforilación oxidativa. La mitocondria presenta una membrana exterior permeable a iones, metabolitos y muchos polipéptidos. Eso es debido a que contiene proteínas que forman poros llamados Porinas o V DAC (canal aniónico dependiente de voltaje), que permiten el paso de moléculas de hasta 10000 Dalton y un diámetro aproximado de 20Å. La membrana mitocondrial interna presenta pliegues dirigidos hacia el interior llamados crestas, que contienen tres tipos de proteínas: o Las proteínas que trasportan los electrones hasta el oxígeno molecular o Un complejo enzimático, la ATP -sintetasa que cataliza la síntesis de ATP (fosforilación oxidativa). o Proteínas trasportadoras que permiten el paso de iones y moléculas a través de la membrana interna.

Estructura y composición
Las mitocondrias se componen de dos bicapas lipídicas que separan tres espacios: el citosol, el espacio celular y la matriz de la mitocondria. La me mbrana externa es una bicapa lipídica lisa (no forma ondulaciones) con proteínas asocputasoras, lo que la hace poco permeable excepto a ATP, ADP, Ácido pirúvico, O 2 y agua. Esta membrana forma ondulaciones, normalmente transversales al eje de la mitocondria, llamadas crestas mitocondriales. En la cara interna tienes proteínas ATP-sintetasas. Como consecuencia, el espacio intermembrana está compuesto de un líquido similar al hialoplasma. La matriz mitocondrial, sin embargo, contiene menos moléculas del citosol, aunque contiene iones, metabolitos a oxidar, ADN circular bicatenario muy parecido al de las bacterias, ribosomas tipo 70S similares a los de bacterias, llamados mitorribosomas, que realizan la síntesis de algunas proteínas mitocondriales y contiene ARN mitocondrial; es decir, tienen los orgánulos que tendría una célula procariota de vida libre. Al respecto de esto la científica estadounidense Lynn Margulis junto con otros científicos ha propuesto la teoría endosimbiótica.
Universidad Católica los Ángeles de Chimbote - ULADECH 96

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Según ésta, en un momento dado, el mitocondrio, una célula procariota c apaz de obtener energía a partir del oxígeno, se fusionó en un momento de la evolución con lasos células eucariotas, proporcionándoles una fuente de energía de la que sacaron mucho partido, aprovechando el aumento de la concentración de oxígeno en la atmós fera terrestre.

Morfología y función
La morfología de la mitocondria es difícil de describir puesto que son estructuras muy plásticas que se deforman, se dividen y fusionan. Normalmente se las representa en forma alargada. Su número depende de las necesi dades energéticas de la célula. Al conjunto de las mitocondrias de la célula se le denomina condrioma celular Su principal función es la oxidación de metabolitos (glucólisis, ciclo de Krebs, beta -oxidación de ácidos grasos) y la obtención de ATP, que supo ne un porcentaje muy alto del ATP sintetizado por la célula. También sirve de almacén de sustancias como iones, agua y algunas partículas como restos de virus y proteínas .

La científica estadounidense Lynn Margulis, junto con otros científicos, recuperó en torno a 1980, reformulándola como teoría endosimbiótica, una antigua hipótesis. Según esta versión actualizada, hace unos 1500 millones de años, una célula procariota capaz de obtener energía de los nutrientes orgánicos empleando el oxígeno mol ecular como oxidante, se fusionó en un momento de la evolución con otra célula procariota o eucariota primitiva al ser fagocitada sin ser inmediatamente digerida, un fenómeno frecuentemente observado. De esta manera se produjo una simbiosis permanente entr e ambos tipos de seres: la procariota fagocitada proporcionaba energía, especialmente en forma de ATP y la célula hospedadora ofrecía un medio estable y rico en nutrientes a la otra. Este mutuo beneficio hizo que la célula invasora llegara a formar parte integral del organismo mayor, acabando por convertirse en parte de ella: la mitocondria. Esta hipótesis tiene entre sus fundamentos la evidencia de que las mitocondrias poseen su propio ADN y está recubierta por su propia membrana. A lo largo de la histori a común la mayor parte de los genes mitocondriales han sido transferidos al núcleo, de tal manera que la mitocondria no es viable fuera de la célula huésped y ésta no suele serlo sin mitocondrias.

Los ribosomas son orgánulos sin membrana, sólo v isibles al microscopio electrónic o debido a su reducido tamaño (29 nm en células procariotas y 32 nm en eucariotas). Están en todas las células vivas (excepto en los espermatozoides). Su función es ensamblar proteínas a partir de la información genética que le llega del ADN transcrita en forma de ARN mensajero (ARNm). La información genética está en el ADN. Esa información se transcribe en ARN. El ribosoma lee el ARN mensajero y ensambla la proteína con los aminoácidos suministrados por los ARN de transferencia, este proceso se denomina síntesis de proteínas. El ribosoma consta de dos partes, la subunidad mayor y una menor, estas salen del núcleo por separado. Por experimentación se puede decir que se mantienen unidas por cargas, ya que al
Universidad Católica los Ángeles de Chimbote - ULADECH 97

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

bajarse la concentración de Mg +2, las subunidades tienden a separarse. El ribosoma procariota tiene un coeficiente de sedimentación de 70s y está formado por dos subunidades (50s y 30s). El ribosoma eucariota tiene un coeficiente de sedimentación de 80s (formado por dos subunidades, una de 60s y otra de 40s). Este se puede encontrar unido al retículo endoplasmático rugoso (RER), que es la forma habitual en la célula eucariota, o encontrarlo en el citoplasma, donde recibe el nombre de polisoma o polirribosoma (forma habitu al en la célula procariota). Este polisoma se encarga de sintetizar proteínas de localización celular, mientras que los ribosomas del RER se encargan de sintetizar proteínas de exportación, o sea que se irán de la célula hacia otro lugar donde se necesite.

Los ribosomas, son organelos celulares don de el ARNm es traducido. Está formado por dos subunidades, y cada una de ellas contiene ARNr y proteínas ribosomales.

Una vacuola es una cavidad rodeada por una membrana que se encuentra e n el citoplasma de las células, principalmente de las vegetales. Se forman por fusión de las vesículas procedentes del retículo endoplasmático y del aparato de Golgi. En general, sirven para almacenar sustancias de desecho o de reserva (agua con varios azúcares, sales, proteínas y otros nutrientes disueltos en ella). En las células vegetales, las vacuolas ocupan la mitad del volumen celular y en ocasiones pueden llegar hasta casi la totalidad. También, aumentan el tamaño de la célula por acumulación de agua.
Universidad Católica los Ángeles de Chimbote - ULADECH 98

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Están relacionadas con los lisosomas secundarios, ya que éstos engloban dos tipos de vacuolas, las heterofágicas o digestivas y las autofágicas. Contienen enzimas hidrolíticas y sustratos en proceso de digestión. En el primer tipo, los sustratos son d e origen externo y son capturados por endocitosis; una vez producida la digestión, ciertos productos pueden ser reutilizados y los no digeribles (llamados cuerpos residuales) son vertidos al exterior por exocitosis. En el caso de las vacuolas autofágicas, lo que se digieren son constituyentes de la célula. Hay otro tipo de vacuolas, las pulsátiles o contráctiles, que aparecen en muchos protozoos, especialmente en los dulceacuícolas. Se llenan de sustancias de desecho que van eliminando de forma periódica y además bombean el exceso de agua al exterior.

En biología celular, una vesícula es un orgánulo que forma un compartimento pequeño y cerrado, separado del citoplasma por una bicapa lipídica igual que la membrana celular. Las vesículas almacenan, transportan o digieren productos y residuos celulares. Son una herramienta fundamental de la célula para la organización del metabolismo. Muchas vesículas se crean en el aparato de Golgi, pero también en el retículo endoplasmático, o se forman a partir de partes de la membrana plasmática.

Cilio o cilia (cilium, masculino; plural cilia) significa en latín "pestaña". Se llama cilio (y, especialmente en Latinoamérica, es frecuente hallar la denominación de cilia) a cada uno de los pequeños apéndices mótiles que cubren total o parcialmente la superficie de muchas células desnudas (sin pared). Los flagelos tienen una estructura esencialmente equivalente, aunque hay algunas diferencias morfológicas y muchas diferencias funcionales. Los cilios tienen una forma cilíndrica, de diámetro uniforme en toda su longitud, con una terminación redondeada, semiesférica. Pueden ser descritos como una evaginación digitiforme (una prolongación en dedo de guante) de la membrana plasmática, con un contenido que es continuación del citoplasma. Estos orgánulos están dotados de un armazón compleja, semejante a la de los flagelos, basada en microtúbulos y que se llama axonema. El axonema se continúa, en la base del cilio y por debajo de la membrana plasmática, con un corpúsc ulo basal, que tiene una estructura semejante pero más compleja. Se mueven rítmicamente y de forma coordinada, cada uno con un movimiento semejante al del brazo de un nadador, retrocediendo en posición extendida, y en conjunto al de un trigal azotado por el viento (movimiento de batida coordinado). Mientras reciban la energía necesaria en forma de ATP los cilios siguen batiendo automáticamente. El efecto es un empuje neto, que da lugar a que la célula se desplace en su medio, como ocurre con ciertos protis tas y animales muy pequeños; o que el líquido extracelular circundante sea impulsado, que es la función que cumplen los cilios en el epitelio de las vías respiratorias humanas. La coordinación de los cilios entre sí, al fustigar el agua sobre la superfici e de una célula, viene dada por la misma agua, movida por el cilio precedente. El que sigue en fila halla así una
Universidad Católica los Ángeles de Chimbote - ULADECH 99

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

dirección favorecida y se mueve por ella con un pequeño retraso, conducta llamada metacronismo. El control de los cilios es fundamental en lo s protozoos ciliados que las emplean para cazar otros protozoos y alimentarse con ellos. Para seguirlos, alcanzarlos, poner su estoma o "boca celular" en posición, retrocediendo si es necesario, para luego comérselos, es menester controlar la natación. Este control se logra por medios eléctricos. Los valores del campo eléctrico en la membrana exterior del protozoo, de donde emergen los cilios o cilias, "dibujan" los movimientos de la presa cercana. Estos le son revelados por las presiones del agua, que interfieren con las oscilaciones u ondas eléctricas que realizan el control.

Un flagelo es un apéndice con forma de látigo que usan muchos organismos unicelulares y unos pocos pluricelulares. Sin embargo, estos apéndices pueden también estar implicad os en otros procesos. Este nombre cubre realmente tres estructuras diferentes encontradas en cada uno de los tres dominios. Los flagelos bacterianos son los filamentos helicoidales que rotan como tornillos. Los flagelos de Archaea son superficialmente sim ilares, pero son diferentes en muchos detalles y considerados no homólogos. Los flagelos de Eukarya - aquellos de células Protista animales y vegetales - son complejas proyecciones celulares que azotan hacia adelante y hacia atrás. En ocasiones, este último es llamado cilio o undulipodia para acentuar su distinción. Esencialmente, la estructura del flagelo es igual a la del cilio, pero generalmente se complica con otras estructuras añadidas, resultando más grueso y más largo. Los flagelos más estudiados son los de espermatozoides. En el espermatozoide de mamíferos, el flagelo (cola) está constituido por: un axonema (9 pares de microtúbulos periféricos y un par central) rodeado por las fibras externas densas 9 cilindros proteicos (uno por cada doblete) que intervienen en el movimiento del flagelo. Por fuera de estas fibras, existen otras estructuras rodeando el complejo axonema -fibras: la vaina mitocondrial, si el corte es por la pieza intermedia, o la vaina fibrosa, si el corte se realiza en la pieza principal. La vaina mitocondrial está constituida por mitocondrias dispuestas en hélice que proporcionan la energía necesaria para el movimiento del flagelo. La vaina fibrosa son pares de estructuras proteicas (cada una rodea la mitad de las fibras densas). Pa rece que intervienen en la protección del axonema y quizás también en el movimiento del flagelo. Por fuera, de todo ello, se dispone la membrana plasmática. Los flagelos, que impulsan a los espermatozoides y a muchos protozoos, están diseñados para despla zar toda la célula a través de un fluido.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 101

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 102

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El núcleo celular es la estructura más característica de las células eucariotas. Se rodea de una cubierta propia, llamada envoltura nuclear y contiene el material hereditario, que es la base del repertorio de instrucciones en que se basa el desarrollo y el funcionamiento de cada organismo, y cuya composición se basa en el ácido desoxirribonucleico (ADN). Por la existencia del núcleo, en las células eucariotas se dan en espacios separados los procesos de replicación del genoma y transcripción del ARN, que ocurren dentro, y la biosíntesis de proteínas (traducción), que se produce fuera. Esta compartimentación es una de las condiciones de la complejidad del control funcional que distingue a los eucariontes de los procariontes. El núcleo es una estructura dinámica, que en los organismos con mitosis abierta, se deshace durante el reparto cromosómico. Se llama núcleo interfásico al que s e observa antes de la mitosis y después de ésta, ya duplicado; es decir, durante los momentos del ciclo celular que no corresponden a la mitosis. Cuando no se especifique otra cosa, las explicaciones siguientes se refieren al núcleo interfásico. Además, el núcleo cuenta con una estructura que se tiñe con facilidad, el denominado nucléolo.

Forma, tamaño y posición
El núcleo es casi siempre una estructura esferoidal relativamente grande, cuando se la compara con los orgánulos citoplasmáticos comunes. En té rminos absolutos, puede medir menos desde 1 µm (en los llamados nanoeucariontes) hasta más de 20 µm. Su volumen guarda cierta proporcionalidad con el del citoplasma. El núcleo tiende a ocupar una posición central, pero en las células adultas de las planta s se ve desplazado a la periferia por el importante volumen del vacuoma (conjunto de vacuolas).

Lo típico es que cada célula eucariota contenga un núcleo, sin embargo son frecuentes e importantes las excepciones. En los hongos también es normal la condición dicariótica (dos núcleos). En protistas es donde se observa mayor diversidad de casos, en éste como en otros temas básicos de la biología eucariótica. En los ciliados existen regularmente dos núcleos, el macronúcleo y el micronúcleo. Los eritrocitos (glóbulos rojos) maduros de casi todos los mamíferos carecen de núcleo.

El núcleo interfásico presenta al menos las siguientes partes diferenciadas: Envoltura nuclear.- Se basa en una doble membrana (2 bicapas lipídicas) reforzada por e l citoesqueleto. Está perforada por poros nucleares, a través de los cuales el interior del núcleo se comunica con el citosol. La envoltura presenta ribosomas adheridos externamente y es la continuación del retículo endoplasmático rugoso. La envoltura nucl ear se halla reforzada por dos armazones de filamentos intermedios, uno adosado a su
Universidad Católica los Ángeles de Chimbote - ULADECH 103

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

superficie interna: la lámina nuclear. Y otro situado sobre la cara citosólica de la membrana externa. Cromatina.- Es la forma que toma el material hereditario durante l a interfase del ciclo celular. Consiste en ADN asociado a proteínas. Nucleoplasma.- también llamado carioplasma o cariolinfa. Se trata del medio interno indiferenciado que llena el núcleo, semejante al citosol o hialoplasma, bañando a sus componentes. Nucléolo(s).- Una o más estructuras esferoidales, relacionadas con la síntesis de las principales piezas de los ribosomas y con su ensamblaje parcial. Éste está conformado por ARN y proteínas básicas. Se distinguen dos porciones del nucléolo, la región granular, formada por gránulos de ARN, y la región fibrilar formada por filamentos de ARN. Una tercera región, muy difícil de observar es la denominada porción cromosómica del nucléolo, en ésta se encuentran filamentos de DNA.

1. Dirige la actividad celular, ya que contiene el programa genético, que dirige el desarrollo y funcionamiento de la célula. 2. Es la sede de la replicación (duplicación del ADN) y la transcripción (síntesis de ARN), mientras que la traducción ocurre en el citoplasma. En las cél ulas procariotas todos esos procesos coinciden en el mismo compartimento celular.

También llamada carioteca, es la envuelta que rodea y delimita al núcleo propio de la célula eucariota. La envoltura nuclear está formada por dos membran as concéntricas, así que la expresión membrana nuclear, frecuentemente usada para referirse a ella, no puede considerarse apropiada. Constitución La envoltura nuclear es una estructura compleja que se basa en una vesícula de retículo endoplasmático extendida alrededor del material hereditario nuclear (cromatina). Como tal
Universidad Católica los Ángeles de Chimbote - ULADECH 104

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

vesícula, la envoltura aparece conformada por dos membranas: la membrana nuclear externa y la membrana nuclear interna. Por el lado de fuera queda el citoplasma y por el de dentro el contenido del núcleo. Por el lado del núcleo la membrana nuclear interna lleva adosada una estructura llamada lámina nuclear, la cual está formada por proteínas, como las llamadas laminas, a veces en forma de capa continua, a veces con la estructura de un panal. El hecho de que la envoltura sea una especialización del retículo endoplasmático se observa también en que suele aparecer recubierta de ribosomas (algo que es característico del retículo endoplasmático rugoso), los cuales fabrican precisamente proteína s que se incorporan a la composición de las membranas nucleares. Funciones La envoltura nuclear aparece atravesada de manera regular por perforaciones, los poros nucleares. Estos poros no son simples orificios, sino estructuras complejas acompañadas de una armazón de proteínas, que facilitan a la vez que regulan los intercambios entre el núcleo y el citoplasma. Se llama complejo del poro a cada una de esas puertas de comunicación. Por ahí salen las moléculas de ARNm producidas por la transcripción, que deben ser leídas por los ribosomas del citoplasma. Por ahí salen también los complejos de ARNr y proteínas a partir de los cuales se ensamblan en el citoplasma los ribosomas. Por los poros entran al núcleo las proteínas, fabricadas en el citoplasma por los r ibosomas, que cumplen su papel dentro del núcleo. Dinámica: En las células con mitosis abierta, que son la mayoría, la envoltura nuclear desaparece al principio de la mitosis, para formarse de nuevo, ahora alrededor de dos núcleos hijos, al acabar aquélla. El proceso depende de la alteración de las lá minas, las proteínas de la lámina, por un complejo enzimático. Cuando el proce so de la mitosis termina, las lá minas vuelven a su estado inicial, formándose primero dos láminas nucleares sobre las cuales, por extensión del retículo endoplasmático, terminan por formarse dos envolturas nucleares completas. En las células con mitosis cerrada, una variante que se observa en muchos protistas, la envoltura nuclear no desaparece durante la mitosis, sino que se esti ra, estrángulándose, para terminar formando los dos núcleos hijos.

La cromatina es el conjunto de ADN, histonas y proteínas no histónicas que se encuentra en el núcleo de las células eucariotas y que constituye el cromosoma eucariótico. Las unidades básicas de la cromatina son los nucleosomas. Éstos se encuentran formados por aproximadamente 146 pares de bases de longitud (el número depende del organismo), asociados a un complejo específico de 8 histonas nucleosómicas (octámero de histonas). Cada partícula tiene una forma de disco, con un diámetro de 11 nm y contiene dos copias de cada una de las 4 histonas H3, H4, H2A y H2B. Este octámero forma un núcleo proteico alrededor del que se enrolla la hélice de ADN (da aproximadamente 1.8 vueltas). En tre cada una de las asociaciones de ADN e histonas existe un ADN libre llamado ADN "espaciador", de longitud variable entre 0 y 80 pares de nucleótidos que garantiza flexibilidad a la fibra de cromatina. Este tipo de organización, permite un primer paso de
Universidad Católica los Ángeles de Chimbote - ULADECH 105

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

compactación del material genético, y da lugar a una estructura parecida a un "collar de cuentas". Posteriormente, un segundo nivel de organización de orden superior lo constituye la "fibra de 30nm" compuestas por grupos de nucleosomas empaquetados uno s obre otros adoptando disposiciones regulares gracias a la acción de la histona H1. Finalmente continúa el incremento del empaquetamiento del DNA hasta obtener los cromosomas que observamos en la metafase, el cual es el máximo nivel de condensación del ADN.

La cromatina se puede encontrar en dos formas: Heterocromatina.- es una forma inactiva condensada localizada sobre todo en la periferia del núcleo, que se tiñe fuertemente con las coloraciones. La heterocromatina puede ser de dos tipos diferentes:

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o La constitutiva.- idéntica para todas las células del organismo y que carece de información genética, incluye a los telómeros y centrómeros del cromosoma que no expresan su ADN. o La facultativa.- diferente en los distintos tipos celulares, contiene información sobre todos aquellos genes que no se expresan o que pueden expresarse en algún momento. Incluye al ADN satélite y al corpúsculo de Barr. Eucromatina.- está diseminada por el resto del núcleo (menor condensación), se tiñ e débilmente con la coloraciones (su mayor tinción ocurre en la mitosis y no es visible con el microscopio de luz. Representa la forma activa de la cromatina en la que se está transcribiendo el material genético de las moléculas de ADN a moléculas de ARNm, por lo que es aquí donde se encuentran la mayoría de los genes activos. La distinción tajante entre eucromatina activa y heterocromatina inactiva es aceptable actualmente, pero con importantes reservas.

El nucleoplasma es el medio interno del núcleo celular, en el se encuentran las fibras de ADN, que asociadas con proteínas denominadas histonas forman hebras llamadas cromatinas y ARN conocidos como nucleolos.

El nucléolo es un suborgánulo del núcleo que tiene como principal func ión la síntesis de los ARNr. En la ultraestructura del nucléolo podemos distinguir: o Centro fibrilar: es poco denso a los electrones. Se encuentra formado por fibrillas muy finas, complejos de preiniciación y factores de iniciación de la transcripción. o Alrededor del centro fibrilar suele situarse un componente fibrilar más denso a los electrones, constituido por fibras más gruesas. Es la zona del ADN que se está transcribiendo activamente, formando árboles de navidad. o Componente granular: formado por gránulos y ribonucleoproteínas (ANRprer). o Intersticios: son zonas donde no se localiza ningún componente. El gen que codifica los ARNr da lugar a un transcrito de 45 S, el ARN prerribosómico (ARNprer). En ese ARNprer pueden distinguirse dos regiones: Las regiones no metiladas: se degradan mediante la introducción de proteínas prerribosómicas en el núcleo y asociación de éstas al ARNprer. Las regiones metiladas: quedan libres como resultado de la lisis del ARNprer. Se forman los tres ARNr: El ARN 18 S junto con algunas proteínas da lugar a la subunidad pequeña inmadura, en forma de RNP. Ésta debe migrar al citoplasma por un poro. Esta salida ocurre muy rápidamente. Los ARN 28 S y 5’8 S se asocian a otras proteínas y a un ARN 5S sintetizado fuera del nucléolo. Los tres forman un gránulo que constituye la subunidad grande del ribosoma y que deberá igualmente atravesar la envoltura nuclear mediante un poro. Esta salida lleva hasta 30 minutos, ya que la estructura debe fragmentarse para atravesar el poro.
Universidad Católica los Ángeles de Chimbote - ULADECH 107

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los genes que codifican este ARNprer 45 S se repiten en cinco pares de cromosomas: 13, 14, 15, 21 y 22. En los cromosomas acrocéntricos con constricción secundaria, es en ésta donde se asocia el gen. El ARN 5S se encuentra codificado en el brazo Q del c romosoma 1. En el nucléolo, además de formarse estas subunidades, se realizan otros procesos: Formación de proteínas telomerásicas y organización de la telomerasa. En los nucleolos y en los cercanos cuerpos de Cajal, se maduran RNP que se sintetizaron en el citoplasma y migraron al nucleolo para su maduración.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


T B M H C G O L A D S R E V I N U Universidad Católica los Ángeles de Chimbote - ULADECH 109

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Virtualmente todas las células, eucariotas (de plantas, animales, hongos y protistas) poseen organelos complejos, llamados MITOCONDRIAS, que son el sitio de la RESPIRACIÓN CELULAR AEROBIA, proceso que incluye casi todas las reacciones que convierten la energía química de determinados alimentos en ATP. Constituyen uno de los ejemplos de integración morfo funcional más admirable, ya que proveen el andamiaje sobre el que asientan las innumerables moléculas que participan en las reacciones que transfieren la energía depositada en los alimentos a una molécula extraordinariamente versátil como es el ATP CARACTERÍSTICAS GENERALES La respiración aeróbica necesita oxígeno y causa la liberación de átomos de carbono de las moléculas alimentarias, en la forma de dióxido de carbono (un producto de desecho). Las mitocondrias son más numerosas en células muy activas y q ue, por lo tanto, tienen altas necesidades de energía. Se han encontrado más de 1000 en una sola célula hepática. Las mitocondrias difieren en su tamaño, que va de 2 a 8 um. de longitud, son cilíndricas y experimentan cambios sutiles con rapidez en su tam año y forma derivados de su actividad. Se encuentran ubicadas en las regiones de las células donde la demanda de energía es mayor, por lo que se desplazan de un lado a otro del citoplasma hacia las zonas necesitadas de energía. No obstante, en algunos tipo s celulares, como los espermatozoides, las células musculares y las células grasas, las mitocondrias permanecen en lugares fijos. Por lo regular una mitocondria da origen a otra mediante crecimiento y ulterior división. Cada MITOCONDRIA está limitada por una doble membrana, que forma dos compartimientos diferentes en el organelo; ESPACIO INTERMEMBRANOSO y la MATRIZ MITOCONDRIAL. El espacio intermembranoso es el compartimiento que se forma entre la MEMBRANA EXTERNA y la MEMBRANA INTERNA. La matriz mitocondr ial, el compartimiento rodeado por la membrana interna, contiene enzimas que degradan moléculas alimentarias y convierten su energía en otras formas de energía química. La MEMBRANA MITOCONDRIAL EXTERNA es lisa y permite el paso de muchas moléculas pequeñas presentes en el citosol, pero no de las macromoléculas. Esto debido a que en su bicapa lipídica presenta, entre otros componentes una proteína de transmembrana llamada “porina” que forman canales acuosos pequeños. En contraste, la MEMBRANA MITOCONDRIAL INTERNA se pliega repetidas veces y regula de manera estricta los tipos de molécula que pueden atravesarla; los pliegues, llamados CRESTAS MITOCONDRIALES, se extienden en el interior de la matriz
Universidad Católica los Ángeles de Chimbote - ULADECH 110

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

mitocondrial y constituyen una superficie para las reaccio nes químicas que transforman la energía química de las moléculas alimenticias en energía química almacenada en el ATP. La membrana contiene la compleja serie de enzimas y otras proteínas necesarias para dichas, reacciones. Esta membrana presenta un alto g rado de especialización. Los organismos autótrofos fijan la energía solar en forma de energía química contenida en los compuestos orgánicos, glucosa (carbohidrato), en particular. Esta energía, convenientemente liberada, será utilizada posteriormente por las partes de la planta que no tienen cloroplastos, como suele ser el caso de las raíces y tallos no verdes, o por toda la planta cuando falta la energía solar. Es también esta energía (presente en estas moléculas orgánicas: glucosa) la que permite la vida de los organismos heterótrofos. La respiración celular y las fermentaciones son las vías catabólicas más corrientes para la obtención de la energía contenida en las sustancias orgánicas. Ambas vías, no obstante, tienen una primera fase común: la glucólisi s.

La respiración celular es el conjunto de reacciones bioquímicas que ocurre en la mayoría de las células, en las que el ácido pirúvico producido por la glucólisis se desdobla a anhídrido carbónico (CO2) y agua (H2O) y se producen 36 o 38 moléculas de ATP. En las células eucariotas la respiración se realiza en las mitocondrias y ocurre en tres etapas que son: o Oxidación del piruvato. o Ciclo de los ácidos tricarboxílicos. o Cadena respiratoria y fosforilación oxidativa del ADP a ATP.

Los vegetales, mediante sus cloroplastos, fijan y almacenan la energía; sintetizando moléculas orgánicas (carbohidratos: glucosa). Posteriormente los animales heterótrofos; con la ayuda de sus mitocondrias transforman esta energía (almacenada en los carbohidratos: glucosa) en energía calórica y energía para el trabajo celular “ATP”.
Universidad Católica los Ángeles de Chimbote - ULADECH 111

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La respiración celular es una parte del metabolismo, concretamente del catabolismo, en el cual la energía contenida en distintas biomoléculas, como los glúcidos (carbohidratos), es liber ada de manera controlada. Durante la respiración una parte de la energía libre desprendida en estas reacciones exotérmicas, es incorporada a la molécula de ATP, que puede ser a continuación utilizado en los procesos endotérmicos, como son los de mantenimie nto y desarrollo del organismo (anabolismo). La respiración celular podría dividirse en dos tipos, según el papel atribuido al oxígeno: o RESPIRACIÓN AEROBIA: Hace uso del O 2 como aceptor último de los electrones desprendidos de las sustancias orgánicas. E s la forma más extendida, propia de los organismos eucariontes (cuyas mitocondrias realizan dicha función) y algunos grupos de bacterias. Se llama aerobios a los organismos que, por este motivo, requieren O 2. o RESPIRACIÓN ANAEROBIA: No interviene el oxígen o, sino que se emplean otros aceptores finales de electrones, muy variados, generalmente minerales y, a menudo, subproductos del metabolismo de otros organismos. Un ejemplo de aceptor es el SO 42(anión sulfato), que en el proceso queda reducido a H 2S:

La respiración anaerobia es propia de procariontes (p.ej.: bacterias) diversos, habitantes sobre todo de suelos y sedimentos, y algunos de estos procesos son importantes en los ciclos biogeoquímicos de los elementos. No debe confundirse la respiración a naerobia con la fermentación, que es una oxidación – reducción interna a la molécula procesada, en la que no se requiere ni O 2 ni ningún otro aceptor de electrones. La respiración anaerobia es un proceso biológico de oxidorreducción de azúcares y otros compuestos. La realizan exclusivamente algunos grupos de bacterias. En las bacterias anaerobias, la cadena de transporte de electrones es análoga a la de la respiración aerobia, ya que se compone de los mismos componentes (citocromos, quinonas, proteínas ferrosulfúricas, etc.). La única diferencia por tanto radica en el aceptor último de electrones. Todos los posibles aceptores en la respiración anaerobia tienen un potencial de reducción menor que el O 2, por lo que se genera menos energía en el proceso. LA RESPIRACIÓN CELULAR AERÓBICA La respiración aerobia es un tipo de metabolismo energético el que seres vivos extraen energía de moléculas orgánicas, como la glucosa, por un proceso complejo en el que el carbono queda oxidado y en el que el oxígeno procedente del aire es el oxidante empleado. En otras variantes, muy raras, de la respiración el oxidante es distinto del oxígeno. La respiración aerobia o normal, es el proceso
Universidad Católica los Ángeles de Chimbote - ULADECH 112

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

responsable de que la mayoría de los seres vivos, los llamados por ello aerobio s, requieran oxígeno. La respiración aerobia es propia de los organismos eucariontes en general y de algunos tipos de bacterias. El oxígeno que, como cualquier gas, atraviesa sin obstáculos las membranas biológicas, atraviesa primero la membrana plasmáti ca y luego la mitocondrial, siendo en la matriz de la mitocondria donde se une a electrones y protones (que sumados constituyen átomos de hidrógeno) formando agua. En esa oxidación final, que es compleja, y en procesos anteriores se obtiene la energía necesaria para la fosforilación del ATP. En presencia de oxígeno, el ácido pirúvico obtenido durante la fase primera anaerobia o glucólisis, es oxidado para proporcionar energía (ATP), dióxido de carbono y agua. A esta serie de reacciones se le conoce con el nombre de respiración aerobia. EL ADENOSIN TRIFOSFATO “ATP” El trifosfato de adenosina (ATP) o adenosín trifosfato es una molécula que consta de una purina (adenina), un azúcar (ribosa), y tres grupos fosfato. Gran cantidad de energía para las funciones biológicas se almacena en los enlaces de alta energía que unen los grupos fosfato y se liberan cuando uno o dos de los fosfatos se separan de las moléculas de ATP. El compuesto resultante de la pérdida de un fosfato se llama difosfato de adenosina, ade nosín difosfato o ADP; si se pierden dos se llama monofosfato de adenosina, adenosín monofosfato o AMP, respectivamente. ATP Y METABOLISMO El acoplamiento entre las reacciones exergónicas (que liberan energía al medio) y endergónicas (que gastan energía del medio) en los seres vivos se realiza a través del ATP. Por eso se le conoce como moneda de intercambio energética celular. La mayoría de los organismos nos alimentamos de metabolitos complejos (proteínas, lípidos, glúcidos, etc.) que degradamos a lo largo del tracto intestinal. De modo que a las células llegan metabolitos complejos, pero no tan complejos como los ingeridos. En la célula van a ser oxidados por una serie de reacciones químicas degradativas “catabolismo”. Como productos del catabolismo se obtienen metabolitos simples y energía. Ambos son los precursores para la síntesis de los componentes celulares. Todo el conjunto de reacciones de síntesis se llama “anabolismo”. En el catabolismo (oxidación) se produce una liberación de electrones que se rán captados por unos transportadores de electrones como el NAD+ (que al aceptar electrones se reduce a NADH). Por otra parte, la energía liberada quedará retenida en su mayoría en el ATP. La síntesis (anabolismo) de los compuestos celulares se realizará con los metabolitos simples, utilizando la energía contenida en el ATP y los electrones contenidos en el NADH, ya que este es un proceso reductivo (toma electrones). El ATP es esa moneda de intercambio energético debido
Universidad Católica los Ángeles de Chimbote - ULADECH 113

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

a su estructura química. Cuando se h idroliza libera mucha energía que va a ser captada por las enzimas que catalizan las reacciones de biosíntesis. ¿Por qué tienen los enlaces del ATP tanta tendencia a hidrolizarse? o Veamos la molécula de ATP y su hidrólisis a ADP + Pi: o Se puede representar así: A– P ~ P ~ P o Donde “~” son los enlaces anhídrido de ácido, que son de alta energía. En la hidrólisis del ATP se está hidrolizando uno de esos enlaces anhídrido de ácido. Esto libera gran energía, concretamente 7'7 kcal/mol . Es decir: ΛG = -7,7 kcal/mol.

o Es una reacción muy exergónica. Su keq (constante de equilibrio) es 11. o Así se comprende que el ATP tiene tendencia a hidrolizarse de forma natural y liberar energía. Nicotinamida Adenín Dinucleótido “NAD” La nicotinamida adenín dinucleóti do (NAD) es una coenzima, de la vitamina B3 cuya función principal es la intercambio de hidrogeniones en la producción de energía de todas las células. El NAD forma el primer complejo en la captación de hidrógenos en la fosforilación oxidativa y aparece en múltiples reacciones del metabolismo. El NADH es la nicotinamida adenín dinucleótido reducida, siendo la forma activa. Cuando pierde el hidrógeno (deshidrogenación), cede energía. El NADP es la nicotinamida adenín dinucleótido fosfato, siendo la NADPH su forma reducida. Las formas reducidas del NAD se obtienen de la glucólisis y ciclo de Krebs principalmente. Flavin Adenine Dinucleotido “FAD” El grupo de la flavina interviene en muchas reacciones bioquímicas de transferencia de hidrógeno. Se encuentra a menudo unido a un grupo de adenosindifosfato ([ADP) en cuyo caso se suele conocer bajo su nombre inglés flavin adenine dinucleotide (FAD). REACCIONES DE OXIDO – REDUCCIÓN Las reacciones de reducción-oxidación (también conocido como reacción redox) son la s reacciones de transferencia de electrones.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Esta transferencia se produce entre un conjunto de especies químicas, uno oxidante y uno reductor (una forma reducida y una forma oxidada respectivamente). OXIDADO (FAD+) REDUCIDO (FADH2)

Oxidación – Reducción de la molécula de FAD

Para que exista una reacción redox, en el sistema debe haber una especie que ceda electrones y otra especie que las acepte: 1. El reductor es la especie química que tiende a ceder electrones de su es tructura química al medio, quedando con carga mayor a la que tenía. 2. El oxidante es la especie que tiende a captar esos electrones, quedando con carga menor a la que tenía. Cuando una especie química reductora cede electrones al medio se convierte en una especie oxidada, y la relación que guarda con su precursor queda establecida mediante lo que se llama un par redox. Análogamente, se dice que cuando una especie capta electrones del medio se convierte en una especie reducida, e igualmente forma un par redox con su precursor reducido. Las reacciones químicas de la respiración aeróbica de la glucosa pueden agruparse en cuatro etapas. En los eucariotas, la primera etapa (glucólisis) se realiza en el citosol, y el resto ocurren en el interior de las mitocondrias. La mayor parte de las bacterias también efectúan estos procesos, pero dado que sus células carecen de mitocondrias, todas las etapas se llevan a efecto en el citosol y en asociación con la membrana plasmática. 1. GLUCÓLISIS. Ocurre en el citosol, donde cada molécula de glucosa, con sus 6 átomos de carbono, se oxida parcialmente dando lugar a dos moléculas de piruvato (de 3 átomos de carbono). Se invierten dos ATP pero se generan cuatro, y 2 NADH. 2. FORMACIÓN DE ACETILCOENZIMA A. Cada molécula del piruvato entra en una mitocondria y se oxida para convertirse en una molécula de dos carbonos (acetato) que se combina con la coenzima A y forma acetilcoenzima A; se produce NADH 2 y se libera C02 como producto de desecho. 3. CICLO DEL ÁCIDO CÍTRICO. El grupo acetato de la acetilCoA se combina con una molécula de cuatro carbonos (oxalacetato), y se forma una molécula de seis carbonos (citrato). En el transcurso del ciclo ésta se recicla a oxalacetato y se libera CO 2 como producto de desecho. Se captura energía c omo ATP y los compuestos reducidos de alto contenido de energía NADH 2 y FADH2. Todas estas reacciones ocurren en la matriz mitocondrial. 4. CADENA DE TRANSPORTE DE ELECTRONES Y QUIMIOSMÓSIS. Los electrones extraídos de la glucosa durante las etapas precedent es se transfieren de NADH 2 y FADH2 a una cadena de compuestos aceptores de electrones. A medida que los
Universidad Católica los Ángeles de Chimbote - ULADECH 115

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

electrones pasan de un aceptor a otro, parte de su energía se emplea para bombear hidrogeniones (protones) a través de la membrana mitocondrial interna, con lo que se forma un gradiente de protones. En un proceso denominado quimiosmósis, la energía de este gradiente se usa para producir ATP.

Las cuatro fases de la respiración aeróbica . La primera fase, la glucólisis ocurre en el citosol. Su producto, el piruvato, entra en la mitocondria, donde continúa la respiración celular con formación de acetilcoenzima A, ciclo del ácido cítrico y la cadena transporte de electrones/quimiosmósis. La mayor parte del ATP se sintetiza por quimiosmosis.

La oxidación de la glucosa es una fuente principal de energía en la mayoría de las células. Cuando la glucosa se degrada en una serie de pequeños pasos por medio de enzimas, una proporción significativa de la energía contenida en la molécula vuelve a emp aquetarse en los enlaces fosfato de las moléculas de ATP. La PRIMERA FASE en la degradación de la glucosa es la glucólisis que se efectúa en el citosol de la célula. La SEGUNDA FASE es la respiración aeróbica, que requiere oxígeno y, en las células eucarióticas, tiene lugar en las mitocondrias. La respiración comprende la formación de la acetilcoenzima A, el ciclo del ácido cítrico (ciclo de Krebs) y el transporte terminal de electrones acoplado al proceso de fosforilación oxidativa. Todos estos procesos están íntimamente relacionados. En condiciones anaeróbicas, el proceso de fermentación transforma al ácido pirúvico producido por la glucólisis o en etanol o en ácido láctico. Es posible saber cómo y en qué cantidad la energía química, originalmente pre sente en la molécula de glucosa, se recupera en forma de ATP en el curso de la degradación de la molécula de glucosa. Así, es posible calcular el rendimiento energético global de la oxidación de la glucosa, que puede dar como resultado un máximo de 38 molé culas de ATP (aunque pueden ser también 36 ATP) . La actividad de la glucólisis y la respiración están reguladas de acuerdo con las necesidades energéticas de la célula. Hasta ahora nos hemos referido a la degradación de la molécula de glucosa, pero otras moléculas alimenticias, que incluyen a las grasas, los polisacáridos y las proteínas, pueden ser también degradadas a compuestos que pueden ingresar en las vías centrales -glucólisis y ciclo de Krebs- en diferentes pasos. La biosíntesis de compuestos orgán icos utiliza los compuestos precursores derivados de intermediarios en la secuencia respiratoria y es impulsada por la
Universidad Católica los Ángeles de Chimbote - ULADECH 116

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

energía derivada de esos procesos. Así, otras vías catabólicas y anabólicas están íntimamente interrelacionadas.

Esquema global de la oxidación de la glucosa

Hasta ahora se ha referido a la degradación de la molécula de glucosa, pero otras moléculas alimenticias, que incluyen a las grasas, los polisacáridos y las proteínas, pueden ser también degradadas a compuestos que pueden ingresar en las vías centrales -glucólisis y ciclo de Krebs- en diferentes pasos. La biosíntesis de compuestos orgánicos utiliza los compuestos precursores derivados de intermediarios en la secuencia respiratoria y es impulsada por la energía derivada de esos procesos. Así, otras vías catabólicas y anabólicas están íntimamente interrelacionadas.

Energía de carbohidratos, proteínas y grasas
Universidad Católica los Ángeles de Chimbote - ULADECH 117

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En presencia de oxígeno, el ácido pirúvico entra en el ciclo de Krebs donde se sintetiza más ATP y se transfieren más electrones y protones a las coenzimas. Estas coenzimas aceptoras de electrones transfieren su carga a la cadena transportadora de electrones a lo largo de la cual, paso a paso, los electrones caen a niveles inferiores de energía. A medida que esto ocurre, se fabrica mucho más ATP. Al final de la cadena transportadora, los electrones se reúnen con los protones y se combinan con el oxígeno, formándose agua . En ausencia de oxígeno, el ácido pirúvico puede convertirse en ácido láctico o etanol. Este proceso, llamado fermentación, no produce ATP, pero regenera las moléculas de coenzima aceptoras de electrones, necesarias para que la glucólisis continúe. EN LA GLUCÓLISIS LA GLUCOSA SE CONVIERTE EN DOS PIRUVATOS La glucólisis, también denominada glicólisis o ruta de Embden -Meyerhof, es la secuencia metabólica en la que se oxida la glucosa. Consiste de nueve reacciones enzimáticas que producen dos moléculas de ácido pirúvico o piruvato y dos equivalentes reducidos de NADH, los que, al introducirse en la cadena respiratoria, producirán cuatro moléculas de ATP. Cuando hay ausencia de oxígeno, la glucólisis es la única vía que produce ATP en los animales. Los organismos primitivos se originaron en un mundo cuya atmósfera carecía de 02 y, por esto, la glucólisis se considera como la vía metabólica más primitiva. Está presente en todas las formas de vida actuales. Es la primera parte del metabolismo energético y en la s células eucariotas ocurre en el citoplasma (citosol). La glucólisis (que literalmente significa “rotura de azúcar”) no necesita oxígeno y ocurre en condiciones aeróbicas o anaeróbicas. En la figura 04 se presenta un resumen sencillo de la glucólisis, en la cual una molécula de glucosa (compuesto de seis carbonos) se convierte en dos moléculas de piruvato (compuesto de tres carbonos). Se captura parte de la energía de la glucosa; hay una ganancia neta de dos moléculas de ATP y dos de NADH. Las reacciones de la glucólisis ocurren en el citosol, donde hay los componentes necesarios, como ADP, NAD + y fosfatos inorgánicos, que flotan libres en el citosol. La glucólisis es un proceso en el cual una molécula de glucosa de 6 carbonos se escinde en dos moléculas de 3 carbonos de ácido pirúvico. Este proceso da como resultado un rendimiento neto de dos moléculas de ATP (a partir de ADP y fosfato inorgánico) y dos moléculas de NADH (a partir de NAD +). La glucólisis comienza con una molécula de glucosa. En este proc eso, primero se invierte energía por transferencia de un grupo fosfato desde una molécula de ATP, una por cada paso, a la molécula de azúcar. La molécula de 6 carbonos luego se escinde y, de allí en adelante, la secuencia produce energía. En cierto momento se reduce una molécula de NAD + a NADH y H + almacenandose parte de la energía producida por la oxidación del gliceraldehído -3-fosfato. En los pasos finales las moléculas de ADP toman energía del sistema, fosforilándose a ATP. Resumiendo: para iniciar la s ecuencia glucolítica es necesaria la energía de los enlaces fosfato de dos moléculas de ATP. Posteriormente se producen dos moléculas de NADH a partir de dos de NAD + y cuatro de ATP a partir de cuatro de ADP: Glucosa+2ATP+4ADP+2Pi+2NAD +=>2 Ácido pirúvico+ 2ADP + 4ATP + 2NADH 2 + 2H+ + 2H2O De esta forma, una molécula de glucosa se convierte en dos moléculas de ácido pirúvico. La ganancia neta, la energía recuperada, es dos moléculas de ATP y dos moléculas de NADH por molécula de glucosa. Las dos moléc ulas de ácido pirúvico contienen todavía una gran parte de la energía que se encontraba almacenada en la molécula de glucosa original. La serie de
Universidad Católica los Ángeles de Chimbote - ULADECH 118

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

reacciones que constituyen la glucólisis se lleva a cabo virtualmente en todas las células vivas, desde las células procarióticas hasta las células eucarióticas de nuestros propios cuerpos.

Glucólisis o ruta de Embden-Meyerhof: transformación de la glucosa en dos moléculas de piruvato (ácido pirúvico)

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Panorama general de la glucólisis. La fase de inversión de energía de la glucólisis (columna izquierda) lleva al desdoblamiento del azúcar; ATP y NADH se producen durante la fase de captura de energía (columna derecha). Durante la glucólisis cada molécula de glucosa se convierte en dos piruvato, con rendimiento neto de dos moléculas de ATP y dos de NADH.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


En los eucariotas, las moléculas de piruvato formadas en la glucólisis entran en las mitocondrias, donde se convierten en acetilcoenzima A (acetilCoA). Estas reacciones ocurren en el citosol de los procariotas aerobios. En esta serie de reacciones, el piruvato experimenta un proceso denominado descarboxilación oxidativa. En primer término, un grupo carboxilo se disocia en la forma de dióxido de carbono, que se difunde hacia el exterior de la célula. Luego, se oxida el fragmento residual de dos carbonos, y el NAD + acepta los electrones que se disociaron durante la oxidación. Por último, el fragmento oxidado de dos carbonos, un grupo acetilo, se une a la coenzima A, de lo que resulta acetilcoenzima A. La coenzima A transfiere grupos derivados de ácidos orgánicos. En este caso se trata de un grupo acetilo, relacionado con el ácido acético. La coenzima A se sintetiza en la célula a partir de una de las vitaminas del complejo B , el ácido pantoténico. La fijación del grupo acetilo a la coenzima A es catalizada por un complejo multienzimático, qu e incluye varias copias de cada una de tres enzimas distintas. La reacción global para la síntesis de acetilcoenzima A es como sigue: 2 Piruvatos + 2 NAD+ + 2 CoA
Universidad Católica los Ángeles de Chimbote - ULADECH

2 AcetilCoA + 2NADH 2 + 2C0 2

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Nótese que la molécula original de glucosa se ha oxidado parcialmente en dos grupos acetilo y dos moléculas de C0 2. Los átomos de hidrógeno disociados redujeron el NAD + a NADH. En este punto de la respiración aeróbica, se han formado cuatro moléculas de NADH por el catabolismo de una sola de glucosa; a saber: dos durante la glucólisis y otras tantas al formarse la acetilCoA a partir del piruvato.

Formación de acetilcoenzima A.- El piruvato, una molécula de tres carbonos que es el producto terminal de la glucólisis, ingresa a la mitocondria y experimenta descarboxilación oxidativa. En primer término, el grupo carboxilo se disocia e n la forma de dióxido de carbono . Luego, se oxida el fragmento residual de dos carbonos, y sus electrones se transfieren al NAD+. Por ú ltimo, el grupo de dos carbonos oxidado, que es un grupo acetilo, se une a la coenzima A. Esta tiene un átomo de azufre, que forma un enlace muy inestable (indicado mediante una línea ondulada) con el grupo acetilo.


Panorama general del ciclo del ácido cítrico. En el ciclo entran dos grupos acetilo por cada glucosa. Cada grupo acetilo, de dos carbonos, se combina con oxalacetato, de cuatro carbonos, para formar
Universidad Católica los Ángeles de Chimbote - ULADECH 122

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

citrato, de seis carbonos. Las dos moléculas de CO 2 se regeneran para formar oxalacetato, y en el proceso se captura energía en la forma de un ATP, tres NADH y un FADH 2 por grupo acetilo (o dos ATP, seis NADH y dos FADH 2 por glucosa).

El ciclo del ácido cítrico, también lla mado ciclo de los ácidos tricarboxílicos (ciclo TCA) o ciclo de Krebs (en honor de Sir Hans Krebs), ocurre en la s mitocondrias. En la figura se presenta un resumen sencillo de este ciclo, y sus ocho pasos se ilustran en la figura 10. Cada reacción es catalizada por una enzima específica.

DE KREBS: a respiración la cual los cetilos se dióxido de s moléculas n el proceso zarse en la ATP.

MBLGO. LUIS A. SANCHEZ ANGULO 13 acetil-CoA, el producto del catabolismo de los carbohidratos, las proteínas y lo s lípidos, ingresa al ciclo
junto con H 20 y se oxida a C0 2 con liberación de equivalentes reductores (2H).
Universidad Católica los Ángeles de Chimbote - ULADECH 123

Ciclo del ácido cítrico. La vía catabólica principal de la acetil -CoA en los organis mos aerobios. La

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La primera reacción del ciclo ocurre cuando la acetilCoA transfiere su gr upo acetilo de dos carbonos al oxalacetato, compuesto de cuatro carbonos, c on lo que se forma citrato, que posee seis carbonos.

El ciclo del ácido cítrico (ciclo de Krebs).

Oxalacetato + AcetilCoA Compuesto Compuesto de cuatro carbono de dos carbonos

Citrato + Compuesto de seis carbonos


Luego, el citrato experimenta una sucesión de transformaciones qu ímicas, en que pierde primero un grupo carboxilo y luego otro, en la forma de C0 2. La mayor parte de la energía que queda disponible con los pasos oxidativos de este ciclo se transfiere en la forma de electrones de alto contenido de energía al NAD +, lo que forma NADH 2. Por cada grupo acetilo que entra el ciclo del ácido cítrico se producen tres moléculas de NADH2. También se transfieren electrones al aceptor de electrones FAD, con lo que se produce FADH2.
Universidad Católica los Ángeles de Chimbote - ULADECH 124

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En el curso del ácido cítrico, se disocian dos mo léculas de C0 2 y el equivalente a ocho átomos de hidrógeno (ocho protones y ocho electrones), con la formación de tres moléculas de NADH 2 y una de FADH 2. Se generan más hidrógeno del que entró en el ciclo con la molécula de acetilCoenzima A. Estos átomos de hidrógeno provienen de moléculas de agua que se agregan durante las reacciones del ciclo. El C0 2, producido corresponde a los dos átomos de carbono del grupo acetilo que entró en el ciclo ATC. Al final se ha regenerado en oxalacetato (de cuatro carbonos), y puede comenzar un nuevo ciclo. Debido a que se producen dos moléculas de acetilCoA por cada una de glucosa, se requieren dos ciclos por molécula de glucosa. Al término de dos vueltas del ciclo la glucosa original ha perdido todos sus átomos de carbo no y podría considerarse como totalmente consumida. Para resumir, el ciclo del ácido cítrico genera 4 C0 2, 6 NADH 2, 2 FADH 2 y 2 ATP por molécula de glucosa. Al final del ciclo del ácido cítrico, la glucosa se ha catabolizado por completo. Solamente cuatro moléculas de ATP se ha formado por fosforilación al nivel del sustrato: dos durante la glucólisis y dos en el ciclo del ácido cítrico. Esta vez, la mayor parte de la energía de la glucosa se encuentra en la forma de electrones de alta energía en NADH 2 y FADH2.Su energía servirá para impulsar la síntesis de más trifosfato de adenosina (ATP) mediante la cadena de transporte de electrones y la quimiosmósis.

El ciclo de Krebs resumido

El ciclo de Krebs contituye la segunda etapa del c atabolismo de carbohidratos. La glucolisis rompe la glucosa (6 carbonos) generando dos moléculas de piruvato (3 carbonos). En eucariotas el piruvato se desplaza al interior de la mitocondria (gracias a un transportador específico de membrana interna). En l a matriz mitocondrial produce acetil -CoA que entra en el ciclo de Krebs.
Universidad Católica los Ángeles de Chimbote - ULADECH 125

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En el catabolismo de proteínas, los enlaces peptídicos de las proteínas son degradados por acción de enzimas proteasas en el tracto digestivo liberando sus constituyentes aminoacídic os. Estos aminoácidos penetran en las células, donde pueden ser empleados para la síntesis de proteínas o ser degradados para producir energía en el ciclo de Krebs. Para su entrada al ciclo deben eliminarse sus grupos amino (terminales y laterales) por acc ión de enzimas aminotransferasas y desaminasas, principalmente.

Leyenda de colores: enzimas, coenzimas, nombres de sustratos, iones metálicos, moléculas inorgánicas, inhibición, estimulación

En el catabolismo de grasas, los trigli céridos son hidrolizados liberando ácidos grasos y glicerol. En el hígado el glicerol puede ser convertido en glucosa vía dihidroxiacetona fosfato y gliceraldehído-3-fosfato, por la gluconeogénesis (ruta anabólica). En muy diversos tejidos, especialmente en músculo cardiaco, los ácidos grasos son degradados en la matriz mitocondrial mediante sucesivos ciclos de beta oxidación que liberan unidades de acetil -CoA, que pueden incorporarse al ciclo de Krebs. En ocasiones, el ciclo de Krebs puede rendir propionil-CoA (3 carbonos), que puede emplearse para la síntesis de glucosa en la gluconeogénesis hepática. El ciclo de Krebs siempre es seguido por la fosforilación oxidativa. Este proceso extrae la energía en forma de electrones de alto potencial de las molécula s de NADH y FADH 2, regenerando NAD + y FAD, gracias a lo cual el ciclo de Krebs puede continuar. Los electrones son transferidos a moléculas de O 2, rindiendo H 2O. Pero esta transferencia se realiza a través de una cadena transportadora de electrones capaz d e aprovechar la energía potencial de los electrones para bombear protones al espacio intermembrana de la mitocondria. Esto genera un gradiente electroquímico de H+, que es utilizado para la síntesis de ATP mediante la enzima
Universidad Católica los Ángeles de Chimbote - ULADECH 126

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

ATP sintetasa De este modo el c iclo de Krebs no utiliza directamente O 2, pero lo requiere al estar acoplado a la fosforilación oxidativa. Por cada molécula de glucosa la energía obtenida mediante el metabolismo oxidativo, es decir, glucolisis seguida del ciclo de Krebs, equivale a unas 38 o 36 moléculas de ATP.

A continuación se considera el destino de todos los electrones disociados de una molécula de glucosa durante la glucólisis, la formación de acetilCoA y el ciclo del ácido cítrico. Estos electrones se transfieren a los aceptores primarios de hidrógeno NAD+ y FAD, con la formación de NADH2 y FADH 2. Tales compuestos reducidos entran en este punto de la cadena de transporte de electrones, donde los electrones de alto contenido de energía de sus átomos de hidrógeno se transfieren de una molécula aceptora a otra.

Representación detallada del transporte de electrones y la quimiosmósis . La cadena de trasnporte de electrones en la membrana interna de la mitocondria incluye tres bombas de protones que se localizan en tres de los cuatro complejos de transporte de electrones. La energía liberada durante dicho transporte se utiliza para llevar protones (H +) de la matriz mitocondrial al espacio intermemb ranoso, donde se acumula una alta concentración de protones. Se impide que estos se difundan de nuevo hacia la matriz, excepto en conductos especiales en la cintasa del ATP en la membrana interna. El flujo de protones a través de la cintasa genera ATP.

La cadena de transporte de electrones es una serie de portadores de electrones incluida en la membrana interna de las mitocondrias en los eucariotas, y en la membrana plasmática de los procariotas aerobios. Como NADH y FADH 2, cada portador puede existir en un a forma oxidada o una reducida. Los electrones pasan por la cadena de transporte en una serie de reacciones redox: cada molécula aceptora se reduce cuando acepta electrones y se oxida cuando los cede. Los que entran en el sistema de transporte de electrone s tienen contenido de energía relativamente alto, y pierden parte de ella en cada paso en la cadena de portadores. La tercera etapa de la respiración celular es la cadena de transporte de electrones. Tal como hemos visto, la cadena obtiene electrones del transportador de hidrógeno NADH + + H+, la forma reducida del NAD +. Otro transportador de hidrógeno relacionado, denominado FAD + (flavín
Universidad Católica los Ángeles de Chimbote - ULADECH 127

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

adenina dinucleótido) también transporta algunos electrones desde el ciclo de Krebs hasta la cadena transportadora de electrones. La forma reducida del FAD + es el FADH 2. De esta forma, la glucólisis y el ciclo de Krebs son etapas liberadoras de energía que extraen electrones de las moléculas de los metabolitos mientras los deg radan hasta formar compuestos más sencillos como el CO2 o el agua. De la glucólisis, el ciclo de Krebs, la etapa previa al ciclo de Krebs, la beta oxidación de ácidos grasos y la oxidación de aminoáidos se obtienen moléculas de NADH + + H+ y FADH2 llamadas moléculas de poder reductor.

Cada molécula de NADH + + H+ cede sus dos electrones a un complejo llamado NADH dehidrogenasa compuesto por flavín mononucleótido (FMN) que se encuentra oxidado. Se reduce con los dos electrones cedidos por el poder reductor que ahora está oxidado y que vuelve a las rutas catabólicas. Estos dos electrones pasan por una serie de compuestos que se van oxidando y reduciendo (cediendo electrones para oxidarse y aceptándolos para reducirse) hasta llegar a un aceptor final que es el oxígeno. El FADH 2 se incorpora a la cadena más tarde, lo que explica su menor rendimiento energético. Esto implica que cada complejo tiene mayor potencial redox que el sigiente, pero menos que el anterior, hasta llegar al aceptor final, el átomo de oxígeno, que se transforma en ión óx ido y se une a dos protones para formar agua. Del complejo NA DH deshidrogenasa y de los cuatro citocromos se expulsan protones H +, que servirán para formar ATP gracias a la fosforilación oxidativa. Sin el oxígeno como aceptor final la cadena no podría ced er los electrones al último aceptor, asÍ que los complejos no podrían volver a su estado oxidado reiniciando la cadena: el proceso es aerobio. Las rutas catabólicas y la cadena de transporte electrónico dependen la una de las otras, ya que sin las rutas catabólicas no existiría poder reductor que comenzara la cadena y sin cadena respiratoria el poder reductor no se podría volver a oxidar. Todo este proceso se produce en la membrana interna de la mitocondria. Ya fue mencionado que la fosforilación oxidativa es la transferencia de electrones de los equivalentes reducidos NADH, NADPH, FADH, obtenidos en la glucólisis y en el ciclo de Krebs hasta el oxígeno molecular, acoplado con la síntesis de ATP. Este proceso metabólico está
Universidad Católica los Ángeles de Chimbote - ULADECH 128

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

formado por un conjunto de enzim as complejas que catalizan varias reacciones de óxido reducción, donde el oxígeno es el aceptor final de electrones y donde se forma finalmente agua. La fosforilación oxidativa es un proceso bioquímico que ocurre en las células. Es el proceso metabólico final (catabolismo) de la respiración celular: la glicólisis y el ciclo del ácido cítrico. De una molécula de glucosa se obtienen 38 moléculas de ATP mediante la fosforilación oxidativa. Dentro de las células, la fosforilación oxidativa se produce en las m embranas biológicas. En procariotas es la membrana plasmática y en eucariotas es la membrana interna de las dos que forman la membrana mitocondrial. El NADH y FADH 2, moléculas donadores de electrones que "fueron cargadas" durante el ciclo del ácido cítrico , se utilizan en un mecanismo intrincado (que implica a numerosas enzimas como la NADH -Q reductasa, la citocromo “c” oxidasa y la citocromo reductasa), gracias a la bomba H + que moviliza los protones contra un gradiante de membrana. Un gran complejo proteico llamado ATP-sintetasa situado en la membrana, permite a los protones pasar a través en ambas direcciones; genera el ATP cuando el protón se mueve a favor de gradiente, y consume una molécula de ATP para bombear un protón en contra de gradiente. Debido a que los protones se han bombeado al espacio intermembranoso de la mitocondria en contra de gradiente, ahora pueden fluir nuevamente dentro de la matriz mitocondrial y mediante la vía ATP -sintetasa, se genera ATP en el proceso. Cada molécula de NADH contribuye suficientemente a generar la fuerza motriz de un protón que produzca 2.5 moléculas de ATP. Cada molécula de FADH 2 produce 1.5 moléculas de ATP. Todas juntas, las 10 moléculas de NADH y las 2 FADH 2 contribuyen a través de la oxidación de la glucosa (glucólisis, conversión de piruvato en acetil -CoA y ciclo de Krebs) a formar 34 de las 30 moléculas totales de ATP transportadoras de energía. Hay que decir que estos valores de moléculas de ATP son máximos. En realidad cada molécula de NADH contribuye a fo rmar entre 2 y 3 moléculas de ATP, mientras que cada FADH 2 contribuye a un máximo de 2 moléculas de ATP.

Se analiza a continuación en que puntos de la respira ción aerobia se captura energía biológicamente útil además de calcular el rendimiento total de energía que resulta de la oxidación completa de la glucosa. 1. En la glucólisis, la glucosa se activa con la adición de fosfatos procedentes de dos moléculas de ATP y se convierte por último en 2 piruvatos + 2NADH 2 + 4 ATP, con la generación de dos moléculas de ATP. Las dos moléculas de piruvato se metabolizan en 2 acetilCoA + 2 C0 2 + 2 NADH. En el ciclo del ácido cítrico, las dos moléculas de acetilCoA s e transforman en 4 CO2 + 6 + NADH2 + 2 FADH 2 + 2 ATP. La oxidación del NADH 2 en la cadena de transporte de electrones genera hasta tres moléculas de ATP por cada una de NADH 2, de modo que las 10 NADH 2 pueden producir hasta 30 ATP. Sin embargo, las dos mol éculas de NADH 2 provenientes de la glucólisis originan cada una dos o tres de ATP. Esto se debe
Universidad Católica los Ángeles de Chimbote - ULADECH 129

2. 3.

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

a que determinados tipos de células eucariotas deben invertir energía para desplazar el NADH 2 resultante de la glucólisis a través de la membrana mitocondrial. Las células procariotas carecen de mitocondrias, de modo que no necesitan transferir moléculas de NADH 2. Por este motivo, las bacterias son capaces de generar tres ATP por cada NADH, aún los producidos en la glucólisis. Así el número máximo de molécula s de ATP formadas con la energía del NADH es de 28 a 30. La oxidación de cada molécula de FADH 2 genera dos de ATP, de manera que las dos moléculas de FADH 2 producidas en el ciclo del ácido cítrico dan origen a cuatro de ATP. 4. Si se suman todas las moléculas de ATP producidas (dos en la glucólisis, dos en el ciclo del ácido cítrico y 32 a 34 en el transporte de electrones y la quimiosmósis), se puede apreciar que el metabolismo aerobio completo de una molécula de glucosa produce como máximo 36 a 38 de ATP . Nótese que la mayor parte del ATP se genera por fosforilación oxidativa, en la que participan la cadena de transporte de electrones y la quimiosmósis. Sólo cuatro ATP se forman por fosforilación a nivel de sustrato en la glucólisis y el ciclo del ácido cítrico.

La membrana mitocondrial interna es impermeable al NADH 2, que es una molécula grande. Por tanto, el NADH 2 producido por el citosol durante la glucólisis no puede difundirse al interior de las mitocondrias para transferir sus electrones a la cadena de transporte de electrones. A diferencia de ATP y ADP, el NADH 2 no tiene una proteína portadora que lo lleve de un lado a
Universidad Católica los Ángeles de Chimbote - ULADECH 130

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

otro de la membrana. En vez de ello, han aparecido por evo lución varios sistemas que transfieren a las mitocondrias los electrones del NADH 2, más no las moléculas del NAD . En las células de hígado, riñón y corazón, un sistema “LANZADERA” especial se encarga de transferir los electrones del NADH 2 a través de la membrana mitocondrial interna a una molécula de NAD + en la matriz. Estos electrones son transferidos a la cadena de transporte de electrones de la membrana mitocondrial interna, con producción de tres moléculas de ATP por cada par de electrones. En las células de músculo esquelético, encéfalo y otras opera un tipo distinto de lanzadera. En éste se requiere más energía que en el de hígado, riñón y corazón, de manera que los electrones están en un nivel de energía más bajo cuando entran en la cadena de trans porte de electrones. Los acepta la coenzima Q (ubiquinona), en vez del NAD +, de modo que se genera un máximo de dos moléculas de ATP por cada par de electrones. Por eso el número de moléculas de ATP que produce la respiración aerobia de una molécula de glu cosa en las células del músculo esquelético es de 36, no de 38. NOTA IMPORTANTE: Si bien la manera correcta de escribir la forma reducida del NAD + es NADH + H +, por sencillez dicha forma se expresa simplememte como NADH 2 en la presente separata.

La fermentación es un proceso catabólico de oxidación incompleto, siendo el producto final un compuesto orgánico. Estos productos finales son los que caracterizan los diversos tipos de fermentaciones. La fermentación típica es llevada a cabo por las levaduras. También algunos metazoos y plantas menores son capaces de producirla. El proceso de fermentación anaeróbica se produce en ausencia de oxígeno como aceptor final de los electrones del NADH producido en la glucó lisis (que funciona como proce so anaerobio). La necesidad de un aceptor final, para los electrones procedentes del NADH, distinto del oxígeno hace que se emplee un compuesto orgánico que se reducirá para poder reoxidar el NADH. El compuesto orgánico que se reduce (acetaldehído, piruvat o, etc.) es un derivado del sustrato que se ha oxidado anteriormente. En los seres vivos, la fermentación es un proceso anaeróbico y en él no interviene la cadena respiratoria. Son propias de los microorganismos, como las bacterias y levaduras. También se produce la fermentación en el tejido muscular de los animales, cuando el aporte de oxígeno a las células musculares no es suficiente para el metabolismo y la contracción muscular.
Reacción enzimática que produce ácido láctico anaeróbicamente a partir de ácido pirúvico en las células musculares.

Desde el punto de vista energético, las fermentaciones son muy poco rentables si se comparan con la respiración, ya que a partir de una molécula de glucosa, sólo se obtienen 2 moléculas de ATP, mientras que en la respiración se producen 38 moléculas de ATP a partir de una molécula
Universidad Católica los Ángeles de Chimbote - ULADECH 131

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

de glucosa. Esto se debe a la oxidación del NADH 2, que en lugar de penetrar en la cadena respiratoria, cede sus electrones a compuestos orgánicos con poco poder oxidante. En la industria la fermentación puede ser oxidativa, es decir, en presencia de oxígeno, pero es una oxidación aeróbica incompleta, como la producción de ácido acético a partir de etanol. Las fermentaciones pueden ser: naturales, cuando las condiciones ambientales permit en la interacción de los microorganismos y los sustratos orgánicos susceptibles; o artificiales, cuando el hombre propicia condiciones y el contacto referido.
Pasos por los cuales el ácido pirúvico, formado en la glucólisis, se convierte anaeróbicamente en etanol.

Usos: El beneficio primario de la fermentación es la conversión, ej. convertir el mosto en vino, cebada en cerveza y carbohidratos en dióxido de carbono para hacer pan. De acuerdo con Steinkraus (1995), la fermentación de los alimentos si rve a 5 propósitos generales: o Enriquecimiento de la dieta a través del desarrollo de una diversidad de sabores, aromas y texturas en los substratos de los alimentos. o Preservación de cantidades substanciales de alimentos a través de ácido lácteo, alcohólico, ácido acético y fermentaciones alcalinas. o Enriquecimiento de substratos alimenticios con proteína, amino ácidos, ácidos grasos esenciales y vitaminas. o Detoxificación durante el proceso de fermentación alimenticia. o Una disminución de los tiempos de co cinado y de los requerimientos de combustible. La fermentación tiene algunos usos exclusivos para los alimentos. Puede producir nutrientes importantes o eliminar antinutrientes. Los alimentos pueden preservarse por fermentación, la fermentación hace uso de energía de los alimentos y puede crear condiciones inadecuadas para organismos indeseables. Por ejemplo, avinagrando el ácido producido por la bacteria dominante, inhibe el crecimiento de todos los otros microorganismos. Dependiendo del tipo de fermentación, algunos productos (ej. alcohol de fusel) pueden ser dañinos para la salud. En alquimia, la fermentación es a menudo lo mismo que putrefacción, queriendo decir, permitir el pudrimiento o la descomposición natural de la sustancia.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 133

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 134

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La capacidad de reproducirse es una propiedad fundamental de la célula. Se puede tener una idea de la magnitud de la reproducción celular si se considera que un individuo adu lto está formado por billones de células (10 13 células), todas derivadas de una sola, el cigoto. La multiplicación celular sigue siendo notable aun en un ser adulto que ha dejado de crecer. Un ejemplo llamativo lo dan los eritrocitos, cuya vida media es de 120 días. Así, el organismo debe producir unos 2,5 millones de eritrocitos por segundo para mantener su número relativamente constante. Esta reproducción celular debe ser regulada de manera perfecta para que la formación de nuevas células compense las pér didas y se mantenga el equilibrio.

El ciclo celular

Se considera como una compleja serie de fenómenos del crecimiento y división celular, que culminan cuando el material celular se distribuye en las células hijas. Las células pasan p or este ciclo que comprende dos períodos fundamentales: la interfase y la división celular. Esta última tiene lugar por mitosis o por meiosis. Durante mucho tiempo se creyó que el período de “división” constituyó el punto de interés primordial, debido a que las “interfase” era considerada como una etapa de reposo, a pesar de ser el período de mayor actividad biosintética del ciclo celular (tanto en el núcleo como en el citoplasma). La mayor parte de las células pasa la parte más extensa de su vida en “inte rfase”, durante la cual duplican su tamaño y el contenido cromosómico. La división celular es sólo la fase final y microscópicamente visible de cambios previos ocurridos a nivel molecular. Así, antes que la célula se divida por mitosis, sus principales componentes ya se han duplicado. Por tal motivo la “división celular” se puede considerar como la separación final de las unidades moleculares y estructurales previamente duplicadas. El “CICLO CELULAR” se divide en cuatro períodos sucesivos: G1, S, G2 y M ( mitosis). G2 es el tiempo que transcurre entre el final de la síntesis de ADN y el comienzo de la mitosis. Se llegó a demostrar que la síntesis del ADN tiene lugar solamente en un tramo limitado de la interfase, denominado “periodo S” o sintético o de repl icación o duplicación, que es precedido por el
Universidad Católica los Ángeles de Chimbote - ULADECH 135

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

período G1 y seguido del periodo G2 (“gap” = intervalo). Durante G2 la célula contiene el doble (4n) de la cantidad de ADN presente en la célula diploide original (2n).

Cambios en el contenido de ADN durante las distintas fases Del ciclo de vida de una célula. 2n contenido diploide de ADN. 4N, contenidpo tetraploide de ADN.

La duración del ciclo celular varía mucho de un tipo celular a otro, pero término promedio la vida generacional es de 16 horas, l a fase G1 dura 5 horas; la fase S, 7 horas; la fase G2, 3 horas, y la M, 1 hora. Los períodos S, G2 y M son relativamente constantes en la mayoría de los tipos celulares. El más variable es el período G1, que puede durar días, meses o años. Las células que no se dividen (como las nerviosos o las del músculo esquelético) se hallan en el período G1, que en estos casos se denomina G0 por que las células se retiran del ciclo celular.

El ciclo celular con la duración de cada una de sus fases, en una célula que se divide cada 16 horas.

Etapas del ciclo celular: Interfase y división celular (fase M)
Universidad Católica los Ángeles de Chimbote - ULADECH 136

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En la fase G1, las moléculas y estructuras citoplasmáticas aumentan en número; en la fase S, los “cromosomas” se duplican; y en la fase G2, comienza la condensación de los cromosomas y el ensamblado de las estructuras especiales requeridas para la mitosis y la citocinesis. Durante la mitosis, los cromosomas duplicados son distribuidos entre los dos núcleo s hijos, y en la citocinesis, el citoplasma se divide, separando a la célula materna en dos células hijas. El “CICLO CELULAR” está finamente regulado. Esta regulación ocurre en distintos momentos y puede involucrar la interacción de diversos factores, entre ellos, la falta de nutrientes y los cambios en temperatura o en pH, pueden hacer que las células detengan su crecimiento y su división. En los organismos multicelulares, además, el contacto con otras células contiguas puede tener el mismo efecto. En cierto momento del ciclo celular, la célula “decide” si va a dividirse o no. Cuando las células normales cesan su crecimiento por diversos factores, se detienen en un punto tardío de la FASE G1, (el punto R (“restricción”), primer pun to de control del ciclo celular) . En algunos casos, antes de alcanzar el punto R, las células pasan de la fase G1 a un estado especial de reposo, llamado G0, en el cual pueden permanecer durante días, semanas o años. Una vez que las células sobrepasan el punto R, siguen necesariamente a través del re sto de las fases del ciclo, y luego se dividen. La FASE G1 se completa rápidamente y, en la FASE S, comienza la síntesis de ADN y de histonas. Existe otro mecanismo de control durante el proceso mismo de duplicación del material genético, en la FASE S, que asegura que la duplicación ocurra sólo una vez por ciclo. Luego, la célula entra en la fase G2 del ciclo. En G2, existe un segmento punto de control en el cual la célula “evalúa” si está preparada para entrar en mitosis. Este control actúa como un mecanis mo de seguridad que garantiza que solamente entren en mitosis aquellas células que hayan completado la duplicación de su material genético. El pasaje de la célula a través del punto R depende de la integración del conjunto de señales externas e internas qu e recibe. El sistema de control del ciclo celular está basado en dos proteínas clave, las ciclinas y las proteínas quinasas dependientes de ciclinas (Cdk), que responden a esta integración de señales.

Regulación del ciclo celular
Universidad Católica los Ángeles de Chimbote - ULADECH 137

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El número de veces que una célula se ha dividido anteriormente también influye en la división celular. Cuando mayor edad tiene el organismo de donde se toman las células, menor será el número de veces que las células se dividan en cultivo. A este fenómeno se lo denomina senescencia o envejecimiento celular. Esta restricción en el número de divisiones se correlaciona con el acortamiento progresivo de los extremos (los telómeros), a lo largo de los sucesivos ciclos celulares. Esto no ocurre en ciertos tipos c elulares, como en las células germinales o en algunas células de la sangre. En estas células, se encuentra activa una enzima llamada telomerasa que agrega continuamente ADN a los extremos de los cromosomas, evitando su acortamiento. Esta enzima también se encuentra activa en células cancerosas. Durante la FASE S ((de síntesis) se duplica el material cromosómico. Entre la división celular y la FASE S hay dos fases G (del inglés “gap” = intervalo). La primera de ellas (G!) es un período de crecimiento general y duplicación de las organelas citoplasmáticas. Durante la segunda (G”), comienza a ensamblarse las estructuras directamente asociadas con la mitosis y la citocinésis. Después de la FASE G2 ocurre la mitosis, que usualmente es seguida de inmediato por la citocinésis. En las células de diferentes especies o de diferentes tejidos dentro del mismo organismo, las diferentes fases ocupan distintas proporciones del ciclo celular completo. IMPORTANCIA La continuidad morfológica y estructural del ser vivo se garantiza mediante la reproducción celular. En los organismos unicelulares el incremento del número celular se relaciona con los procesos de reproducción de cada organismo, por lo tanto forma parte del ciclo vital de cada especie. Esto es posible observar en los procariotas (bacterias y cianofitas), protozoarios, algas unicelulares y levaduras. En los organismos pluricelulares, la reproducción de las células está implicada en el crecimiento corporal, la regeneración de los tejidos y la reproducción sexual. INTERFASE “NO DIVISIÓN CELULAR” Comprende los eventos del crecimiento y maduración de las células y su preparación para la división celular. Se divide en tres etapas denominadas perio dos: G1, S y G2. o La célula esta ocupada en la actividad metabólica pr eparándose para la mitosis. o Los cromosomas no se disciernen claramente en el núcleo, aunque una mancha oscura llamada nucleolo, puede ser visible.
Universidad Católica los Ángeles de Chimbote - ULADECH 138

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o Es el período comprendido entre divisiones celulares. Es la fase más larga del ciclo celular, ocupando casi el 95% del ciclo, trascurre entre dos mitosis y comprende tres etapas: Fase G1, S y G2. 1. Fase G1 (del inglés Growth 1): o Es la primera fase del ciclo celular en el que existe crecimiento celular con síntesis de los componentes citoplasmáticos en todos los n iveles; siendo los más importantes la síntesis de proteínas estructurales “citoesqueléticas”, enzimas y reguladores fisiológicos. Paralelamente se fabrican gran cantidad de lípidos, polisacáridos y complejos moleculares y también ARN). o Se incrementan los organelos, como consecuencia aumenta considerablemente el volumen celular llegando en algunos casos a duplicarse el tamaño inicial de las células. o Tiene una duración de entre 6 y 12 horas y durante este tiempo, la célula dobla su tamaño y masa debido a la continua síntesis de todos sus componentes como resultado de la expresión de los genes que codifican las proteínas responsables de su fenotipo particular. o Diferenciación celular (Go): se denomina así a la transformación que sufren las células cuando se encuentran en interfase, entrando en procesos de maduración. Las células diferenciadas pierden al menos temporalmente la capacidad de división, adquiriendo las características de células adultas propias de cada individuo. Son diferenciadas las células que constituyen los órganos y tejidos adultos de los vegetales y animales; tales como eritrocitos, leucocitos y neuronas. Incluso las células formadoras de gametos se encuentran parcialmente diferenciadas y orientadas para realizar una división especial: la meiosis. La diferenciación es estimulada por factores hormonales y las condiciones del medio. 2. Fase S (del inglés Synthesis): o Es la segunda fase del ciclo, la más importante dentro del ciclo celular, en la que se produce la duplicación (replicación o síntesi s) del ADN, como resultado cada cromosoma se duplica y queda formado por dos cromátidas idénticas . Con la duplicación del ADN, el núcleo contiene el doble de proteínas nucleares y de ADN que al principio; por lo cual el volumen nuclear se hace considerable mente más grande. Tiene una duración de unos 6 a 8 horas. 3. Fase G2 (del inglés Growth 2): o Es la tercera fase de crecimiento del ciclo celular en la que continúa la síntesis de proteínas y ARN. o Comprende desde el final de la duplicación de la cromatina ha sta el inicio de la división celular, esencialmente es un perio do de reordenamiento celular y control del material citoplasmático; aunque la síntesis de proteínas y otras moléculas no se detiene durante la interfase, la transcripción (síntesis de ARN) y tr aducción (síntesis de proteínas) se reduce durante el periodo S y se reactivan con mayor intensidad en el periodo G2. o Al final de este período se observa al microscopio cambios en la estructura celular, que indican el principio de la división celular. Tie ne una duración entre 3 y 4 horas. Termina cuando los cromosomas empiezan a condensarse al inicio de la mitosis. FASE M “DIVISIÓN CELULAR”
Universidad Católica los Ángeles de Chimbote - ULADECH 139

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En el ciclo celular el proceso de división es importante porque permite la repartición de los materiales celulares en las células resultantes, el origen de nuevas células hace posible la perpetuación de los organismos unicelulares y pluricelulares. En la división celular típica primero se realiza la división del núcleo (cariocinesis) y después la división del citoplasma (citocinesis), originando células hijas; la división del núcleo es paulatina e incluye fases, por ello se dice que es indirecta. Esta división indirecta es realizada por organismos eucariotas (animales y plantas, hongos, algas y protozoarios). Existen dos tipos básicos de división indirecta: la mitosis (en células somáticas) y la meiosis, ésta última es propia de células parcialmente diferenciadas y permite la formación de gametos. Por lo tanto, la división celular, es aquella en la que una célula prog enitora (células eucariotas, células somáticas: células comunes del cuerpo) se divide en dos células hijas idénticas. Esta fase incluye la mitosis, a su vez dividida en: profase, metafase, anafase, telofase; y la citocinesis, que se inicia ya en la telofas e mitótica. Si el ciclo completo durara 24 horas, la fase M duraría alrededor de media hora (30 minutos). LA CARIOCINESIS “DIVISIÓN DEL NÚCLEO” La cariocinesis (del griego cario = núcleo y cinesis = división) es la división del núcleo celular. Es el proceso por el cual el material genético de una célula madre se distribuye de manera idéntica entre dos células hijas. La mitosis (en células somáticas) y la meiosis.

La mitosis (del griego mitos, hebra) es un proceso de reparto equitativo del mater ial hereditario (ADN) característico de las células eucarióticas. Normalmente concluye con la formación de dos núcleos separados (cariocinesis) seguido de la partición del citoplasma (citocinesis), para formar dos células hijas. Una célula con núcleo diplo ide (2n) se divide originando dos células hijas diplodes (2n, cada célula). La mitosis completa, que produce células genéticamente idénticas, es el fundamento del crecimiento, de la reparación tisular y de la reproducción asexual. La meiosis, un proceso qu e comparte mecanismos con la mitosis pero que no debe confundirse con ella, produce células genéticamente distintas y, combinada con la fecundación, es el fundamento de la reproducción sexual.

Las etapas de la mitosis
Universidad Católica los Ángeles de Chimbote - ULADECH 140

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Importancia Permite en los protistas y hongos unicelulares el aumento de la población; mientras que en los pluricelulares se relaciona al crecimiento, a la reparación de tejidos y al desarrollo embrionario. La alteración de la mitosis, en la que se da una división descontrol ada, se denomina cáncer. Con fines didácticos y de investigación los biólogos celulares han dividido a la cariocinesis mitótica en cuatro fases consecutivas: profase, metafase, anafase y telofase. En algunos libros se considera una quinta fase la prometaf ase, pero nosotros la consideraremos dentro de la profase. 1. Profase o La cromatina en el núcleo comienza a condensarse y se vuelve visible en el microscopio óptico como cromosomas. o El nucleolo desaparece. Los centríolos comienzan a moverse a polos opuestos de la célula y las fibras se extienden desde los centrómeros. Algunas fibras cruzan la célula para formar el huso mitótico. o La membrana nuclear se disuelve, marcando el comienzo de la prometafase (considerada dentro de la profase) . Las proteínas de adhieren a los centrómeros creando los cinetócoros (placas proteicas localizadas en ambos la dos del centrómero). Los microtubulos se adhieren a los cinetócoros y lo s cromosomas comienzan a moverse. 2. Metafase o Fibras del huso alinean los cromosomas a lo largo del medio del núcleo celular. Esta línea es referida como, la placa ecuatorial o metafásica. Esta organización ayuda a asegurar que en la próxima fase, cuando los cromosomas se separan, cada nuevo núcleo recibirá una copia de cada cromosoma. 3. Anafase: o Los pares de cromosomas se separan en los cinetócoros y se mueven a lados opuestos de la célula. o El movimiento es el resultado de una combinación de: el movimiento del cinetocoro a lo largo de los microtubulos del huso y la interacción física de los microtubulos polares.
Universidad Católica los Ángeles de Chimbote - ULADECH 141

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

4. Telofase: o Los cromatidos llegan a los polos opuestos de la célula, y nuevas membrana s se forman alrededor de los núcleos hijos. Los cromosomas se dispersan y ya no son visibles bajo el microscopio óptico. o Las fibras del huso se dispersan, y la citocinesis o la partición de la célula puede comenzar también durante esta etapa . CITOCINESIS: Etapa culminante de la división celular que garantiza la distribución del citoplasma en células hijas. El proceso de división del volumen citoplasmático se inicia en la anafase y es perceptible durante la telofase, se lleva a cabo por mecanismos distintos en animales y vegetales. o En células animales, la citocinesis ocurre cuando un anillo fibroso compue sto de una proteína llamada actina, alrededor del centro de la célula se contrae pellizcando la célula en dos células hijas, cada una con su núcleo. o En células vegetales, la pared rígida requiere que un a placa celular sea sintetizada entre las dos células hijas. Durante la mitosis se mantiene una constant e cantidad de material genético de generación en generación celular. Consideremos un a célula hipotética diploide (2n) con un cromosoma. Consideremos también que la célula es Aa; esto es, es heterocigótica para un par de alelos con A que viene de un padre y con a que viene del otro. En la figura de abajo, note como empieza y termina con células que tienen el mismo genotipo.

Las etapas del proceso mitótico en donde se nota que las dos células que se originan tienen la misma carga corm osómica que la célula original.
Universidad Católica los Ángeles de Chimbote - ULADECH 142

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El proceso mitótico originan dos nuevas células idénticas a la que les dio origen, además el proceso se lleva a cabo en células somáticas y la carga cromosómica permanece constante.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Interfase – Mitosis – Citocinesis

EL CÁNCER En medicina, el término cáncer (palabra derivada del latín cancrus = cangrejo) o carcinoma (del griego karkinos = cangrejo y ma = cuerpo) es usado para identificar una afección clínica de carácter maligno que afecta a un paciente, y cuyas características son la alteración morfológica y funcional seguida de la proliferación descontrolada (no siempre acelerada) de las células de un tejido que invaden, desplazan y destruye n, localmente y a distancia, otros tejidos sanos del organismo. En otras palabras, cáncer es la palabra que se emplea para definir un grupo de
Universidad Católica los Ángeles de Chimbote - ULADECH 144

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

enfermedades con un denominador común: la transformación de la célula normal en otra que se comporta de manera muy peligrosa para el cuerpo humano. También suele ser utilizada la palabra neoplasia pero esta palabra, como la palabra tumor, puede significar a afecciones benignas. A partir de la concepción celular de Virchow ("toda célula proviene d e otra célula") se entiende que el cáncer es una patología celular. El cáncer es un proceso lógico y coordinado en el que una célula (o un grupo de ellas) sufre cambios y adquiere capacidades especiales diferentes de las células normales. De esta forma, la s células cancerosas no están sujetas a las restricciones usuales (normales) concernientes a la proliferación celular, impuestas por la biología tisular y corporal. Los efectos del cáncer (enfermedad cancerosa) conforman un conjunto de signos y síntomas de pronóstico y tratamiento diferentes, que depende de la localización anatómica en la que se encuentre y del tipo celular o histológico del que proceda.

Cuando las células normales se lesionan o envejecen, mueren por apoptosis, pero las células cancerosas evitan la apoptosis.

DEFINICIONES SEMEJANTES AL CÁNCER: o NEOPLASIA: El término neoplasia significa literalmente "tejido formado de nuevo". "Neoplasia" se aplica generalmente a los tumores malignos (proliferaciones de células con comportamiento maligno), ya que cuando se aplica a los tumores benignos suele especificarse el calificativo: "neoplasia benigna". Puede emplearse de manera genérica, donde significará "cualquier clase de tumor" (siempre en el sentido de proliferación celular) e incluso es correcto referirse a una neoplasia benigna empleando simplemente el término "neoplasia". Cualquier proliferación de células, con el tiempo tiende a aumentar su volumen, a ocupar un espacio y a generar un abultamiento en una estructura del cu erpo. Este abultamiento puede ser benigno o maligno; eso depende de la naturaleza y comportamiento de las células proliferantes; tales características sólo pueden ser definidas por un estudio histopatológico adecuado (en general, una biopsia). La s enfermedades o lesiones que tienen el sufijo -oma indican neoplasia, como por ejemplo adenoma, osteosarcoma, leiomioma, lipoma, melanoma, etc. Existen, por tanto, dos tipos de neoplasias, que son las benignas o tumores benignos y las malignas o cáncer.
Universidad Católica los Ángeles de Chimbote - ULADECH 145

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o TUMOR: Inicialmente, este término se aplicó a la tumef acción, hinchazón, "bulto" o aumento de tamaño de un órgano o tejido con la inflamación. Con el transcurso del tiempo se olvidó el sentido no neoplásico de tumor y en la actualidad el término tumor es el equivalente o sinónimo de neoplasia; al igual que ellas, también hay tumores benignos y tumores malignos. o CÁNCER: Esta palabra deriva del latín, y como la derivada del griego carcinoma, significa 'cangrejo'. Se dice que las formas corrientes de cáncer avanzado ad optan una forma abigarrada, con ramificaciones, que se adhiere a todo lo que agarra, con la obstinación y forma similar a la de un cangrejo marino, y de ahí deriva su nombre. Se considera a veces sinónimo de los términos 'neoplasia' y 'tumor'; sin embargo, el cáncer siempre es una neoplasia o tumor maligno. o ONCOLOGÍA: Del griego "onkos", tumor, es la parte de la medicina que estudia los tumores o neoplasias, sobre todo malignos (cáncer) . NOMENCLATURA DEL CÁNCER Todos los tumores, benignos y malignos, tie nen dos componentes básicos en su estructura: 1. Las células neoplásicas proliferantes que constituyen el parénquima. 2. Su estroma de sostén, constituido por tejido conectivo y vasos sanguíneos. La nomenclatura oncológica se basa en el componente parenquimat oso. Según el comportamiento de los tumores: 1. TUMORES BENIGNOS: Su nombre acaba en el sufijo -oma; simplemente, y según el origen del tejido del que procedan los tumores benignos, pueden ser: fibroma (tejido conjuntivo fibroso), mixoma (tejido conjuntivo laxo), lipoma (tejido adiposo), condroma (tejido cartilaginoso), osteoma (tejido óseo), hemangioma o angioma (tejido vascular), linfangioma (tejido linfático), meningioma (meninges), tumor glómico (tejido nervioso de sostén), leiomioma (tejido muscular lis o), rabdomioma (tejido muscular estriado), papiloma (tejido epitelial formando papilas), adenoma (tejido glandular), teratoma (células totipotenciales), nevus (melanocitos). Algunos de los tumores benignos derivados de tejido epitelial terminan con el sufi jo "adenoma", si bien tenemos que tener en cuenta que existen múltiples excepciones a las normas de nomenclatura tumoral. Por ejemplo: El cáncer benigno de melanocitos se denomina Nevus, y su forma maligna, Melanoma. 2. TUMORES MALIGNOS O CÁNCER: Los cánceres que derivan de los tejidos mensenquimatosos o mesodermo se denominan sarcomas (del griego sarcos, "carnoso"); por ejemplo: fibrosarcoma, mixosarcoma, liposarcoma, condrosarcoma, osteosarcoma, angiosarcoma, lifangiosarcoma, sinoviosarcoma, mesotelioma (ca vidad pleural, pericárdica o abdominal), leiomiosarcoma, rabdomiosarcoma. Las neoplasias malignas de origen epitelial, derivadas de cualquiera de las tres capas germinales del embrión, se denominan carcinomas; por ejemplo: carcinoma epidermoide o escamoso, carcinoma basocelular, adenocarcinoma, cistoadenocarcinoma, coriocarcinoma. Los tumores que proceden del tejido nervioso son los gliomas (realmente no se trata de un tumor derivado de células nerviosas, sino de uno de los tipos celulares encargados de su sostén, las células gliales, el tejido "conectivo" del cerebro, por así decir).
Universidad Católica los Ángeles de Chimbote - ULADECH 146

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los cánceres hematológicos son los linfomas y las leucemias, siempre malignos (derivados del tejido linfoide y el mieloide respectivamente). Los tumores malignos que no cum plen las reglas anteriores y acaban en -oma, son: el melanoma, el hepatoma, el seminoma. Es el crecimiento descontrolado de las células en el cuerpo.

DEFINICIÓN La meiosis es un mecanismo de división celular que permite la obtención a partir de células diploides (2n) de células haploides (n) con diferentes combinaciones de genes. OBJETIVOS DE LA MEIOSIS La meiosis no es un tipo de división celular diferente de la mitosis o una alternativa a ésta. La meiosis tiene objetivos diferentes. Uno de es tos objetivos es la reducción del número de cromosomas. Otro de sus objetivos es el de establecer reestructuraciones en los cromosomas homólogos mediante intercambios de material genético. Por lo tanto, la meiosis no es una simple división celular. La meiosis está directamente relacionada con la sexualidad y tiene, como veremos más adelante, un profundo sentido para la supervivencia y evolución de las especies. IMPORTANCIA La meiosis permite el aumento de la variabilidad en los organismos, por ejemplo en el caso de los animales permite la formación de células haploid es y variables, que luego madura n para originar gametos. En conclusión, la meiosis es la base de la rep roducción sexual, y con ello tiene trascendencia en el proceso de evolución biológica de la mayoría de seres eucariontes (con núcleo celular). La meiosis incluye dos divisiones sucesivas de una célula e ucariótica diploide (2n), de organismos de reproducción sexual, dando como resul tado cuatro células haploides (n) hijas, cada una con la mitad del material de la célula original, llevándose a cabo el entrecruzamiento (que producirá variación genética).

Primera división meiótica (meiosis I) y segunda división meiótica (meiosis II)

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La meiosis ocurre en las células diploi des. Los cromosomas se duplican y a través de sucesivas divisiones, se producen cuatro células haploides, cada una de las cuales tiene la mitad del número de cromosomas que las células "padre". La meiosis se lleva a cabo solamente en organismos con reprodu cción sexual. Dependiendo del organismo, se pueden producir gametos haploides (n), que se fusionan para producir cigotos diploides; también pude producir esporas haploides, las que por división mitótica de las células, pueden producir organismos unicelulares o pluricelulares. En animales, donde las células somáticas (las del cuerpo) son diploides (2n), los productos de la meiosis son los gametos. En muchos hongos y algunas algas, la meiosis se efectúa inmediatamente después de que dos células haploides se fusionan y la mitosis produce un organismo multicelular (ejemplo: los hongos filamentosos, algas) u organismos haploides unicelulares (ejemplo: levaduras y algas unicelulares). Las plantas y algunas algas tienen etapas multicelulares haploides y diploides. La etapa multicelular es el esporofito. La meiosis en el esporofito produce esporas haploides. Esas esporas son capaces de generar una etapa multicelular haploide llamada gametofito. El gametofito produce gametos por ciclos celulares mitóticos. La meiosis consiste en dos divisiones nucleares sucesivas, la meiosis I (reduccional) y la meiosis II (ecuacional). Cada división tiene las siguientes etapas: profase, metafase, anafase y telofase.

Primera división meiótica (meiosis I) y s egunda división meiótica (meiosis II)

INTERFASE PREMEIÓTICA Antes de iniciarse la meiosis, todos los cromosomas se duplican en un proceso similar a la duplicación de cromosomas al inicio de la mitosis. Fuera del núcleo de las células animales, hay dos centrosomas, cada uno conteniendo un par de centriolos. Los dos centrosomas son producidos por la duplicación de un c entrosoma durante la interfase p remeiótica. Los centrosomas funcionan como centros de organización de microtúbulos. Los microtúbulos se extienden radialmente de los centrosomas formando un áster. Las células de las plantas no tienen centrosomas. Diferentes clases de centros de organización de microtúbulos, funcionan como sitios de formación de los husos.
Universidad Católica los Ángeles de Chimbote - ULADECH 148

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los cromosomas se duplican antes de la meiosis.

MEIOSIS I (DIVISIÓN REDUCCIONAL) PROFASE I Los cromosomas se hacen visibles, se lleva a cabo el entrecruzamiento, el nucléolo desaparece, se forma el huso meiótico y la membrana nuclear desaparece.

Al inicio de la profase I, los cromosomas se han duplicado. Durante la profase I, se hacen más pequeños, cortos, y enrollados y son visibles al microscopio. Los cromosomas homólogos duplicados se aparean y el entrecruzamiento (el intercambio de partes de cromosomas) se lleva a cabo. El entrecruzamiento es un proceso fundamental para la recombinación genética. Cada par de cromosomas homólogos es visible como una tétrada, que es un agrupamiento de dos cromosomas. Lo sitios de entrecruzamiento es donde se juntan cromáti das de diferentes cromosomas y el lugar de cruce se conoce como quiasma. El nucléolo desaparece durante la profase I. En el citoplasma, el huso meiótico, consistente de microtúbulos y otras proteínas, se forma entre los dos pares de centriolos, cuando est os migran a los polos opuestos de la célula. La membrana nuclear desaparece y al final de la profase I permite al huso entrar al núcleo. La profase I es la fase más larga de la meiosis, ocupando el 90% del tiempo de las dos divisiones. Dada su duración y complejidad se subdivide en seis etapas: preleptonema, leptonema, cigonema, paquinema, diplot¡nema y diacinesis. o Preleptonema (Preleptoteno) En esta etapa los cromosomas son muy difíciles de observar. o Leptonema (leptoteno)

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los cromosomas aparecen como largos filamentos que de trecho en trecho presentan unos gránulos: los cromómeros. Cada cromosoma ya está constituido por dos cromátidas, pero aún no se observan bien diferenciadas al microscopio óptico, y se encuentran unidos en diversos puntos a la envoltura nuclear. o Cigonema (zigoteno) En esta etapa los cromosomas homólogos se aparean punto por punto en toda su longitud. Este apareamiento puede comenzar bien por el centro o por los extremos y continuar a todo lo largo. Cuando los homólogos se aparean c ada gen queda yuxtapuesto con su homólogo. o Paquinema (paquiteno) Los pares de cromosomas homólogos aparecen íntimamente unidos: bivalentes. Se puede ya observar que cada cromosoma tiene sus dos cromátidas. Mientras están estrechamente unidos tienen lugar roturas entre cromátidas próximas de cromosomas homólogos que intercambian material cromosómico. Este intercambio se llama entrecruzamiento o sobrecruzamiento (crossing-over) y supone una redistribución cromosómica del material genético. Aunque los sobrecruzamientos se producen en esta fase no aún visibles y se apreciarán más tarde en forma de quiasmas.

o Diplonema (diploteno) Los bivalentes inician su separación, aunque se mantienen unidos por los puntos donde tuvo lugar el sobrecruzamiento, estas uniones reciben ahora el nombre de quiasmas y permiten ver los puntos en los que hubo sobrecruzamientos. En cada par de cromosomas homólogos pueden persistir uno o varios quiasmas, todo depende de cuántos sobrecruzamientos hayan tenido lugar a lo largo del bivalente. o Diacinesis Las cromátidas aparecen muy condensadas preparándose para la metafase I. La separación entre bivalentes persiste y permanecen los quiasmas. Al final de la profase la envoltura nuclear ha desaparecido totalmente y ya se ha formado el huso acromático.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Meiosis i: profase i leptonema y paquinema y Meiosis II

METAFASE I Los centriolos se van a los polos opuestos de la célula. Los pares de cromosomas homólogos, es tán ahora fuertemente condensados y enrollados, se empiezan a acomodar en un plano equidistante de los polos y se denomina la placa de la metafase. Las fibras del huso que van de un polo a otro de la célula se unen a un cromosoma de cada par.

ANAFASE I La anafase I empieza cuando los cromosomas de cada tétrada se separan, y empiezan a moverse a los polos de la célula, como resultado de la acción del huso. En la anafase I las cromátidas permanecen unidas a sus centrómeros y se mueven hacia los polos. Una diferencia clave entre mitosis y meiosis, es que las cromátidas permanecen juntas en la metafase de la meiosis I, mientras que en la mitosis se separan.
Universidad Católica los Ángeles de Chimbote - ULADECH 151

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

TELOFASE I Los pares de cromosomas homólogos completan su migración a los dos polos, como result ado de la acción del huso. La membrana nuclear se vuelve a formar alrededor de cada juego de cromosomas, el huso desaparece y la citoquinésis continúa. en las células animales, la citoquinésis implica la formación de un surco que corta a la célula en dos células. Después de la citoquinésis, cada una de las células hijas tiene un núcleo con cromosomas recombinados diploides. Muchas células que tienen meiosis rápidas, no descondensan sus cromosomas al final de la telofase I. INTERCINESIS Luego de la división citoplasmática, las células hijas formadas aumentan el volumen y duplican los centriolos. A este periodo se le denomina intercinesis, porque está comprendida entre ambas divisiones (meiosis I y meiosis II). MEIOSIS II (DIVISIÓN ECUACIONAL) La meiosis II empieza sin ninguna replicación de cromosomas. PROFASE II Mientras hay duplicación de cromosomas en la meiosis I, en la meiosis II no sucede esto. Los centríolos se duplican. Esto sucede por separación de los dos miembros de un par. Los dos pares de centríolos se separan en dos centrosomas. La membrana nuclear desaparece y el huso se forma. En la profase II, la membrana nuclear desaparece y se forma el huso meiótico METAFASE II Cada una de las células hijas completa la fo rmación del huso meiótico Cada cromosoma se alinea en la placa ecuatorial de la metafase, tal como sucede en la mitosis. Por cada cromosoma, los microtúbulos cinetocóricos de las cromátidas hermanas las jalan hacia los polos opuestos.
Los cromosomas se acomodan en la placa ecuatorial de la metafase, parecido a como sucede en la mitosis. Están unidos al ya completamente formado huso meiótico. Universidad Católica los Ángeles de Chimbote - ULADECH 152

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

ANAFASE II Los centrómeros se separan, y las dos cromátidas de cada cromosoma se mueven hacia los polos opuestos en el huso. Las cromátidas separadas, ahora pueden llamarse cromosomas por propio derecho.
Los centrómeros se separan y las cromátidas hijas -ahora cromosomas individuales- se mueven hacia los polos opuestos de la célula.

TELOFASE II La membrana nuclear se forma alrededor de cada juego de cromosomas. La citoquinésis (citocinesis) tiene lugar, produciendo cuatro células hijas (gametos en animales), cada una con un juego haploíde de cromosomas. Debido al entrecruzamiento, algunos cromosomas tienen segmentos recombinados de los cromosomas progenitores originales.
Una membrana nuclear se forma alrededor de cada juego de cromosomas y la citoquinésis se lleva a cabo, produciendo cuatro células hijas, cada una con un juego haploíde de cromosomas.

Primera división meiótica (meiosis I) y segunda división meiótica (meiosis II)
Universidad Católica los Ángeles de Chimbote - ULADECH 153

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La reproducción sexual se caracteriza por dos hechos: la fecundación y la meiosis. Una vez finalizada la meiosis, las células resultantes tienen una sola dotación cromosómica, el número haploide de cromosomas (n). Después de la fecundación, el cigoto tiene una dotación cromosómica doble, o sea, el número diploide (2n).

El proceso meiótico

La meiosis, un tipo especial de división nuclear. Consiste en dos divisiones nucleares sucesivas, designadas convencionalmente meiosis I y meiosis II. Durante este proceso de división se redistribuyen los cromosomas y se producen células que tienen un número haploide de cromosomas (n). Debido al fenómeno del entrecruzamiento y al de segregación al azar de los cromosomas, durante la meiosis se recombina el material genético de los progenitores, lo que no ocurre en la mitosis.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Comparación de la mitosis y la meiosis. En estos ejemplos, cada célula diploide tiene seis cromosomas (2n = 6). Las características comunes a ambos procesos están escritas sobre fondo naranja; las características de la mitosis en rosa y las prop ias de la meiosis en amarillo.

MEIOSIS Y CICLO VITAL Los gametos (óvulos y espermatozoides) son producidos por meiosis. En la fecundación, los gametos haploides se fusionan, restableciéndose, en el cigoto, el número diploide. El cigoto dará lugar a un hombre o a una mujer que, cuando maduren, nuevamente producirán gametos haploides. Como en el caso de la mayoría del resto de los animales, las células son diploides durante casi todo el ciclo de vida; la única excepción son los gametos.
Universidad Católica los Ángeles de Chimbote - ULADECH 155

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En la especie humana, a partir de cada espermatocito primario diploide se forman, en el hombre, cuatro espermátidas haploides, que se diferencian en cuatro espermatozoides. En la mujer, en cambio, a partir de cada ovocito primario diploide, el citoplasma se divide desigualmente y se produce un solo óvulo haploide; los núcleos haploides restantes forman los cuerpos o corpúsculos polares que se desintegran.

El ciclo vital de Homo sapiens

La reproducción sexual se caracteriza por la fusión de dos células sexuales haploides para formar un cigoto diploide, por lo que se deduce, en un ciclo vital sexual, debe ocurrir la meiosis antes de que los gametos puedan reproducirse. En animales y otros pocos organismos la meiosis precede de mane ra inmediata a la formación de gametos. Las células del cuerpo somáticas de un organismo individual se multiplican por mitosis y son dipliodes; las únicas células haploides son los gametos. Estos se forman cuando algunas células de la línea germinativa exp erimentan la meiosis. La formación de gametos recibe el nombre de gametogenesis. La gametogenesis masculina denominada espermatogénesis da por resultado la formación de cuatro espermatozoides haploides por cada célula que entra en la meiosis. En contraste, la gametogenesis femenina llamada ovogénesis genera un solo ovulo por cada celular que entra en la meiosis, esto se realiza por un proceso que asigna virtualmente todo el citoplasma a uno solo de dos núcleos en cada división meiótica. Al final de la prime ra división meiótica se retiene un núcleo; el otro, llamado primer cuerpo polar, se excluye de la célula y por ultimo degenera. De modo general, al final de la segunda división un núcleo se convierte en el segundo cuerpo polar y el otro núcleo sobrevive.
Universidad Católica los Ángeles de Chimbote - ULADECH 156

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

De esta forma, un núcleo haploide pasa a ser el receptor de la mayor parte del citoplasma y los nutrimentos acumulados de la célula meiótica original. Sin embargo, aunque la meiosis se realiza en algún punto de los ciclos vitales sexuales, no siempre precede directamente a la formación de gametos. Muchos eucariontes sencillos (incluso algunos hongos y algas) permanecen haploide (sus células se dividen por mitosis) la mayor parte de su vida, y los individuos pueden ser unicelulares o pluricelulares. Dos gametos haploide (producidos por mitosis) se fusionan para formar un cigoto diploide, el cual experimenta la meiosis para volver al estado haploide. Los ciclos vitales más complejos se encuentran en vegetales y algunas algas. Estos ciclos vitales, que se caracterizan por alternancia de generaciones, consisten en una etapa diploide multicelular, denominada generación esporófita, y una etapa haploide multicelular, a la que se llama generación gametófita. Las células esporofitas dipliodes experimentan la meios is para formar esporas haploide, cada una de las cuales se divide en forma mitótica para producir un gametofito haploide multicelular. Los gametofitos producen gametos por mitosis. Los gametos femeninos y masculinos (óvulo y espermatozoides) se fusionan enton ces para formar un cigoto diploide, el cual se divide de manera mitótica para producir un esporofito diploide multicelular. VARIABILIDAD GENÉTICA El proceso de meiosis presenta una vital importancia en los ciclos vitales ya que hay una reducción del número de cromosomas a la mitad, es decir, de una célula diploide (ej: 46 cromosomas en el ser humano) se forman células haploides (23 cromosomas). Esta reducción a la mitad permite que en la fecundación se mantenga el número de cromosomas de la especie. También hay una recombinación de información genética, que es heredada del padre y la madre; el apareamiento de los homólogos y consecuente crossing -over permite el intercambio de información genética. Por lo tanto el nuevo individuo h ereda información genética única y nueva, y no un cromosoma íntegro de uno de sus parientes. Otra característica importante en la significación de la meiosis para la reproducción sexual, es la segregación al azar de cromosomas maternos y paternos. La separación de los cromosomas paternos y maternos recombinados, durante la anafase I y II, se realiza completamente al azar, hecho que contribuye al aumento de la diversidad genética. En la anafase I, por cada par de homólogos existen dos posibilidades: un cromosoma puede ir a un polo mitótico o al otro. El número de combinaciones posibles por tanto se calcula 2n donde n es el número de pares de cromosomas homólogos (variaciones con repetición de n elementos en grupos de 2). En el ser humano, que tiene 23 pares de cromosomas homólogos, tiene la posibilidad de recombinación con 223 = 8 388 608 combinaciones, sin tener en cuenta las múltiples combinaciones posibilitadas por la recombinación en el crossing -over. ANOMALIAS CROMOSÓMICAS En la meiosis debe ocurrir una correcta separación de las cromatidas hacia los polos durante la anafase, lo que se conoce como disyunción meiotica, cuando esto no ocurre o hay un retraso en la primera o segunda división meiotica, conlleva problemas en la configuración de los cromosomas, alterando el numero c orrecto de estos, es decir, dejan de ser múltiplos básicos del numero haploide original de la especie, lo que se conoce como aneuploidía. Entre los problemas en el material genético encontramos: o Nulisomía en la que faltan un par de cromosomas homólogos (2 n - 2 cromosomas). o Monosomía (2n - 1 cromosoma).
Universidad Católica los Ángeles de Chimbote - ULADECH 157

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o Trisomía (2n + 1 cromosoma). En los animales sólo son viables monosomías y trisomías. Los individuos nulisómicos no suelen manifestarse, puesto que es una condición letal en diploides. MONOSOMÍA o Monosomía autosomática: produce la muerte en el útero. o Sindrome de turner: solamen te un cromosoma X presente en las mujeres. Los afectados son hembras estériles, de estatura baja y un repliegue membranoso entre el cuello y los hombros. Poseen el pecho con forma de escudo y pezones muy separados, así como ovarios rudimentarios y manchas marrones en las piernas. TRISOMÍA o Síndrome de Down - Trisomía del cromosoma 21: es la aneuploidía más viable, con un 0,15% de individuos en la población. Es una trisomía del cro mosoma 21, que incluye retraso mental (C.I de 20 - 50), cara ancha y achatada, estatura pequeña, ojos con pliegue apicántico y lengua grande y arrugada. o Síndrome de Patau - Trisomía del cromosoma 13: es una enfermedad genética que resulta de la presencia de un cromosoma 13 suplementario. Se trata de la trisomía menos frecuente. Se suele asociar con un problema meiótico materno, más que paterno y como el síndrome de Down, el riesgo aumenta con la edad de la mujer. Los afectados mueren poco tiempo después de nacer, la mayoría a los 3 meses, como mucho llegan al año. Se cree que entre el 80-90% de los fetos con el síndrome no llegan a término. o Síndrome de Edwards - Trisomía del cromosoma 18: se trata de una enfermedad rara, cromosómica caracterizada por la p resencia de un cromosoma adicional en el par 18. Clínicamente se caracteriza por: bajo peso al nacer, talla corta, retraso mental, y del desarrollo psicomotor (coordinación de la actividad muscular y mental), e hipertonía (tono anormalmente elevado del mús culo). Se acompaña de diversas anomalías viscerales. o Síndrome de Klinefelter - Un cromosoma de X adicional en varones: produce individuos altos, con físico ligeramente feminizado, coeficiente intelectual algo reducido, disposición femenina del vello del p ubis, atrofia testicular y desarrollo mamario. Tenemos una mezcla de ambos sexos. o Síndrome de XYY - Un cromosoma de Y adicional en varones: en esta anaploidia, el varón afectado recibe un cromosoma Y adicional. No presenta diferencias a las personas normales y de hecho se duda del término “síndrome” para esta condición. o Síndrome Triple X - Un cromosoma de X adicional en hembras: está caracterizada por un cromosoma X adicional en la mujer; quienes presentan la condición no están en ningún riesgo creciente para los problemas médicos. Las mujeres con esta condición son altas, de bajo peso, con irregularidad en el periodo menstrual y rara vez presentan debilidad mental.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 159

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


El experimento de Frederick Griffith

En 1928, el microbiólogo Fred erick Griffith, que investigaba varias cepas de pneumococcus, inyectó ratones con la cepa S y la cepa R de la bacteria. La cepa S era dañina, mientras que la rugosa (R), no lo era. Cuando, inactiva por calor, la cepa S era inyectada, no había secuelas y
Universidad Católica los Ángeles de Chimbote - ULADECH 160

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

el ratón vivía. Sorprendentemente, al combinar cepa R (no letal), con cepa S inactivada por calor (no letal), el ratón murió. Además, Griffith e ncontró células de cepa S vivas. En apariencia la cepa R se convirtió en cepa S. Este hallazgo no se pudo explicar, hasta que en 1944 Avery, Mc Leod, y Mc Carty, cultivaron cepa S y: 1. Produjeron extracto de lisado de células (extracto libre de células). 2. Luego que los lípidos, proteínas y polisacaridos se removieron, el estreptococo aun conservó su capacidad de replicar su ADN e introducirlo en neumococo R. La inactivación por calor de Griffith habría dejado intacto el ADN de los cromosomas de las bacterias, que era el causante de la formación del gen S, y podía ser liberado por las células destruidas e implantarse en cultivos sucesivos de cepa R. ¿En qué consistió su experimento? En el año 1928 Frederick Griffith investigando una enfermedad infecciosa m ortal la neumonía, estudió las diferencias entre una cepa de la bacteria Streptococcus peumoniae que producía la enfermedad y otra que no la causaba. La cepa que causaba la enfermedad estaba rodeada de una cápsula (también se la conoce como cepa S, del ing les smooth, o sea lisa, que es el aspecto de la colonia en las placas de Petri). La otra cepa (la R, de rugosa, que es el aspecto de la colonia en la placa de Petri) no tiene cápsula y no causa neumonía. Griffith inyectó las diferentes cepas de la bacteria en ratones. La cepa S mataba a los ratones mientras que la cepa R no lo hacía. Luego comprobó que la cepa S, muerta por calentamiento, no causaba neumonía cuando se la inyectaba. Sin embargo cuando combinaba la cepa S muerta por calentamiento, con la cepa R viva, es decir con componentes individuales que no mata a los ratones e inyectaba la mezcla a los ratones, los ratones contraían la neumonía y morían; en la sangre de estos ratones muertos Griffith encontró neumococos vivos de la cepa S. Es decir que en las bacterias S muertas había “algo” capaz de transformar a las bacterias R, antes inocuas, en patógenas y este cambio era permanente y heredable. Este "algo" fue aislad o; luego se encontró que era ADN Las bacterias que se aislaban de los ratones muertos poseían cápsula y, cuando se las inyectaba, mataban otros ratones. Frederick Griffith fue capaz de inducir la transformación de una cepa no patogénica Streptococcus pneumoniae en patogénica. Griffith postuló la existencia de un factor de transformación com o responsable de este fenómeno.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El problema que quería investigar con su experimento Frederick Griffith estaba interesado en la virulencia (capacidad de infectar y producir enfermedad) de las bacterias causantes de la neumonía, llamadas Pneumonococcus. Por este experimento se pudo alcanzar a llegar a la conclusión de la existencia del ADN. ¿Por qué utilizó células muertas? Porque necesitaba comprobar que era lo que ocurría si éstas se ponían en contacto con células vivas, trato de probar si volvían a ser peligrosas para el organismo de las ratas. ¿Qué transformación experimentan las cepas al estar en contacto con células muertas? Estas cepas se infectaron con la enfermedad y causaron la muerte de las ratas a las cual se les inyectó.

Conclusiones Con el experimento de Griffith se pudo concluir que el ADN de las bacterias inactivadas (muertas) con temperatura, había sido en insustancial, ya que éste era el causante de la formación del gen S (viruela), y podía ser liberado por las células destruidas e implantarse en cultivos sucesivos de cepa R (cepas sanas), es decir, demostró con sus experimentos que el ADN era necesario para adquirir la virulencia.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Los datos de Griffith acerca de esta transformación rápidamente fueron confirmados por varios laboratorios en todo el mundo, incluyendo el de Oswald Avery, inmunólogo en el Rockefeller Institute. Al principio, Avery dudó que una sustancia l iberada por una célula muerta pudiera alterar el aspecto de la célula viva, pero se convenció cuando Martín Dawson, su joven ayudante, confirmó los mismos resultados en su laboratorio. El siguiente paso lo dio J. Lionel Alloway, otro miembro del laborator io de Avery, quien pudo solubilizar el agente transformador. El extracto soluble así filtrado mostró la misma capacidad transformadora que las células originalmente muertas por calor. En los siguientes diez años, Avery y sus colegas enfocaron su atención e n purificar la sustancia causante de la transformación y en determinar su identidad. Tan sorprendente puede parecer ahora, en aquel tiempo ningún otro laboratorio del mundo se dedicó a identificar el “principio transformador”, como lo llamó Avery. Los avan ces en este problema fueron lentos. Con el tiempo, Avery y sus colaboradores, Colin MacLeod y Maclyn McCarty, lograron aislar una sustancia activa del extracto soluble capaz de causar la transformación de apenas una parte en 600 millones. Todas las pruebas sugerían que la sustancia activa era ADN: 1. - mostraba muchas de las propiedades químicas características del ADN; 2. - ningún otro tipo de material detectarse en la preparación, y 3.- los ensayos con diferentes enzimas mostraron que sólo aquellas capaces de digerir ADN podían inactivar el principio transformador. El trabajo publicado en 1944 fue escrito con escrupulosa cautela, sin conclusiones espectaculares afirmando que los genes estaban constituidos por ADN y no por proteínas. Algunos biólogos estaban convencidos que las preparaciones de Avery debían estar contaminadas con cantidades mínimas de proteínas y que ese contaminante, no el ADN, era el agente transformador activo. Otros se preguntaban si estudios acerca de bacterias publicados en una revista médica podían tener relevancia alguna en el campo de la genética y consideraban el fenómeno de la transformación como una peculiaridad de las bacterias. En los años siguientes a la publicación del trabajo de Avery hubo cambios importantes en la genética, se reconoció la existencia de cromosomas bacterianos y algunos prominentes genetistas volvieron su atención a esos procariotes. Estos científicos estaban convencidos de que el conocimiento logrado por el estudio de organismos celulares muy simples arrojarí a luz sobre los mecanismos que operan en plantas y animales complejos.

Dos características bien definidas que saltan a la vista de inmediato en el modelo de Watson y Crack hicieron más evidente el hecho de que el ADN es el material genético. Se sabe que el ADN puede contener información codificada en su secuencia de bases. El modelo también sigiere una forma en que esa información puede ser copiada de manera precisa, proceso conocido como “DUPLICACIÓN” (O REPLICACIÓN) del ADN. La importancia del mecanismo de duplicación era conocida para Watson y Crack, quienes en un clásico y ahora famoso ejemplo de exposición escueta al final de su primer artículo, escribieron: “NO HA ESCAPADO A NUESTRA ATENCIÓN EL HECHO DE QUE EL APARE AMIENTO ESPECÍFICO DE BASES QUE HEMOS POSTULADO SUGIERE DE INMEDIATO UN POSIBLE MECANISMO DE COPIADO PARA EL MATERIAL GENÉTICO”.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Estructura del ADN
Universidad Católica los Ángeles de Chimbote - ULADECH 165

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El modelo sugería que, como los nucleótidos se aparean entre sí de manera complementaria , cada molécula de la cadena del ADN podría servir de plantilla o patrón para la síntesis de la cadena opuesta. Sólo sería necesario que lo s enlaces de hidrógeno entre las dos cadenas se rompieran y que las dos cadenas se separaran. Cada semihélice (cada cadena) podría entonces aparecer como nucleótidos complementarios para restituir al compañero faltante. El resultado serían dos dobles hélic es de ADN, cada una idéntica a la original y consistente en una cadena original de la cadena progenitora y una cadena complementaria recién sintetizada. Este tipo de copiado de información se conoce como mecanismo de “DUPLICACIÓN SEMICONSERVADORA”. Si bien el mecanismo de duplicación semiconservadora propuesto por Watson y crack era (y sigue siendo) un modelo sencillo y atractivo, se requerían pruebas experimentales para establecer que en efecto el ADN se duplica de esa manera. Primero era necesario descar tar otras posibilidades. Por ejemplo, con un mecanismo de DUPLICACION CONSERVADORA, ambas cadenas progenitoras (“antiguas”) permanecían juntas, y las cadenas recién sintetizadas, formarían una segunda doble hélice. En una tercera alternativa, las cadenas originales y recién sintetizadas podrían mezclarse al azar durante el proceso de duplicación; esta posibilidad recibió el nombre de DUPLICACIÓN DISPERSA.

Teorías que trataban de explicar la replicación de ADN

Para discriminar entre el mecanismo de duplicación semiconservadora y las otras posibilidades, era necesario distinguir entre las cadenas originales y las recién sintetizadas del ácido desoxirribonucleico (ADN). Un modo de lograr esto es con el empleo de un isótopo pesado del n itrógeno, el nitrógeno 15 con símbolo N 15 (el nitrógeno ordinario o liviano es el nitrógeno 14, N 14), para marcar cadenas de ADN haciéndolas más densas. Las moléculas más grandes, como la de ADN, pueden separarse por diferencias en su densidad mediante una técnica conocida como “CENTRIFUGACIÓN EN GRADIENTE DE DENSIDAD”. Cuando el ADN se mezcla con la solución que contiene cloruro de cesio (CsCl) y se centrifuga a alta velocidad, la solución forma un gradiente de densidad en el tubo de la centrífuga, que va de una región de baja densidad en la parte superior a una región con la máxima densidad en el fondo. Durante la centrifugación, las moléculas de ADN emigran a la región del gradiente que tiene valor de densidad idéntico al suyo.
Universidad Católica los Ángeles de Chimbote - ULADECH 166

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El experimento de MatthewW Meselson y Franklin Stahl

En 1957, Matthew Meselson y Franklin Stahl cultivaron células de la bacteria Escherichia coli en un medio que contenía N 15 en la forma de cloruro de amonio (NH 4Cl). Las células utilizaban el N15 para sintetizar bases, que a su vez eran incorporadas en EL ADN. Las moléculas de ADN resultantes, que contenían nitrógeno pesado, se extrajeron de algunas células; cuando se sometieron a centrifugación en gradiente de densidad se acumularon en la r egión de alta densidad del gradiente. El resto de las bacterias (que también contenían ADN marcado con N15) se transfirieron a un medio de cultivo y más ligero; ahí se le permitió experimentar varias divisiones celulares más. Se esperaba que las cadenas d e ADN recién sintetizadas fueron menos densas, por haber incorporado bases que contenían el isótopo ligero, N 14. En efecto, las moléculas de ADN de células aisladas después de una generación tenían densidad intermedia, lo cual indicaba que contenían la mitad de átomos de N15 que el ADN “progenitor”. Este hecho apoyaba el modelo semiconservador, el cual decía que cada doble hélice debe contener una cadena previamente sintetizada (pesada en este caso) y una recién sintetizada (ligera en este caso). Refutaba e l modelo conservador, que sugería que habrían dos clases de moléculas de doble cadena (una con dos cadenas pesadas y otra con dos cadenas ligeras). Después de otro ciclo de división celular en el medio con el isótopo ligero (N14), aparecieron dos tipos de ADN en el gradiente de densidad. Uno consistía en hélices “HÍOBRIDAS” de ADN
Universidad Católica los Ángeles de Chimbote - ULADECH 167

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

(con N15 en una cadena y N 14 en la otra), en tanto que la otra contenía sólo ADN con el isótopo ligero natural. Esta observación refutaba el modelo disperso, el cual sugería que todas las cadenas debían tener densidad intermedia. En cambio, cada cadena de la doble hélice original se conservaba, pero en una molécula hija “diferente”, tal como lo sugería el modelo de duplicación semiconservadora. REPLICACION SEMICONSERVADORA



Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

CARACTERÍSTICAS DEL PROCESO REPLICATIVO Existen cierto número de características para el proceso de replicación del ADN que son comunes a todos los organismos, virus, bacterias y células eucariotas. Es sin embargo importante destacar que la mayor parte del conocimiento que se tiene sobre ellas proviene de estudios realizados en bacterias y bacteriófagos. En lo que sigue se describirán algun as de estas características: 1. ESQUEMA SEMICONSERVADOR DE LA REPLICACIÓN: la replicación de una molécula de ADN de doble cadena es un proceso semiconservador. Esto significa que cada cadena cuando se copia queda apareada a la cadena hija. Ello implica que durante el proceso de copia cada cadena debe separarse de su homóloga y que luego no vuelve a aparearse a ésta, sino que, como ya se dijo, queda ligada a la cadena hija. 2. ORIGEN Y SENTIDO DE LA REPLICACIÓN: por lo menos en virus y bacterias la replicación del ADN siempre comienza en un punto fijo del cromosoma y de ese punto puede extenderse unidireccionalmente o bidireccionalmente. 3. ETAPAS DE LA REPLICACIÓN: como todo proceso de polimerización, la síntesis de ADN tiene tres etapas: la INICIACIÓN, la ELONGAC IÓN y la TERMINACIÓN. La velocidad de síntesis de la molécula se considera que depende eminentemente de la etapa de iniciación. Sobre esta etapa actúan la mayor parte de factores de regulación. Se considera que una vez iniciada la síntesis actúan la mayor parte de factores de regulación. Se considera que una vez iniciada la síntesis, la elongación se hace a velociada constante. 4. DIRECCIÓN DE LA REPLICACIÓN: el proceso de polimerización consiste en la adición de nucleótidos en el sentido 5’ 3’. Ello significa que, siendo las cadenas del ADN antiparalelas, o sea, que presentan la disposición. p 5’ 3’ OH Dirección de la síntesis Dirección de la síntesis OH 3’ 5’ p La dirección de la síntesis de las cadenas es especialmente opuesta. 5. DISCONTINUIDAD DE LA REPLICACIÓN: teniendo la replicación un sentido determinado y siendo la dirección de la síntesis de ambas cadenas opuestas en el espacio, el sistema está obligado a operar en forma discontinua. Esto significa que el proceso de replicación da origen temporalmente a la formación de pequeños segmentos de por lo menos una de las cadenas, que luego son ligados entre sí. El proceso de REPLICACIÓN se puede dividir en tres etapas: INICIACIÓN, ELONGACIÓN y TERMINACIÓN: 1. INICIACIÓN.- Las dos cadenas de la doble hélice de ADN se separan y sirven como moldes para la síntesis de nuevas cadenas complementarias. Las HELICASAS, enzimas que operan en las horquillas de replicación, separan las dos cadenas de la doble hélice original. Las TOPOISOMERASAS, evitan el superenrrollamiento, catalizando la formación y resellado de cortes en una o ambas cadenas delante de las horquillas de replicación. Las proteí nas de unión a cadena simple estabilizan las cadenas abiertas.
Universidad Católica los Ángeles de Chimbote - ULADECH 169

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Como las cadenas no apareadas de un ADN son muy sensibles al ataque por nucleasas, al producirse la separación, cada cadena es inmediatamente cubierta por proteínas específicas que la protegen y que se denominan 2PROTEÍNAS DE UNIÓN A CADENAS SIMPLES”. La iniciación real de la síntesis de ADN comienza con la formación de una CADENA INICIADORA o PRIMER (cebador). Curiosamente, esta cadena iniciadora no es de ADN sino de ARN. La síntesis de la mo lécula iniciadora es llevada a cabo por una ARN – polimerasa especial que se denomina INICIASA o PRIMER. La iniciasa, a partir de los ribonucleótidos trifosfatados, sintetiza una cadena de ARN que ha de ofrecer en su extremo 3’ el hidroxilo requerido para iniciar la síntesis de la cadena de ADN en la siguiente etapa.

El proceso de replicación del ADN

El proceso de replicación del ADN

2. ELONGACIÓN.- La ADN polimerasa III cataliza la adición de nucleótidos a ambas cadenas operando sólo en dirección 5’ a 3’. Para comenzar a añadir nucleótidos, esta enzima requiere la presencia de un cebador de ARN, unido por puentes de hidrógeno a la cadena molde que es luego reemplazado por nucleótidos de ADN.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La cadena adelantada se sintetiza en la dirección 5’ a 3’ en forma continua. En este caso, el único cebador de ARN está situado en el origen de la replicación. La cadena rezagada también se sintetiza en la dirección 5’ a 3’, a pesar de que esta dirección es opuesta a la del movimiento de la horquilla de replicación. El problema se resuelve mediante la síntesis discontinua de una serie de fragmentos, los FRAGMENTOS DE OKAZAKI. Cuando un fragmento de Okazaki ha crecido lo suficiente como para encontrar a un cebador de ARN por delan te de él, otra ADN polimerasa (ADN POLIMERASA I) reemplaza a los nucleótidos de ARN del cebador con nucleótidos de ADN. Luego, la ADN LIGASA conecta cada fragmento con el fragmento contiguo recién sintetizado en la cadena.

El proceso de replicación del ADN

3. TERMINACIÓN.- es el menos conocido, y en cromosomas circulares está asociado al proceso de separación de los dos cromosomas hijos del origen de la replicación así como también a la generación de superhélices. En estos fenómenos interv iene una familia de enzimas denominadas TOPOISOMERASAS, en particular la ADN - GIRASA. El ADN de una sola célula humana que, si se extendiera en una h ebra única mediría casi 2 metros de largo, puede contener una información equivalente a unas 600,00 pági nas impresas de 500 palabras cada una, o a una biblioteca de aproximadamente 1,000 libros. Sin duda, la estructura del ADN puede dar cuenta de la enorme diversidad de los seres vivos. La información se encuentra en la secuencia de bases nitrogenadas y cua lquier secuencia de bases es posible. Dado que el número de pares de bases es de aproximadamente 5,000 en el virus más simple conocido, hasta una estimación de 5,000 millones en los 46 cromosomas humanos, el número de variaciones posibles es astronómico. L a replicación de los cromosomas eucarióticos se inicia en orígenes múltiples. Cada burbuja de replicación individual se extiende hasta que finalmente se encuentra con otra y ambas se unen.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Esquema de cómo se produce el enrollamiento del ADN para formar los cromosomas

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular



Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Los seres vivos poseen una complejidad morfológica y estructural que está determinada por la síntesis y ensamblaje precisos de macromoléculas a lo largo del ciclo vital de la célula o bien en momentos determinados del desarrollo e mbrionario. Así mismo, las actividades metabólicas se realizan gracias a las propiedades funcionales específicas de algunas macromoléculas; las más relevantes en este aspecto son las inherentes a las proteínas. En los organismos vivientes la información n ecesaria para la síntesis de proteínas está contenida en el ADN en forma de secuencias discretas, contínuas o discontínuas, denominadas genes. Esta información se estructuró a través del largo proceso de evolución biológica, durante el cual los mecanismos de recombinación y mutación, sumados a una selección adecuada, determinan la producción del diccionario genético o genoteca de cada individuo viviente. La información contenida en el ADN se expresa en las células por medio de una cadena de procesos denominad “FLUJO DE INFORMACIÓN”. Es así como la información genética almacenada en los genes no se traduce directamente a proteínas, sino mediante la síntesis de otras macromoléculas intermediarias, los ARNs.

EL PROCESO DE LA TRANSCRIPCION Las moléculas de ARNm son largas copias (o transcriptos) de secuencias de ADN de 500 a 10,000 nucleótidos y de cadena simple pero, a diferencia de las moléculas de ADN, las de ARN se encuentran en su mayoría como moléculas de cadena única. Cada nueva mol écula de ARNm se copia –o transcribe- de una de las dos cadenas de DAN (la cadena molde) según el principio de apareamiento de bases que gobierna la replicación del ADN. Al igual que una cadena de ADN, cada molécula tiene un extremo 5’ y un extremo 3’. Com o en la síntesis del ADN, los ribonucleótidos, que están presentes en la célula como trifosfatos, se añaden uno por vez al extremo 3’ de la cadena en crecimiento de ARN. El proceso, conocido como
Universidad Católica los Ángeles de Chimbote - ULADECH 175

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

TRANSCRIPCION, es catalizado por la enzima “ARN POLIMERASA”. Esta enzima opera de la misma forma que la ADN polimerasa, moviéndose en dirección 3’ a 5’ a lo largo de la cadena molde de ADN, sintetizando una nueva cadena complementaria de nucleótidos (en este caso de ribonucleótidos) en la dirección 5’ A 3’. Así, la cadena de ARNm es antiparalela a la cadena molde de ADN de la cual es transcripta. La ARN POLIMERASA, a diferencia de la ADN polimerasa, no requiere cebador para comenzar la síntesis de ARN, ya que es capaz de iniciar una nueva cadena uniendo dos ribonucleótidos. En procariotas, hay un único tipo de ARN POLIMERASA que, en realidad, es un gran complejo multienzimático asociado con varias proteínas que participan en diferentes momentos de la transcripción. Cuando va a iniciar la transcripción, la ARN POLIMERASA sen une al ADN en una secuencia específica denominada secuencia promotora o promotor; abre la doble hélice en una pequeña región y, así, quedan expuestos los nucleótidos de una secuencia corta de ADN. Luego, la enzima va añadiendo ribonucleótidos, mo viéndose a lo largo de la cadena molde, desenrollando la hélice y exponiendo así nuevas regiones con las que se aparearán los ribonucleótidos complementarios. El proceso de elongación de la nueva cadena de ARNm continúa hasta que la enzima encuentra otra secuencia especial en el transcripto naciente, la señal de terminación. En este momento la ARN POLIMERASA se detiene y libera a la cadena de ADN molde y a la recién sintetizada cadena de ARNm. El proceso de la transcripción del ARNm descrito para procariot as es similar en eucariotas, aunque presenta algunas diferencias importantes. Entre ellas, se puede mencionar que, si bien en procariotas las moléculas de ARNm se producen directamente por transcripción del ADN, en eucariotas superiores, la mayor parte de los transcriptos sufren un procesamiento posterior a la transcripción, llamado “SPLICING” (CORTE) del ARN, antes de dejar el núcleo e ingresar al citoplasma (CITOSOL). El ARN mensajero transcrito a partir del ADN es. Entonces, la copia activa de la inform ación genética. Incorporando las instrucciones codificadas en el ADN, el ARNm dicta la secuencia de aminoácidos en las proteínas. Químicamente, el ARN es muy semejante al ADN, pero hay dos diferencias en sus nucleótidos:
Universidad Católica los Ángeles de Chimbote - ULADECH 176

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

1. Una diferencia es el azúcar que l o compone. En lugar de desoxirribosa, el ARN contiene ribosa, en la cual el grupo hidroxilo reemplaza a un hidrógeno en el carbono 2’. 2. La otra diferencia es que, en lugar de timina, el ARN contiene una pirimidina íntimamente relacionada con ésta, el uracil o (U). El uracilo, al igual que la timina, se aparea sólo con la adenina (A). 3. Una tercera y muy importante diferencia entre los dos ácidos nucleicos es que, en la mayoría de los casos, el ARN se encuentra como cadena simple y no forma una estructura helicoidal regular como el ADN.

MECANISMO DE LA SINTESIS DEL ARN El ARN se sintetiza usando como “TEMPLADO O MOLDE” al ADN de cadena doble. Sin embargo, sólo una de las dos hélices del ADN se transcribe para producir moléculas de ARN con la codificación adecuada. Esto determina una de las propiedades más sobresalientes del proceso de transcripción, “LA ASIMETRÍA”. Así mismo, la dirección de la síntesis del ARN sobre la cadena del ADN apropiada se realiza siempre unidireccionalmente con la polaridad 3’ 5’ tomando como referencia al templado de ADN. Si se toma como referencia la polaridad del ARN, la síntesis se efectúa en el sentido 5’ 3’. A diferencia de lo que ocurre en el caso de las ADN – POLIMERASAS durante la r eplicación del ADN, las ARN POLIMERASA dependientes de ADN no requieren para su funcionamiento de la presencia de UNA MOLÉCULA INICIADORA o PRIMER. El proceso de polimerización se realiza mediante la síntesis de un enlace covalente denominado UNIÓN FOSFODI ESTER (su mecanismo intrínseco consiste en u ataque nucleofílico que el hidroxilo 3’ de la ribosa del último nucleótido polimerizado lleva a cabo sobre el nucleotidilfosfato interno del nucleósido trifosfato entrante; esta reacción continúa luego por la en ergía obtenida de la hidrólisis de pirofosfato inorgánico perteneciente al nucleótido trifosfato entrante). Por lo tanto, siempre el primer nucleósido retiene su grupo fosfato en el extremo 5’ de la ribosa. En la gran mayoría de los casos la reacción se inicia con un ATP o GTP, y por lo general el segundo nucleóitido incorporado es CTP o UTP.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

LA ARN POLIMERASA La transcripción de la información genética se realiza mediante la síntesis de una de las especies de RNA. El proceso es catalizado por un grupo d e enzimas de estructuras complejas denominadas ARN – POLIMERASA DEPENDIENTES DE ADN. Estas enzimas son capaces de sintetizar polinucleótidos discretos, respetando con fidelidad señales o sitios precisos de iniciación y terminación y, por ello, de la fase d e lectura de ADN. Finalmente, la función de estas enzimas está regulada por factores intracelulares y extracelulares que modulan su concentración, su unión al sustrato y su actividad catalítica. La “ARN POLIMERASA” de Escherichia coli, que puede tomarse como modelo de este tipo de enzimas, es una proteína compleja formada por CINCO SUBUNIDADES: 4 Los péptidos componentes de la enzima se denominan: ALFA, BETA, BETA PRIMA, SIGMA y OMEGA. 4 La enzima activa, llamada HOLOENZIMA, está compuesta por DOS CADENAS ALFA , UNA CADENA BETA, UNA CADENA BETA PRIMA, UNA CADENA SIGMA y UNA CADENA OMEGA. 4 Aún cuando es necesaria la presencia de todas esta subunidades para que la holoenzima cumpla su función, no se conoce muy bien la función específica de cada una de ellas. 4 Se sabe que la SUBUNIDAD BETA reconoce como sustratos a los ribonucleótidos trifosfatos (ATP, GTP, UTP y CTP), mientras que la SUBUNIDAD BETA PRIMA es necsaria para que la holoenzima se una al templado de ADN y permanezca unida a éste durante el proceso de sínte sis de ARN. Las funciones de ALFA y OMEGA se desconocen. Así mismo la SUBUNIDAD SIGMA permite el correcto inicio de la síntesis del ARNm y la asimetría de la transcripción. 4 Luego de producida la iniciación la subunidad sigma se disocia de la holoenzima dejando una enzima formada por: dos alfas, una beta, una beta prima y una omega, a la cual se denomina ENZIMA RESIDUAL o CORE y es responsable de la elongación de la cadena de ARN. Puede concluirse entonces que la actividad funcional específica de las ARN PO LIMERASAS depende de su estructura molecular, de tal modo que todas las subunidades de la holoenzima son importantes en la reacción. Otra definición que debe de quedar bien en claro es que cada componente actúa en una etapa bien definida de la reacción en forma aislada y coordinada con las demás. Para un mejor entendimiento, se pasará a describir más detalladamente la transcripción dividiéndola en tres etapas: INICIACION, ELONGACION y TERMINACION. INICIACION: La iniciación de la transcripción se produce cu ando la holoenzima se une al templado de ADN. Como se explicó antes en esta etapa es fundamental la presencia de la SUBUNIDAD SIGMA. La unión de la ARN – POLIMERASA se realiza sobre un segmento de ADN que antecede al comienzo del gen y que se denomina PROM OTOR. Los promotores tienen tres segmentos funcionales con los cuales la ARN – POLIMERASA interactúa con el ADN: un sitio de “RECONOCIMIENTO”, un sitio de “UNION” y un sitio de “INICIACION”. Las secuencias de reconocimiento se ubican aproximadamente 10 nuc leótidos antes del comienzo del gen. Las secuencias de reconocimiento están compuestas por aproximadamente 7 a 8 nucleótidos y son específicos para cada gen.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El proceso de la transcripción

Inicio del proceso de transcripción

ELONGACIÓN: La finalización de la iniciación está marcada por la salida de la SUBUNIDAD SIGMA de la holoenzima, la traslocación de ésta y la unión del primer nucleósido trifosfato /ATP oGTP); la adición posterior de los nucleósidos trifosfatos correspondientes se realiza a una velocidad de 50 – 60 nucleótidos por segundo; en dirección 5’ 3’. Con respecto al ARN. Durante la elongación ocurre una apertura regional transitoria de la doble hélice de ADN en los sitios donde se encuentra la ARN – POLIMERASA; se cree que esta desnaturalización es producida por la misma enzima. La fidelidad de la transcripción es relativamente baja, ya que las ARN – POLIMERASAS no cuentan con mecanismo de corrección de errores, como sucede con las ADN – POLIMERASAS. Sin embargo, el gran número de copias de capa tipo de ARN producidas por las ARN – POLIMERASAS garantiza siempre una cantidad óptima de producto final fundamentalmente competente. TERMINACION: Sobre el ADN hay señales de terminación del proceso d e la transcripción. Estas señales están formadas por secuencias ricas en bases GC que dan lugar a la formación de estructuras terciarias especiales a modo de RULOS (LOOPS) o de zonas palindrómicas que de terminan una disminución significativa de la velocida d de síntesis; esto, sumado a secuencias no afines a la RNA – POLIMERASA, hacen que la ENZIMA RESIDUAL o CORE se disocie del DNA y quede liberada la cadena de RNA. Actualmente se piensa que una proteína llamada “RHO” participa activamente en la terminación específica de la transcripción en algunos genes. La “PROTEÍNA RHO” está compuesta por cuatro cadenas polipeptídicas idénticas con un peso molecular de 50,000 cada una. Esta configuración tetramérica le otorgaría a esa proteína una afinidad alta por la doble hélice del DNA. Los datos experimentales sugieren que “RHO”
Universidad Católica los Ángeles de Chimbote - ULADECH 179

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

se uniría al segmento terminal del gen (extremo 5’ de la cadena molde) y comenzaría a desplazarse en dirección 3’, es decir, en sentido contrario al de la polimerasa. Su llegada a zonas en donde la velocidad de elongación de síntesis de la enzima disminuye por efecto de las secuencias de terminación determinaría el desplazamiento de ésta fuera del templado, con la consiguiente liberación del RNA recién sintetizado. MODIFICACIONES POST – TRANSCRIPCIONALES En los seres vivientes existen básicamente tres clases principales de RNA: RIBOSÓMICOS (RNAr), MENSAJEROS (RNAm) y de TRANSFERENCIA (RNAt). Todos los RNAs, sin excepción, son sintetizados por copia del DNA mediante la transcripción selectiva de genes. Los productos primarios de la transcripción son, salvo contadas excepciones, precursores de mayor peso molecular que sus productos finales. Estos precursores son PROCESADOS o MODIFICADOS adecuadamente a fin de producir moléculas de RNA competent es para realizar sus funciones específicas en la síntesis de proteínas. El conjunto de reacciones que dan lugar al PROCESAMIENTO y MODIFICACIONES de los RNAs precursores se denomina “MADURACIÓN POST – TRANSCRIPCIONAL”. Todos estos procesos representan par a la célula importantes etapas en la regulación de la expresión genética, mediante las cuales se establece la cantidad óptima de cada especie de RNA y la oportunidad de su síntesis. Los procesos de maduración POST – TRANSCRIPCIONAL más importantes son: 1. Procesamiento de los RNA precursores por acción combinada de endonucleasas y exonucleasas que determinan un acortamiento de las moléculas del transcrito primario. Este proceso se produce tanto en los RNAm y RNAt de procariotas y eucariotas, como en la mayor parte de los RNAm de eucariotas. 2. Modificaciones químicas internas de los polinucleótidos. La metilación de los ribosomas en sitios precisos de los precursores de RNAs ribosómicos en eucariotas son obligatorios para su posterior clivaje por nucleasas. 3. Modificaciones de los extremos de las moléculas de RNAm. El agregado post – transcripcional de aproximadamente 200 “RESIDUOS DE ADENILATO” al extremo 3’ – OH (POLI A) de la mayor parte de los RNA mensajeros de eucariotas o de sus precursores (poliadenilación) es esencial para un procesamiento adecuado de la molécula, para la eficiencia de su transporte al citoplasma y para proporcionar al RNAm maduro estabilidad metabólica. Otra modificación de los RNAm eucariotas es el agregado POST – TRANSCRIPCIONAL al extremo 5’ del transcrito primario de un nucleótido modificado, la 7 – METILGUANOSINA. Esta modificación, llamada “CAP” se conserva durante el procesamiento del precursor, protege al RNA del ataque de nucleasas y fosfatasas y es sumamente importante para una efectiva iniciación de la síntesis de proteínas.

Maduración post-transcripcional de los extremos

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

4 Procesamiento de los RNAm. Un hecho extraordinariamente importante y recién descubierto es que las secuencias codificantes o expresable s denominadas “EXONES”, de los genes se encuentran interrumpidas por secuencias intercaladas que no se expresan y se llaman “INTRONES”. Esta discontinuidad real de los segmentos expresables presentes en el DNA son transcritos como tales (INTRONES Y EXONES) y se hallan en el precursor del RNA mensajero. El número de intrones varía para cada gen. Un fenómeno post – transcripcional relevante es, pues, la remoción de esas secuencias intercaladas, seguida luego por el ligamiento preciso de todos los segmentos c odificantes.

Esquema de las reacciones que dan lugar al procesamiento de una molécula de RNAm o exones para que mantengan las secuencias adecuadas de bases. Estos procesos, conocidos en el idioma como SPLICING (cortar y reunir), son cataliz ados por un sistema enzimático de nucleasa – ligasa, cuya identificación y aislamiento están todavía en desarrollo. Se cree posible que en el mecanismo molecular del SPLICING intervenga un tipo de RNAs de bajo peso molecular presente en el núcleo celular. La participación de estos RNAs pequeños sería a través de su unión o hibridación al RNA precursor, produciendo sitios de doble cadena reconocibles específicamente por las enzimas del SPLICING así como el alineamiento adecuado de los exones para su ligamien to correcto.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 182

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

INTRODUCCION Las letras A, G, T y C corresponden a los nucleótidos encontrados en el DNA. Están organizadas en palabras claves de tres letras lla madas codones y el conjunto de los codones constituye el código genético. Un ordenamiento lineal de los codones (un gen) especifica la síntesis de varias moléculas de RNA, la mayor parte responsable de algún aspecto de la TRADUCCIÓN o BIOSÍNTESIS DE PROTEÍ NAS. Este proceso se lleva a cabo en tres etapas principales: INICIACIÓN, ELONGACIÓN y TERMINACIÓN. Es semejante a la replicación y transcripción del DNA en sus características generales y en el hecho de que también sigue la polaridad 5 ’ 3’.

El flujo de la información genética

IMPORTANCIA BIOMÉDICA Antes de dilucidar el código genético era imposible comprender la síntesis proteica o explicar las mutaciones. El código genético proporciona la base de la forma en que los defectos de las proteínas pueden causar enfermedad y sirve para el diagnóstico y quizá para el tratamiento de las enfermedades genéticas. Además, la fisiopatología de numerosas infecciones virales se relaciona con la capacidad de estos medicamento s de interrumpir la síntesis proteica en la célula huésped.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

LA INFORMACIÓN GENÉTICA FLUYE DEL DNA AL RNA Y DE ESTE ÚLTIMO A LA PROTEÍNA La información genética contenida en la secuencia de nucleótidos del DNA es transcrita en el núcleo celular a la secuencia específica de un nucleótido de una molécula de RNAm. La secuencia de nucleótidos del RNA es complementaria de la secuencia de la tira codificante de su gen en concordancia con las reglas del apareamiento de bases. Varias clases diferentes del RNA se combinan para dirigir la síntesis de proteínas.

En los PROCARIOTAS hay una correspondencia lineal entre el gen, el RNAm transcrito del gen y el producto polipeptídico. La situación es más complicada en los EUCARIOTAS SUPERIORES, en los cuales la transcripción del RNAm nuclear es de mayor tamaño que el RNAm maduro. El RNAm es procesado en el núcleo y los intrones, que a menudo constituyen una porción mayor del RNAm que los exones, son removidos. A continuación, los exones son empalmados para formar RNAm maduro, que es transportado al citoplasma, donde se traduce la proteína. La célula debe poseer la maquinaria necesaria para de manera precisa y eficiente traducir la información de la secuencia de nucleótidos de un RNAm, en la secuencia d e aminoácidos de la correspondiente proteína específica. Para aclarar la comprensión de este proceso, al que se ha denominado TRADUCCIÓN, se esperaba el descifrado del código genético que pronto fue comprendido, que las moléculas de RNAm no tienen por sí m ismas, afinidad para los aminoácidos y, por lo tanto, que la traducción de la información de la secuencia de nucleótidos del RNAm en la secuencia de aminoácidos de una proteína requiere de una molécula adaptadora intermediaria. Esta molécula adaptadora deb e reconocer una secuencia específica de nucleótidos por una parte, así como un aminoácido específico por la otra. Con tal molécula adaptadora, la célula puede dirigir un aminoácido específico hacia la posición secuencial apropiada de la proteína como lo di cta la secuencia de nucleótidos del RNAm específico. De hecho, los grupos funcionales de los aminoácidos en realidad no se ponen en contacto con el molde del RNAm. La síntesis de proteínas ocurre en los ribosomas que consisten en dos subunidades, una grande y una pequeña, cada una formada por RNAr y proteínas específicas. Para la síntesis de proteínas, también se requiere de moléculas de RNAt, que están plegadas en una estructura secundaria con forma de hoja de trébol. Estas moléculas pequeñas pueden lleva r un aminoácido en un extremo y tienen un triplete de bases, el anticodón en un asa central, en el
Universidad Católica los Ángeles de Chimbote - ULADECH 184

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

extremo opuesto de la molécula. La molécula de RNAt es el adaptador que aparea el aminoácido correcto con cada codón de RNAm durante la síntesis de proteína s. Hay al menos un tipo de molécula de RNAt para cada tipo de aminoácido presente en las células. Las enzimas conocidas como aminoacil -RNAt sintetasas catalizan la unión de cada aminoácido a su molécula de RNAt específica. En el lugar donde la cadena de R NAm está en contacto con un ribosoma, se unen RNAts temporalmente a la cadena de RNAm. Esta unión ocurre por apareamiento de bases complementarias entre el codón de RNAm y el anticodón de RNAt. Cada molécula de RNAt lleva el aminoácido específico requerido por el codón de RNAm, al cual se une el RNAt. Así, siguiendo la secuencia dictada originalmente por el DNA, las unidades de aminoácidos son alineadas una tras otra y, a medida que se forman los enlaces peptídicos entre ellas, se unen en una cadena polipeptídica. TRES SON LOS TIPOS DE RNA QUE SE FORMAN 1. EL ACIDO RIBONUCLEICO MENSAJERO (RNAm). - Lleva el mensaje genético que codifica la producción de las distintas proteínas necesarias para la vida. Esta información es recogida en TRIPLETES DE BASES (CODONES) .

2. EL ACIDO RIBONUCLEICO RIBOSÓMICO (RNAr). - Es el encargado de la traducción del mensaje del RNAm y lugar donde se lleva a cabo la polimerización de los aminoácidos. Cosnta de dos subunidades que normalmente están separadas y, de acuerdo co n su constante de sedimentación, se denominan 50s, 30s en procariotas y 80s, 40s en eucariotas. Existen dos lugares funcionales: AMINOACIL o aceptor donde se unen los aminoácidos y PEPTIDIL o dador.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

3. EL ACIDO RIBONUCLEICO DE TRANSFERENCIA (RNAt).- Es el encargado de transportar los aminoácidos necesarios al ribosoma para realizar la síntesis de proteínas. Consta de un extremo, donde existe un triplete de bases, complementario a los distintos codones (ANTICODÓN). De esta forma, existen tantos tipos de RNAt como aminoácidos. En otro de sus extremos se une específicamente un aminoácido, que será distinto según el triplete del anticodón.

EL PROCESO DE LA SÍNTESIS PROTEICA CONSTA DE TRES ETAPAS: INICIACIÓN, ELONGACIÓN Y TERMINACIÓN INICIACIÓN.- Comienza con la disociación del ribosoma 70s en sus subunidades 30s y 50s. Luego, la subunidad 30s se une la RNAm. El aminoácido que comienza la síntesis, la formilmetionina (fMet) en procariotas y metionina (Met) en eucariotas, se agrupan formando el complejo de iniciación. Posteriormente se acopla el ribosoma 50s y se forma el 70s funcionante.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La subunidad ribosómica más pequeña se une al extremo 5' de una molécula de RNAm. La primera molécula de RNAt, que lleva el aminoácido modificado fMet, se acopla con el codón iniciador AUG de la molécula de RNAm. La subunidad ribosómica más grande se ubica en su lugar, el complejo RNAt -fMet ocupa el sitio P (peptídil). El sitio A (aminoacil) está vacante. El complejo de iniciación está co mpleto ahora. ELONGACIÓN.- Se compone de una serie de estadíos repetitivos, que son el RECONOCIMIENTO, TRANSFERENCIA y TRANSLOCACIÓN. 1. RECONOCIMIENTO.- Al ribosoma 70s con fmet (o Met) y su correspondiente RNAt se une un nuevo aminoácido con su RNAt en el lugar A, determinado por el codón del RNAm. 2. TRANSFERENCIA.- Mediante este proceso, el primer aminoácido (fMet) se une al segundo y se inicia la cadena polipeptídica. 3. TRANSLOCACIÓN.- El ribosoma se mueve para leer el mensaje de otro codón; en este proceso, la cadena polipeptídica pasa al lugar P: queda libre el RNAt que vehiculaba la fMet, y el lugar A queda vacante para ser ocupado por otro RNAt con su aminoácido.

Estos pasos se repiten sucesivamente de forma continua hasta comple tar la síntesis de la proteína. Un segundo RNAt, con su aminoácido unido, se coloca en el sitio A y su anticodón se acopla con el RNAm. Se forma un enlace peptídico entre los dos aminoácidos reunidos en el ribosoma. Al mismo tiempo, se rompe el enlace ent re el primer aminoácido y su RNAt. El ribosoma se mueve a lo largo de la cadena de RNAm en una dirección 5' a 3', y el segundo RNAt, con el dipéptido unido, se mueve desde el sitio A al sitio P, a medida que el primer RNAt se desprende del ribosoma. Un ter cer aminoacil-RNAt se coloca en el sitio A y se forma otro enlace peptídico. La cadena peptídica naciente siempre está unida al RNAt que
Universidad Católica los Ángeles de Chimbote - ULADECH 187

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

se está moviendo del sitio A al sitio P y el RNAt entrante que lleva el siguiente aminoácido siempre ocupa el sitio A. Este paso se repite una y otra vez hasta que se completa el polipéptido. TERMINACIÓN.- El proceso termina en el lugar del RNAm, donde existe uno de estos tripletes (codones), UAA, UAG o UGA, para los que normalmente no existe RNAt correcpondiente (y por ello aminoácidos), y también gracias a la intervención de factores de terminación al final quedan libres el polipéptido, el último RNAt, el ribosoma 70s y el RNAm. Cuando el ribosoma alcanza un codón de terminación (en este ejemplo UGA), el polipéptido se escinde del último RNAt y el RNAt se desprende del sitio P. El sitio A es ocupado por un factor de liberación que produce la disociación de las dos subunidades del ribosoma.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

INTRODUCCION El código genético es la regla de correspondencia entre la serie de nucleótidos en que se basan los ácidos nucleicos y las series de aminoácidos (polipéptidos) en que se basan las proteínas. Es como el diccionario que permite traducir la información genética a estructura de proteína. A, T, G, y C son las "letras" del código genético y representan las bases nitrogenadas adenina, timina, guanina y citosina, respectivamente. Cada una de estas bas es forma, junto con un glúcido (pentosa) y un grupo fosfato, un nucleótido; el ADN y el ARN son polímeros formados por nucleótidos encadenados. Durante el proceso de traducción (síntesis de proteína) el mensaje genético es leído de una cadena de ARN, colocando cada vez el aminoácido indicado por el codón siguiente según la regla que llamamos código genético.

ES NUCLEÓTIDOS CONTIENEN LA INFORMACIÓN PARA UN AMINOÁCIDO La unidad hereditaria que contiene la información para codificar un a minoácido es el CODÓN, que está formado por tres nucleótidos (triplete). Esta información se transcribe en el ARN mensajero (ARNm) que tiene una secuencia de bases complementarias a la del ADN. Tanto el ADN como el ARN mensajero poseen sólo 4 bases diferen tes, mientras que las proteínas contienen 20 aminoácidos distintos. El CODIGO GENÉTICO se lee en grupos de tres bases; EL TRIPLETE (CODÓN) es pues el número menor de bases (o nucleótidos) capaz de codificar los aminoácidos, si el código consistiera de dos bases, el número posible de codones 4 2 = 16 sería insuficiente; en cambio, con tripletes el número posible de codones es de 4 3 = 64, que es suficiente. Si el código genético fuera de 4 bases el número posible de codones sería excesivo (4 4 = 256).

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La longitud de la porción del gen que codifica depende del número de aminoácidos en la proteína. Por ejemplo, para codificar 500 aminoácidos se necesitan 500 codones, o sea 1500 nucleótidos. La lectura del mensaje se hace desde un punto fijo de partida, y este sitio está determinado por un codón de iniciación especial. La secuencia de codones determina la de los aminoácidos en la proteína; pero, por su parte, los aminoácidos son incapaces de reconocer directamente los codones correspondientes en el ARNm. Para que esto ocurra se requiere la intervención de otra molécula que sirve como adaptador, el ARN DE TRANSFERENCIA (ARNt). El ARNt tiene un sitio que se une al aminoácido y otro, el ANTICODÓN, que reconoce al codón en el ARNm. CADA ANTICODÓN TIENE TRES NUCLEÓTIDOS QUE SON COMPLEMENTARIOS DE LOS CODONES. La traducción del mensaje, o sea, la síntesis de la proteína, se produce en los ribosomas, los que aseguran la interacción ordenada de todos los componentes que intervienen en ella. EL CÓDIGO GENÉTICO ES INEQUÍVOCO, NO TRASLAPANTE, SIN PUNTUACIÓN, DEGENERADO Y UNIVERSAL TRES CODONES no cifran para aminoácidos específicos, estos han sido llamados CODONES SIN SENTIDO. Ellos son utilizados en la célula como señales de terminación; estas especifican donde detener la polimerización de los aminoácidos en la molécula de proteína. Los 61 codones restantes codifican para 20 aminoácidos. Así, debe haber una “DEGENERACIÓN DEL CÓDIGO GENÉTICO”; es decir varios codones codifican para un mismo aminoácido, pero un aminoácido p uede ser decodificado por varios codones; por ejemplo, seis codones diferentes especifican serina. Otros aminoácidos como metionina y triptofano, sólo tienen un codón. En general el tercer nucleótido en un codón es menos importante que los otros dos para d eterminar el aminoácido específico por ser incorporado y esto da cuenta de la mayor parte de la degeneración del código genético. Sin embargo, para cualquier codón específico sólo está indicado un aminoácido único; EL CÓDIGO GENÉTICO NO ES AMBIGUO, es deci r, dado un codón específico, sólo un aminoácido está determinado. La distinción entre ambigüedad y degeneración es un concepto importante para ser enfatizado.
Universidad Católica los Ángeles de Chimbote - ULADECH 191

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El código genético no ambiguo, pero degenerado, puede ser descrito en términos moleculares. El reconocimiento de codones específicos en el ARNm por las moléculas adaptadoras del RNAt depende de su región anticodón y de las reglas de apareamiento de bases. Cada molécula de ARNt contiene una secuencia específica, complementaria de UN CODÓN, llamado “A NTICODÓN”. Para un codón dado en el ARNm, sólo una única especie de molécula de ARNt posee el anticodón apropiado. Dado que cada molécula de ARNt puede ser cargada por un solo aminoácido, cada codón, por lo tanto, especifica únicamente un aminoácido. Sin embargo, algunas moléculas de ARNt pueden utilizar el anticodón para reconocer más de un codón. Con algunas excepciones, para un codón específico, sólo un aminoácido específico será incorporado; aunque dado un aminoácido, más de un codón puede requerirlo. La lectura del código genético durante el proceso de la síntesis de proteínas no incluye traslapo alguno de codones. Por tanto, el código genético no se traslapa. Además, una vez que se comienza la lectura de un codón específico, no hay puntuación entre l os codones y el mensaje es leído en una secuencia contínua de tripletes de nucleótidos hasta que se alcanza un codón sin sentido (codón de terminación). Hasta hace poco, se pensó que el código genético era universal. En la actualidad se ha desmostrado que el conjunto de moléculas del ARNt en las mitocondrias (las cuales poseen su propia y distinta maquinaria de traducción) de eucariotas inferiores y superiores, incluyendo al ser humano, leen cuatro codones de modo diferente a las moléculas de ARNt del citoplasma, aún en las mismas células. El CODÓN
Universidad Católica los Ángeles de Chimbote - ULADECH 192

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

“AUA” se lee como Met (METIONINA) y el “UGA” codifica para Trp (TRIPTOFANO) en las mitocondrias de los mamíferos. Además, los codones “AGA” y “AGG” son leídos como CODONES DE TERMINACIÓN de cadenas más que como A RGININA. Como consecuencia, las mitocondrias sólo requieren 22 moléculas de ARNt para leer su código genético en tanto que en el citoplasma se tiene un complemento total de 31 especies de ARNt. Anotadas estas excepciones EL CÓDIGO GENÉTICO ES UNIVERSAL. Lo s cuadros de uso de los codones se están haciendo cada vez más exactos conforme aumenta la secuenciación de los genes. Su importancia es grande debido a que con frecuencia los investigadores necesitan deducir la estructura del ARNm a partir de la secuencia primaria de la proteína para sintetizar una sonda de oligonucleótidos a iniciar un proyecto de clonación de ADN recombinante. HAY 61 CODONES PARA CODIFICAR 20 AMINOÁCIDOS Y POR LO TANTO HAY CODONES SINÓNIMOS En 1964, ya se habían descrifrado los 64 codo nes posibles, 61 codones corresponden a los 20 aminoácidos y tres representan SEÑALES DE TERMINACIÓN de la síntesis. Si existen 61 codones para los 20 aminoácidos, es evidente que varios tripletes pueden codificar un mismo aminoácido, o sea que algunos tr ipletes SON SINÓNIMOS (degeneración del código genético). Por ejemplo la prolina es codificada por CCU, CCA, CCG, CCC. Observando este ejemplo y la primera tabla, se puede llegar a la conclusión de que la mayoría de los casos los codones sinónimos sólo dif ieren en la última de las tres bases; en consecuencia, las dos primeras son más importantes en la codificación. Por este motivo una mutación que se produzca en la tercera base pasa inadvertida, ya que no cambia la composición de los aminoácidos de la prote ína. Los estudios sobre la secuencia del ADN han confirmado que la célula utiliza todos los codones. Esto tiene una ventaja selectiva, puesto que reduce el posible efecto de las mutaciones dañinas. Si muchos codones no se usaran, las mutaciones podrían interferir más seriamente con la secuencia normal de la síntesis de proteínas. El uso de los 61 codones para los 20 aminoácidos plantea el problema de si hay un ARNt especial para cada codón. Los estudios sobre ARNt han revelado que hay menos de 61 de estas moléculas. Es preciso admitir pues que un ARNt puede reconocer más de un codón (aunque siempre para el mismo aminoácido). Crack propuso que esto sería posible si la tercera base del anticodón tuviera cierto grado de movimiento que le permitiese establecer puentes de hidrógeno con otras bases que no fuesen las complementarias normales. Esta hipótesis probó ser correcta. Y es así como G en la tercera posición puede aparearse con Y o C en el ARNm, y U puede interaccionar con A o C. EL CODÓN DE INICIACIÓN ES EL AUG Y EL DE TERMINACIÓN UAG, UAA y UGA El ARNm se traduce en la dirección 5’ 3’, la misma que se usó en la transcripción. La cadena polipeptídica siempre se origina a partir del extremo que lleva el NH 2 (amino terminal). La “SEÑAL PARA LA INICIACIÓN” de la síntesis de proteínas es el CODÓN AUG, que tiene una doble función. Cuando se halla en el comienzo del mensaje, el AUG representa el CODÓN DE INICIACIÓN, que en las bacterias (procariotas) codifica la N – formilmetionina (F- met); mientras que cualquier otra posición codifica metinina. En los mensajeros de eucariotas el comienzo es también por el codón AUG, que utiliza un ARNt especial que dirige la incorporación de la metionina en vez de f – met.
Universidad Católica los Ángeles de Chimbote - ULADECH 193

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La SEÑAL DE TERMINACIÓN está dada p or los codones UAG, UAA y UGA, denominados CODONES SIN SENTIDO. Cuando al ribosoma llega el codón de terminación, la cadena polipeptídica se completa y es liberada. LOS CODONES UAG, UAA y UGA no son reconocidos por ARNt especiales, pero si por ciertas prot eínas, los FACTORES DE LIBERACIÓN, que ayudan en la terminación de la síntesis de proteínas. La DEGENERACIÓN DEL CÓDIGO GENÉTCIO reside en su mayor parte en el último nucleótido del triplete codón, sugiriendo que el apareamiento de bases entre este último nucleótido del triplete codón, sugiriendo que el apareamiento de bases entre este último nucleótido y el nucleótido correspondiente del anticodón no es estricto. Este fenómeno se denomina “BAMBOLEO”; el apareamiento del codón y del anticodón puede bambole arse en este sitio de apareamiento específico de nucleótido a nucleótido. Por ejemplo los dos codones para la arginina, AGA, AGG, se pueden unir al mismo codón que tiene uracilo en su extremo 5’. De manera semejante tres codones para la glicina, GGU, GGC y GGA pueden formar un par de bases a partir de un anticodón CCI. I es un nucleótido de INOSINA, una de las bases peculiares que aparecen en las moléculas de ARNt. El código de tres nucleótidos, o código de tripletes, fue ampliamente adoptado como hipótes is de trabajo. Sin embargo, su existencia no fue realmente demostrada hasta que el código fue finalmente descifrado, una década después que Watson y Crack presentaran por primera vez su modelo de la estructura del ADN. De todas maneras, aunque existen des viaciones del código universal, éstas son sólo variaciones menores. La casi universalidad del código indica un origen único. Si bien las variaciones ocasionales muestran que las asignaciones de codones pueden cambiar, estos cambios ocurren muy raramente; a unque en la evolución temprana del código, estos cambios podrían haber sido más frecuentes.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

INTRODUCCION ¿Por qué las células PROCARIOTAS y las EUCARIOTAS tienen estrategias claramente destintas para regular la actividad de sus genes? En gran medida, estas diferencias reflejan las formas en que los organismos llevan su propia vida. Como las células bacterianas existen de manera independiente, cada célula debe ser capaz de realizar todas sus funciones es enciales. Y dado que se desarrollan con rapidez y tienen tiempo de vida relativamente breve, portan poco “exceso de equipaje”. El tema dominante en la REGULACIÓN GENÉTICA de los PROCARIOTAS es “economía”, y controlar la transcripción suele ser la forma má s eficaz en términos de costo para regular la expresión genética. La organización de genes relacionados en operones que pueden activarse y desactivarse como unidades permite a estas células sintetizar sólo dos productos genéticos requeridos en un momento dado. Para este tipo de regulación es necesario un rápido recambio de ARNm, de modo que los mensajes no se acumulen y no sigan siendo traducidos cuando no se les requiere. Las bacterias rara vez regulan las concentraciones de enzimas degradando proteínas. Una vez que la síntesis de una proteína concluye, las moléculas proteínicas sintetizadas con anterioridad se diluyen tan rápido en las subsecuentes divisiones celulares que no suele ser necesario degradarlas. Sólo cuando las células padecen inanición o se privan de aminoácidos esenciales se emplean enzimas que digieren proteínas a fin de degradar las que ya no son necesarias para la supervivencia, y sus aminoácidos se recirculan. Las CÉLULAS EUCARIOTAS tienen diferentes requerimientos reguladores. En los organismos multicelulares, grupos de células cooperan entre sí en una división del trabajo. Como un solo gen puede requerir regulación de diferentes formas en varios tipos de células, la regulación de genes eucarióticos es compleja y se realiza no sólo a n ivel de la transcripción, sino también a otros niveles de expresión genética. Además las células eucariotas suelen tener ciclos de vida largos, durante los cuales deben reaccionar en forma repetida a diversos estímulos. En lugar de sintetizar nuevas enzimas cada vez que reaccionan a un estímulo, estas células hacen amplio uso de enzimas preformadas y otras proteínas que pueden pasar con rapidez de un estado inactivo a otro activo. En los organismos multicelulares, la regulación genética se basa fundamental mente en la especificidad de la forma y la función de las células de cada tejido. Cada tipo de célula tiene determinados genes activos y otros que tal vez nunca se utilicen. Al parecer, las ventajas adaptativas de la cooperación celular en los eucariotas s uperan, con mucho, a los efectos adversos de portar una carga de genes inactivos a través de muchas divisiones celulares. Las células cuentan con dos maneras básicas de controlar su actividad metabólica: pueden regular la actividad de algunas enzimas o co ntrolar el número de enzimas presentes. La regulación implica interacciones entre el ambiente químico de la célula y proteínas reguladoras especiales, codificadas por genes reguladores. Por ejemplo, las células de Escherichia coli abastecidas con el disacárido lactosa como fuente de carbono y energía, requieren de la enzima beta-galactosidasa para escindir (partir, dividir) ese disacárido. Las células que crecen en un medio con lactosa fabrican aproximadamente 3,000 moléculas de beta-galactosidasa. Sin embargo, en ausencia de lactosa hay un promedio de una molecula de enzima por célula. En conclusión, la presencia de lactosa provoca la inducción de la producción
Universidad Católica los Ángeles de Chimbote - ULADECH 195

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

de las moléculas de enzima necesarias para degradarla. Se dice, entonces, que estas enzimas son INDUCIBLES. Por el contrario, la presencia de un nutriente determinado puede inhibir la transcripción de un grupo de genes estructurales. La Escherichia coli, como otras bacterias, puede sintetizar cada uno de sus aminoácidos a partir de amoníaco y de una fuente de carbono. Los genes estructurales que codifican las enzimas necesarias para la biosíntesis del aminoácido triptófano, por ejemplo, están agrupadas y se transcriben en una única molécula de ARNm. Este ARNm es producido continuamente por células en crecimiento si el triptófano no está presente. En presencia de triptófano, se detiene la producción de las enzimas. Estas enzimas, cuya síntesis se reduce en presencia de los productos de las reacciones que catalizan, se denominan REPRESIBLES.

1. La velocidad de síntesis de beta -galactosidasa, una enzima inducible producida por Escherichia coli, se incrementa dramáticamente cuando se añade lactosa al medio de crecimiento circundante. En tanto la lactosa sea abundante en el medio, la producción de enzima continúa a su velocidad máxima. Sin embargo, cuando se elimina la lactosa del medio, la velocidad de síntesis de beta -galactosidasa cae inmediatamente. 2. En ausencia de un sustrato esencial, como el aminoácido triptófano, las enzimas requeridas para su producción se sintetizan a velocidad máxima. Sin embargo, si se añade triptófano al medio, la síntesis de estas enzimas se reprime rápidamente. EL SISTEMA DE OPERONES Todas las células presentan mecanismos para regular la expresión de los genes. De esta manera, las células procariotas y eucariotas, sintetizan en cada momento solamente aquellos elementos que necesitan. A principio de los años sesenta, JACOB y MONOD, del “ Instituto Pasteur de París”, propusieron un modelo denominado OPERÓN para la reg ulación de la expresión génica en las bacterias.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En CADA OPERÓN se diferencian DOS CLASES DE GENES: 1. Los GENES ESTRUCTURALES (E1, E2, E3…), que codifican proteínas, participantes en un determinado proceso bioquímico. 2. Un GEN REGULADOR (R), que cod ifica a una proteína represora (PR) que puede encontrarse en la forma activa o inactiva y es el agente que controla materialmente la expresión. Existen además DOS REGIONES que intervienen en la regulación: 1. El PROMOTOR (p), es una zona donde se une la ARN -polimerasa y decide el inicio de la transcripción. 2. El OPERADOR (O), que posee una secuencia reconocida por la “proteína represora activa”, cuando se bloquea el operador con la proteína represora, impide el avance de la ARN-polimerasa y la transcripción se interrumpe, con lo que se origina el proceso conocido como represión génica. Un medio principal de regulación genética en las bacterias es el sistema operón. Un operón comprende al promotor, a los genes estructurales y el operador. Los genes estructurales del operón codifican un grupo de proteínas funcionalmente relacionadas y se transcriben como una sola molécula de ARNm. La transcripción es controlada por secuencias en el promotor y en el operador, adyacentes a los genes estructurales y capaces de unir proteínas específicas. El promotor contiene un sitio de unión a la ARN-polimerasa y puede contener un sitio de unión para el complejo CAP -AMP CICLICO. El operador es el sitio de unión para un represor, proteína codificada por otro gen, el regulador, que puede estar localizado a cierta distancia en el cromosoma bacteriano. El operador se puede superponer con el promotor, con el primer gen estructural, o con ambos; cuando el represor se une a la molécula de ADN en el sitio operador, la ARN -polimerasa no puede iniciar la transcripción del ARNm. Cuando el represor no está presente, la ARN -polimerasa puede unirse al ADN y comenzar su movimiento a lo largo del cromosoma permitiendo que ocurra la transcripción y la síntesis de proteínas. El OPERÓN LAC es un eje mplo de un OPERÓN INDUCIBLE. Pasa de “DESCONECTADO” A “CONECTADO” cuando un inductor se une al represor y lo inactiva. Otros operones, como el OPERÓN TRP, son OPERONES REPRESIBLES. Estos pasan de “CONECTADO” a “DESCONECTADO” por la acción de un correpresor , que se une a un represor inactivo. Éste activa al represor y se une al operador. Tanto la inducción como la represión son formas de regulación negativa. La regulación positiva de algunos operones la suministra la unión del complejo CAP -AMPc. Por ejemplo, cuando hay glucosa en la célula, los niveles de AMP cíclico son bajos y el complejo CAP-AMPc no se forma. Cuando la glucosa se agota, aumentan los niveles de AMPc y se forman complejos CAP-AMPc que se unen luego al promotor. Con la lactosa presente (y el represor inactivo) y el complejo CAP -AMPc en su lugar, la ARN-polimerasa también se une al promotor y ocurre la transcripción desde el operón. En un operón, la síntesis de proteínas está regulada por interacciones que involucran a un represor y a un inductor o bien a un represor y a un correpresor. o En los SISTEMAS INDUCIBLES, como el OPERÓN LAC, la molécula del represor es activa, hasta que se combina con el inductor (en este caso, alolactosa).

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o En los SISTEMAS REPRESIBLES, como el OPERÓN TRP, el repres or se activa sólo cuando se combina con el correpresor. Los operones inducibles y represibles son ambos desconectados por proteínas represoras codificadas por genes reguladores. El represor se une al ADN en el operador y evita, de esta forma, que la ARN-polimerasa inicie la transcripción.

En los operones inducibles, el inductor contrarresta el efecto del represor uniéndose a él y manteniéndolo en una forma inactiva. Así, cuando el inductor está presente, el represor ya no puede unirse al operador y pueden proseguir la transcripción y la traducción

1. La INDUCCIÓN ENZIMÁTICA, como en el caso del operón lactosa, que regula la síntesis de las enzimas encargadas de metabolizar la lactosa. Las tres enzimas necesarias para l a utilización de la lactosa son: o BETA-GALACTOSIDASA o BETA-GALACTOSIDO PERMEASA o TRANSACETILASA La síntesis de todas ellas Regulada de manera coordinada por una unidad denominada OPERÓN. El “operón lactosa” está compuesto por tres genes estructurales, Z, Y y A, que codifican las tres enzimas mencionadas y por dos elementos reguladores, el PROMOTOR (P) y el OPERADOR (O). Los genes para las tres enzimas siempre son transcritos a la vez en un solo ARNm policistrónico, lo que implica por que siempre se expresan j untos.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Como puede verse en el esquema, cuando aparece la lactosa (molécula inductora), se une a la proteína represora inactivándola; entonces el complejo inductor -represor se separa del operador, permitiendo el funcionamiento del oper ón.

EL INDUCTOR SE UNE A LA PROTEÍNA REPRESORA La afinidad de la unión del represor al operador está regulada por el INDUCTOR, una pequeña molécula que puede unirse al represor. El inductor natural del operón lactosa es la AALOLACTOSA, un metabolito de la lactosa; cada subunidad del represor tiene un sitio de unión para el inductor, que provoca un cambio conformacional por el cual el represor no puede unirse al operador. De esta manera la presencia del inductor permite la transcripción del operón LAC, que ya no es bloqueado por el represor. LOS REPRESORES SE UNEN DENTRO DE LOS PROMOTORES A IMPIDEN LA INSERCIÓN DE LA ARN POLIMERASA El PROMOTOR (P) es el segmento de ADN donde se fija la ARN -polimerasa al iniciarse la transcripción. La ARN-polimerasa se une a una región de aproximadamente 80mnucleótidos de ADN y, el sitio de unión de la ARN -polimerasa se superpone a la región cubierta por el represor (es decir, el operador). Experimentos “IN VITRO” han demostrado que el represor unido al operador bloquea l a fijación de la ARN-polimerasa. En consecuencia la forma como funcionan los represores es muy simple; se unen al promotor e impiden la fijación de la ARN -polimerasa. 2. La REPRESIÓN ENZIMÁTICA, el ejemplo es el operón triptófano, que regula la síntesis de las enzimas que intervienen en la síntesis del triptófano. El OPERÓN TRIPTÓFANO codifica las cinco enzimas que se requieren para la síntesis de este aminoácido. Desde hace mucho tiempo se sabía que la expresión de este operón era regulada por el nivel de triptófano en el medio de cultivo, y que su presencia producía “represión” de la síntesis de enzimas Trp. Este otro mecanismo que permite la síntesis de enzimas únicamente cuando las necesita.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En los operones represibles, en ausen cia del correpresor, el represor se encuentra inactivo. En este estado, la transcripción y la traducción ocurren permanentemente. En presencia de un correpresor, se forma un complejo represor -correpresor y el represor se activa. Así puede unirse al operado r bloqueando la transcripción.

También puede explicarse la represión enzimática sobre la base de un modelo parecido al descrito para la inducción enzimática en el operón lactosa. En la represión enzimática el gen regulador produce una proteína que normalm ente es inactiva. El represor, al unirse con un metabolito denominado “CORREPRESOR” (en este caso el aminoácido triptófano) sufre un cambio de configuración que le permite unirse al operador e inhibir la unión de la ARN – polimerasa al promotor Trp. La afini dad del represor para unirse al operador es normalmente baja, pero aumenta por la acción del correpresor. Esto es lo contrario de lo que ocurre con el operón lac, que tiene actividad propia y pierde afinidad por el operador cuando se une al inductor. MECANISMO DEL OPERON La transcripción de los genes estructurales depende frecuentemente de la actividad de otro gen, EL REGULADOR, que puede estar localizado en cualquier lugar del cromosoma bacteriano. Este gen codifica para una proteína llamada REPRESOR(A) , que se une al OPERADOR. Cuando un REPRESOR está unido al OPERADOR, obstruye al PROMOTOR. En consecuencia, la ANR-polimerasa no puede unirse a la molécula de ADN, o, si se une, no puede comenzar su movimiento a lo largo de la molécula. El resultado en cua lquier caso es el mismo: “no hay transcripción del ARNm”. Sin embargo, cuando se remueve el represor puede comenzar la transcripción.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La capacidad del REPRESOR para unirse al OPERADOR y así bloquear la síntesis de proteínas depende a la vez de otra molécula que funciona como un EFECTOR. Dependiendo del operón, el efector puede activar o bien inactivar al represor para ese operón en particular. Por ejemplo cuando está presente la lactosa en el medio de cultivo, el primer paso en su metabolismo produce un azúcar íntimamente relacionado, la ALOLACTOSA que se une al REPRESOR y lo inactiva, separándolo del OPERADOR del operón lactosa. Como resultado de esto, la ARN -polimerasa puede comenzar su movimiento a lo largo de la molécula de ADN, transcribiendo los genes estructurales del operón en ARNm. En el caso del operón triptófano (trp), la presencia del aminoácido activa al represor, que luego se une al operador y bloquea la síntesis de las enzimas innecesarias. Tanto la alolactosa como el triptófano, así como las moléculas que establecen interacciones con los represores de otros operones, son efectores alostéricos, que ejercen sus efectos causando un cambio en la configuración de la molécula del represor.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

INTRODUCCION La ciencia genética es un campo de estudio fascinante e importan te. Los procesos genéticos son esenciales para la comprensión de la vida, la información genética dirig e el funcionamiento de la célula, determina la apariencia externa de un organismo y sirve de unión entre generaciones en todas las especies. La palabra genética viene de generes, y estos son su objeto central de estudio. ¿ Qué es un gen? Un gen es un segmento de una molécula cintiforme con forma de una escalera de caracol llamado Acido Desoxirribonucleico (ADN) EL ADN es el material hereditario que pasa de generación en generación, y de esta molécula depende las características inherentes a cada especie. Todas las características externas e internas de un organismo dependen de los genes. Los genes son la causa, el origen de las características y controlan los rasgos únicos de una especie, sean estructuras o procesos. Antiguamente se pensaba que l as jirafas provenían del cruce de caballo con leopardos, actualmente se sabe que proviene de jirafas, lo que sucede es que el ADN es capaz de producir copias de si mismo, permitiendo que se generen y persistan a lo largo del tiempo, nuevas replicas de células y organismos. Los genes no son inmutables, cambian a través del tiempo; esta propiedad se llama mutabilidad, la mutabilidad es una de las bases de la evolución. Las mutaciones genéticas se relacionan con la variabilidad de las especies. Entonces po demos definir a la genética como el estudio de los genes a través de su variación. La genética es el corazón de la biología. Los descubrimientos de la genética han sido fundamentales, a tal punto que han permitido enlazar las diversas disciplinas biológicas. GENETICA 1. DEFINICION La genética es una rama de la biología que estudia los mecanismos de la herencia, es decir, la transmisión de características biológicas de una generación a otra, de los padres a los hijos; estudia las leyes que rigen la herencia , sus bases moleculares y las variaciones que ocurren en la transmisión de caracteres hereditarios. 2. HISTORIA DE LA GENETICA Unas de las observaciones hechas por el hombre desde épocas primitivas es el hecho de que los seres vivos son capaces de transmitir sus características de la descendencia. Los Hebreos, Griegos y otros pueblos de la antigüedad aplicaron de manera empíricas estas observaciones en la crianza del ganado y en la agricultura .
Universidad Católica los Ángeles de Chimbote - ULADECH 203

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Muchos de los hechos sociales del esclavismo estaba ligado al convencimiento de la fecundación de transmiten las caracterizas de los padre a los hijos. Hipócrates, quien fuera el primero en enseñar sobre la herencia, creía que en el semen del hombre se encuentran todo los elementos representativos del ser hum ano, incluso los adquiridos, señalaba: el calvo tendrá hijos que serán calvos, y el que tiene ojos azules engendrará hijos que tiene ojos azules. Aristóteles discrepaba respecto a los caracteres adquiridos , señalando que el semen actúa modelando la sangre materna en la formación del descendiente. Bajo los criterios desarrollados por Platón, se promovía como política de estado la reproducción y el cuidado de aquellos individuos mejor dotados, impidiendo en muchos casos la reproducción de los esclavos, a qui enes se le consideraban inferiores, Sócrates también fue de la misma opinión. En sentido opuesto se pronuncia Demócrito sosteniendo que la capacidad de los individuos se debía más a la capacitación que a la predisposición heredada. Es interesante observar como muchos estudios son utilizados por ciertos sectores sociales para mantener sus estados de dominación clasista. En nuestros tiempos aú n se mantienen algunas de esas ideas primitivas, se promueve los métodos de control de la natalidad utilizando nuevos argumentos tales como la falsa idea de la superpoblación, y alentándola la xenofobia de las razas fuerte s sobre las débiles. Durante el feudalismo, por limitado desarrollo del conocimiento objetivo , no se generaron aportes teóricos sobre la herencia; más aún la tendencia general era de aceptación tá cita del designio divino. En el renacimiento predominó la teoriza de la preformación, planteada por Aristóteles, retomada y desarrollada por Malpighi (1628-1694), según la cual un organismo en forma de homúnculo esta preformado en e l ovulo o en el espermatozoide. El botánico Linneo, realizo cruces con diversas especies, obteniendo muchos híbridos, sin embargo, debido a su religiosidad no aceptaba la posibilidad de que se originen nuevas especies partir de los cruces. En el año 1761, Koelreuter publicó los resultados obtenidos en sus cruces con plantas de tabaco. Entre 1830 y 1837 Carls Federico Gaertner expuso sus más de 9,000 resultados de hibridación vegetal a la Academia de la Ciencia de Haarlern (Holanda). Naudin, botánico reconocido, presentó el resultado de sus trabajos en 1838. También son importantes los trabajos de Maupertuis (1752) sobre la polidactilia y de Nasse que en 1820 estudió la transmisión hereditaria de la hemofilia. Sin embargo es rec ién en 1865 cuando la Genética tiene su origen como rama científica con la publicación de los hallazgos hechos por Gregor Mendel al cultivar guisantes “Phisum sativum”. Johann Gregor Mendel nació en 1822 en la aldea de Heizendorf. Fue hijo de campesinos. Como consecuencia de sus necesidades económicas tuvo que abandonar sus estudios de filosofía en la Universidad de Viena e ingresar como monje agustino en el Monasterio de Bruno (actual república checa), al hacerse monje adoptó el nombre de Gregorio, como s e le conoce actualmente.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El mayor mérito de Mendel fue el modo en el que abordó sus trabajos; observó y analizó las características de las plantas de arvejas de forma aislada, a diferencia de los anteriores experimentos que habían tomado en cuenta los caracteres globales. No se conocía aún en aquella época los genes ni su localización en los cromosomas y núcleo celular. En 1888 Waldeyer acunó el término Cromosoma para cuerpos celulares que Homeister había observado en 1848. No fue sino hasta el año de 1900 en que los trabajos de Mendel fueron revalorados cuando Correns, Tschermak Y Hugo de Vries llegaron a las mismas conclusiones. Luego vendría el aporte del genetista inglés Reginald Punnett. En las primeras décadas del siglo XX, Sutton, Boveri y Morgan demostraron que los genes descritos por Mendel como factores estaban situados en los cromosomas. Morgan y colaboradores revelaron en la “mosca de la fruta” Drosophila melnogaster la base genética de la determinación del sexo y la he rencia ligada al sexo. El más importante de los principios establecidos por Morgan y sus colegas fue que los factores de Mendel, los genes, están ubicados en los cromosomas. En 1927, Muller demostró que se podía inducir la mutación de los genes mediante la acción de los rayos X. En 1941. Beadle y Tatum plantearon la correlación: un gen una enzima; es decir, que un gen origina a una enzima. En 1953, James Watson, Francis Crack y Maurice Wilkins plantearon el modelo de la doble hélice para explicar la estructura del ADN. Sus trabajos se basaron en el aporte de Linus Pauling, Edwin Chargaff y Rosalind Franklin. A partir de este modelo el desarrollo de la Genética ha sido vertiginoso, está revolucionando las ciencias biológicas. 3. APLICACIONES DE LA GENETICA Como se ha señalado, desde tiempos antiguos se a plico el conocimiento empírico de la herencia en el aumento de la producción agrícola y ganadera en el cruzamiento de especies vegetales de grandes frutos y de especies de animales productoras de mucha
Universidad Católica los Ángeles de Chimbote - ULADECH 205

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

carne, leche o huevos. En al actualidad se trabaja en el mejoramiento genético de las especies. Gracias a la genética se ha logrado la prevención y el tratamiento de diversas enfermedades asociadas a la herencia, tales como la eritoblastosis fetal y la diabetes mellitus. Actualmente por ejemplo; se produce insulina para los diabéticos, utilizando genes (ADN) que se incorpora a bacterias; del m ismo modo como se produce ínter leucinas para los que padecen de enfermedades inmunitarias. Mediante la técnica de hibridación del ADN se puede realizar estudios de evolución de los seres vivos; de lo que a su vez permite establecer los parentescos entre diferentes especies. La técnica de clonación, producción de idénticos, si se aplicara en la ganadería a gran escala podría servir para satisfacer el hambre de muchos países. El establecimiento de la paternidad en casos de problemas judiciales se puede so lucionar con la llamada prueba del ADN. Esta misma prueba permi te, en base de análisis de cadáveres, dar con la identidad de individuos desaparecidos. La principal limitación que se sigue observando es que el conocimientos y los logros obtenidos no se encuentran al servicios de los amplios sectores de la humanidad, si no que están sujetos al control de las clases d ominantes y de los grandes consorcios imperialistas. 4. CONCEPTO BASICOS: Gregorio Mendel, considerado el iniciador de la genética, acuño algunos términos para utilizarlos en la descripción de sus experi mentos tales como: generación p (parental), generación F1 (1ra. filial), generación F 2 (2da. filial), factor dominante y factor recesivo. Con el paso de los años y los avances de la ciencia se ha ido sumando nuevos términos y conceptos tales como: gen, alelos, carácter, cromosomas homólogos, locus, loci, genotipo, fenotipo, etc. La transmisión de caracteres de generación ocurre cuando los organismos se reproducen y los descendientes se desarrollan manifestando las características heredadas.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

GENERACION PATERNA (P) En la reproducción sexual típica participan dos progenitores; uno es el macho representando con el símbolo de Marte (dios de la guerra); y el otro es la hembra, representando con el símbolo de Venus (diosa de la fecundidad ). Los padres es lo que Mendel denominaba la generación P (paterna). Los progenitores forman células especiali zadas llamadas gametos (Gamos = esposo). El gameto masculino en los animales es una célula flagela da conocida como espermatozoide y el gameto femenino es inmóvil y ovoide l lamada consecuentemente ovulo (huevo pequeño). En las plantas superiores los gamet os son los anterozoides, la ovocélula y la célula polar. GENERACION FILIAL (F) Los gametos se fusionan en el proceso de fecundación originando el huevo (cipote o zigoto), que al desarrollarse fuera o dentro del cuerpo de la hembra origina un individuo o hijo que constituye la primera generación o generación F 1 (Filium = hijos, tribu). La descendencia de la primera generación se denomina F 2.

LA MOLECULA HEREDITARIA : EL ADN Los seres vivos poseen muchas características, algunas de ellas son comunes a todas las especies, otros son patrimonios de solo algunas especies y existen incluso características específicas a grupos muy pequeños de individuos de una especie. Las características biológicas heredables son aquellas que se han ido desarrollan do a lo largo de la evoluciona y que no dependen directamente de los procesos de la socialización. El habla, el comportamiento social y sexual, la actitud para el deporte y las matemáticos no son heredables pues se adquieren según el estimulo recibido durante el desarrollo.
Universidad Católica los Ángeles de Chimbote - ULADECH 207

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Las características biológicas heredables dependen de la existencia de un tipo especial de información a nivel molecular, contenida en las moléculas de acido desoxirribonucleico o ADN constituyendo su material genético. En las eucariotas del ADN se encuentran formados parte de la cromatina y, cuando esta se condensa forma parte de los cromosomas. Los organismos que se reproducen sexualm ente heredan a través de los gametos de sus progenitores los cromosomas, la cromatina y el ADN de s u progenitor. En cualquier caso, las cantidades heredadas de cada uno son equivalentes y en la misma proporción. Es decir, cada individuo recibe la mima cantidad de información de cada progenitor. Por ello en cada individuo los segmentos de ADN, cromatina y cromosomas se hayan en pares.

Cuando los gametos se combinan para formar un cigoto, éste y el embrión resultante tienen pares homólogos de cromosomas, pero en cada par u n miembro será de origen materno y otro será paterno. Cada par portará genes alélicos.

CROMOSOMAS Los cromosomas se definen como cuerpos de cromatina (ADN y Proteínas) condensada. Durante la reproducción cada gameto es portador de la mitad del número cr omosómico que caracteriza a una especie dada. Cuando se forma el cigoto en su núcleo encontraremos pares de cromosomas morfológicas y genéticamente similares. Cada par esta formado por uno de origen paterno y otro de origen materno, este par de cromosomas se denomina homólogos (homo = igual), de acuerdo a los postulados de la teoría cromosomita de Morgan, los cromosomas son l os cuerpos que portan los genes . o LOCUS Es el lugar físico que ocupa un gen dentro de los cromosomas. o LOCI Evidentemente un cromosoma porta muchos genes y por lo tanto existen muchos locus. El conjunto de los locus de un cromosoma se denomina loci.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

GEN Palabra griega que significa llegar a ser o convertirse en algo. Los genes son los factores de la herencia, las unidades que determinan la transmisión de caracteres (gen = origen). Según Banzer se trata de un cistrón es decir, un fragmento limitado de ADN, con una secuencia especifica de nucleótidos, que tiene información y por tanto codifica para la in formación de un polipéptido. En los escaritas el descubrimiento de la maduración del ARNm permitió definir a los genes como fragmentados o discontinuos, por que están constituidos por secuencias modificantes o exones y secuencias no codificantes o intr ones. ALELOS (genes alelomorfos) Son las variantes hereditarias de un gen, es decir segmentos de ADN que controlan un carácter biológico porque contienen información diferenciable en su expresión. Los alelos han surgido a lo largo de la evolución como co nsecuencia de mutaciones que han modificado la secuencia original de nucleótidos en el segmento de ADN. En los organismos diploides (con dos juegos cromosómicos) los caracteres biológicos son controlados en algunos casos por pares de alelos, es decir gen es que contiene información para una misma característica y localización en el mismo locus de un par de cromosomas homólogos .Un par de alelos siempre estas formado por uno que se hereda del padre y otro de la madre.

GENOTIPO Es la carga o constitución genética de un individ uo; es decir la clase de alelos que existe en sus células; a veces los dos alelos heredados son iguales, lo que da lugar a dos genotipos: genotipo homocigoto y genotipo heterocigoto. o GENOTIPO HOMOCIGO O PURO Cuando dos genes alelos son idénticos. Se les llama homocigoto dominante cuando los dos son dominantes y se denotan, por ejemplo: AA. Otras veces los dos genes
Universidad Católica los Ángeles de Chimbote - ULADECH 209

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

son recesivos a lo que se denomina homocigoto recesivo y se denota, Ejemplos: aa. En los otros tipos de los alelos se sigue el mismo patrón. o GENOTIPO HETEROCIGOTE O HIBRIDO Cuando los dos genes alelos son diferentes. Ejemplo: uno dominante y otro recesivo, el primero se denota con la letra mayúscula y seguidamente se presenta el recesivo con una letra minúscula, Ejemplo: Aa FENOTIPO Es el resultado de los genes alelos y su interacción. Se trata de las características observables, visibles y detectables de un organismo; tales como y tamaño, forma, textura, color, brillo, olor, etc. Para determinar un fenotipo se puede requerir de pruebas, por ejemplo para decir que una persono es grupo sanguíneo A Rh positivo se requiere de un análisis de un grupo sanguíneo. El fenotipo que depende de alelos dominantes se denomina carácter dominante, mientras el dependiente de los alelos recesivos se denomina carácter recesivo. GENÉTICA MENDELIANA

PRINCIPIOS Y LEYES DE MENDEL Mendel eligió para sus experimentos el guisante (Phisum sativum) común de jardín, conocido también como “legumbre”, “chícharo” o “arveja”. Al escoger a la “arveja” tomo en cuenta lo siguiente: 1. Fácil disposición de muchas variedades que se podían cultivar. 2. Los guisantes tienen flores que se autofertilizan. En sus experimentos Mendel extrajo todos los estambres de las flores de un grupo de plantas para convertirlas en femeninas, luego las polinizó con polen de otras plantas y obtuvo la F :1. Para obtener la F:2 dejó que las plantas de la F:1 se auto polinizaran.
Universidad Católica los Ángeles de Chimbote - ULADECH 210

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Mendel estudió caracteres opuestos en las plantas de arvejas, los siguientes caracteres fueron estudiados para establecer sus postulados: Carácter Forma de la semilla Color de la semilla Posición de la flor en el tallo Color de la cubierta de la semilla Forma de la vaina oi fruto Color de la vaina Altura Dominante Lisa (redonda) Amarillo Axial- a lo largo del tallo Gris Lisa (Inflada) Verde Alto (largo) Recesivo Rugosa (Arrugada) Verde Terminal- en la punta Blanca Rugosa (Arrugada) Amarillo Bajo (Corto)

El carácter del color de la flor de las “arve jas” también fue estudiado por Mendel, pero no lo consideró carácter dominante ni recesivo.


Mendel hizo publico sus trabajos el 8 de febrero de y el 8 de marzo de 1865 en dos re uniones de la Sociedad de Historia Natural de Bruno. De acuerdo a datos muy recientes, también experimento con ratones, sin embargo, sus trabajos no fueron publicados por cierto pudor religioso.

PRINCIPIO DE LA UNIFORMIDAD Y LA RECIPROCIDAD (Principio de la dominancia) Del cruce de dos líneas puras la primera generación filial (F:1) estará formada por individuos idénticos que presentan solo uno de los caracteres al ternativos paternos, cualquiera que sea la dirección del cruce. Mendel tomó plantas altas (trepadoras) y plantas enanas (matas) de línea pur a, es decir homocigotos, realizó cruzamientos entre estos dos grupos de plantas; y obtuvo una descendencia F:1 donde todas las plantas eran altas (trepadoras). Generación P : Planta alta x planta enana. Generación F1 : Plantas altas. Esta clase de apareamiento se le llama cruce monohíbrido ya que es sólo para una característica; en este caso la talla de la planta. En la generación F:1 formada, las plantas altas eran más altas que la generación P.
Universidad Católica los Ángeles de Chimbote - ULADECH 211

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

¿Cómo se explica que del cruce de dos plantas, una alta y una enana, de descendientes sólo plantas altas? ¿Que sucedió con el carácter enano? La explicación se encuentra en que los individuos cruzad os de la generación paterna (P) son homocigotos .La planta alta era homocigoto dominante (AA) y la planta enana homocigoto recesiva (aa); el resultado del cruce genera heterocigotos (Aa) donde el alelo dominante (A) se expresa y el alelo recesivo (a) no se expresa en el fenotipo final . El rasgo enano no sea ha expresado, pero la descendencia porta el gen recesivo (a).

Los resultados del cruzamiento son la F :1 (primera generación) y se expresan de la siguiente forma: GENOTIPO Proporción genotípica Probabilidad porcentual genotípica FENOTIPO Proporción fenotípica Probabilidad porcentual fenotípica 4/4 Aa (Heteroci gotas) 100% Aa (Heterocigotas) 4/4 altas 100% altas

LEY DE LA SEGREGRACION Y PUREZA DE LOS GAMETOS También es conocida como ley de la disyunción. Mendel la planteó así: Los caracteres hereditarios están controlados por pares de factores hereditarios, los cuales se separan durante la formación de gametos. Actualmente, se plantea de la siguiente forma: Los dos miembros de una pareja genética se distribuyen separadamente entre lo s gametos, de modo que la mitad de gametos lleva un miembro de la pareja y la otra mitad el otro. Mendel tomo dos plantas de la F:1 y las cruzó obteniendo una F:2, donde el 75% de las plantas eran altas y el 25% enanas, es decir, se daba una relación 3:1. Generación F 1 : planta alta x planta alta. Generación F 2 : 75% plantas altas, 25% plantas enanas. ¿Cómo se explica que del cruce de dos plantas altas se obten ga como descendientes plantas enanas?
Universidad Católica los Ángeles de Chimbote - ULADECH 212

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La explicación se encuentra en que los individuos cruzados de la F :1 eran heterocigotes (Aa). De acuerdo a la ley de la segregación los gametos serían el 50% con el factor dominante (A). Y el 50% con el factor recesivo (a). Al producir las fecundaciones, 3 de las cuatro posibilidades llevan por lo menos un gen dominante por lo que son altas y uno resulta ser homocigoto recesivo (aa) y manifiesta el fenotipo de planta enana (baja).

Los resultados del cruzamiento son la F2 (segunda generación) y se expresa de la siguiente forma: GENOTIPO Proporción genotípica Probabilidad genotípica Probabilidad porcentual genotípica Relación genotípica FENOTIPO Proporción fenotípica Probabilidad fenotípica Probabilidad porcentual fenotípica Relación fenotípica 1/4 AA 1/4 AA 25% AA 1AA : 2/4 Aa : 1/2 Aa : 50% Aa : 2Aa : : : : 1/4 aa 1/4 aa 25% aa 1aa

3/4 altas : 3/4 altas : 75% altas : 3 altas :

1/4 enanas 1/4 enanas: 25% enanas 1 enana

Este cruzamiento también se puede resolver usando el tab lero de Punnett, llamando así en honor al genetista que lo propuso. El tablero de Punnett es un conjunto de cuadriculas que se utiliza para realizar las posibilidades de fecundación de una forma ordenada. El tablero de Punnett tiene la siguiente estruct ura: TABLERO DE PUNNETT ♀ ♂ Gameto masculino Gameto masculino Gameto femenino 25% Cuadrilula 1 25% Cuadricula 3 Gameto femenino 25% Cuadricula 2 25% Cuadricula 4

n = número de generaciones
Universidad Católica los Ángeles de Chimbote - ULADECH 213

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Si utilizamos el tablero para el cruce anterior, la solución seria:

Se considera como proporción genotípica : 1 : 2 : 1. y como proporción fenotípica : 3:1

LEY LA DISTRIBUCION INDEPENDIENTE DE LOS CARACTERES También llamada distribución de la libre combinación de factores hereditarios. Men del planteo que cuando dos o más factores hereditarios se agregan simultáneamente la distribución de cualquier de ellos es independiente de los demás. Actualmente se sostiene que du rante la formación de la célula sexual, en cada gameto se incluye solamente un gen de cada par. En el guisante Mendel encontró que la semilla amarilla (A) era dominante a la semilla verde (a) y que la forma lisa de la semilla era dominante (B) sobre la rugosa (b). Cuando se cruza una planta de s emillas amarillas y redondas (AABB ) con una planta de semillas verdes y rugosas (aabb) se obtiene plantas de semillas amarillas y redondas (AaBb).

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

P: plantas de semillas amarillas y lisas x plantas de semillas verdes y rugosas AABB aabb F1: plantas de semillas amarillas y lisas AaBb ¿Cómo se explica este resultado? Primero, hay que tener en cuenta que se trata de dos caracteres: el color de la semilla, y la forma de la semilla. Segundo, para el color de la semilla tenemos el alelo dominante A (amarillo) y el alelo recesivo a (verde), para la forma, el alelo dominante B (lisa) y el alelo b (rugosa). Tercero, debido a la independencia de los pares de alelos, o sea del que determina el color con respecto al que determina la forma, se tiene los siguientes game tos:

Cada gameto posee un gen para el color y otro para la forma. Además los gametos del primer progenitor son (AB) y los gametos del segundo progenitor son (ab) . Los resultados de la fecundación siempre darán AaBb. La fecundación se puede representar en un tablero de Punnett de 16 posibilidades o en uno resumido de solo una posibilidad. TABLERO DE PUNNETT DE 16 POSIBILIDADES

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Cuando se cruza dos plantas F1 de semillas amarillas - lisas (AaBb) se obtiene 9 amarillas lisas, 3 amarillas - rugosas, 3 verdes - lisas, 1 verde - rugosa.

GENOTIPO Proporción genotípica: Probabilidad genotípica: Relación genotípica: FENOTIPICO Proporción fenotípica: Probabilidad fenotípica: Relación fenotípica: 9/16 amarilla - lisas 3/16 verdes - lisas 9/16 amarillas - lisas 3/16 verdes - lisas 9 amarillas - lisas 3 verdes - lisas : : : : : : 3/16 amarillas - rugosas; 1/16 verdes - rugosas. 3//16 amarillas - rugosas; 1/16 verdes – rugosas 3 amarillas - rugosas; 1 verde - rugosa 1/16 AABB; 2/16 AaBB; 2/16 AaBB; 4/16 AaBb; 1/16 AAbb; 2/16 Aabb; 1/16 aaBB; 2/16 aaBb; 1/16 aabb. 1/16 AABB; 1/8 AABb; 1/8 AaBB; 1/4 AaBb; 1/16 AAbb; 1/8Aabb; 1/16 aaBB; 1/8 aaBb; 1/16 aabb. 1 AABB; 2 AABb; 2 AaBB; 4 AaBb; 1 AAbb; 2 Aabb; 1 aaBB; 2 aaBb; 1 aabb.

¿Cómo se explica la relación entre genotípico y fenotipito en estos casos? Recuerde que el alelo A es para semilla amarilla y es dominante sobre su alelo a que es para semilla verde. Recuerdas también que el alelo B es para semilla lisa y dominante sobre su alelo b que es para semilla rugosa. Por lo expuesto, analiza la siguiente relación genotípica y su correspondiente relación fenotípica.
Universidad Católica los Ángeles de Chimbote - ULADECH 216

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

RELACION GENOTIPICA 1 AABB 2 AABb 2 AaBB 4 AaBb 1 AAbb 2Abb 1 aaBB 2 aaBb 1 aabb

Se expresan los genes 9A_B_

RELACION FENOTIPICA 9 amarillas - lisas

3 A _ bb 3 aaB _ 3 aabb

3 amarillas - rugosas 3 verdes - lisas 1 verde - rugosa


Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 218

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


Universidad Católica los Ángeles de Chimbote - ULADECH 219

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular


En la primera década del siglo XX se observó que algunos heterocigotos mostraban rasgos intermedios, lo que contradecía la herencia descubierta por Mendel o de la dominancia completa, este tipo de herencia sería llamada con el tiempo NO MENDELIANA. Sin embargo, la dominancia completa no es lo esencial de las leyes de Mendel, lo importante de ellas es la forma en que se transmiten las características biológicas. Mendel y los Mendelistas aportaron con el descubrimiento de los principios básicos que rigen la herencia de las plantas y en los animales. Por ello se prefiere usar el concepto de herencia Postmendeliana para referirse a la que se desarrolla después de los aportes de Mendel y de los Mendelistas. La Dominancia incompleta es la interacción génica en la cual los homocigotos son fenotípicamente diferentes a los heterocigotos. Los cruzamientos que tienen una dominancia incompleta son aquellos en los que no existe rasgo dominante, ni recesivo. Suponiendo que la forma de los ojos estuviera determinada por un gen cuyo homocigoto dominante da forma grande y redonda y el homocigoto recesivo da una forma semi -alargada, y el heterocigoto resulte con forma achatada y más alargada que la de cualquier progenitor homocigoto para esta característica, se puede tener el ejemplo en los progenitores IJ y KL y most rándose en el heterocigoto IJKL. Hay dos tipos: Herencia Intermedia (Dominancia incompleta) En los cruzamientos que hay una herencia intermedia o sin dominancia, los individuo s heterocigotos para cierta característica expresan una "condición intermedia" de los dos genes alelos. Por ejemplo: al cruzar dos plantas de líneas puras, una con flores rojas y otras con flores blancas, la generación filial uno será 100% h eterocigota y 100% plantas con flores rosadas. Para simbolizar los genes de los individuos se usa la letra inicial del rasgo (en el caso anterior C - color de la flor-), en mayúscula y la letra inicial de las distintas expresiones del mismo (Rojo o Blanco), en minúscula y superíndice. Por ejemplo, en la herencia del color de algunas flores el genotipo C RCR expresan color rojo y el genotipo C BCB expresa blanco, mientras el genotipo C RCB expresa el color rosado, es decir el color rojo no es dominante sobre el blanco ni vic eversa, sino que se expresa un color que es intermedio: el rosado. Las plantas híbridas F1 tienen un fenotipo diferente (flores rosadas) de cada uno de los padres. Esto es un ejemplo de dominancia incompleta. Cuando las plantas híbridas F1 se auto fertilizan, ambos fenotipos paternos (plantas con flores rojas y plantas con flores bla ncas) reaparecen en la generación F2.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Codominancia (Dominancia incompleta) En los cruzamientos en los que hay codominancia, en los heterocigotos los dos genes alelos se expresan, pero sin "unirse". Por ejemp lo: en la “achira” (Canna edulis) del cruce de plantas con flores rojas C RCR con plantas de flores amarillas C ACA resultan plantas con flores amarillas y manchas rojas C RCA. ¿Cómo se explica el fenotipo de las plantas de flores manchadas?, los genes CR y CA se manifiestan y dan origen a enzimas que participan en la elaboración de pigmentos rojos en una parte de la flor y pigmento amarillo en otras partes de la misma flor, de tal manera que los colores no se mezclan sino que se expresan por separado. ALELOS LETALES Los alelos letales son alelos mutantes que causan la muerte de los individuos. El alelo que causa la muerte de un organismo es llamado alelo letal y el gen involucrado es llamado gen esencial. Genes esenciales son genes que al mutar pueden resu ltar en un fenotipo letal. Alelo letal dominante es aquel que causa la muerte en heterocigosis. Alelo letal recesivo es aquel que causa la muerte en homocigosis. Un ejemplo de un gen esencial, es el gen para el color amarillo del cuerpo en ratones. El color amarillo es una característica codificada por AY. Ratones genotípicamente AYAY no son viables y mueren antes del nacimiento. Ratones AY A son amarillos y ratones A A son no amarillos. Entonces, cuando ratones amarillos son cruzados con ratones no a marillo, la progenie muestra la proporción esperada de 1:1 de ratones amarillos versus no amarillos. Cuando los ratones heterocigotos de la generación F1 son cruzados entre sí, esperaríamos una proporción 1/4 homocigoto para el color amarillo, 1/2 hetero cigoto para el color amarillo y 1/4 homocigoto para el no amarillo. Pero, los resultados obtenidos indican que dos tercios son amarillos y un tercio no son amarillos, ya que el primer 1/4 muere antes de nacer. El alelo amarillo posee un efecto dominante sobre el alelo no amarillo, pero sucede que cuando el ratón es homocigoto para este alelo ocurre un efecto letal, en otras palabras el alelo amarillo es un alelo letal recesivo.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Patrones de herencia de tres cruces que invol ucran los alelos que se presentan en el tipo salvaje Agoutti y el alelo mutante que le otorga el color amarillo a los ratones. El alelo mutante se comporta de forma dominante so bre el alelo normal en el controlo del color de piel, pero también se comporta como un alelo letal homocigoto. CITOGENÉTICA GENERAL DEFINICION Ciencia híbrida que resultó de la fusión de los estudios de herencia y los estudios sobre la célula. La citogenética se encarga de estudiar el fenómeno de la herencia a nivel celu lar. La herencia de una generación celular a otra se da mediante los cromosomas, por ello la Citogenética es el estudio de los cromosomas. En 1902, Sutton fue uno de los primeros en llegar a la conclusión de que los genes son llevados por lo cromosomas. Estudió el comportamiento de los cromosomas en la meiosis, y la segregación de los genes descritos por Mendel. LA CELULA ES UNA UNIDAD GENETICA Se sabe que la teoría celular propuesta por los alemanes Schleiden y Schwann considera a la célula como una unidad capaz de transmitir sus características de generación en generación. Así en el proceso de división mitótica de una célula diploide se originan dos células dipliodes y las células hijas son idénticas a la progenitora, además las células sexuales que en los animales son los espermatozoides y los óvulos, permiten transmitir características de la generación paterna a los hijos.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

LOS CROMOSOMAS EUCARIOTICOS En las células eucariotas el centro que controla el metabolismo es el núcleo celular. Dentro del núcleo se encuentra un material nucleoproteico llamado cromatina, que está compuesta principalmente por ADN y proteínas histónicas. El ADN es la principal molécula de la herencia. Desde el punto de vista estructural, los fragmentos de ADN con información he reditaria son los genes. Las histonas son proteínas que bloquean y protegen al ADN. En el proceso de la división celular la cromatina condensa y origina cuerpos conocidos como cromosomas. Durante la división, los cromosomas serán los cuerpos responsables de llevar genes de las células madres a las células hijas. Cromosoma (del griego chroma, color, y soma, cuerpo o elemento) es cada uno de los pequeños cuerpos en forma de bastoncillos en que se organiza la cromatina del núcleo celular en la mitosis, cada uno de los cuales se divide longitudinalmente, dando origen a dos cadenas gemelas iguales. Su número es constante para una especie determinada; en Homo sapiens (el ser humano) se tienen 46. De ellos 44 son autosómicos y 2 son sexuales o gonos omas. Es el material microscópico constituido del ADN y de proteínas especiales llamadas histonas que se encuentra en el núcleo de las células eucariotas en las cuales los cromosomas se ven como una maraña de hilos delgados, llamada cromatina. Cu ando la célula comienza su proceso de división (cariocinesis), la cromatina se condensa y los cromosomas se hacen visibles como entidades independientes. La unidad básica de la cromatina son los nucleosomas. Se suelen representar por pares, en paralelo con su homólogo. CONSTANCIA DEL NÚMERO DE CROMOSOMAS Usualmente las especies animales y vegetales tienen un número de cromosomas constante y determinado que constituyen su cariotipo (ley de la constancia numérica de los cromosomas), aunque existen especies con una alta variabilidad cariotípica, no sólo en número sino en forma y tamaño de los cromosomas. Cariotipo: Forma, cantidad y tamaño de los cromosomas. Au nque la diferencia entre un individuo y otro es la información especificada en los genes de estos cromosomas. El número de cromosomas de una especie (o fase vital) diploide se identifica como 2n mientras que ese número en una especie (o fase vital) haploide se identifica con la letra n. En aquellas especies que presentan un número repetido de cromosomas superior a dos complementos se habla de poliploidía, representándose el múltiplo por delante de la letra n. Así: 3n indicaría un complemento cromosómico triploide, 4n un tetraploide, etc. Todas es tas son situaciones euploides. Con la indicación x se quiere expresar el número básico de cromosomas de una especie que presenta individuos con diversos grados de ploidía o el de una línea filogenética a partir de la cual diversos táxones han alcan zado situaciones aneuploides variadas, siendo en este caso el número cromosómico una variación del número original con aumento o disminución del número básico, por pérdida, fusión o división de cromosomas (p. ej., n+1 o n 1). Un ejemplo de esta situación anormal la tenemos en los individuos de la especie humana que presentan el llamado síndrome de Down, situación de aneuploidía (2n=47) por la presencia de un ejemplar más de lo habitual del cromosoma 21 (trisomía). CROMOSOMAS SEXUALES En muchos organismos, uno de los pares de los cromosomas homólogos es distinto al resto, realizando la determinación genética del individuo. A estos cromosomas se les
Universidad Católica los Ángeles de Chimbote - ULADECH 223

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

llama cromosomas sexuales o heterocromosomas e incluso gonosoma s, porque determinan el sexo por la proporción de los dos cromosomas homólogos. Sistema de determinación XY: es propio del ser humano y muchos otros animales. Las hembras, siendo XX, darán gametos iguales con cromosoma X, sexo homog amético y los machos, siendo XY, darán dos tipos de gametos, uno con el cromosoma X y otro con el cromosoma Y. La probabilidad de que en la fecundación, al unirse los gametos, resulte una combinación XX (hembra) o XY (macho) es del 5 0%.

FORMA DE LOS CROMOSOMAS La forma de los cromosomas es para todas las células somáticas constante y característica de cada especie. La forma depende fundamentalmente de las constricciones que presente el cromosoma y de su localización en la cromátida. El cromosoma se encuentra constituido básicamente por el centrómero que divide el cromosoma en un brazo corto o brazo p y un brazo largo o brazo q. Algunos cromosomas presentan satélites en el brazo corto. Según la posición del centrómero, los cromosomas se clasifican en: o Metacéntricos: el centrómero se localiza a mitad del cromosoma y los dos brazos presentan igual longitud. o Submetacéntricos: la longitud de un brazo del cromosoma es algo mayor que la del otro. o Acrocéntricos: un brazo es muy corto (p) y el otro largo (q). o Telocéntricos: sólo se aprecia un brazo del cromosoma al estar el centrómero en el extremo (este tipo de cromosomas no se en cuentran en el cariotipo humano). Los cromosomas son los portadores del ADN, por lo tanto son parte integral estructural imprescindible de los seres vivos.
Universidad Católica los Ángeles de Chimbote - ULADECH 224

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

CARIOTIPO Es el ordenamiento de los cromosomas de una célula metafás ica de acuerdo a su tamaño y morfología. El cariotipo es característico de cada especie y, el humano tiene 46 cromosomas o 23 pares de cromosomas, organizados en 22 pares autosómicos y un par sexual. (Hombre 46 XY) (Mujer 46 XX). Cariotipo de un linfocito de un humano mujer. No obstante puede darse el caso, en humanos, de que exista otros patrones en los cariotipos, a lo cual se le conoce como aberración cromosómica. Mediante el cariotipado se pueden analizar anomalías numéricas y estructurales, cosa que sería muy difícil de observar mediante genética mendeliana. CARIOTIPADO CLÁSICO Existen varios métodos para la visualización mediante microscopía óptica de los cromosomas humanos. Los procedimientos más clásic os consisten en la tinción con sustancias como la mostaza de quinacrina, que permite la observación de las bandas Q, giemsa, que permite la observación de las bandas G, R o C (dependiendo del tratamiento que se realice con el ADN). Este bandeo característico de cada uno de los cromosomas está relacionado con regiones de eucromatina (bandas R), heterocromatina facultativa (bandas G), heterocromatina constitutiva (bandas C). No obstante existen distintas visiones del motivo por el cual se pueden hace r estas correlaciones.

Cariotipo clásico de una mujer normal
Universidad Católica los Ángeles de Chimbote - ULADECH 225

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

No obstante el uso de técnicas de bandeo junto al estudio del cariotipo ha sido utilizado para la detección de aberraciones cromosómicas a gran escala. Es decir, aberraciones que afec tan a regiones de un cromosoma o al propio cromosoma. Estas aberraciones cromosómicas o anomalías cromosómicas se pueden dividir en numéricas y estructurales.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

BIOTECNOLOGÍA MODERNA INTRODUCCION Actividad científica y comercial en la que se usan agentes biológicos (organismos pluricelulares o unicelulares, células vivas o muertas, enzimas) para la producción industrial. La Biotecnología es actualmente una estrategia para aumentar la productividad y obtener mayores ganancias; así el poder económico de empresas transnacionales de los países desarrollados les permite liderar la industria de la biotecnología en el mundo. Empresas como Mnsanto, Novartis y Dow; que dominan el mercado mundial de herbicidas, son también las que monopolizan la oferta de semillas transgénicas. Con la expansión del cultivo transgénico, en cuatro o cinco años el consumo de fertilizantes se quintuplicó, y el de agroquímicos se triplicó. Dominando el mercado de semillas y herbicidas, estas empresas tienen en sus manos el proceso agrícola. La Biotecnología tiene como áreas de aplicación actividades productivas ya existentes, como la agricultura, agro-industria, industria farmacéutica, salud humana, minería, industria química y energética, protección del medio ambiente. RESEÑA HISTORICA DE LA BIOTECNOLOGIA Los inicios de la transformación de alimentos Hace 8 mil años, los sumerios y babilonios comenzaron a produ cir cerveza mientras que los egipcios descubrieron la técnica para elaborar pan de levadura hace 6 mil años. Alrededor de la misma época se desarrollaron otros procesos para la conservación de alimentos (particularmente en China) como la fabricación de yog urt, queso, vinagre y vino. Muchos de estos procesos son tan efectivos que aún hoy seguimos haciéndolos siguiendo el mismo método básico. Así por ejemplo, la producción de cerveza se hace a partir granos sometidos a un proceso de malteo (lo que aumenta su cantidad de enzimas) para convertir el almidón de los granos en azúcar y después añadiendo levaduras específicas para producir la cerveza al convertir los carbohidratos del grano en etanol. Aunque el proceso de fermentación no se comprendió sino hasta los trabajos de Louis Pasteur en 1857, éste es el primer uso de la biotecnología para convertir un alimento en otro. La protección contra las enfermedades En muchas civilizaciones antiguas se emplearon combinaciones de plantas y otros organismos como medicinas. Desde hace aproximadamente 2200 años la gente empezó a utilizar agentes infecciosos inactivos o en muy pequeñas cantidades para inmunizarse contra las infecciones. En 1701, Giacomo Pylarini comenzó a practicar en Constantinopla la "inoculación", el infectar intencionalmente a niños con viruela para prevenir casos más graves más adelante en sus vidas. La inoculación competiría con la “vacunación” por casi un siglo; en esta última técnica, desarrollada en 1798 por Edward Jenner, se infectaba a la gente con viruela bovina para inducir resistencia a la viruela humana, lo que la convierte en una técnica mucho más segura (vacuna viene de la palabra latina vaccinus que quiere decir "a partir de vacas". Estos y otros procesos se fueron refinando a en la medicina moderna y han llevado a muchos desarrollos tales como los antibióticos, vacunas y otros métodos para combatir las enfermedades.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La conservación de los alimentos En 1799, Lazaro Spallanzani realizó experimentos en los que mostró que se podían conservar “infusiones” (medios de cultivo líquidos) por mucho tiempo sin que se descompusieran mediante el calentamiento en agua hirviendo de matraces herméticamente sellados que contenían la infusión, ya que el calor mata los microbios. Antes de esto se pensaba que la vida se generaba de manera espontánea. Para 1809, Nicolas Appert desarrolló una técnica, también usando calor, para enlatar y esterilizar la comida, con lo que ganó un premio de 12 mil francos ofrecido en 1795 por Napoleón. En la primera mitad de la década de 1860, el químico francés Louis Pasteur desarrolló la técnica que lleva su nombre (pasteurización) para preservar los alimentos calentándolos, con lo que se destruye a los microbios dañinos, y manteniéndolos aislados del exterior. Esta técnica ayudó a mejorar la calidad de vida de las personas pues permitió conservar muchos alimentos sin cambiar su sabor, con esto se pudo por ejemplo transportar leche sin que se echara a perder o evitar que el vino se convirtiera en vinagre (“vino agrio”). El nacimiento de la lucha moderna contra las enfermedades Hacia 1850, Ignacio Felipe Semmelweis, un médico austro -húngaro utilizó observaciones epidemiológicas para proponer la hipótesis que la fiebre puerperal se transmite de una mujer a otra a través de los médi cos. Probó su hipótesis haciendo que los médicos se lavaran las manos después de examinar a cada paciente, sin embargo su propuesta fue tan escandalosa en la época que hizo que el resto de la comunidad médica lo despreciara y que perdiera su trabajo. En 1865, Joseph Lister comenzó a utilizar desinfectantes como el fenol en el tratamiento de heridas y en cirugías al tiempo que Pasteur desarrollaba la teoría de los gérmenes como causa de las enfermedades. Para 1882, Robert Koch, usando cobayas como huéspedes alternativos, describió la bacteria que causa la tuberculosis en los seres humanos. Koch fue el primero en descubrir la causa de una enfermedad microbiana humana y estableció qué cada enfermedad es causada por un microorganismo específico. El surgimiento de la genética Hacia 1859, Charles Darwin propuso que las poblaciones animales adoptan formas diferentes a lo largo del tiempo para aprovechar mejor el medio ambiente, un proceso al cual llamó “selección natural”. Mientras viajaba por las Islas Galápagos, observó como los picos de una clase particular de aves se habían adaptado en cada una de las islas a las fuentes de alimentos disponibles y planteó que sólo las criaturas mejor adaptadas a su medio ambiente son capaces de sobrevivir y reproducirse. El lib ro emblema de Darwin “El Origen de las Especies”, opacó todas las otras voces científicas (incluyendo la de Mendel) durante varias décadas. Unos años después, Gregor Mendel, un monje agustino, presentó en 1865 sus leyes de la herencia a la Sociedad de Cien cias Naturales en Brunn, Austria. Su trabajo con chícharos llevó a Mendel a proponer que había unidades internas de información invisibles dentro de los organismos, las que eran responsables de los rasgos observables (como por ejemplo el color, altura de l a planta, tamaño de la vaina, etc.) y que estos factores (que después serían conocidos como genes), se transmitían de una generación a la siguiente, sin cambiar pero recombinándose. El trabajo de Mendel permaneció desapercibido durante largos años a causa del mucho más sensacional descubrimiento de Darwin, hasta 1900 cuando Hugo de Vries, Erich Von Tschermak y Carl Correns publicaron sus investigaciones corroborando el mecanismo de la herencia de Mendel.
Universidad Católica los Ángeles de Chimbote - ULADECH 228

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El papel del ADN en la herencia En 1868, Fredrich Miescher, un biólogo suizo, aisló por primera vez un compuesto al que llamó nucleína y que contenía ácido nucleico, sin embargo esto no se relacionó en su tiempo con las leyes de la herencia. En 1882, Walther Flemming reportó su descubrimiento de los cromosomas y la mitosis. Para 1902, Walter Stanborough Sutton estableció que los cromosomas se encuentran en parejas y que pudieran ser los portadores de la herencia, apoyando la teoría de Mendel y renombrando a sus “factores” con el nombre que los conocemos el día de hoy: “genes”. En 1910 el biólogo estadounidense Thomas Hunt Morgan, descubre que los genes se encuentran en los cromosomas. En 1935 Andrei Nikolaevitch Belozersky logró aislar ADN en forma pura por primera vez y en 1941 George Beadle y Edward Tatum desarrollan el postulado de “un gen una enzima”. En el año de 1944, Oswald Theodore Avery, Colin MacLeod y Maclyn McCarty determinaron que el ADN es el material hereditario, sin embargo su teoría tuvo poca aceptación pues se pensaba que el ADN era una molécula demasiado simple para poder llevar a cabo esta función. Para principios de los 1950, la científica británica Rosalind Franklin trabajaba en modelos estructurales de ADN que más tarde perfeccionarían James Watson y Francis Crick y que serían la base para su descubrimiento de la estructura del ADN, que publicaron en 1953 y en la que proponían el modelo de doble hélice complementaria y antiparalela que hoy conocemos, con lo que inauguraron un nuevo capítulo en el estudio de la genética. La comprensión del ADN fue esencial para la exploración de la biotecnología. Las células son las unidades básicas de la materia viva en todos los organismos y el ADN contienen la información que determina las características que tendrá una célula. Desde el inicio los científicos vislumbraron la posibilidad de nuevos medicamentos diseñados para ayudar al cuerpo a hacer lo que no podía por su propia cuenta o de cultivos capaces de protegerse por si solos de las enfermedades. Las fermentaciones industriales A principios del siglo XX, los científicos ya habían adquirido una mejor comprensión de los fenómenos microbiológicos y comenzaron a explorar nuevas formas de fabricar algunos productos. Así, en 1917, Chaim Weizmann usó por primera vez un cultivo microbiano puro en un proceso industrial para la fabricación de acetona a partir de almidón de maíz usando Clostridium acetobutylicum; de esta manera el Reino Unido pudo fabricar a partir de acetona el explosivo cordita durante la Primera Guerra Mundial. También en la misma guerra, Alemania produjo glicerina por fermentación para la fabricación de nitroglicerina. Así como la biotecnología ayudó a matar soldados, también contribuyó a curarlos. En 1928, Alexander Fleming notó que todas las bacterias que crecían en una placa de cultivo murieron alrededor de un moho que contaminaba al cultivo. Para 1938, Howard Florey y Ernst Chain de la Universidad de Oxford en Inglaterra, aislaron el compuesto causante de este efecto: la penicilina, pero fue hasta la década de 1940 que se logró la produ cción de penicilina a gran escala, que probaría ser altamente exitosa en el tratamiento de heridos durante la guerra. Fleming obtuvo el Premio Nobel de Medicina en 1945 gracias a este descubrimiento. Nuevas agriculturas Trabajando sobre los conocimientos ya existentes, William James Beal desarrolló en 1879 el primer híbrido experimental de maíz, demostrando incrementos en el rendimiento de entre el 21 y el 51 %. En 1918, un ingeniero agrícola húngaro, Karl Ereky, utiliza por primera vez la palabra “biotec nología”. Para el periodo de 1920 a 1930, técnicas de
Universidad Católica los Ángeles de Chimbote - ULADECH 229

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

mejoramiento agrícola se emplean ampliamente en los Estados Unidos incrementando la productividad del campo con lo que para la década de 1940 el país ya era un líder agrícola. Entre esa década y la de los 1960 se conjuntaron una serie de avances tecnológicos en el área agrícola que en conjunto se denominaron la “Revolución Verde” que implicaron el poder tener una mayor disponibilidad de alimentos. La llegada de los híbridos implicó además la creación de nuevos negocios como el de la industria de semillas. Los buenos resultados de estas técnicas en los Estados Unidos llevaron a buscar el exportar la Revolución Verde a otros países a través de la Fundación Rockefeller. Para esto se fundó en México la “Oficina de Estudios Especiales” en 1943, antecesora del “Centro Internacional de Mejoramiento de Maíz y Trigo” (CIMMYT) que se fundaría en 1963. Gracias a estos esfuerzos y a la inversión del gobierno en el área, México se volvió autosuficiente en trigo para 1957 y más tarde exportador. Esto también permitió que la población alcanzara 103.3 millones de habitantes para 2005 cuando en 1900 apenas había 13.6 millones. El CIMMYT más tarde ayudaría a llevar la Revolución Verde a India y después a Filipinas, Indonesia , Pakistán, Sri Lanka y otros países de Latinoamérica, Asia y el norte de África. Gracias a sus contribuciones, uno de los investigadores del CIMMYT, Norman E. Borlaug, ganó el Premio Nobel de la Paz en 1970, el único otorgado por contribuciones a la agricultura. Plantas de laboratorio Desde 1898, el botánico alemán G. Haberlandt pudo cultivar de manera exitosa células vegetales individuales, completamente diferenciadas, aisladas de diferentes tejidos vegetales de varias especies, en un medio de glucosa y peptona, aunque no puedo obtener división celular. Por aproximadamente 35 años se lograron pocos avances en la investigación del cultivo de tejidos, aunque se pudieron cultivar embriones, raíces y otros tipos de tejidos. Fue hasta el periodo de 1934 a 193 9 que tres científicos: Roger-Jean Gautheret, Pierre Nobécourt y Philip White, pudieron establecer las bases del cultivo de tejidos vegetales gracias al descubrimiento de la importancia de los distintos reguladores de crecimiento y otros compuestos como la s vitaminas B, lo que permitió obtener los primeros cultivos permanentes de callos (masas indiferenciadas de células) de zanahoria y tabaco. Durante los siguientes veinte años (de 1940 a 1960), se identificaron una gran variedad de compuestos químicos (hormonas, vitaminas, etc.) con efectos sobre la división celular, el crecimiento y la diferenciación, pudiéndose obtener tejidos y órganos distintos de los originalmente cultivados. Skoog y Miller demostraron en 1958 que la relación de concentraciones entre varios de estos reguladores controla la formación de raíces y brotes, lo que abrió la puerta a la regeneración de plantas completas a partir de la década de 1960; la aplicación de técnicas de crioconservación exitosas a partir de 1976 y la propagación automatizada a partir de 1988. La llegada de la ingeniería genética Desde antes del descubrimiento de la estructura del ADN, en 1941, el microbiólogo danés A. Jost, acuñó el término “ingeniería genética” para designar la idea que, escribiendo directamente la información en las células se podían modificar sus funciones. Más tarde, entre 1945 y 1950, se lograron crecer cultivos de células animales aisladas en el laboratorio, lo que permitiría su estudio y aprovechamiento industrial. En 1957, Francis Crick y George Gamov trabajaron en lo que se conoce como el “dogma central” que explica cómo el ADN fabrica proteínas, cómo su secuencia especifica la de los aminoácidos en dichas proteínas y cómo fluye la información en una sola dirección, del ADN al ARN
Universidad Católica los Ángeles de Chimbote - ULADECH 230

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

mensajero y a las proteínas. Para 1966 el código genético pudo ser descifrado, Marshall Nirenberg, Heinrich Mathaei y Severo Ochoa demostraron que una secuencia de tres bases determina cada uno de los 20 aminoácidos. Más tarde, en 1972, Paul Berg aisló y empleó una enzima de restricción para cortar ADN y después unirlo formando una molécula circular híbrida: la primera molécula de ADN recombinante. Al año siguiente, Stanley Cohen, Annie Chang y Herbert Boyer cortaron secciones de ADN viral y bacteriano para crear un plásmido con resistencia dual a antibióticos y lo insertaron al ADN de una bacteria produciendo el primer organismo con ADN recombinante. La primera compañía biotecnológica En 1976, Herbert Boyer y Robert Swanson fundan Genentech, Inc., la primera compañí a biotecnológica, dedicada al desarrollo y comercialización de productos basados en el ADN recombinante, y al año siguiente Genentech reporta la producción de la primera proteína humana fabricada en una bacteria: la somatostatina. Por primera vez se usa un gen sintético recombinante para producir una proteína por lo que muchos consideran a este hecho como el inicio de la Era de la Biotecnología. En 1978 Genentech se convierte en la primera empresa biotecnológica en entrar a la bolsa de valores de Nueva York , y ese mismo año, junto con The City of Hope National Medical Center, anuncia la producción exitosa en laboratorio de insulina human usando la tecnología del ADN recombinante; en 1982 Genentech recibe aprobación de la FDA para comercializarla, lo que la c onvierte en el primer medicamento de origen recombinante aprobado. La biotecnología moderna y la industria A partir del inicio de la Era de la Biotecnolo gía, los avances en el campo han sucedido a gran velocidad. Así, en 1980 la Suprema Corte de los Esta dos Unidos determinó que los organismos modificados genéticamente podían ser patentados, lo que permitió a la compañía Exxon patentar un microoganismo (derivado del género Pseudomonas) diseñado para “comer” petróleo y utilizarse en derrames. Ese mismo año se consigue introducir exitosamente un gen humano (el que codifica para la producción de interferón) en una bacteria y al año siguiente Bill Rutter y Pablo Valenzuela publican un reporte en la revista Nature sobre un sistema de expresión en levaduras para producir el antígeno de superficie del virus de la hepatitis B y que llevaría más adelante a que la FDA aprobara a Chiron Corp., en 1986, la producción de la primera vac una recombinante: Recombivax HB . También en 1981, un grupo de científicos de la Univers idad de Ohio produjeron los primeros animales transgénicos al transferir genes de otros animales a ratones y en 1988 los biólogos moleculares Philip Leder y Timothy Stewart recibieron la primera patente para un animal genéticamente modificado, un ratón alt amente susceptible a desarrollar cáncer. La biotecnología moderna entra a nuestras vidas En el año de 1984, Alec Jeffreys introduce la técnica de caracterización de ADN para la identificación de personas y al año siguiente comienza a usarse como una he rramienta legal en las cortes de los Estados Unidos. En 1985, la compañía belga Plant Genetic Systems fue la primera en desarrollar plantas genéticamente modificadas con resistencia al ataque de insectos. Esta compañía desarrolló plantas de tabaco que expr esaban genes que codifican proteínas insecticidas de la bacteria Bacillus thuringiensis (Bt). En 1987, Calgene, Inc. recibe una patente para la secuencia de ADN de la poligalacturonasa del jitomate, usada para producir una secuencia antisentido de ARN que permite alargar la vida de anaquel de este fruto. En 1993 la FDA declara que los alimentos genéticamente
Universidad Católica los Ángeles de Chimbote - ULADECH 231

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

modificados “no son inherentemente peligrosos” y por lo tanto no requieren de una regulación específica, lo que permite que estos jitomates obtuvieran el permiso de la FDA para ser comercializados, lo que ocurriría bajo el nombre “Flavi Savr”. En 1988, Genencor International, Inc. recibe una patente para el proceso de fabricación de enzimas resistentes a cloro para su uso en detergentes. Para el año 2000 , se anuncia la creación del “Arroz Dorado” (Golden Rice), una variedad de arroz modificada para producir vitamina A, que se espera ayude a mejorar la salud en los países en desarrollo y a prevenir algunas formas de ceguera. Todos estos avances llevan en 2 004 a que la FAO apoye el uso de los cultivos obtenidos por técnicas de ingeniería genética como una herramienta complementaria a las técnicas agrícolas tradicionales para ayudar a los campesinos y consumidores en los países en vías de desarrollo. Pasos hacia la medicina del futuro En 1989 se crea el Centro Nacional de los Estados Unidos para la Investigación del Genoma Humano (National Center for Human Genome Research), dirigido por James Watson para supervisar el proyecto elaborar el mapa y la secuencia del ADN humano para 2005. Al año siguiente se inauguró de manera formal el Proyecto Internacional del Genoma Humano (International Human Genome Project). La meta de este proyecto era identificar y secuenciar todos los genes del genoma humano. En 1990 se l leva a cabo la primera terapia génica en una niña de cuatro años con una enfermedad del sistema inmune llamada “deficiencia ADA”; aparentemente la terapia funcionó, pero desató una serie de debates sobre los aspectos éticos de la misma. En 1998, dos grupos de investigación tuvieron éxito en el cultivo de células troncales embrionarias, lo que abriría nuevas perspectivas para el tratamiento de enfermedades. Como resultado del proyecto del Genoma Humano, se publica en 2001 la secuencia de dicho genoma en las revistas Science y Nature, haciendo posible el que investigadores de todo el mundo comiencen a desarrollar tratamientos genéticos a enfermedades. La secuencia se completó para el 2003, dos años antes de lo planeado y con un gasto menor al estimado. Un grup o de investigadores anuncia en 2002 sus resultados exitosos en la obtención de una vacuna contra el cáncer cérvico, la primera vacuna preventiva para algún tipo de cáncer. En 2003, se encuentra un gen relacionado con la depresión y se avanza en la detecció n de lazos genéticos con esquizofrenia y desorden bipolar. Ese mismo año, el gobierno de China aprueba el uso del primer producto de terapia génica (Gendicine), desarrollado por la compañía Shenzhen SiBiono GenTech para el tratamiento de cáncer de cabeza y cuello. Más avances en genética Para 1996, un grupo de científicos reportó la primera secuencia completa de un organismo complejo: la levadura de pan Saccharomyces cerevisiae. El año siguiente pasaría a la historia por el anuncio de investigadores del I nstituto Rosalin de Escocia sobre la clonación de una oveja, a la que llamaron Dolly, a partir de una célula adulta. A partir de la secuenciación del primer organismo complejo, comienza la carrera por obtener el genoma de más organismos, así en 1998 se obt uvo la secuencia del gusano Caenorhabditis elegans, el primer genoma completo de un animal; en 2000 la primera planta, Arabidopsis thaliana; en 2002 la primera planta usada como alimento, el arroz, así como el parásito que causa la malaria y la especie de mosquito que lo transmite; en 2004 el pollo, la rata de laboratorio y el chimpancé, el primate más cercano al hombre; en 2005 el perro; en 2006 la abeja y de manera parcial el Neandertal; y en 2007 el caballo. En el año 2002, un grupo de investigadores logra obtener un virus sintético (de poliomielitis) partiendo únicamente de su genoma; este logro despierta muchas preguntas éticas y de seguridad. Ya en 2005, se
Universidad Católica los Ángeles de Chimbote - ULADECH 232

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

logra sintetizar parcialmente al virus de la influenza causante de la muerte de al menos 20 millones de personas en todo el mundo de 1918 a 1919. En 2003 se logra clonar por primera vez una especie en peligro de extinción (el banteng) y otras especies como el caballo, venados y mulas; al año siguiente se lleva a cabo la clonación de la primera mascota: un gato; un año más tarde, en 2005, se logra la clonación de una vaca a partir de células de un animal muerto. En el año 2005, científicos de la Universidad de Harvard reportan haber tenido éxito en convertir células de piel en células troncales embrion arias al fusionarlas con células troncales embrionarias existentes.

De acuerdo a la técnica, la Biotecnología puede ser dividida en dos categorías: tradicional y moderna. A. Biotecnología tradicional Utiliza técnicas tradicionales y sus principales productos son alimentos tales como el pan, el yogur, las leches agrias, los quesos; saborizantes como el sillao, los sazonadores; alcohol industrial, antibióticos y ácido cítrico. B. Biotecnología moderna Emplea técnicas novedosas de ingenier ía genética para obtener organismos capaces de formar productos útiles en el campo de la industria, salud y medio ambiente. En este campo sobresale el cultivo de células y tejidos, la hibridación, la transgenia, la clonación, la terapia génica y el estudio de genomas.

La ingeniería genética es la tecnología o más concretamente la biotecnología de la manipulación y transferencia de ADN de un organismo a otro, que posibilita la creación de nuevas especies, la corrección de defectos genét icos y la fabricación de numerosos compuestos. Actualmente la Ingeniería Genética está trabajando en la creación de técnicas que permitan solucionar problemas frecuentes de la humanidad como, por ejemplo, la escasez de donantes para la urgencia de trasplantes. En este campo se están intentando realizar cerdos transgénicos que posean órganos compatibles con los del hombre.

La ingeniería genética que mediante la manipulación de la información genética ayuda al ser humano
Universidad Católica los Ángeles de Chimbote - ULADECH 233

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

El ADN es una base fundam ental de información que poseen todos los organismos vivos, hasta el más simple y pequeño. Esta información está a su vez dividida en determinada cantidad espacios llamado loci (plural) o locus (singular); que es donde se encuentra insertado los genes, que varían dependiendo de la especie. Entre los procesos biotecnológicos destacan la reproducción asistida, que involucra conservación de espermatozoides y óvulos en nitrógeno líquido, la inseminación artificial, fecundación “in Vitro”, conservación de embri ones por congelación, y transferencia e implantación de embriones en el útero de la hembra. La ingeniería genética ha alcanzado en los últimos tiempos un alto grado de desarrollo. Entre las técnicas más usadas y conocidas tenemos: o La tecnología del ADN recombinante. o La reacción en cadena de la polimerasa. o El cultivo de células y tejidos. o La hibridación. o La transgenia. o La terapia génica. o La clonación. o Elaboración de bibliotecas genómicas. o El secuenciamiento de genomas. La ingeniería genética puede definirse como un conjunto de técnicas, nacidas de la Biología molecular, que permiten manipular el genoma de un ser vivo. TECNOLOGIA DEL ADN RECOMBINANTE Esta tecnología nos permite obtener fragmentos de ADN en cantidades ilimitadas, que llevará además el gen o los genes que se desee. Este ADN puede incorporarse a las células de otros organismos (vegetales, animales, bacterias...) en los que se podrá "expresar" la información de dichos genes. (De una manera muy simple podemos decir que "cortamos" un gen humano y se lo "pegamos" al ADN de una bacteria; si por ejemplo es el gen que regula la fabricación de insulina, lo que haríamos al ponérselo a una bacteria es "obligar" a ésta a que fabrique la insulina). Por lo tanto en la tecnología del ADN recombinant e podemos diferenciar cuatro etapas básicas: 1. Corte específico del ADN en fragmentos pequeños y manejables mediante la utilización de un tipo de enzimas conocidas como enzimas de restricción que pueden considerarse como las "tijeras moleculares". Estas enz imas se aislaron en bacterias y se identifican con distintos nombres, siendo lo característico de ellas estos dos principios: o Cada enzima de restricción reconoce una secuencia específica de nucleótidos y corta en ese punto cada una de las cadenas de ADN. o Los extremos libres que quedan se llaman extremos pegajosos, porque pueden unirse a otros fragmentos de ADN que hayan sido cortados por la misma enzima de restricción.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En este esquema se indica el lugar en el que corta la enzima de restr icción. Se aprecia la actuación en ambas hebras.

En este esquema se ve el resultado de la actuación de la enzima de restricción. Ha quedado rota la molécula de ADN, quedando unos bordes pegajosos por donde puede unirse este ADN, con otro aunque sea de una especie diferente.

2. Inserción de los fragmentos de ADN. Esta inserción se realiza en vectores de clonado, que son los agentes transportadores capaces de introducirlos en las células hospedadoras. Los vectores de clonación son pequeñas moléculas de ADN, que tienen capacidad para autorreplicarse dentro de las células hospedadoras. Se utilizan con frecuencia dos tipos de vectores de clonación: plásmidos y virus de introducirlos en las células hospedadoras. Plásmidos. Son moléculas de ADN circular , con un tamaño menor que el del cromosoma. Se replican con independencia del cromosoma bacteriano ya que tienen su propio origen de replicación. En esta secuencia de dibujos se puede ver como se realiza la inserción de un gen en un plásmido. En la figura a tenemos un gen (color rojo) que interesa insertar en un plásmido (color turquesa). En la figura b, vemos como una enzima de restricción ha cortado el gen y el plásmido, quedando unos bordes cohesivos o pegajosos.
Universidad Católica los Ángeles de Chimbote - ULADECH 235

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La unión del ADN que contiene el gen q ue se desea clonar con el vector de clonación, se realiza por medio de otras enzimas, denominadas ADN-ligasas (figura c), que unen ambos trozos de ADN. El resultado es una molécula de ADN recombinante, ya que contiene fragmentos de ADN de distinta procedencia.

Bacteriófagos. El proceso es similar, se trata de insertar el gen deseado en un fragmento de ADN vírico (figura d) Posteriormente se ensamblarán las distintas partes del virus (figura e). Así quedará el virus completo (figura f). En el siguiente paso se insertará este ADN por el proceso de la TRANSDUCCIÓN.

Cósmidos. Son plasmidos que contienen el fragmento de ADN deseado que posee un borde cohesivo procedente del genoma del fago lambda (extremo cos) y se empaqueta en el interior de un fago. Se construye el cosmido uniendo los tres elementos génicos, y el resultado final es poder introducir en la célula receptora fragmentos largos de ADN.

Además del origen de
Universidad Católica los Ángeles de Chimbote - ULADECH 236

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

replicación, los vectores de clonación deben llevar otros genes denominados “marcadores”, que sirven para identificar las células que contienen el vector de clonación. Se suelen utilizar como marcadores, genes de resistencia a antibióticos y genes de bioluminiscencia. o Genes de resistencia a antibióticos. Sirven para identificar bacterias que contienen el vector de clonación, porque estas bacterias serán resistentes al antibiótico del gen marcador. o Genes de luminiscencia. En este caso, la célula que contenga el gen que se quiere clonar, tendrá la propiedad de emitir luz, ya que e l marcador que se le incorpora determina que se exprese esa característica. Este sistema se emplea cuando la célula hospedadora es una célula eucariota. Métodos de introducción del vector El siguiente paso será introducir el vector de clonación que cont iene el gen que se quiere clonar en la célula hospedadora, para que ésta, al multiplicarse, origine un clon celular que lleve el gen concreto. Existen varios métodos que dependerán del tipo de célula fundamentalmente. En bacterias (células procariotas), me diante estos procesos: o Transformación. Ocurre espontáneamente en ciertos tipos de bacterias y se consigue artificialmente sometiendo a la célula bacteriana a tratamientos físicos y químicos. La célula capta moléculas de ADN que se encuentran en el medio externo, las introduce en su interior y las incorpora a su genoma. o Transducción. Este método consiste en introducir el ADN en la célula hospedadora mediante un virus, utilizando como vector de clonación el genoma del virus. En la siguiente figura puede verse el proceso en tres etapas. El número 1 corresponde al virus aproximándose a una bacteria. Se puede observar como lleva un genoma ya con el gen que interesa clonar. El siguiente momento 2, corresponde al contacto entre el virus y la pared bacteriana, en cuya zona de contacto se produce un poro por donde como vemos en la etapa 3, el virus inyecta su ADN al interior de la célula bacteriana.

¿Cómo cortar y pegar el ADN? Tijeras moleculares: enzimas de restricción En 1975 Daniel Nathans y Hamilton O. Smith descubrieron un tipo de proteínas –las enzimas endonucleasas o enzimas de restricción - que actúan como “tijeras moleculares”, cortando la doble cadena de ADN a través del esqueleto de fosfatos sin dañar las bases. El descubrimient o
Universidad Católica los Ángeles de Chimbote - ULADECH 237

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

de estas enzimas condujo a dichos microbiólogos al Nobel en 1978 y dio origen a la ingeniería genética. Las enzimas de restricción son producidas por bacterias como método de defensa contra virus y degradan el ADN extraño. A su vez, el propio genoma bacteriano está protegido contra sus enzimas de restricción mediante metilaciones (es decir, el agregado de un grupo metilo [ -CH3)]) en un átomo específico de ciertos nucleótidos. Estas moléculas son indispensables para la ingeniería genética, ya que produ cen fragmentos que se pueden unir entre sí fácilmente (con la ayuda de un “pegamento molecular”: la enzima ligasa). Las enzimas de restricción cortan dejando extremos cohesivos o romos. Los extremos cohesivos son generados cuando la enzima corta las dos hebras asimétricamente, dejando los extremos de cada hebra de simple s cadenas complementarias entre sí. Por otro lado, los extremos romos son generados cuando la enzima corta las dos hebras por el mismo lugar, generando dos extremos doble cadena.
Figura 1. Enzimas de restricción. Este tipo de endonucleasas puede dejar dos tipos de extremos. En el primer caso, el corte genera nucléotidos de simple cadena llamados extremos cohesivos. Estos extremos se pueden unir por medio de otra enzima, la ADN ligasa. En el segundo caso, se generan extremos doble cadena (extremos romos). Estos extremos también pueden ser unidos con la ayuda de una enzima ligasa pero, como no los extremos no son complementarios, la unión será más inespecífica.

Las enzimas de restricción permiten cortar el genoma de cualquier organismo en pequeños fragmentos llamados fragmentos de restricción. La colección de miles o millones de estos fragmentos se llama biblioteca génica. Actualmente se conocen unas 200 enzimas de restricción ( las más conocidas se muestran en la tabla 1), las cuales se nombran de acuerdo al organismo del cual se extraen, como por ejemplo EcoRI y EcoRII, que se extraen de Escherichia coli o HaeIII que se extrae de Haemophilus aegyptius.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Tabla 1: Algunas de las principales enzimas de restricción conocidas y su origen (en base a Griffiths et al. 1998). Enzima de restricción EcoRI EcoRII HindII HindII HaeIII HpaII PstI SmaI BamI BglII Organismo de donde se extrae Escherichia coli Escherichia coli Haemophilus influenzae Haemophilus influenzae Haemophilus aegyptius Haemophilus parainfluenzae Providencia stuartii Serratia marcesens Bacillus amyloliquefaciens Bacillus globiggi Las enzimas de restricción trabajan únicamente sobre secuencias específicas de bases nitrogenadas, el lugar donde se produce el corte se denomina sitio de restricción y producen dos tipos de corte: (1) corte con extremos cohesivos y (2) corte con extremos romos (ver Fig. 1) (Griffiths et al. 1998). Los extremos cohesivos dejan porciones lineales a ambos lados del fragmento, es decir, quedan pequeñas secuencias de bases sin aparear a cada lado, siendo éstas complementarias entre sí, mientras que los extremos romos son aquellos en los que no queda una porción lineal
Universidad Católica los Ángeles de Chimbote - ULADECH 239

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

a ninguno de los lados. De acuerdo a la especificidad de las enzimas de restricción, se conocen dos tipos: las enzimas de tipo I cortan en un sitio cercano al sitio de restricción, a una distancia que varía aleatoriamente, y por ello no se suelen emplear para DNA recombinan te. Las de tipo II reconocen y cortan en la secuencia específica, y son las más empleadas en este tipo de protocolos por su alta precisión. Las enzimas de restricción de tipo III son similares a las de tipo II en cuanto a la precisión del lugar de corte, p ero se diferencian de éstas en que sólo cortan entre nucleótidos del mismo tipo, por ejemplo entre dos adeninas.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

INTRODUCCION La reacción en cadena de la polimerasa, co nocida como PCR por sus siglas en inglés (Polymerase Chain Reaction), es una técnica de biología molecular desc rita en 1986 por Kary Mullis, cuyo objetivo es obtener un gran número de copias de un fragmento de ADN particular, partiendo de un mínimo; en teo ría basta partir de una única copia de ese fragmento original, o molde. Esta técnica sirve para amplificar un fragmento de ADN; su utilidad es que, tras la amplificación, resulta mucho más fácil identificar con una muy alta probabilidad virus o bacterias causantes de una enfermedad, identificar personas (cadáveres) o hacer investigación científica sobre el ADN amplificado. Estos usos derivados de la amplificación han hecho que se convierta en una técnica muy extendida, con el consiguiente abaratamiento del equipo necesario para llevarla a cabo . FUNDAMENTO E IMPORTANCIA Esta técnica se fundamenta en la propiedad natural de las ADN polimerasas para replicar hebras de ADN, para lo cual emplea ciclos de altas y bajas temperaturas alternadas para separar las hebras de ADN recién formadas entre sí tras cada fase de replicación y, a continuación, dejar que vuelvan a unirse a polimerasas para que vuelvan a duplicarlas. Inicialmente la técnica era lenta, ya que las polimerasas se desnaturalizaban al realizar los cambios de temperatura y era necesario agregar nuevas polimerasas en cada ciclo. Puesto que las temperaturas del ciclo (95 ºC en las fases de desnaturalización del ADN) suponen la inmediata desnaturalización de toda proteína, se emplean ADN polimerasas term oestables, extraídas de microorganismos adaptados a vivir a esas temperaturas, restrictivas para la mayoría de los seres vivos. Dichos micro organismos, generalmente bacterias , son: Thermus aquaticus (polimerasa Taq), Pyrococcus furiosus (Pfu), Thermococcus litoralis (Vent) y Thermus termophilus (Tth). Generalmente se emplean mezclas de polimerasas muy procesivas (Taq) con otras con corrección de errores (Pfu, Vent). Hoy, todo el proceso de la PCR está automatizado mediante un aparato llamado termociclador , que permite calentar y enfriar los tubos de reacción para controlar la temperatura necesaria para cada etap a de la reacción. Muchos termocicladores modernos hacen uso del efecto Peltier, que permite tanto calentar como enfriar los tubos simplemente invirtiendo la corriente eléctrica. Los tubos usados para PCR tienen una pared muy fina, lo que favorece una buena conductividad térmica, permitiendo que se alcance rápidamente el equilibrio térmico. Casi todos los termocicladores tienen un sistema que calienta la tapa de cierre con el fin de evitar la condensación sobre los tubos de reacción. Los termocicladores más antiguos que carecían de este sistema,
Universidad Católica los Ángeles de Chimbote - ULADECH 241

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

solucionaban el problema de la condensación con una capa de aceite en la parte superior de la mezcla de reacción o con un poco de cera dentro de los tubos.
Termociclador original 1987

Por lo general, la PCR es una técnica común y normalmente indispensable en laboratorios de investigación médica y biológica para una gran variedad de aplicaciones. Entr e ellas se incluyen la clonación de ADN para la secuenciación, la filogenia basada en ADN, el análisis funcional de genes, el diagnóstico de trastornos hereditarios, la identificación de huellas genéticas (usada en técnicas forenses y tests de paternidad) y la detección y diagnóstico de enfermedades infecciosas.
Termocclador: aparato en el cuál se realiza la PCR convencional.

REACTIVOS Tubos de PCR que albergan la mezcla en un volumen total de 100 μL. Para realizar la técnica se necesitan: o Desoxinucleótidos trifosfato (dNTPs), el sustrato para polimerizar nuevo ADN. o Dos cebadores (o primers), oligonucleótidos que son, cada uno, complementarios a una de las dos hebras del ADN. Son secuencias cortas, de entre seis y cuarenta nucleótidos, normalmente de 1 8 a 22, que son reconocidos por la polimerasa permitiendo iniciar la reacción. Deben estar situados enfrentados y a no mucha distancia (no más de 4 kb. Delimitan la zona de ADN a amplificar. Además deben de ser complementarios con los extremos 3’ de cada c adena de ADN que se amplificará. o Iones divalentes. Se suele usar magnesio (Mg 2+), agregado comúnmente como cloruro de magnesio (MgCl 2), o algún otro catión divalente. También se puede emplear manganeso (Mn 2+), para mutagénesis de ADN mediante PCR, ya que a ltas concentraciones de Mn 2+ incrementan la tasa de error durante la síntesis de ADN. Actúan como cofactores de la polimerasa. o Iones monovalentes, como el potasio. o Una solución tampón que mantiene el pH adecuado para el funcionamiento de la ADN polimerasa. o ADN polimerasa o mezcla de distintas polimerasas con temperatura óptima alrededor de 70ºC (la más común es la Taq polimerasa). o ADN molde, que contiene la región de ADN que se va a amplificar. o Termociclador, el aparato que va a mantener la temperatura necesaria en cada una de las etapas que conforman un ciclo.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Tubos de PCR que contienen la mezcla en un volumen total de 100 ul.

CICLO DE AMPLIFICACIÓN El proceso de PCR por lo general consiste en una serie de 20 a 35 cambios repetidos de temperatura llamados ciclos; cada ciclo suele consistir en 2 -3 pasos de temperaturas. La PCR común se realiza con ciclos que tienen tres pasos de temperatura. Los pasos de ciclos a menudo están precedidos por un choque térmico (llama do "hold") a alta temperatura ( 95°C), y seguido por otro hold al final del proceso para la extensión de producto final o el breve almacenaje. Las temperaturas usadas y el tiempo aplicado en cada ciclo dependen de gran variedad de parámetros. Éstos incluyen la enzima usada pa ra la síntesis de ADN, la concentración de iones divalentes y dNTPs en la reacción, y la temperatura de unión de los cebadores.

1. INICIALIZACIÓN (DESNATURALIZACION) Este paso consiste en llevar la reacció n hasta una temperatura de 95 ºC (ó 98ºC si se está usando una polimerasa termoestable extrema), que se mantiene durante 1 minuto. Esto sólo es necesario para ADN polimerasas que requieran activación por calor. En primer lugar, se desnaturaliza el ADN (se separan las dos hebras de las cuales e stá constituido). Este paso puede realizarse de diferentes mod os, siendo el calentamiento (95ºC) de la muestra la forma más habitual. La temperatura a la cual se decide realizar la desnaturalización depende, por ejemplo, de la proporción de G+C que tenga l a hebra, como también del largo de la misma. Otros métodos, raramente empleados en la técnica de la
Universidad Católica los Ángeles de Chimbote - ULADECH 243

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

PCR, serían la adición de sales o agentes químicos capaces de realizar la desnaturalización.

2. ALINEAMIENTO/UNIÓN DEL CEBADOR A continuación se producirá la hibridación del cebador, es decir, el cebador se unirá a su secuencia complementaria en el ADN molde. Para ello es necesa rio bajar la temperatura a 60ºC durante 30 segundos (según el caso), permitiendo así el alineamiento. Los puentes d e hidrógeno estables entre las cadenas de ADN (unión ADN -ADN) sólo se forman cuando la secuencia del cebador es muy similar a la secuencia del ADN molde. La polimerasa une el híbrido de la cadena molde y el cebador, y empieza a sintetizar ADN. Los cebadore s actuarán como límites de la región de la molécula que va a ser amplificada.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

3. EXTENSIÓN/ELONGACIÓN DE LA CADENA Actúa la ADN polimerasa, tomando el ADN molde para sintetizar la cadena complementaria y partiendo del cebador como sopor te inicial necesario para la síntesis de nue vo ADN. La polimerasa sintetiza una nueva hebra de ADN complementaria a la hebra molde añadiendo los dNTP's complementarios en dirección 5' → 3', uniendo el grupo 5'- fosfato de los dNTPs con el grupo 3'- hidroxilo del final de la hebra de ADN creciente (la cual se extiende). La temperatura para este paso depende de la ADN polimerasa que usemos. Para la Taq polimerasa, la temperatura de máxima actividad está en 75 -80°C (comúnmente 72°C). El tiempo de extensión depende tanto de la ADN polimerasa usada como de la longitud del fragmento de ADN que se va a amplificar. Hay una regla básica: en su temperatura óptima, la polimerasa de ADN polimerizará mil bases en un minuto. Generalmente el tiempo en esta etapa es de dos minutos. Como se puede observar a las tres e tapas (iniciación o desnaturalización, acoplamiento de los primers o cebadores y la extensión o elongación), demora termino promedio tres minutos y medio y en conjunto recibe en nombre de ciclo. APLICACIONES La técnica de la PCR tiene multitud de aplicac iones: ya en ciencia básica, como herramienta de detección y/o generación de acervos de fragmentos de ADN de interés; ya en ciencia aplicada, como elemento resolutivo en sí mismo, por ejemplo en diagnóstico clínico. o Investigación La PCR convencional se emplea como base para multitud de técnicas en el laboratorio debido a su robustez y rapidez. De este modo, la PCR de punto final permite controlar y detectar los fragmentos de ADN de interés. Clonación de un segmento de ADN mediante amplificación con cebad ores que contienen una secuencia apta para la recombinación dirigida con un plásmido. Una aplicación de la PCR de extrema importancia es la clonación de secuencias de ADN en vectores, como pueden ser los plásmidos. Para ello, se emplean cebadores que conti enen en su extremo 5' una corta secuencia que permite la interacción posterior con otra complementaria situada en el vector de clonación a emplear. Por ejemplo, se puede incluir una diana de restricción en dichos cebadores, de modo que, y si ésta no existí a previamente en el fragmento y es única en el vector, pueda efectuarse una ligación mediante la ligasa de T4 tras la digestión con la enzima de restricción apropiada de ambos elementos. Otro método asimilable a esta vía es el empleo de la recombinación di rigida; esto es, se adapta al 5' de los cebadores una secuencia que faculta a una recombinasa la recombinació n dirigida con un vector dado. o Medicina En medicina, la PCR se emplea fundamentalmente como herramienta de diagnosis (Coleman y Tsongalis, 2006): Permite el genotipar la especie o especies que provocan un determinado cuadro infeccioso: para ello, se amplifica una zona del genoma bacteriano cuyo producto de PCR posea unas características de tamaño o temperatura de fusión que permitan identificarlo de forma inequívoca. En el caso de infecciones virales que implican la integración del genoma del patógeno en el ADN del hospedador, como es el de la infección por VIH, la PCR cuantitativa posibilita la determinación de la carga viral existente y por tanto , del estadio de la enfermedad.
Universidad Católica los Ángeles de Chimbote - ULADECH 245

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

La PCR también se puede usar en revisiones médicas rutinarias, como en los servicios de donantes de sangre, para test de rutina. A través de esta técnica se pueden detectar infecciones peligrosas en el donante (como VIH o H epatitis B) mientras aún están en el periodo de incubación. Dada la sensibilidad de los test de PCR se pueden tomar muestras colectivas o "pools" (por ejemplo, 96 pruebas individuales). Si una de estas muestras colectivas da positivo, se toman a partir de ella muestras progresivamente menores hasta que se encuentra el causante. El diagnóstico de enfermedades hereditarias presentes en el genoma es un proceso largo y complicado que puede acortarse significativamente gracias a la PCR. Cada uno de los genes prueba se pueden amplificar mediante sus correspondientes primers y posteriormente secuenciar para detectar la existencia de mutaciones. Guerras de patentes La técnica de la PCR fue patentada por Cetus Corporation, donde Mullis trabajaba cuando inventó la técnica en 1983. La enzima Taq polimerasa fue también cubierta de patentes. Tuvieron lugar varios pleitos relacionados con la técnica, incluyendo un pleito fracasado generado por DuPont. La compañía farmacéutica Hoffmann -La Roche adquirió los derechos de las patentes en 1992 y actualmente mantiene las que aún están protegidas. LA TRANSGENIA Los cultivos transgénicos son nuevas formas de vida creadas en el laboratorio con una técnica que permite insertar genes extraños de bacterias, plantas o animales a cu ltivos como el maíz y la soya. Estas técnicas permiten a los científicos saltarse la selección natural y la evolución, al intercambiar genes entre especies que normalmente no se cruzan. Una vez que estas nuevas especies hechas por el ser humano son liber adas al medio ambiente y a la cadena alimenticia, no hay manera de revertir la situación ni se conocen los efectos a largo plazo que estos cultivos producirán sobre los ecosistemas y la salud humana. "Todos los organismos vivos están constituidos por conj untos de genes. Las diferentes composiciones de estos conjuntos determinan las características de cada organismo. Por la alteración de esta composición los científicos pueden cambiar las características de una planta o de un animal. El proceso consiste en la transferencia de un gen responsable de determinada característica en un organismo, hacia otro organismo al cual se pretende incorporar esta característica. En este tipo de tecnología es posible transferir genes de plantas o bacterias, o virus, hacia otras plantas, y además combinar genes de plantas con plantas , de plantas con animales, o de animales entre sí, superando por completo las barreras naturales que separan las especies". ALIMENTOS TRANSGÉNICOS. ESTADO ACTUAL Algunos enzimas y aditivos utiliza dos en el procesado de los alimentos se obtienen desde hace años mediante técnicas de ADN recombinante. La quimosina, por ejemplo, enzima empleada en la fabricación del queso y obtenida originalmente del estómago de terneros, se produce ahora utilizando microrganismos en los que se ha introducido el gen correspondiente. Sin embargo, la era de los denominados “alimentos transgénicos" para el consumo humano directo se abrió el 18 de mayo de 1994, cuando la Food and Drug Administration de Estados Unidos autorizó la comercialización del primer alimento con un gen "extraño", el tomate "Flavr Universidad Católica los Ángeles de Chimbote - ULADECH 246

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Savr", obtenido por la empresa Calgene. A partir de este momento, se han obtenido cerca del centenar de vegetales con genes ajenos insertados, que se encuentran en distinta s etapas de su comercialización, desde los que representan ya un porcentaje importante de la producción total en algunos países hasta los que están pendientes de autorización. Existen diferentes posibilidades de mejora vegetal mediante la utilización de la ingeniería genética. En el caso de los vegetales con genes antisentido, el gen insertado produce un ARNm que es complementario del RNAm de la enzima cuya síntesis se quiere inhibir. Al hibridarse ambos, RNAm de la enzima no produce su síntesis. En el caso de los tomates "Flavr -Savr" en enzima cuya síntesis se inhibe es la poligalacturonasa, responsable del ablandamiento y senescencia del fruto maduro. Al no ser activo, este proceso es muy lento, y los tomates pueden recogerse ya maduros y comercializarse directamente. Los tomates normales se recogen verdes y se maduran artificialmente antes de su venta con etileno, por lo que su aroma y sabor son inferiores a los madurados de forma natural. En este caso, el alimento no contiene ninguna proteína nueva. La misma técnica se ha utilizado para conseguir una soja con un aceite con alto contenido en ácido oleico (80 % o más, frente al 24% de la soja normal), inhibiendo la síntesis de la enzima oleato desaturasa. La inclusión de genes vegetales, animales o bacterianos da lugar a la síntesis de proteínas específicas. La soja resistente al herbicida glifosato, conocida con el nombre de "Roundup Ready" y producida por la empresa Monsanto contiene un gen bacteriano que codifica el enzima 5-enolpiruvil-shikimato-3fosfato sintetasa. Este enzima participa en la síntesis de los aminoácidos aromáticos, y el propio del vegetal es inhibido por el glifosato; de ahí su acción herbicida. El bacteriano no es inhibido. El maíz resistente al ataque de insectos contienen un gen que codifica una proteína del Bacillus thuringiensis, que tiene acción insecticida al ser capaz de unirse a receptores específicos en el tubo digestivo de determinados insectos, interfiriendo con su proceso de alimentación y causando su muerte. La toxina no tiene ningún efecto sobre las personas ni sobre otros animales. La utilización de plantas con genes de resistencia a insectos y herbicidas permite reducir la utilización de plaguicidas y conseguir un mayor rendimiento. También se ha obtenido una colza con un aceite de elevado contenido en ácido laúrico, mediante la inserción del gen que codifica una tioesterasa de cierta especie de laurel. Los vegetales resistentes a virus se consiguen haciendo que síntetizen una proteína vírica que interfiere con la p ropagación
Universidad Católica los Ángeles de Chimbote - ULADECH 247

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

normal del agente infecioso. Estos vegetales contienen proteína vírica, pero menos de la que contienen los normales cuando están severamente infectados. Los vegetales transgénicos más importantes para la industria alimentaria son, por el momen to, la soja resistente al herbicida glifosato y el maíz resistente al taladro, un insecto. Aunque se utilice en algunos casos la harina], la utilización fundamental del maíz en relación con la alimentación humana es la obtención del almidón, y a partir de este de glucosa y de fructosa. La soja está destinada a la producción de aceite, lecitina y proteína. Puesto que la harina de maíz, la proteína de soja y los productos elaborados con ellas contienen DNA y proteínas diferentes a la de las otras variedades de maíz, en la Unión Europea (no en los Estados Unidos) existe la obligación de mencionar su presencia en el etiquetado de los alimentos. Aunque no se ha detectado ningún caso, sería concebible la existencia de personas alérgicas a las nuevas proteínas. N o obstante, en el caso de la proteína de B. thuringiensis, su amplio uso como plaguicida en agricultura ecológica permite asegurar su falta de alergenicidad. El aceite de soja transgénica y la glucosa y la fructosa obtenidas del almidón de maíz transgénico no contienen ningún material distintinto a los que contienen cuando se obtienen a partir de los vegetales convencionales. En la mayoría de los casos, ni siquiera las técnicas de PCR, que como se sabe tienen una sensibilidad extrema, son capaces de detec tar material genético extraño, por lo que no existe ninguna obligación de etiquetado diferencial. En el caso de los alimentos completos, o de partes que incluyan la proteína extraña, como podría ser la proteína de soja o la harina de maíz, hay que consid erar el riesgo de la aparición de alergias a la nueva proteína. Este es el caso de la soja a la que se le había introducido el gen de una proteína de la nuez del brasil para aumentar el contenido de aminoácidos azufrados de sus proteínas y por ende su valo r nutricional. La nueva proteína resulto ser alergénica, y esta soja no ha llegado a salir al mercado . Sin embargo, esto es absotutamente excepcional, y no existe ninguna evidencia de que las proteínas introducidas por medio de la ingeniería genética sean más alergénicas que las naturales. En el caso de la utilización de materiales procesados exentos de proteínas, como el aceite de soja o la glucosa obtenida a partir del almidón del maíz, no existe ningún material que no se encuentre en el producto conven cional, y consecuentemente no existe ningún riesgo, ni siquiera hipotético, atribuible a la manipulación genética. Incluso en los casos en que existe alergia a una proteína de la semilla oleaginosa (convencional o transgénica), un aceite procesado no produce respuesta. ¿Para que se obtienen vegetales transgénicos? Actualmente existen, comercializados o en proceso avanzado de desarrollo, vegetales modificados para: o o o o o o Que tengan una vida comercial más larga. Resistan condiciones ambientales agresivas, co mo heladas, sequías y suelos salinos. Resistan herbicidas. Resistan plagas de insectos. Resistan enfermedades. Tengan mejores cualidades nutritivas.

La modificación más interesante en animales sería conseguir vacas que incluyeran en la leche proteínas de la leche humana con efecto protector, como la lactoferrina
Universidad Católica los Ángeles de Chimbote - ULADECH 248

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

MICROORGANISMOS TRANSGÉNICOS Los microorganismos se caracterizan por ser demasiado pequeños para poder ser observados a simple vista, siendo necesario emplear el microscopio para visualizarlos. S on microorganismos las bacterias, levaduras, protozoos, algas multicelulares, etc. La introducción de ADN foráneo en un microorganismo da lugar a los microorganismos transgénicos. La mayoría de microorganimos transgénicos son bacterias unicelulares o levaduras. Las bacterias y levaduras transgénicas se usan principalmente en la industria alimentaria, en la producción de aditivos alimentarios, aminoácidos, péptidos, ácidos orgánicos, polisacáridos y vitaminas. También se han aplicado en procesos de bioreme diación y, en medicina, se emplean ampliamente para producir proteínas de interés como por ejemplo, la insulina.

o Desarrollo de un microorganismo transgénico Fabricar un transgénico unicelular es más fácil q ue producir una planta o animal transgénico, ya que en éstos hay que asegurar la presencia del nuevo ADN en todas las células del organismo. Para desarrollar una bacteria transgénica, el gen de inte rés se incorpora en un plásmido (ADN circular extracromosómico capaz de a utoreplicarse) y se incuba junto con la bacteria bajo condiciones específicas que favorecen la entrada del plásmido en el interior de la bacteria. Si la bacteria retiene el plasmido y la proteína que expresa el gen de interés no resulta tóxica para su desarrollo, se obtiene una bacteria transgénica, con nuevas características determinadas por el gen introducido. La bacteria más utilizada es la Escherichia coli (o E. Coli).
Universidad Católica los Ángeles de Chimbote - ULADECH 249

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

No obstante y a pesar que su fá cil manipulación, las bacterias no son siempre la m ejor elección para producir proteínas humanas. Algunas de éstas no son funcionales si no están glicosiladas, es decir, si no se añaden azúcares a la cadena de aminoácidos, y este proceso no lo pueden llevar a cabo las bacterias. En estos casos se utilizan levaduras transgénicas, que sí son capaces de glicosilar. La producción de levaduras transgénicas implica también el empleo de plásmidos, siendo la levadura Saccharomyces cerevisiae (responsable, entre otros procesos, de la fermentación del pan) la especie más empleada. o Aplicaciones de microorganismos transgénicos 1. Investigación Los microorganismos transgénicos son una herramienta de fundamental importancia en investigación. La introducción en bacterias de plásmidos que contienen un gen concreto a estudiar se realiza de forma rutinaria en los laboratorios, ya sea con el objeto de tener un stock de dicho gen (mediante el crecimiento de colonias que permiten tener gran cantidad de células que lo contienen) o para expresar una proteína de interés. Estas bacterias transgénicas ayudan a los científicos a entender mejor algunos procesos bioquímicos, la regulación de genes y su función. 2. Producción de proteínas en medicina Como ya se ha comentado, se han desarrollado bacterias E.coli capaces de producir insulina humana, imprescindible para pacientes diábeticos. Antes del empleo de bacterias transgénicas, la insulina se obtenía de vacas y cerdos, pero, como su estructura difería ligeramente de la variedad humana, en algunos casos provocaba una reacción alérgica. Las bacterias transgénicas han eliminado este problema. Asimismo, la levadura Saccharomyces cerevisiae se ha modificado genéticamente para obtener insulina humana. También se han desarrollado bacterias transgénicas para producir la hormona del crecimiento, que se emplea para tratar a niños con enanismo. Otros usos en medicina de los microorganismos transgénicos son la producción de vacunas, anticuerpos, etc 3. Bioremediación Existen microorganismos capaces de utilizar como nutrientes compuestos tóxicos o peligrosos, como hidrocarburos, detergentes, bifenilos policlorados, etc, de forma que su metabolismo los convierte en productos inocuos para el medio ambiente. El empleo de organismos vivos para degradar residuos se conoce como bioremediación. La mayoría de aplicaciones biotecnológicas aplicadas al medio ambiente utilizan microorganismos naturales, pero se están desarrollando microorganimos transgénicos para eliminar materiales difíciles de degradar. Por ejemplo, bacterias Pseudomonas
Universidad Católica los Ángeles de Chimbote - ULADECH 250


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

transgénicas son capaces de degradar compuestos polihalogenados. La investigación en este campo busca los enzimas presentes en microorganismos naturales que son eficientes en el tratamiento de compuestos tóxicos y determinar como pueden mejorarse mediante ingeniería genética . 4. Industria alimentaria Los microorganismos modificados genéticamente se emplean en la industria alimentaria para producir aditivos alimentarios como edulcorantes artificales y aminoácidos con el proposito de incrementar la eficiencia y reducir su cost e. Otros productos de estos microorganismos son enzimas recombinantes que se emplean en panadería, producción de cerveza, producción de queso (por ejemplo, quimosina). También se aplican en procesos de fermentación, como por ejemplo el empleo de levaduras transgénicas para desarrollar el sabor y aroma en la industria de la cerveza. ANIMALES TRANSGENICOS Los animales transgénicos son aquellos que poseen un gen que no les pertenece La forma más sencilla para generar un animal transgénico es la que involucra el aislamiento del gen que se quiere introducir (al que llamaremos transgén), su clonación y manipulación para que pueda ser expresado por el organismo blanco, y su inserción en el organismo. Para lograr que todas las células del organismo expresen este nuevo gen, incorporamos dicho gen en un embrión en estadio de cigoto. Una vez seguros que el embrión incorporó el transgén, implantamos el embrión en un animal receptivo, que actúa como madre (en un procedimiento similar al de fertilización in vitro).
Cabras transgénicas portadoras de un gen humano. La técnica para producir un animal transgénico consta de varios pasos: a) se produce un transgén, b) se realiza una fertilización in vitro, c) se inyecta el gen transgénico en el cigoto, d) se implanta el embrió n en una madre sustituta. De esta manera se han producido conejos, cabras, ovejas y chanchos transgénicos. Si, en cambio, no nos interesa que todo el animal contenga el transgén, sino sólo determinadas células, realizamos un procedimiento similar al descr ipto, pero en vez de inyectar el transgén en un cigoto, lo inyectamos en un embrión ya formado. Esto da como resultado un organismo con células normales y otras con el transgén.

Un ejemplo del empleo de esta técnica es la producción de ovejas o cabras tra nsgénicas. Estas se crean inyectando el gen que codifica la proteína deseada en un óvulo fecundado, que se implanta a una oveja o cabra madre. Luego, se analiza la presencia del gen deseado en la descendencia y aquellas cabras que lo tengan son inducidas a producir leche.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

En la Argentina se han creado vacas transgénicas, llamadas vacas Pampa, que producen en su leche hormona de crecimiento humano. Este emprendimiento fue llevado a cabo mediante una colaboración entre docentes de la Universidad de Buenos A ires y la empresa BioSIDUS. Este es un desarrollo de avanzada para la región ya que, en primer lugar, se logró obtener un clon viable (la vaca Pampita), y luego se logró insertar el transgén en animales de diferente sexo (la vaca Pampa Mansa, y el toro Pam pero). Estos fueron los primeros animales transgénicos en el mundo capaces de tener una progenie que mantuviera el transgén por apareamiento tradicional. La creación de animales transgénicos presenta nuevas oportunidades, pero también crea nuevos desafíos. Entre las primeras está la posibilidad de estudiar la función de ciertas proteínas, incluidas algunas causantes de enfermedades humanas. Uno de los mayores problemas es la inserción al azar de los genes deseados. TERAPIA GENICA La TERAPIA GÉNICA es un tratamiento médico que consiste en manipular la información genética de células enfermas para corregir un defecto genético o para dotar a las células de una nueva función que les permita superar una alteración. Con la ayuda de vectores adecuados, que son generalmente virus, se introduce el gen correcto y se integra en el ADN de la célula enferma mediante técnicas de recombinación genética. En principio existen tres formas de tratar enfermedades con estas terapias: o Sustituir genes alterados. Se pueden corregir mutaciones mediante cirugía génica, sustituyendo el gen defectuoso o reparando la secuencia mutada. o Inhibir o contrarrestar efectos dañinos. Se lleva a cabo mediante la inhibición dirigida de la expresión génica. Este proceso se desarrolla bloqueando promotores, interfiriendo con los mecanismos de expresión génica mediante RNAs anti-sentido que son complementarios de RNA -m y se unen a ellos bloqueándolos, o, más recientemente, mediante siRNA ("small interferents RNA", "RNAs pequeños interferentes"), que bloquean secuencias específicas de RNA, por lo que pueden inhibir cualquier gen bloqueando sus RNA -m. o Insertar genes nuevos. Se realiza por supresión dirigida de células específicas. Se insertan genes suicidas que destruyen a la propia célula que los aloja o genes estimuladores de la respuesta inmune. También se puede introducir una copia de un gen normal para sustituir la función de un gen mutante que no fabrica una proteína correcta. Por ejemplo, en el tratamiento de los cánceres que se rea liza hoy día, una de las principales vías de investigación es la de marcar genéticamente a las células tumorales de un cáncer para
Universidad Católica los Ángeles de Chimbote - ULADECH 252

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

que el organismo las reconozca como extrañas y pueda luchar contra ellas, estimulando la respuesta inmune. Otras estrategias que se siguen en la actualidad contra el cáncer son: - Inactivar oncogenes. - Introducir genes supresores de tumores. - Introducir genes suicidas. - Introducir genes que aumenten sensibilidad a fármacos. EL PROCESO DE LA CLONACION El proceso de clonación a partir de células adultas ya diferenciadas ha sido el resultado de mínimo 40 años de investigación en diferentes áreas del conocimiento, como la genética y la biología reproductiva. El sincronizar tanto la célula donante como la receptora permitió el éxito final de un procedimiento que se creía imposible. Este avance científico abrirá nuevos horizontes especialmente en el campo de la biotecnología, pero es precisamente su aplicación lo que tiene hoy al mundo, tanto científico como político, en refle xión y legislando al respecto. La clonación (derivado del griego : κλων, que significa "retoño") es el proceso de crear una copia genética idéntica de otro organismo original. La clonación en el sentido biológico resulta en una molécula, una célula e incluso un organismo multicelular idéntico al original. A veces este término puede utilizarse a los clones "naturales", por ejemplo los gemelos monocigóticos, o cuando un organismo se reproduce asexualmente como en el caso de especies monosexuales y organismos hermafroditas, aunque la mayoría de las veces se refiere a un clon creado intencionalmente. Si nos referimos al ámbito de la Ingeniería Genética, clonar es aislar y multiplicar en tubo de ensayo un determinado gen o, en general, un trozo de ADN. Sin embargo, Dolly no es producto de Ingeniería Genética. En el contexto a q ue nos referimos, clonar significa obtener un individuo a partir de una célula o de un núcleo de otro individuo. En los animales superiores, la única forma de reproducción es la sexual, por la que dos células germinales (óvulo y espermatozoide) se unen, formando un cigoto (o huevo), que se desarrollará hasta dar el individuo adulto. La reproducción sexual fue un invento evolutivo (del que quedaron excluidas las bacterias y muchos organismos unicelulares), que garantiza que en cada generación de una especie van a aparecer nuevas combinaciones de genes en la descendencia, que posteriormente será sometida a la dura prueba de la selección y otros mecanismos evolutivos. Las células de un animal proceden en última instancia de la división repetida y diferenciación del cigoto. Las células somáticas, que constituyen los tejidos del animal adulto, han recorrido un largo camino "sin retorno", de modo que, a diferencia de las células de las primeras fases del embrión, han perdido la capacidad de generar nuevos individuos y cada tipo se ha especializado en una función distinta (a pesar de que, salvo excepciones, contienen el mismo material genético).
Universidad Católica los Ángeles de Chimbote - ULADECH 253

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

No es extraño pues el revuelo científico cuando el equipo de Ian Wilmut, del Instituto Roslin de Edimburgo comunicó que habían logrado una oveja por clonación a partir de una célula diferenciada de un adulto. Esencialmente el método (que aún presenta una alta tasa de fracasos) consiste en obtener un óvulo de oveja, eliminarle su núcleo, sustituirlo por un núcleo de célula de oveja adulta (en este caso, de las mamas), e implantarlo en una tercera oveja que sirve como "madre de alquiler" para llevar el embarazo. Así pues, Dolly carece de padre y es el producto de tres "madres": la donadora del óvulo contribuye con el citoplasma (que contiene, además mitocondrias que llevan un poco de material genético), la donadora del núcleo (que es la que aporta la inmensa mayoría del ADN), y la que parió, que genéticamente no aporta nada. Científicamente se trata de un logro muy interesante, ya que demuestra que, al menos bajo determinadas circunstancias es posible "reprogramar" el material genético nuclear de una célula diferenciada (algo así como volver a poner a cero su reloj, de modo que se comporta como el de un zigoto). De este modo, est e núcleo comienza a "dialogar" adecuadamente con el citoplasma del óvulo y desencadena todo el complejo proceso del desarrollo intrauterino. Dolly no es una copia idéntica de la "madre" que donó el núcleo (no se olvide que el óvulo contiene ese pequeño ADN de la mitocondria). Aunque ambas comparten el mismo ADN nuclear, las instrucciones genéticas de Dolly no experimentaron exactamente el mismo tipo y combinación de estímulos que los de su "madre nuclear". Esto se debe a los fenómenos de epigénesis, complejas series de interacciones entre los genes y el entorno, y aquí entendemos por entorno desde los factores presentes en el citoplasma del óvulo, pasando por los procesos de formación del embrión/feto, a su vez sometidos al peculiar ambiente uterino, y alca nzando a la vida extrauterina (estímulos al nacer, periodo de lactancia, relaciones con la madre, interacciones "sociales" con otros individuos de la especie, etc). En resumidas cuentas, el ADN no contiene un programa unívoco de instrucciones, sino que es flexible, y la expresión genética en cada individuo queda matizada por multitud de factores, quedando "abierta" con una finalidad adaptativa clara. ¿Para qué serviría la clonación en animales? Como suele ocurrir con muchos avances científicos de vanguar dia, aquí puede que también se hayan exagerado las posibles derivaciones prácticas inmediatas, aunque no cabe duda que a medio y largo plazo, cuando la técnica se vaya perfeccionando, podría encontrar numerosos campos de aplicación. (Dejamos aparte el ámbi to de la biología fundamental, que tendrá que "hincar el diente" en los fascinantes interrogantes básicos abiertos, sobre todo relativos al ciclo celular y al control de la diferenciación). Como suele ocurrir con muchos avances científicos de vanguardia, aquí puede que también se hayan exagerado las posibles derivaciones prácticas inmediatas, aunque no cabe duda que a medio y largo plazo, cuando la técnica se vaya perfeccionando, podría encontrar numerosos campos de aplicación. (Dejamos aparte el ámbito de la biología fundamental, que tendrá que "hincar el diente" en los fascinantes interrogantes básicos abiertos, sobre todo relativos al ciclo celular y al control de la diferenciación). Uno de los objetivos buscados por el grupo de Wilmut (en alianza con u na empresa) es unir la técnica de la clonación con la de Ingeniería genética de mamíferos con objeto de producir medicamentos o sustancias útiles comercialmente. La idea es que una vez que se haya obtenido un animal transgénico interesante (por ejemplo, ov ejas o vacas que en su leche secretan sustancias terapéuticas determinadas por un gen introducido previamente), ese individuo serviría de "molde" para generar varios ejemplares clónicos.
Universidad Católica los Ángeles de Chimbote - ULADECH 254

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

Otra aplicación (más en la línea de la ganadería tradicional) sería asegurar copias de un ejemplar que haya mostrado buenos rendimientos (en carne, en leche, etc.). La clonación evitaría que su buena combinación de genes (su genotipo) se "diluyera" al cruzarlo sexualmente con otro. Sin embargo, mientras el coste de la téc nica sea elevado, no estará al alcance de las explotaciones ganaderas convencionales. Pero además habría que tener mucha precaución con la amenaza de pérdida de diversidad genética de la cabaña ganadera, ya que si se impusiera este método, se tendería a la uniformidad (una tendencia ya presente en la agricultura y ganadería actuales). Recordemos que la biodiversidad es un recurso valioso también en los "ecosistemas agropecuarios", ya que supone una reserva de recursos genéticos adaptados a diversas condiciones ambientales y a diversos contextos socioeconómicos. Se ha hablado igualmente de que la clonación podría representar la salvación "in extremis" de ciertas especies silvestres amenazadas de extinción y difíciles de criar en cautividad. Pero si se llega a este caso, sería el triste reconocimiento de nuestro fracaso de conservarlas por medios más simples y naturales. Además, lo más probable es que, debido a que la clonación no aporta diversidad genética, la especie estuviera abocada de todas formas a la "m uerte genética", condenada quizás a vivir en zoológicos o en condiciones altamente artificiales, casi como piezas de un museo viviente. LA CLONACION HUMANA La publicación de la existencia de Dolly levantó inmediatamente un debate sobre la posibilidad de clonar personas. La proximidad biológica hace pensar que la clonación humana sería posible desde un punto de vista técnico, aunque haya factores limitantes (principalmente el número de óvulos necesarios: hicieron falta más de 400 para conseguir a Dolly). E l debate, por tanto, se sitúa en un contexto ético, no en si es posible llevarla a cabo, sino en si es conveniente, si debe aprobarse . Son muchas las consideraciones éticas que pueden hacerse en torno a la clonación humana. Una aproximación sería considerar el fin de la clonación: o Obtener un nuevo ser desarrollado (clonación con fines reproductivos). o Obtener un embrión que será destruido para proporcionar células o tejidos (clonación humana con fines terapéuticos). Existe entre la comunidad científica una actitud bastante generalizada de rechazo hacia la clonación humana con fines reproductivos, aunque sólo sea por consideraciones prácticas: bajo porcentaje de éxitos, alto número de óvulos requerido, posibilidad de alteraciones o enfermedades en los clo nes... Estas objeciones, que se centran en las consecuencias negativas, no parecen tener suficiente fundamento, y con frecuencia se oye a investigadores afirmar que si hubiese un motivo realmente importante para clonar seres humanos no verían inconveniente s en que se hiciera. Los argumentos con un fundamento de tipo antropológico, y por tanto más sólido, podrían resumirse del siguiente modo:
Universidad Católica los Ángeles de Chimbote - ULADECH 255

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o La clonación, incluso si no conllevara la muerte de embriones y tuviese un 100% de éxito dando lugar a un ser humano sin fallos, supone un atentado a la persona así generada, que sufriría una manipulación difícil de superar: o El clonado sería seleccionado positivamente por otros, que han decidido cuál va a ser su dotación genética y sus características biológicas. o El clonado sería generado con un fin: emular a alguien cuyas características interesan por algún motivo: un hijo fallecido al que se pretende sustituir, un genio cuyas habilidades interesa mantener, etc. Las consecuencias psicológicas de esa presión serían imprevisibles. o El clonado carecería de las relaciones elementales de familia: no tendría en absoluto padre, ni propiamente hablando madre: tendría un herman o gemelo mayor, una madre ovular (¿citoplásmica?) y una madre de alquiler. Se puede formular positivamente lo expuesto diciendo que, cualquier ser humano tiene derecho a que: o Ningún tercero decida su componente genético. o Ser querido por sí mismo y no para conseguir un fin, como emular o reemplazar a alguien (planteamiento que supone, además, un desconocimiento total de cómo son los seres humanos). o Tener un padre y una madre de los que procede, también biológicamente y que son responsables de él. Dicho de otro modo: la clonación reproductiva atenta a la libertad del clon, fija sus condiciones biológicas según el criterio de otros, y en ese sentido es un ejemplo difícilmente superable de manipulación del hombre por la técnica (manejada por terceros). La clonación humana con “fines terapéuticos”: el descubrimiento de las células madre embrionarias. En el campo de la aplicación terapéutica de los embriones se encuentra el verdadero debate que zarandea actualmente la opinión pública y a la comunidad científica. Para describir con detalle en qué consistirían esas posibles aplicaciones hay que hacer referenci a a algunos descubrimientos o avances recientes, que no están directamente relacionados con la clonación. Concretamente: o La posibilidad de curar enfermedades llevando a cabo transplantes no con órganos completos, sino con células, mediante la llamada tera pia celular. Esto parece una buena alternativa para determinadas enferm edades que son el resultado del mal funcionamiento de una población bien definida de células. Consistiría en reemplazar las células enfermas por otras sanas, sin necesidad de transplant ar el órgano entero. o La posibilidad de obtener células madre embrionarias. En el año 1998 dos grupos de Estados Unidos publicaron la obtención de células madre embrionarias a partir de embriones humanos que procedían de la fecundación in vitro. Esos embri ones estaban
Universidad Católica los Ángeles de Chimbote - ULADECH 256

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

en la fase llamada de blastocisto. Los blatocistos son embriones de 5 -6 días y que tienen un aspecto esférico con una cavidad interna. Se diferencian en ellos lo que es propiamente el embrión (un grupo de células llamado masa celular interna), de las células que darán lugar a la placenta (llamadas trofoblasto). Los “logros” de estos grupos fueron de tipo técnico: tomaron masas celulares internas de varios blastocistos (destruyéndolos en el proceso) y las pusieron en cultivo. Consiguieron por un lado que esas células, llamadas células madre embrionarias, viviesen y se dividieran activamente en cultivo; y por otro lograron una especialización dirigida de esas células: tratándolas con diferentes factores consiguieron que dieran lugar a células tipo piel (ectodermo), tipo tubo digestivo (endodermo) o tipo músculo (mesodermo). ¿En qué consiste entonces la propuesta de clonación humana con fines terapéuticos? Consistiría en combinar la técnica de clonación con la de obtención de células madre embrionarias, para curar a adultos que tuviesen una enfermedad que pudiera resolverse mediante transplante celular. Esto se haría de la siguiente manera: 1. Mediante la técnica empleada en Dolly se generaría un embrión a partir de células diferenciadas de la persona que se quiere curar. 2. El embrión obtenido por clonación se destruiría a los 6 días para obtener a partir de él células madre embrionarias. 3. Esas células se especializarían hacia el tipo celular necesario para curar a la persona en cuestión. 4. Se implantarían esas células para curar a la persona. Al proceder de un embrión idéntico a la persona de partida, las células no provocarían rechazo al ser implantadas y además la posibilidad de mantener congelados los cultivos celulares proporcionaría una fuente casi ilimitada de tejidos. Hay que indicar que desde el punto de vista técnico este proceso es aún una mera posibilidad y haría falta mucha investigación para ponerlo en marcha: no se han conseguido todavía tipos celulares bien definidos a partir de células madre embrionarias y hay pocas evidencias de que de hecho puedan curar enfermedades. Algunas alternativas a la clonación humana con fines terapéuticos Existen alternativas a la clonación humana con fines terapéuticos que no presentan objecion es éticas tan serias. La más interesante es la posibilidad de conseguir células madre de origen no embrionario. o En el cuerpo humano existen células madre de adulto que son precursoras de otros tipos celulares: células menos especializadas que podrían dar lugar a varios tipos de células. En los últimos años se ha descubierto que estas células son mucho más versátiles de lo que
Universidad Católica los Ángeles de Chimbote - ULADECH 257

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

se pensaba. Si se ponen en cultivo y se tratan con diversos factores puede hacerse que se diferencien hacia tipos celulares muy dife rentes de aquellos a los que habitualmente dan lugar en el cuerpo. Por ejemplo, a partir de células de médula ósea se han conseguido células de músculo, hueso, células nerviosas, hepatocitos, etc...Las células madre se encuentran en el adulto en la médula ósea, el sistema nervioso y órganos diversos. o También pueden obtenerse células madre del cordón umbilical y de la placenta del recién nacido. Como ya hemos indicado, placenta y cordón umbilical proceden del embrión y sus células tampoco provocarían rechaz o.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

1. ¿Por qué decimos que los niveles de organización atómico y molecular son niveles abióticos? 2. ¿Cuáles son los atributos que identifi can a los seres vivos y los hacen diferentes de la materia inanimada? 3. ¿Qué caracteriza a cada nivel de organización en relación con los inferiores a él? 4. ¿En qué se diferencian los bioelementos primarios y secundarios? 5. ¿Qué significado puede tener la unifor midad en la composición elemental de la materia viva? 6. Explica la diferencia entre bioelemento secundario y oligoelemento. 7. ¿Qué característica presentan en conjunto los bioelementos primarios que los hace idóneos para formar parte de las biomoléculas? ¿Y el carbono en particular? 8. Explica por qué el silicio no puede dar lugar a una variedad de compuestos químicos tan grande como lo hace el carbono. 9. ¿A qué llamamos grupo funcional? ¿Cita y escribe la estructura química de los más relevantes entre las biomolécu las? 10. Pon algunos ejemplos de macromoléculas y cita los sillares estructurales de que están compuestas. 11. ¿Qué ventajas representan las interacciones débiles frente a los verdaderos enlaces químicos en los procesos biológicos? 12. Formula las líneas básicas de la hipótesis de Oparin. ¿Qué es lo que demostró Stanley Miller con su experimento sobre atmósferas simuladas? 13. ¿Qué unidades utilizarías para expresar las dimensiones de las biomoléculas? )Cuál es su equivalencia en metros? 14. ¿Qué tipo de modelo molecular const ruirías si quisieras representar una biomolécula de modo que se pudiesen apreciar los ángulos de enlace y las distancias entre átomos? 15. ¿Cómo variaría el punto de fusión del agua si el oxígeno no fuese un elemento tan electronegativo? Justifica la respuesta )Y si la geometría de sus orbitales de enlace fuese lineal y no tetraédrica? 16. El metano (CH 4) en estado líquido, ¿sería un buen disolvente de sustancias iónicas? Ten en cuenta que C y H tienen electronegatividades semejantes. 17. ¿A qué se debe el que el ángulo que forman los tres átomos de la molécula de agua sea algo menor de lo que cabría esperar de su geometría tetraédrica? 18. Explica por qué los monosacáridos son netamente solubles en agua. 19. Explica por qué el agua es un fluido tan poco viscoso a pesar de que sus moléculas están intensamente ligadas por puentes de hidrógeno. 20. ¿Qué condiciones se han de dar para que se forme un puente de hidrógeno entre dos moléculas cualesquiera? 21. ¿Qué característica común presentan los compuestos de carácter hidrofílico? ¿Y los de carácter hidrofóbico? 22. Analiza brevemente el por qué las moléculas antipáticas tienden a formar micelas y estructuras afines cuando se encuentran en medio acuoso.
Universidad Católica los Ángeles de Chimbote - ULADECH 259

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

23. Explica como se comportarán en medio acuoso las siguientes biomoléculas: un fosfoglicérido, un aminoácido, una cera, un disacárido, un triacilglicérido, un dipéptido, un ácido graso. 24. Cuál es la causa de que las disoluciones acuosas presenten propiedades coligativas que no aparecen en el agua pura? 25. Explica por qué las células vivas se ven afectad as por fenómenos osmóticos. 26. Define con precisión ósmosis y presión osmótica. 27. ¿En qué se diferencia una disolución coloidal de una disolución verdadera? 28. ¿Qué le ocurrirá a un glóbulo rojo si lo colocamos en un medio hipertónico? ¿Y en un medio hipotónico? 29. Pon un ejemplo de un par ácido-básico conjugado. 30. Define ácido y base según el concepto de Brönsted -Lowry. 31. ¿Por qué resulta útil la escala de pH? 32. Relaciona la fuerza de los ácidos con la constante de disociación y el pK. 33. ¿Qué expresión matemática describe la forma de las curvas de titulación de los pares ácido-básicos conjugados? ¿Podrías escribirla? 34. ¿Por qué en un sistema tampón deben existir cantidades aproximadamente iguales de las especies dadora y aceptora de protones? 35. ¿El ácido acético tiene un pK=4,76.? Cuáles serán aproximadamente los límites de sur región tamponante? 36. Explica por qué las células vivas necesitan tampones. 37. ¿Por qué en los sistemas vivos las interacciones iónicas se consideran interacciones débiles y no verdaderos enlaces químicos? 38. ¿Cuál es el papel de las sales minerales disueltas en la materia viva? 39. ¿Qué característica química común a todos los lípidos es la responsable de su escasa solubilidad en agua? 40. ¿Qué rasgo estructural común presentan los lípidos saponificables? 41. Define en pocas palabras lo que se entiende por ácido graso. 42. Explica por qué las grasas ricas en ácidos grasos insaturados son líquidas a temperatura ambiente mientras que las ricas en ácidos grasos saturados son sólidas a esa temperatura. 43. Explica cómo influye la longitud d e la cadena hidrocarbonada en el punto de fusión de los ácidos grasos. 44. ¿Qué ventajas e inconvenientes presentan los lípidos como material de reserva energética para los seres vivos? 45. ¿Cómo harías para obtener jabón a partir de la grasa de cerdo? 46. ¿Qué otras funciones desempeñan los triacilglicéridos en los seres vivos, además de la de reserva de energía? 47. Describe la estructura química de una cera. 48. ¿Por qué las cubiertas de algunos frutos están impregnadas en ceras? 49. ¿Qué compuestos obtendríamos si rompemos med iante hidrólisis todos los enlaces éster de un fosfoglicérido? 50. ¿Qué propiedad de los fosfoglicéridos los faculta para formar parte de las membranas biológicas? 51. ¿Qué compuestos obtendríamos si rompemos mediante hidrólisis todos los enlaces éster y amida de un esfingfosfátido? 52. Explica por qué los ácidos grasos libres tienden a formar micelas en medio acuoso, mientras que los fosfoglicéridos tienden a formar bicapas y liposomas.
Universidad Católica los Ángeles de Chimbote - ULADECH 260

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

53. ¿Qué compuesto resulta de la unión de una ceramida y una molécula de glucosa? 54. ¿Por qué los terpenos no son saponificables? 55. Cita algunas funciones de los terpenos en los seres vivos. ¿En cuál de los reinos de los seres vivos se encuentran preferentemente? 56. ¿Cuál es la principal función del colesterol en las células vivas? 57. Cita algunas biomoléculas de importancia biológica que derivan del colesterol. 58. ¿En qué grupo de lípidos clasificarías a las prostaglandinas? Justifica la respuesta. 59. ¿Por qué los glúcidos fueron denominados (incorrectamente) hidratos de carbono? 60. Describe la estructura básica de un monosacárido. 61. ¿Qué compuestos se obtienen cuando se somete a un ósido a hidrólisis completa? 62. Escribe la fórmula de una cetotetrosa y una aldopentosa en forma de cadena abierta. 63. ¿Cuántos estereoisómeros presenta una cetopentosa? ¿Y una aldohexosa en forma de cadena abierta? 64. Distingue entre: estereoisómero, enantiómero, epímero, anómero. 65. Enuncia el criterio para asignar a un monosacárido a la serie D o a la serie L. ¿Qué relación tiene la pertenencia a serie D o serie L con el fenómeno de la rotación óptica? 66. ¿A qué llamamos rotación óptica? 67. Escribe la fórmula de una aldohexosa en forma de cadena abierta y en forma de anillo de piranosa. Señala en esta última el carbono anomérico. 68. ¿Por qué las disoluciones de D-glucosa presentan el fenómeno de la mutarrotación? 69. ¿Por qué la glucosa no exhibe las propiedades químicas que cabría esperar de un polihidroxialdehido? 70. ¿Qué utilidad presentan las proyecciones de Haworth de la que carecen las de Fisher? 71. Explica por qué unos monosacáridos dan lugar a formas cíclic as y otros no lo hacen. 72. Explica por qué los monosacáridos de 3 y 4 átomos de carbono no forman enlaces glucosídicos. 73. ¿Por qué algunos disacáridos tienen poder reductor y otros no lo tienen? ¿Tienen poder reductor todos los monosacáridos? ¿Por qué? 74. ¿Puede existir un homopolisacárido formado por unidades monoméricas de Dgliceraldehido? ¿Por qué? 75. ¿Qué factor limita la posibilidad de los monosacáridos de dar lugar a formas cíclicas? 76. Cita cuatro tipos de derivados de los monosacáridos de importancia biológica. 77. Relaciona el tipo de enlace glucosídico ( α o β) presente en los polisacáridos con la función que éstos desempeñan en la naturaleza. 78. Dos monosacáridos se encuentran unidos mediante un enlace β(1-4). Explica el significado de esta notación. 79. ¿Por qué los polisacáridos son insolubles en agua a pesar de ser sustancias altamente hidrofílicas? 80. ¿Qué diferencia estructural hay entre el glucógeno y la amilopectina? 81. ¿Qué diferencia estructural hay entre el almidón y la celulosa? 82. ¿Qué ventajas y qué inconvenientes presentan los polisacáridos como material de reserva energética? 83. ¿A qué se debe la extraordinaria resistencia mecánica de la celulosa? ¿Por qué otros polisacáridos importantes no presentan esta propiedad? 84. Dí qué tipos de compuestos se obtienen en cada caso tras someter a hidrólisis completa a los siguientes glúcidos: un homopolisacárido, un heteropolisacárido, un
Universidad Católica los Ángeles de Chimbote - ULADECH 261

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

holósido, un heterósido. 85. ¿Conoces algún lípido que pueda ser clasificado también como heterósido? 86. ¿Qué bioelementos se encuentran presentes siempre en las proteínas y sólo ocasionalmente en los azúcares y los lípidos? 87. A diferencia de lo que ocurre con otras macromoléculas como los polisacáridos, las cadenas de aminoácidos de las proteínas nunca son ramificadas. ¿Crees que sería posible sintetizar artificialmente una cadena polipeptídica ramifi cada? Justifica la respuesta. 88. Escribe las fórmulas de un α y un β-aminoácido (utiliza el símbolo “R” para la cadena lateral). ¿Qué tipo de aminoácidos se hallan presentes en las proteínas? 89. Explica por qué los aminoácidos son sólidos cristalinos y tienen un punto de fusión más alto de lo que cabría esperar dada su estructura química. 90. Explica por qué los aminoácidos son más solubles en agua de lo que cabría esperar de su estructura química y de su relativamente elevada masa molecular. 91. ¿Qué carga neta presentará un aminoácido con grupo R no ionizable a pH isoeléctrico? ¿Y a pH 0? ¿Y a pH 14? (El pK del grupo carboxilo es de alrededor de 2 y el del grupo amino de alrededor de 10). 92. ¿Existen en la naturaleza D-aminoácidos? )Se encuentran formando parte de las proteínas? 93. Escribe las fórmulas de dos aminoácidos cualesquiera y la reacción de formación de un enlace peptídico entre ellos. 94. ¿Qué restricciones existen para la libertad de giro de los enlaces que forman el esqueleto de una cadena polipeptídica? 95. ¿Por qué el enlace peptídico no tiene libertad de giro? 96. ¿Qué relación existe entre las secuencias de aminoácidos de proteínas homólogas en especies diferentes? 97. ¿Podría cualquier secuencia de aminoácidos adoptar una estructura secundaria en hélice α? Justifica la respuesta. 98. Un poliaminoácido sintético formado exclusiva mente por restos de triptófano ¿adoptará espontáneamente una estructura secundaria en hélice α o preferirá la conformación β? Razona la respuesta. ¿Qué ocurrirá si el poliaminoácido es tá formado por restos de alanina? 99. Define los términos estructura supersecundaria y dominio. 100.¿Qué tipos de interacciones débiles estabilizan la estructura terciaria de las proteínas? 101.¿Conoces algún tipo de enlace covalente, además del enlace peptídico, que pueda unir restos de aminoácidos en una cadena polipeptídica? 102.¿En dónde se halla presente la estructura secundaria que denominamos codo β? 103.¿Cómo afectará una alteración en el pH de la disolución a una proteína cuya estructura terciaria se encuentra estabilizada por interacciones iónicas entre grupos R de diferentes aminoácidos? 104.¿Por qué decimos que las interacciones débiles que estabilizan la estructura terciaria de las proteínas son interacciones de “largo alcance”? 105.¿Por qué las proteínas pierden su función biológica cuando se desnaturalizan? 106.¿Cuáles interacciones se rompen y cuáles no lo hacen durante el proceso de desnaturalización de una proteína? 107.¿Por qué una proteína puede recuperar en determinadas condiciones su conformación tridimensional nativa después de haber sido desnaturalizada?
Universidad Católica los Ángeles de Chimbote - ULADECH 262

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

108.¿Por qué decimos que entre una proteína y su ligando específico hay una complementariedad estructural? 109.¿Qué compuestos obtendríamos si sometemos a un ácido nucleico a hidrólisis en condiciones suaves? ¿Y si lo hacemos en condiciones más drásticas? 110.¿Podrían formarse nucleósidos en los que la unión entre la base nitrogenada y la pentosa se estableciese a través del carbono 2' de ésta última? Razona la respuesta. 111.¿A qué deben los ácidos nucleicos su carácter ácido? 112.Describe la estructura de un nucleótido, mediante qué tipos de enlace est án unidos sus componentes y cuáles son los átomos implicados en dichos enlaces. 113.Nombra los componentes moleculares de los siguientes nucleótidos: AMP, CTP, dTDP, GMP, UTP. 114.Asigna su nombre sistemático a cada uno de los siguientes nucleósidos: Nucleósido de adenina y ribosa. Nucleósido de timina y desoxirribosa. Nucleósido de guanina y desoxirribosa. Nucleósido de uracilo y ribosa. Nucleósido de citosina y ribosa. 115.Asigna su nombre sistemático a los nucleótidos formados por: Adenina, desoxirribosa y un grupo fosfato. Uracilo, ribosa y tres grupos fosfato. Timina, desoxirribosa y un grupo fosfato. Guanina, ribosa y tres grupos fosfato. Citosina, desoxirribosa y dos grupos fosfato. 116.¿Qué otras funciones pueden desempeñar los nucleótidos en la célula además de ser los sillares estructurales de los ácidos nucleicos? 117.Establece una analogía entre la estructura primaria de las proteínas y la de los ácidos nucleicos. 118.¿A qué llamamos extremo 5' y extre mo 3' de una cadena polinucleotídica?

119. ¿Por qué decimos que los niveles de organización atómico y molecular son niveles abióticos mientras que consideramos al nivel celular como un nivel biótico? 120. Robert Hooke denominó cellulla a cada una de las celdillas que aparecían en el campo de su microscopio cuando observaba láminas finas de corcho. ¿Eran en realidad células lo que observaba? ¿Qué era realmente lo que estaba observando? 121. Los científicos del Siglo XIX descartaron definitivamente la hipótesis de la “generaciónespontánea” afirmando que toda célula procede por división de otra célula preexistente. Si hubieran podido viajar en el tiempo y observar el océano de la Tierra hace unos 3000 millones de años es muy probable que no fueran tan categóricos en su afirmación. ¿Cómo explicarías esta aparente contradicción? 122. El tamaño de las células vivas oscila entre los 0,3 μm para las más pequeñas y los 100 μm para las más grandes. ¿Por qué no existen células sensiblemente más pequeñas o más grandes? 123. Completa la siguiente tabla indicando con un “Si” o un “No” la presencia o ausencia en los distintos tipos celulares de los siguientes orgánulos, estructuras,
Universidad Católica los Ángeles de Chimbote - ULADECH 263

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

componentes y procesos. CÉLULA PROCARIOTA Membrana Pared celular Envoltura nuclear Ribosomas Mitocondrias Cloroplastos Citoesqueleto Centrosoma Microtúbulos Nucleólos Cromatina Flagelos Mitosis Endocitosis 124.¿Por qué razón muchos tipos de células alteran la composición en ácidos grasos de los lípidos que forman parte de sus membrana s respondiendo a las variaciones de la temperatura ambiental? ¿Por qué se hace necesaria la presencia de esteroles entre los lípidos de membrana? 125.¿Por qué decimos que la membrana plasmática es un mosaico fluido? 126.Explica las diferencias entre las proteínas integrales y las proteínas periféricas de la membrana plasmática. ¿Por qué las proteínas integrales tienden en general a precipitar cuando se las extrae de la membrana? 127.¿Cómo se genera la pared celular vegetal? ¿Cómo se disponen sus diferentes capas en función de su mayor o menor proximidad a la membrana plasmática? 128.Después de una precipitación intensa el suelo queda totalmente encharcado y las células de las raíces de las plantas que habitan en él se ven rodeadas de un medio fuertemente hipotónico con respecto a su interior. ¿Cómo consiguen estas células resistir la elevada presión osmótica a la que se ven sometidas? 129.Las células musculares estriadas presentan unas estructuras repetitivas denominadas sarcómeros que son las responsables del fenómeno de la con tracción muscular. ¿Cuál es la composición química de estas estructuras? ¿En qué parte de la célula las encuadrarías? 130.En ocasiones, los microtúbulos dispersos del citoesqueleto se organizan para dar lugar a estructuras más concretas que pueden ser más o me nos permanentes en la célula. ¿Cuáles son esas estructuras? 131.¿A qué llamamos diplosoma? ¿Cuál es su composición y estructura? 132.¿Qué analogías y diferencias existen entre un centriolo, un corpúsculo basal de un cilio o flagelo, y el axonema del mismo? 133.Define mediante una frase corta los siguientes términos: ribosoma, lisosoma, nucleosoma, cromosoma, dictiosoma, peroxisoma, diplosoma, mesosoma . 134.¿En qué lugares de la célula eucariota podemos encontrar a los ribosomas? 135.Describe el camino que ha de seguir y las mo dificaciones que ha de experimentar una glucoproteína desde el momento en que es sintetizada hasta que queda
Universidad Católica los Ángeles de Chimbote - ULADECH 264



Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

definitivamente emplazada en la bicapa lipídica de la membrana plasmática. 136.¿Por qué decimos que el aparato de Golgi está estructural y bioquímicamente polarizado? 137.¿Con qué objeto la membrana de los lisosomas presenta una proteína que bombea iones hidrógeno desde el hialoplasma hacia el interior del lisosoma? 138.Expón dos razones por las que los enzimas hidrolíticos albergados en el interior de los lisosomas no degradan las biomoléculas localizadas en el citosol. 139.Explica la diferencia esencial entre vacuolas e inclusiones. 140.Una célula dispone en un momento dado de las siguientes sustancias para almacenar: glucosa, glucógeno, triacilglicéridos, aminoácidos. Razona en qué tipo de enclave citoplasmático se debería almacenar cada una de ellas. 141.¿Qué rasgos distintivos presenta la membrana mitocondrial interna comparada con otras membranas celulares? 142.Señala algunas de las analogías entre las mitocondrias y las ba cterias actuales que apoyen la teoría del origen endosimbionte de estos orgánulos. 143.Haz un esquema de una mitocondria y señala en él las dos membranas y los diferentes compartimientos que delimitan. 144.¿Por qué las patatas “verdean” superficialmente cuando se las expone durante mucho tiempo a la luz? 145.Haz un esquema de un cloroplasto y señala en él las tres membranas y los diferentes compartimientos que delimitan. 146.¿Qué rasgos distintivos presenta la membrana tilacoidal comparada con otras membranas celulares? 147.¿A qué llamamos espacio perinuclear? ¿Con qué otro compartimiento subcelular se comunica? 148.¿Qué similitudes y diferencias existen entre la cromatina y los cromosomas? 149.¿A qué llamamos cariotipo de una especie? 150.Cuando se observan las fibras de cromatina al micr oscopio electrónico aparecen unas estructuras repetitivas a las que se ha dado en llamar “el collar de perlas”. ¿En qué consiste esta estructura? 151.¿Qué ventaja representa para las células eucariotas empaquetar sus moléculas de DNA junto con proteínas histónicas? 152.Tanto las células eucariotas como las procariotas disponen de una serie de proteínas transportadoras de electrones que intervienen en el proceso de respiración celular, así como un enzima encargado de sintetizar el ATP. ¿En dónde se localizan estas proteínas en uno y otro tipo de célula? 153.¿Qué diferencias existen entre la pared celular de la célula vegetal y la de la célula procariota? 154.¿Qué diferencias existen entre los cromosomas de las células eucariotas y los de las células procariotas? 155.¿Por qué decimos que la membrana plasmática presenta permeabilidad selectiva? 156.¿Puede una sustancia atravesar la membrana plasmática en contra de gradiente de concentración por transporte pasivo? ¿En qué casos? ¿Qué tipo de gradiente determinaría la dirección del trans porte en tales casos? 157.Teniendo en cuenta que la vitamina A es una sustancia liposoluble ¿por qué modalidad de transporte crees que podrá atravesar la membrana plasmática? 158.¿A qué llamamos gradiente electroquímico a través de una membrana? 159.Teniendo en cuenta que el interior de la célula está cargado negativamente con
Universidad Católica los Ángeles de Chimbote - ULADECH 265

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

respecto al exterior (hay más cargas negativas dentro que fuera) ¿Crees que el aminoácido arginina podría entrar en la célula por difusión facilitada? 160.Muchas células son capaces de incorporar glu cosa al citosol en contra de gradiente de concentración a través de una proteína de la membrana que no consume ATP, sino que utiliza la energía almacenada en un gradiente electroquímico previamente establecido por la bomba de Na + y K+. ¿Cómo se denomina esta modalidad de transporte? 161.¿De dónde procede la energía que utiliza la bomba de Na + y K+ para bombear estos iones a través de la membrana en contra de sus respectivos gradientes? 162.Los distintos compartimientos subcelulares tienen en general una composición química diferente de la del citosol circundante. ¿Cómo explicarías este fenómeno? 163.Señala los mecanismos por los que crees que podrán entrar en la célula las siguientes sustancias: agua, glucosa, oxígeno, CO 2, aminoácidos, proteínas polisacáridos. 164.¿Cuál es el papel de la clatrina en los procesos de endocitosis? 165.¿En qué se diferencian pinocitosis y fagocitosis? 166.¿En qué consiste la pinocitosis mediada por receptores específicos? ¿Qué ventaja representa para las células frente a la pinocitosis convencional? 167.Una célula acaba de incorporar dentro de una vesícula endocítica un agregado supramolecular formado por proteínas y polisacáridos. Indica qué acontecimientos tendrán lugar desde este momento hasta que los nutrientes incorporados pasen a formar parte de la maquinaria bioquímica de la célula. 168.Indica cuál será el resultado de la digestión celular de cada uno de los siguientes tipos de biomoléculas: proteínas, polisacáridos, triacilglicéridos, oligosacáridos, fosfoglicéridos, nucleótidos, ácidos nucleicos. 169.¿Por qué algunas sustancias deben ser sometidas a un proceso de digestión celular antes de ser incorporadas a la maquinaria bioquímica de la célula? ¿A qué tipos de sustancias nos referimos? 170.¿Qué ventajas representa para los organismos unicelulares la digestión intracelular frente a la digestión extracelular? 171.¿Qué tipo de reacciones químicas intervienen en el proceso de digestión celular? ¿Qué tipo de enzimas catalizan estas reacciones? 172.¿Qué diferencia hay entre la digestión intracelular autofágica y la heterofágica? 173.¿Todas las células de un organismo pluricelular tienen la misma información genética? Razona la respuesta. 174.En el supuesto de que se pudiesen distinguir los cromosomas como entidades individualizadas a lo largo de todo el ciclo celular, indica en cuale s de las siguientes fases se encontrarían divididos longitudinalmente en dos cromátidas hermanas y en cuales no: telofase, período G1, período G2, profase, período S, anafase, metafase . Señala cuáles de ellas pertenecen a la interfase y cuáles a la mitosis. 175.¿Por qué consideramos poco adecuado denominar a la interfase período de reposo? 176.¿A qué llamamos placa metafásica? 177.¿Cuál es la diferencia entre los microtúbulos cinetocóricos y los microtúbulos polares del huso mitótico? 178.¿Por qué en la citocinesis de células vegetales no es posible la formación de un surco de segmentación semejante al que aparece en el caso de las células animales? 179.¿Qué orgánulo interviene en la citocinesis de las células vegetales que no lo hace en la de las células animales?
Universidad Católica los Ángeles de Chimbote - ULADECH 266

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

180.De las siguientes fases de la división celular meiótica distingue en cuales los cromosomas aparecerán divididos longitudinalmente en dos cromátidas hermanas y en cuales no: profase I, metafase I, anafase I, telofase I, profase II, metafase II, anafase II, telofase II. 181.¿Cuál es la diferencia esencial entre la anafase de la mitosis y la anafase de la primera división meiótica? 182.¿Por qué es necesaria una segunda división meiótica? 183.Cuál es el significado biológico de la meiosis? ¿Con qué tipo de reproducción se encuentra asociada? 184.¿En qué consiste el entrecruzamiento que tiene lugar durante la profase de la primera división meiótica? ¿Cuál es el significado biológico de este proceso? 185.¿Cuál es la diferencia entre la reproducción asexual y la reproducción sexual? 186.¿A qué llamamos cromosomas homólogos? )Cuál es la diferencia entre una dotación cromosómica haploide y una diploide? 187.¿Cuántas células resultan de una división meiótica completa? )Qué tipo de dotación cromosómica tendrán dichas células? 188.Algunos organismos unicelulares t ienden a acercarse a cualquier fuente luminosa. ¿Cómo llamarías a este tipo de movimiento celular? Distingue en este comportamiento cual es el estímulo y cual es la respuesta. 189.Las células del hígado alteran su metabolismo ante la presencia de distintas hormonas en el medio extracelular. ¿Cuál sería en este caso el estímulo y cuál la respuesta? 190.¿A qué llamamos conjugación bacteriana? ¿Por qué decimos que es una forma primitiva de sexualidad? 191.¿Por qué decimos que las células vivas son máquinas químicas? 192.Los enzimas consiguen que las reacciones químicas desfavorables termodinámicamente (ΔG1>0) se tornen favorables. ¿Qué opinas de esta afirmación? 193.Las enzimas no alteran los equilibrios termodinámicos de las reacciones químicas, pero consiguen que dichos equilibrios se alcancen más rápidamente de lo que sucedería en ausencia de enzima. ¿Qué opinas de esta afirmación? 194.¿A qué llamamos energía libre de activación de una reacción química? 195.¿Qué importancia tuvo para la b ioquímica el descubrimiento, debido a E. Büchner, de que los enzimas pueden actuar independientemente de la estructura celular? 196.¿Se puede afirmar en la actualidad que todos los enzimas son proteínas? Razona la respuesta. 197.¿Qué tipos de aminoácidos podemos encontrar en el centro activo de un enzima y cuáles son sus funciones? 198.¿En qué consiste el efecto de saturación del enzima por el sustrato? 199.¿A qué llamamos constante de Michaelis -Menten de un enzima? ¿Cuál es el significado biológico de dicha constante? 200.¿Por qué decimos que la hipótesis del complejo enzim a-sustrato explica satisfactoriamente el efecto de saturación del enzima por su sustrato? 201.Desarrolla el concepto de energía de fijación entre el enzima y el sustrato. Comenta brevemente el papel que juega la energía de fijación en la actividad de los enzim as. 202.¿Por qué resulta inadecuada la imagen de la llave y la cerradura para referirse a la interacción entre el sustrato y el enzima? ¿Qué otra imagen podría resultar más adecuada y por qué? 203.¿Por qué decimos que el grado de especificidad de los enzimas es mu y variado?
Universidad Católica los Ángeles de Chimbote - ULADECH 267

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

204.¿A qué llamamos pH óptimo de un enzima? ¿Por qué los enzimas pierden su actividad a valores de pH alejados de su pH óptimo? 205.¿Qué diferencia existe entre la inhibición enzimática competitiva y la incompetitiva? 206.Por qué son necesarios los enzimas reguladores? ¿Qué tipos de enzimas reguladores conoces? 207.¿A qué llamamos enzimas alostéricos? ¿Y moduladores alostéricos? ¿Qué tipos de moduladores alostéricos conoces? 208.¿En qué consiste el control feed-back o inhibición por el producto final? 209.Señala las principales diferencias entre los enzimas alostéricos y los enzimas modulados covalentemente. 210.¿A qué llamamos zimógenos? ¿Cómo se activan? 211.¿De qué maneras pueden actuar los iones metálicos como cofactores enzimáticos? 212.Explica la relación que existe entre coen zimas y vitaminas. 213.Explica por qué las necesidades exógenas de vitaminas varían ampliamente de unas especies a otras. 214.¿A qué llamamos rutas metabólicas? 215.¿Enuncia las principales diferencias entre el catabolismo y el anabolismo? 216.Qué es una ruta anfibólica? Pon un ejemplo que conozcas. 217.¿Podría una célula quimiótrofa utilizar el CO 2 como fuente de carbono? ¿Cómo llamarías a este tipo de célula? 218.Las células anaerobias no pueden utilizar el oxígeno como aceptor último de electrones en las reacciones redox que utilizan para obtener energía. ¿Qué tipo de compuestos utilizan? Pon algún ejemplo de este tipo de compuestos. 219.Haz una clasificación de los distintos tipos celulares atendiendo simultáneamente a las fuentes de carbono y energía que utilizan para su metabolis mo. 220.¿Cuándo podemos decir que una célula es anaerobia facultativa? Pon un ejemplo de este tipo de células? 221.Las células de las hojas de las plantas verdes ¿son fotolitótrofas en todas las situaciones? Justifica la respuesta. 222.La obtención de ATP a partir de ADP y fosfato inorgánico se denomina fosforilación . ¿Qué tipos de fosforilación conoces? Rastrea las rutas catabólicas que hemos estudiado y localiza en ellas dos ejemplos de fosforilación a nivel de sustrato. 223.¿Por qué decimos que el ATP es la moneda energ ética de la célula? 224.Escribe las formas oxidada y reducida de dos coenzimas transportadores de electrones. 225.¿Por qué decimos que la degradación de los glúcidos se lleva a cabo “vía glucosa”? 226.¿En qué lugar de la célula tiene lugar la glucolisis? ¿De qué compuesto parte esta ruta metabólica? ¿Qué compuestos se obtienen al final de la misma? 227.¿A qué llamamos fermentación? ¿Con qué objeto llevan a cabo las células este proceso? 228.Cita dos tipos de fermentación que conozcas y señala en cada uno de ellos cuál es el aceptor último de electrones. 229.¿Para qué utilizan las células la ruta de las pentosas? 230.¿En qué lugar de la célula tiene lugar el ciclo de Krebs? Indica los compuestos que entran y salen del ciclo en cada vuelta. 231.¿De dónde procede el acetil-CoA que entra en el ciclo de Krebs? 232.¿Por qué decimos que el transporte electrónico mitocondrial es un proceso “cuesta abajo”?
Universidad Católica los Ángeles de Chimbote - ULADECH 268

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

233.¿De dónde proceden los electrones que son transportados hasta el oxígeno por la cadena de transporte electrónico mitocondrial? 234.¿Cómo llega a la cadena de transporte electrónico mitocondrial el poder reductor generado en el hialoplasma durante la glucolisis? 235.Algunos compuestos como el 2,4, dinitrofenol tienen el efecto de desacoplar el transporte electrónico de la fosforilación oxidativa. Para ello, se introducen entre los lípidos de la membrana mitocondrial interna volviéndola permeable a los iones hidrógeno. ¿Podrías explicar este efecto desacoplante? 236.Explica por qué los electrones procedentes del NADH producen más ATP al circular por la cadena respiratoria que los procedentes del FADH 2. 237.Calcula cuantas moléculas de ATP se obtienen mediante la degradación total de una molécula de glucosa hasta CO 2 y H2O. 238.¿Podría tener lugar la fosforilación oxidativa si los componentes de la cadena respiratoria se encontrasen libres en disolución en lugar de estar anclados en la membrana mitocondrial interna? 239.Explica la diferencia entre el anabolismo autótrofo y el anabolismo heterótrofo. ¿Qué tipos de células pueden realizar uno y otro tipo de anabolismo? 240.¿Qué tipos de sustancias inorgánicas se fijan en forma de materia orgáncia en el proceso de fotosíntesis? 241.Localiza los pigmentos responsables de la fotosíntesis en una célula procariota y en una célula eucariota. 242.Resume en pocas palabras los procesos de la fase luminosa y de la fase oscura de la fotosíntesis. 243.¿En qué tipo de estructuras están organizados los pigmentos fotosintéticos? Describe brevemente una de estas estructuras. 244.¿A qué llamamos complejo antena? ¿Y centro de reacción? ¿Cómo se denomina el conjunto formado por ambos? 245.¿En qué se diferencian fundamentalmente el transporte electrónico mitocondrial del transporte electrónico fotosintético? 246.¿En qué lugar de la célula tiene lugar la fase luminosa de la fotosíntesis? ¿Y la fase oscura? 247.Describe brevemente el flujo de electrones característico del transporte electronico fotosintético (puedes ayudarte de un esquema). 248.¿Con qué objeto llevan a cabo las células la fotofosforilación cíclica? ¿En qué se diferencia de la fotofosforilación no cíclica? 249.¿Por qué se considera poco afortunada la denominación “fase oscura” de la fotosíntesis? 250.Enuncia los tres procesos principales que configuran el ciclo de Calvin. 251.¿Cuál es el destino de los fosfatos de triosa que se generan en el ciclo de Calvin? 252.¿A qué se debe el fenómeno de la fotorrespiración? ¿Por qué se denomina así? 253.¿Cómo solucionan algunas plantas el problema causado por la fotorrespiración? ¿Cómo se denominan estas plantas? 254.¿En qué forma obtienen las plantas el nitrógeno y el azufre que necesitan para construir determinadas biomoléculas? 255.¿Cómo emplean las células fotosintéticas los productos de la fase luminosa para la fijación del nitrógeno y el azufre? 256.Explica cómo varía la intensidad fotosintética en función de la concentración de dióxido de carbono. ¿Por qué para nivele s altos de CO2 la intensidad fotosintética se
Universidad Católica los Ángeles de Chimbote - ULADECH 269

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

torna insensible a este factor? 257.¿Cómo afecta la mayor o menor concentración de O 2 a la intensidad fotosintética? ¿A qué puede ser debido este efecto? 258.¿En qué se diferencian fundamentalmente la fotosíntesis de l a quimiosíntesis? 259.¿En qué consiste la gluconeogénesis? ¿En qué lugar de la célula transcurre? 260.¿De qué metabolito parte la síntesis reductora de ácidos grasos? ¿En qué lugar de la célula transcurre?

261.Indica en qué datos experimentales se basaron Watson y Crick para elaborar su modelo de doble hélice para la estructura del DNA. 262.Enuncia brevemente la “regla de equivalencia de bases ” de Chargaff. 263.¿Por qué decimos que las dos hebras de una doble hélice d e DNA son antiparalelas? 264.La transformación R en S observada por Griffith en los pneumococos fue atribuida por algunos críticos a que algunas bacterias S habían sobrevivido a la esterilización por calor, siendo éstas las responsables de la infección y muert e del ratón y no las bacterias R supuestamente transformadas. ¿Cómo se pudo demostrar que en efecto tenía lugar una transformación R en S? 265.¿Qué demostraron exactamente Hershey y Chase en su experimento con bacteriófagos? 266.¿Qué procedimiento utilizaron Avery y sus colaboradores para demostrar que el “principio transformador” era DNA?. 267.Enumera los tres modelos “a priori” considerados para la replicación del DNA y explica brevemente en qué consiste cada uno de ellos. 268.Explica esquemáticamente los resultados que hubiesen obtenido Messelson y Sthall en su experimento en caso de que la replicación del DNA siguiese un modelo dispersivo. ¿Y en el caso de que fuese conservativo? 269.¿Por qué las cadenas de DNA en crecimiento se sintetizan a partir de nucleótidos trifosfato y no a partir de nucleótidos monofosfato? 270.Explica en pocas palabras qué es lo que Asaben@ hacer las DNA polimerasas conocidas hasta la actualidad. 271.Explica por qué en la replicación del DNA son necesarios los “cebadores”. ¿En qué consisten tales cebadores? 272.¿Qué hecho estamos resaltando cuando decimos que la replicación del DNA es “semiconservadora”? 273.Comenta las diferencias entre el concepto clásico de gen y el nuevo concepto que surge con la biología molecular. 274.¿Por qué decimos que la replicación del DNA es bidireccional? 275.Explica el problema que se deriva del hecho de que las DNA polimerasas solo puedan sintentizar cadenas en dirección 5' a 3'. 276.En la replicación del DNA ¿a qué llamamos hebra líder y a qué hebra rezagada? ¿En qué consisten los llamados “fragmentos de Okazaki”? 277.¿Cómo explicarías, a la luz de los conocimientos actuales, el fenómeno de la transformación R en S observado por F. Griffith en sus experimentos con neumococos?
Universidad Católica los Ángeles de Chimbote - ULADECH 270

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

278.En el lejano planeta Rebordelos (todavía por descubrir) existen organismos v ivos que difieren de los organismos terrestres en algunos aspectos de su bioquímica. El profesor Bernardo Lumbreras, prestigioso investigador rebordeliano, ha realizado recientemente en su planeta un experimento análogo al realizado en la Tierra por Messelson y Sthal. Los resultados que obtuvo fueron los siguientes: en la primera generación el tubo de la centrífuga mostraba una banda “ligera” y otra “pesada”; en sucesivas generaciones se mantenía este patrón, pero la banda “ligera” se iba haciendo más nítida mientras que la “pesada” se iba difuminando; en ningún caso aparecían bandas híbridas. A la vista de estos resultados ¿Podrías ayudar al profesor Lumbreras a discernir que tipo de replicación del DNA presentan los organismos vivos de Rebordelos? 279.¿A qué llamamos “molde” y “cebador” en el proceso de replicación del DNA? 280.Explica de donde proviene la energía necesaria para enlazar los sucesivos restos nucleotídicos en una cadena de DNA en crecimiento. 281.Todas las DNA-polimerasas conocidas sintetizan DNA añadien do nucleótidos en dirección 5' a 3'. Por otra parte, las dos cadenas de una doble hélice de DNA son antiparalelas. Explica como pueden las células vivas sintetizar simultáneamente las dos cadenas hijas complementarias a las dos cadenas parentales de una mo lécula de DNA en replicación. 282.Explica como solucionan las células eucariotas el problema del acortamiento de los telómeros que se produce en cada ciclo de división celular. ¿Por qué no se da este problema en las células procariotas? 283.¿Cuál es la función que realizan las helicasas y las topoisomerasas en la replicación del DNA? 284.¿Cuál es el papel de la DNA ligasa en la replicación del DNA? 285.¿Qué característica de la telomerasa le permite “reparar” los extremos de los cromosomas? 286.Enumera los principales tipos de RNA y cita la función biológica de cada uno de ellos. 287.Indica cuáles de las siguientes proposiciones son verdaderas y cuáles falsas atendiendo a la regla de equivalencia de bases de Chargaff: [A+C] = [G+T] [A] = [T] y [G] = [C] [A+G] = [C+T] [A] = [G] y [T] = [C] [A] = [C] y [G] = [T] 288.Explica la diferencia entre mutación génica y mutación cromosómica. 289.¿En qué reside la capacidad mutagénica de los agentes químicos denominados “análogos de base”? 290.Explica cómo actúan los denominados “agentes intercalantes” en la producción de mutaciones. ¿Qué tipo de mutación suelen producir? 291.¿Por qué la inserción o deleción de una base en una cadena de DNA suele tener consecuencias más drásticas que una simple sustitución de una base por otra ? 292.Señala la diferencia esencial entre las “actividades” de las DNA polimerasas y las RNA polimerasas. 293.En la actualidad se considera más apropiado referirse a la clásica teoría “un gen – una enzima” con la denominación “un gen - un polipéptido” o incluso “un cistrón – un polipéptido”. Trata de justificar este cambio de denominación. 294.¿Todas las células somáticas de un organismo pluricelular llevan la misma
Universidad Católica los Ángeles de Chimbote - ULADECH 271

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

información genética? Justifica la respuesta. 295.¿En todas las células somáticas de un organismo pluricelul ar se expresa la misma información genética? Justifica la respuesta. 296.Explica en pocas palabras los conceptos de transcripción y traducción. 297.Elabora un pequeño esquema en el que se refleje el denominado “dogma central de la biología molecular”. 298.¿Pueden existir segmentos con estructura de doble hélice dentro de una molécula de RNA? ¿Y dobles hélices mixtas DNA-RNA? Pon ejemplos de uno y otro caso. 299.Los productos de la transcripción ¿Terminan siempre siendo traducidos a la estructura primaria de una proteína? Justifica la respuesta. 300.Enumera las tres fases de que consta el proceso de transcripción. ¿Como se llama la fase adicional que puede tener lugar o no? 301.Explica los conceptos de exón e intrón. 302.¿En qué fase de la expresión génica se eliminan los intrones? ¿Tiene lugar antes o después de la transcripción? 303.¿En qué grupos de organismos los genes se encuentran fragmentados en intrones y exones y en cuales no lo están? 304.¿En qué consiste el proceso de maduración del RNA transcrito primario en las células eucariotas? 305.¿Por qué en los organismos eucariontes la transcripción y la traducción no pueden ser casi simultáneas como lo son en los procariontes? 306.Enuncia al menos tres diferencias entre la transcripción en procariontes y en eucariontes. 307.¿Por qué decimos que el código genético es degenerado, universal, sin comas y sin solapamientos? 308.¿Qué ventaja evolutiva pudo suponer la “degeneración” del código genético? 309.Con la ayuda de una tabla del código genético, si es preciso, determina la secuencia de aminoácidos codificada en la secuencia de nucleótidos del siguiente fragmento de DNA (se tendrán en cuenta los tripletes de inicio y fin de síntesis) 5' GTTATTTACGATTAGCCCAAAAGGTGCACTAAAGTC 3' 310.Define con precisión los términos codón y anticodón. 311.¿En dónde reside la especificidad de la unión entre cada aminoácido y su correspondiente t-RNA? 312.En ocasiones se observan al microscopio electrónico estructuras inestables, denominadas polisomas, que están formadas por varios ribosomas próximo unos a otros. ¿Qué interpretación darías a estas estructuras? 313.¿Cuál es la función del enzima peptidil -transferasa en el proceso de síntesis de una proteína? 314.¿Cuál es el aminoácido con el que generalmente se inicia la síntesis de una cadena polipeptídica? ¿En qué extremo de la cadena se sitúa? 315.¿Qué representan los denominados “sitio A” y “sitio P” en el proceso de traducción? 316.¿Por qué la regulación de la expresión génica tiene lugar fundamentalmente a nivel del proceso de transcripción y no del de traducción? 317.Define los términos operón, promotor, operador, represo . 318.Explica la diferencia entre genes estructurales y genes reguladores. 319.¿Cuál es la fórmula de un polisacárido que está formado por 245 moléculas de terrosas? 320.¿Cuál es la f´órmula de un polisacárido que está formado por 15 p entosas, 16
Universidad Católica los Ángeles de Chimbote - ULADECH 272

Mblgo. Luis Alberto Sánchez Angulo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

hexosas y 17 heptosas? 321.Si una proteína en su estructura primaria está formada por 2,547 aminoácidos, ¿Cuántos átomos de hidrógeno se han liberado para formar dicha estructura primaria? 322.¿En el proceso de glucólisis, cuántos piruvatos, NADH 2 reducidos, ATP totales, ATP netos se forman? 323.¿Qué función cumple la enzima aldolasa en el proceso de glucólisis? 324.¿Al actuar la piruvato deshidrogenasa en la conversión del piruvato a acetilcoenzima A, cuantas moléculas de dióxido de carbono se liberan y cuanto s NADH 2 (reducidos) se forman si se degradan cinco moléculas de glucosa totalmente? 325.¿Si se degradan doce moléculas de glucosa en un proceso estrictamente anaeróbico, cuántos ATP se forman en total? 326.¿En el ciclo de Krebs cuantos ATP se forman por molécula d e glucosa? 327.¿En el ciclo de Krebs cuántos NADH 2 (reducidos) se forman cuando se degrada completamente ocho moléculas de glucosa? 328.¿Cuándo se degrada totalmente una molécula de glucosa. en un proceso aeróbico, cuántos ATP se forman en cadena respiratoria? 329.¿En un proceso hipotético aeróbico, se obtienen 2ATP, 4GTP, 12 NADH 2 y 4 FADH 2; cuántos ATP totales se forman a partir de una fosforilación oxidativa? 330.¿Si se degrada media molécula de glucosa en el ciclo, cuántos ATP se forman en cadena respiratoria? 331.¿Incluyendo los NADH 2 reducidos que van a cadena respioratoria, cuántos ATP se forman en el proceso de glucólisis teniendo en cuenta el gasto de energía? 332.¿Cuántos ATP se formarán (sin tomar en cuenta el gasto de energía) si se degrada por completo veinte moléculas de glucosa? 333.¿Cuántos ATP se formarán en forma global (sin tener en cuenta el gasto de energía), cuando se degradan totalmente, en forma aeróbica, cuatro maltosas, cinco glucosas, y seis piruvatos? 334.¿Cuántos ATP se formarán en forma global (teniendo en cuen ta el gasto de energía), cuando se degradan totalmente, en forma aeróbica, cuatro maltosas, cinco glucosas, y seis piruvatos? 335.¿Cuántos ATP se formarán en forma global (sin tener en cuenta el gasto de energía), cuando se degradan en forma anaeróbica, ocho m altosas y seis glucosas? 336.¿Cuántos ATP se formarán en forma global (teniendo en cuenta el gasto de energía), cuando se degradan en forma anaeróbica, ocho maltosas y seis glucosas?

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

1. 2. Acido.- Una sustancia que produce un incremento en el número de iones hidrógeno (H +) en una solución y una disminución en el número de iones hidrógeno (OH -); que tiene un pH inferior a 7; lo opuesto a una base. Acido graso.- Acido orgánico que contiene una cade na de hidrocarburo larga sin dobles enlaces (ácido graso saturado), un doble enlace (un ácido graso monoinsaturado) o dos o más dobles enlaces (ácido graso poliinsaturado); los ácidos grasos son componentes de grasas neutras y fosfolípidos. Actina.- Una proteína compuesta por subunidades globulares, que forma filamentos que se encuentran entre los componentes principales del citoesqueleto. También una de las dos proteínas principales del músculo (la otra es miosina), el constituyente principal de los filam entos delgados. Actividad fotosintética. - En la fotosíntesis, las plantas verdes utilizan el pigmento verde clorofila para captar energía luminosa, que convierten en energía química, la cual utilizan para fabricar materia orgánica a partir de anhídrido carbónico (CO 2) y agua, desprendiendo oxígeno. En el laboratorio la actividad fotosintética puede medirse de varias formas, entre ellas por la cantidad de oxígeno desprendido. En la naturaleza, en superficies terrestres o masas de agua, la determinación de l a clorofila presente o su evaluación por teledetección puede utilizarse como una medida de la biomasa de organismos fotosintéticos. Adaptación.- l. Estado de encontrarse ajustado al ambiente como resultado de la selección natural. 2. Una peculiaridad de la estructura, fisiología o comportamiento que ayuda al organismo en su ambiente. 3. Adaptación fisiológica, proceso que puede ocurrir ya sea en el curso de la vida de un organismo individual –tal como la producción de más glóbulos rojos en respuesta a la e xposición a grandes altitudes– o bien en una población, durante el curso de muchas generaciones. Adenina.- Base nitrogenada purínica componente de ácido desoxirribonucleico y ATP. Adenosín trifosfato.- El nucleótido que suministra la moneda corriente ene rgética para el metabolismo celular; compuesto por adenina, ribosa y tres grupos fosfatos. Al hidrolizarse, el ATP pierde un grupo fosfato y un ion hidrógeno y se transforma en adenosina difosfato (ADP), liberando energía en el proceso. El ATP se forma a p artir de ADP y fosfato inorgánico, en una reacción enzimática que atrapa energía liberada por el catabolismo o energía capturada en la fotosíntesis. ADN.- Acido nucleico de doble cadena; contiene información genética codificada en la forma de secuencias específicas de los nucleótidos que lo constituyen. ADN recombinante.- Molécula de ADN formado por recombinación de fragmentos de ADN de orígenes diferentes. La (o las) proteína que codifica es una proteína recombinante. Se construye mediante la unión de un fragmento de ADN de origen diverso a un vector, como, por ejemplo, un plásmido circular bacteriano. El vector se abre por un sitio específico, se le inserta entonces el fragmento de ADN de origen diverso y se cierra el círculo de nuevo. El ADN recombinante se amplifica en una célula huésped en la que puede replicarse el vector. Agente Mutagénico.- Compuesto químico que produce mutaciones en la descendencia de los organismos vivos. Una mutación es un cambio en la estructura del material genético de un orga nismo, y aunque existen mutaciones ventajosas la mayoría son dañinas o neutras. Con frecuencia los agentes mutagénicos son cancerígenos. Un ejemplo común es la acción del diclorvos; otro es la radiación ionizada. Aislamiento genético.- La ausencia de intercambio genético entre poblaciones o especies como resultado de la separación geográfica o de mecanismos de preapareamiento o posapareamiento (anatómicos, fisiológicos o de comportamiento) que evitan la reproducción. Albinismo.- El pigmento melanina no puede ser sintetizado por los albinos. Diferentes mutaciones pueden causar albinismo: 1) la falta de una u otra enzima lo largo de la vía sintetizadora de melanina; o 2) la incapacidad de la enzima para entrar en las células pigmentarias y transformar el ami noácido tirosina en melanina. Alelo dominante.- Alelo que siempre se expresa cuando está presente, sin importar si es homocigoto o heterocigoto. Alelo recesivo.- Alelo que no se expresa en el estado heterocigoto. Alelos.- Genes que rigen la variación de l mismo carácter y que ocupan posiciones (loci) correspondientes en cromosomas homólogos; formas alternativas de un gen. Aminoácido.- Compuesto orgánico que contiene un grupo amino ( -NH2) y un grupo carboxilo ( -COOH); puede estar unido por enlaces peptídi cos para formar las cadenas polipeptídicas de las moléculas de proteína. Las subunidades (monómeros) que forman las proteínas (polímeros). Cada aminoácido posee por lo m enos un grupo funcional amino (básico) y un grupo funcional carboxilo (ácido) y difiere de otros aminoácidos por la composición de su grupo R. Los aminoácidos son ácidos en los cuales uno o más átomos de carbono tienen un grupo amino 275




6. 7.

8. 9.




13. 14. 15. 16.

Universidad Católica los Ángeles de Chimbote - ULADECH

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular



19. 20.



23. 24. 25. 26. 27. 28.

(derivado del amoníaco en el que uno o más átomos de hidrógeno se han sustituído por radicales hidrocarbonados), de los 70 conocidos, sólo 20 se encuentran en las proteínas Aminoácido esencial.- Aminoácido que no puede ser sintetizado por el propio organismo. De los 20 aminoácidos necesarios en las proteínas humanas, solamente son esenciales los 8 siguientes: le ucina, isoleucina, lisina, metionina, fenilalanina, treonina, triptófano y valina. Amniocentésis.- Procedimiento invasivo por el cual mediante una fina aguja que se inserta en el fluido amniótico (bajo monitoreo ecográfico) que rodea al feto (término apl icado al bebé antes del primer trimestre) se obtienen células que se desprendieron del feto. Estas células pueden cultivarse y utilizarse, entre otras, para determinar el cariotipo el cual puede mostrar las anomalías del Síndrome de Down o el sexo del bebé . Amplificación.- Un aumento del número de copias de un fragmento específico de ADN. Puede producirse in vivo o in vitro. Ver clonación, reacción en cadena de la polimerasa. Anafase.- Etapa de la mitosis y de las meiosis I y II en la que los cromosoma s se desplazan a los polos opuestos de la célula; la anafase ocurre despuén de la metafase y antes de la tefofase. En la mitosis y en la meiosis II, la etapa en la cual las cromátides de cada cromosoma se separan y se mueven a polos opuestos; en la meiosis I, la etapa en la cual los cromosomas homólogos se separan y se mueven hacia polos opuestos. Anticodón.- Secuencia de tres nucleótidos en el RNA de transferencia que es complementaria al codón de tres nucleótidos del RNA mensajero (y se combina con él), de manera que ayuda a especificar la adición de un aminoácido dado al extremo de un polipéptido en formación. Apoptosis.- Muerte celular programada, suicidio celular. Cuando ello ocurre la célula se encoge y desprende de sus vecinas. En su superficie apar ecen burbujas (la célula parece hervir) y la cromatina se condensa formando una o varias manchas cerca de la membrana nuclear. Poco después se fragmenta en numerosos cuerpos apoptosicos que engloban fracciones de las células siendo finalmente fagocitados. ARN.- Familia de ácidos nucleicos monocatenarios que participan principalmente en la síntesis de proteínas. ARN satélites.- ARN similar a los viroides empaquetados en capsides de determinadas cepas de virus, se replican en presencia del virus "colabor ador" específico, modificando su patogenicidad. Aster.- Sistema de microtúbulos con forma de estrella, que se expande desde un centrosoma o desde el polo del huso mitótico. ATP.- Compuesto orgánico que contiene adenina, ribosa y tres grupos fosfato; de i mportancia fundamental para las transferencias energéticas en las células. Autosoma.- Cualquier cromosoma que no sea un cromosoma sexual. Los seres humanos tienen 22 pares de autosomas y un par de cromosomas sexuales. Autótrofo.- Un organismo capaz de sintetizar todas las moléculas orgánicas necesarias a partir de sustancias inorgánicas simples (por ejemplo, H 2O, CO2, NH3) y de alguna fuente de energía (por ejemplo, luz solar); opuesto a heterótrofo. Las plantas, las algas y algunos grupos especializados de procariotas son autótrofos.

29. Bacterias.- Término general para referirse a dos grupos de microorganismos procarióticos unicelulares, arqueobacterias y eubacterias. La mayoría son desintegradoras, pero algunas son parásitas, y otras, autótrofas. 30. Bacteriófago.- Virus que infecta bacterias (literalmente, "comedor de bacterias"). También llamado fago. 31. Bases apareadas.- Dos bases nitrogenadas (adenina y timina o guanina y citosina) mantenidas juntas por enlaces débiles (puente hidrógeno). Las dos hebras del ADN se mantienen juntas formando una doble hélice por los enlaces de sus bases apareadas. 32. Biblioteca de cDNA.- Colección de plásmidos recombinantes que contienen copias de DNA complementario (cDNA) de plantillas de mRNA. El cDNA, que carece de int rones, es sintetizado por transcriptasa inversa. Compárese con biblioteca genómica de DNA. 33. Biología molecular.- Parte de la biología que trata de los fenómenos biológicos a nivel molecular. En sentido restringido comprende la interpretación de dichos fenó menos sobre la base de la participación de las proteínas y ácidos nucleicos. 34. Biotecnología.- Conjunto de técnicas desarrolladas en los últimos años, en que se aplican los avances en genética y fisiología para nuevas aplicaciones industriales, agrícolas, c línicas o de tratamiento de residuos (producción de insulina y hormona del crecimiento humanos por bacterias, obtención de cepas o de organismos transgénicos de mayor crecimiento o resistencia a stress ambientales, etc.). 35. Bomba de sodio y potasio. - Sistema de transporte activo celularque extrae iones sodio e introduce iones potasio en las células. 36. Buffer.- Combinación de las formas dadora y aceptora de H+ de un ácido débil o una base débil; un buffer evita cambios apreciables de pH en las soluciones a las cuales se les añade pequeñas cantidades de ácidos o bases.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

37. Caloría.- La cantidad de energía en forma de calor que se necesita para elevar la temperatura de un gramo de agua en 1°C, al hacer mediciones metabólicas, se usa generalmente la kilocaloría (caloría). Una caloría es la cantidad de calor requerida para elevar la temperatura de un kilogramo de agua en 1°C. 38. Canal iónico.- Proteína que forma un poro hidrofílico a través de la membrana por el que difunden iones específicos a favor de su gradient e electroquímico. 39. Cáncer.- Tumor maligno en general y especialmente el formado por células epiteliales. La característica básica de la malignidad es una anormalidad de las células transmitida a las células hijas que se manifiesta por la reducción del control del crecimiento y la función celular, conduciendo a una serie de fenómenos adversos en el huésped, a través de un crecimiento masivo, invasión de tejidos vecinos y metástasis. La proliferación celular en los tumores malignos no es totalmente autónoma. Además de la dependencia del cáncer respecto del huésped para su irrigación sanguínea, su crecimiento se afecta por las hormonas, los fármacos y los mecanismos inmunológicos del paciente. Los cánceres se dividen en dos grandes categorías de carcinoma (epit elios) y sarcoma (mesénquimas). 40. Cápside.- Cubierta proteínica que rodea al ácido nucleico de un virus. 41. Carbohidrato.- Compuesto que contiene carbono, hidrógeno y oxígeno en la porción aproximada de C:2H:O; por ejemplo azúcares, almidón y celulosa. 42. Carbono 14.- Isótopo radiactivo del elemento químico Carbono (símbolo C). el C 14 se utiliza como marcador radiactivo de sustancias químicas. Su determinación en materiales orgánicos antiguos, subfósiles y fósiles permite determinar la edad en años. Este método desarrollado por W.F. Libby en 1948, fue la primera técnica de datación absoluta por isótopos radiactivos. 43. Cariotipo.- Constitución cromosómica de un individuo. Las representaciones del cariotipo por lo general se obtiene fotografiando los cromosomas y d isponiendo los pares homólogos en pares conforme a su tamaño, posición del centrómero y patrón de bandas. 44. Cariotipo XYY.- Constitución cromosómica que hace que los individuos afectados (varones fecundos) sean inusualmente altos, con acné intensa. 45. Casquete de mRNA.- Un nucleótido inusual, 7-metilguanosina, que se agrega al extremo 5' de un RNA mensajero eucariótico. La formación del casquete permite a los ribosomas eucarióticos unirse al mensaje. 46. Catabolismo.- Aspecto del metabolismo en el cual se degrada n sustancias complejas para formar otras más simples; las reacciones catabólicas revisten particular importancia para la liberación de la energía química almacenada por la célula. 47. Catalizador.- Sustancia que incrementan la rapidez con que ocurre una reac ción química sin consumirse en esa reacción. Las enzimas son catalizadores biológicos. 48. Catión.- Partícula con una o más unidades de carga positiva, como el ión hidrógeno (H+) o el ión calcio (Ca+). 49. Célula.- Unidad estructural y funcional básica de la vid a, que consta de materia viva rodeada por una membrana. 50. Célula madre.- Célula relativamente indiferenciada capaz de experimentar división celular repetida. En cada división cuando menos una de las células hijas suele permanecer como célula madre, mientras que es posible que la otra se diferencie en u tipo celular específico. 51. Célula plasmática.- Célula que secreta anticuerpos; linfocitos B diferenciados. Célula productora de anticuerpos que resulta de la diferenciación y proliferación de un linfocito B en interacción con un antígeno complementario a los anticuerpos que despliega en su superficie. Una célula plasmática madura puede producir entre 3.000 y 30.000 moléculas de anticuerpo por segundo. 52. Célula somática.- Célula del cuerpo que no participa en la f ormación de gametos. 53. Células pluripotenciales. - Células que pueden originar por diferenciación varias líneas celulares a diferencia de las totipotenciales o totipotentes que pueden originar cualquier tipo celular. 54. Celulosa.- Polisacárido estructural formado por unidades de glucosa beta; principal constituyente de las paredes primarias de las plantas. 55. Centriolos.- Un par de pequeños organelos cilíndricos dispuestos perpendicularmente entre sí cerca del núcleo en el citoplasma de las células animales y det erminados protistas y células vegetales; cada centriolo tiene la forma de un cilindro constituído por nueve tripletes de microtúbulos (estructura 9 x 3). 56. Centrómero.- Región constreñida especializada de una cromátide; contiene el cinetocoro. En las célula s en profase y metafase, las cromátides hermanas se unen en la vecindad de sus centrómeros. 57. Centrosoma.- Estructura de las células animales que funciona primariamente como un centro organizador de microtúbulos y actúa como polo del huso mitótico durante l a división celular. En la mayoría de las células animales contiene un par de centríolos. 58. Cenzima A.- Cofactor orgánico encargado de transferir grupos derivados de ácidos orgánicos. Universidad Católica los Ángeles de Chimbote - ULADECH 277

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

59. Ciclinas.- Proteínas reguladoras cuya concentración oscila durante el ci clo celular, activan cinasas de proteína dependientes de ciclina. 60. Ciclo celular.- Serie cíclica de procesos en la vida de una célula eucariota capaz de dividirse; consiste en mitosis, citocinesis y las etapas de la interfase. El tiempo necesario para comp letar un ciclo es el tiempo de generación. 61. Ciclo del ácido cítrico.- Serie de reacciones químicas en la respiración celular aerobia; en él, la acetilCoA se degrada por completo a dioxido de carbono y agua, con liberación de energía metabólica, la cual se emplea para producir ATP. 62. Ciclo del carbono.- Circulación y reutilización mundial de los átomos del carbono, debido principalmente a los procesos metabólicos de los seres vivos. El carbono inorgánico, en forma de dióxido de carbono, se incorpora a compuestos orgánicos por acción de los organismos fotosintéticos; cuando los compuestos orgánicos son degradados durante la respiración, se libera dióxido de carbono. Grandes cantidades de carbono se "almacenan" en los mares y en la atmósfera, así como en los dep ósitos de combustibles fósiles. 63. Ciclo vital.- El lapso entero de existencia de cualquier organismo, desde el momento en que se forma el cigoto (o desde la reproducción sexual) hasta que se reproduce. 64. Cigoto.- Célula 2n que resulta de la unión de gametos "n" en la reproducción sexual. Las especies no poliploides tienen gametos haploides y cigotos diploides. 65. Cinetocoro.- Porción del centrómero cromosómico a la que se unen las fibras del huso mitótico. 66. Citocinesis.- Etapa de la división celular en la que e l citoplasma se divide para formar dos células hijas. 67. Citocromos.- Proteínas hem que contiene hierro y participan en un sistema de transporte de electrones. 68. Citoesqueleto.- Red interna dinámica de fibras proteínicas; incluye microfilamentos, filamentos i ntermedios y microtúbulos. 69. Citoplasma.- Contenido celular, con la excepción del núcleo. 70. Citosina.- Base nitrogenada pirimídica componente de los ácidos nucleicos. 71. Citosol.- Componente líquido del citoplasma en el cual están suspendidos los organelos. 72. Citrato.- Acido orgánico de seis carbonos. 73. Clona.- (1) Población de células descendientes por división mitótico de una sóla célula ancestral; (2) población de organismos genéticamente identicos propagados de manera asexual a aprtir de un sólo individuo. 74. Clonación humana.- Proceso para obtener individuos genéticamente idénticos o poblaciones celulares humanas con una misma información genética. 75. Clorofila.- Grupo de pigmentos verdes captadores de luz presentes en la mayor parte de organismos fotosintéticos. 76. Cloroplastos.- Organelos membranosos donde ocurre la fotosíntesis en los eucariotas; se encuentran en algunas células vegetales y algales. 77. Código de tripletes.- Secuencias de tres nucleótidos que constituyen los codones, unidades de información genética en el mRNA que especifican el orden de los aminoácidos en una cadena polipeptídica. 78. Código genético.- Sistema de tripletes de nucleótidos en el DNA y el RNA, que lleva información genética; determina la secuencia de aminoácidos en las enzimas y otras p roteínas sintetizadas por el organismo. 79. Codominancia.- Condición enla cual dos alelos de un locus se expresan en el heterocigoto. 80. Codón.- Triplete de bases de mRNA que especifica un aminoácido, una señal de inicio o una señal de terminación del polipéptido. 81. Codón de inicio.- Codón AUG, que actúa como señal para iniciar la traducción del RNA mensajero. Compárese con codón de terminación. 82. Codón de terminación.- Cualquier codón en mRNA que no codifica un aminoácido (UAA; UAG o UGA). Detiene la traducción en ese punto. Comparese con codón de iniciacion. 83. Coenzima.- Cofactor orgánico de una enzima; por lo general participa en la reacción transfiriendo algún componente, como electrones o parte de una molécula sustrato. Molécula orgánica no proteínica que desem peña un papel accesorio en los procesos catalizados por enzimas y frecuentemente actúan como dador o aceptor de una sustancia que interviene en la reacción. NAD+, FAD y la coenzima A son coenzimas comunes. 84. Cofactor.- Sustancia no proteica necesaria para l a actividad normal de una enzima; algunos cofactores son inorgánicos (usualmente iones metabólicos), y otros son orgánicos (coenzimas). 85. Complejo de Golgi.- Organelo formado por pilas de sacos membranosos aplanados. Encargado principalmente de modificar, empacar y clasificar proteínas que serán secretadas o enviadas a otros organelos del sistema de membranas internas o a la membrana plasmática. 86. Complejo enzima-sustrato.- Asociación temporal entre enzimas y sustrato que se forma durante el transcurso de una reación catalizada; también llamada complejo ES. 87. Complejo sinaptonémico. - Estructura visible al microscopio electrónico que se forma entre cromosomas homólogos en sinapsis. Universidad Católica los Ángeles de Chimbote - ULADECH 278

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

88. Control por realimentación. - Tipo de regulación enzimática en el cual la acumulac ión del producto de una reacción inhibe una reacción anterior en la secuencia. También llamado control por retroacción. 89. Cósmico.- En la tecnología del DNA recombinante, un vector construido para portar fragmentos de DNA de gran tamaño. El inserto queda flanqueado por regiones cohesivas (regiones COS), derivadas del bacteriófago lambda. 90. Crestas mitocondriales.- Proyecciones internas a modo de repisas o dedos de la menbrana interna de una mitocondria. 91. Cri-du-chat.- Enfermedad genética humana causada por la pérdida de parte del brazo corto del cromosoma 5 y caracterizada por retardo mental , llanto parecido al maullido de un gato, y muerte en la lactancia o la infancia temprana. 92. Crick, Francis.- Biofísico inglés que contribuyó a determinar la estructura del ADN. En 1962 Crick, Watson y Wilkins compartieron el Premio Nobel de Fisiología y Medicina por su trabajo. 93. Cromátide, cromátides hermanas. - Cualquiera de las dos cadenas de un cromosoma replicado, unidas por sus centrómeros. 94. Cromátides.- Las mitades idénticas de un cromosoma duplicado; las dos cromátides que constituyen un cromosoma se denomina cromátides hermanas. 95. Cromatina.- El complejo de DNA, proteína y RNA que constituye los cromosomas eucarióticos. El complejo de DNA y proteínas histónicas y no hi stónicas que componen a los cromosomas encarióticos; se tiñe intensamente. 96. Cromosomas.- Estructura presentes en el núcleo celular formadas por cromatina y que contiene los genes. Los cromosomas se hacen visibles al microscopio como estructuras bien defini das cuando la célula se divide. Estructura formada por ADN y proteínas que contiene la información hereditaria. Cuando se condensan durante la mitosis o la meiosis resultan especialmente fáciles de visualizar al microscopio. La estructura que lleva los gen es. Los cromosomas eucarióticos son filamentos o bastones de cromatina que aparecen contraídos durante la mitosis y la meiosis y que en otros momentos están contenidos en un núcleo. Los cromosomas procarióticos consisten en un círculo de DNA con el que se asocian varias proteínas. Los cromosomas virales son moléculas lineales o circulares de DNA o RNA. 97. Cromosomas homólogos. - Cromosomas similares en morfología y constitución genética. En el ser humano hay 23 pares de cromosomas homólogos; un miembro de cada par es heredado de la madre, y el otro lo es del padre. 98. Cruza de prueba.- Apareamiento entre un individuo de genotipo desconocido y otro individuo homocigota recesivo que se usa para determinar la constitución genética del genotipo desconocido, es decir, si es homocigoto o heterocigoto para el gen que se está estudiando. 99. Cruzamiento dihíbrido. - Cruzamiento genético que toma en consideración el comportamiento de los alelos de dos loci. Compárese con cruzamiento monohíbrido. 100. Cruzamiento monohíbrido. - Cruzamiento genético que toma en cuenta el comportamiento de los alelos de un solo locus. Compárese con comportamiento dihíbrido.

101. Dador de electrones.- Sustancia que dona o emite electrones en una reacción de oxidación -reducción, oxidándose en el proceso. 102. Desmosoma.- Tipo de unión célula-célula que confiere resistencia mecánica a los tejidos animales; consiste en una placa de material fibroso, denso, entre células contiguas con grupos de filamentos que forman bucles entrantes y salientes en el citoplasm a de ambas células. 103. Desnaturalización.- La pérdida de la configuración nativa de una macromolécula que resulta, por ejemplo, del tratamiento con calor, cambios extremos de pH, tratamiento químico u otros agentes desnaturalizadores. Habitualmente está acompañado por pérdida de la actividad biológica. 104. Diapédesis.- Salida de los leucocitos a través de las paredes de los capilares sanguíneos (endotelio) mediante seudópodos. 105. Dictiosoma.- Estructura membranosa y vesicular que constituye el Aparato de Golgi. Un a célula puede tener uno ó varios dictiosomas. Las membranas se apilan formando una cara cis, cerca del núcleo, y otra cara trans, cerca de la membrana citoplasmática, y hacia donde se van formando las cisternas cargadas de moléculas orgánicas. 106. Disacárido.- Molécula de carbohidrato compuesta por dos monómeros de monosacáridos; como ejemplos: sacarosa, maltosa y lactosa. 107. DNA.- Polinucleótido de desoxirribosa, normalmente formado por dos cadenas complementarias y antiparalelas, abiertas (en células eucarióticas) ó cerradas (en células procarióticas). Es el material genético. 108. DNA satélite.- Regiones de DNA altamente repetitivo en los cromosomas eucarióticos. El DNA satélite no se transcribe y no tiene una función conocida. 109. Dominancia incompleta.- En genética, fenómeno por el cual los efectos de ambos alelos de un locus particular se presentan en el fenotipo del heterocigoto. Universidad Católica los Ángeles de Chimbote - ULADECH 279

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

110. Enlace éster.- Enlace químico formado entre una radical ácido ( -COOH) y otro alcohol (-OH). Es típico de los lípidos, cuando el ácido es un ácido graso: R - COOH + R' - OH —› R - COO - R' + H2O. 111. Enlace fosfodiéster.- Enlace bioquímico formado entre dos radicales hidroxilos ( -OH), a través del Fosfato. Es característico de los polinucleótidos (ácidos nucleicos). 112. Enlace glucosídico.- Enlace bioquímico formado entre dos radicales alcohol ( -OH). Es típico de los glúcidos. 113. Enlace peptídico.- Enlace bioquímico formado entre un radical amino ( -NH2) y otro ácido (-COOH). Es el enlace característico de las proteínas. 114. Entrecruzamiento (o crossing over).- Durante la meiosis, el intercambio de material genético entre las cromátides de cromosomas homólogos apareados. 115. Entrecruzamiento cromosómico. - Proceso por el cual los cromosomas homólogos se rompen en algunos puntos y se intercambian fragmentos de cromátidas no hermanas. 116. Envoltura nuclear.- La doble membrana que rodea al núcleo de una célula eucariótica. 117. Enzima.- Molécula (prácticamente siempre una proteína) que tiene la capacidad de catalizar (acelerar) una reacción química específica. 118. Enzimas alostéricos.- (ó reguladoras). Tipo de enzimas que pueden encontrarse de forma habitual en estado activado ó en estado inhibido, y su actuación depende de la presencia ó ausencia de sustrato y factores activadores ó inhibidores, a través de un me canismo feed - back. 119. Enzimas de restricción. - Enzimas que cortan la doble hélice de DNA en secuencias específicas de nucleótidos. 120. Epístasis.- Interacción entre dos genes no alélicos en la que uno interfiere o modifica la expresión fenotípica del otro. 121. Especie.- El concepto biológico de especie se refiere a un grupo de organismos que, en realidad (o potencialmente), se cruzan entre sí en la naturaleza y están aislados reproductivamente de otros grupos similares. El concepto biológico debe diferenciarse de l concepto de especie como categoría y del concepto de especie como taxón. 122. Espermátida.- Cada una de las cuatro células haploides resultantes de las divisiones meióticas de un espermatocito; cada espermátida se diferencia en un espermatozoide. 123. Espermatocitos.- Primarios: las células diploides (2n) formadas por el aumento en tamaño de las espermatogonias; secundarios: las células haploides originadas tras la meiosis I; cada espermatocito secundario se diferencia en una espermátida. 124. Espermatogonias.- Las células diploides no especializadas (2n) en las paredes de los testículos que por división meiótica se transforman en espermatocitos, luego en espermátidas y finalmente en espermatozoides. 125. Espermatozoide.- Célula sexual masculina madura, o gameto, habi tualmente móvil y de menor tamaño que el gameto femenino. 126. Estructura cuaternaria de una proteína. - La estructura general de una molécula de proteína globular, formada por dos o más cadenas polipeptídicas. 127. Estructura primaria de una proteína. - La secuencia de aminoácidos de una proteína. 128. Estructura secundaria de una proteína. - La estructura simple (a menudo semejante a una hélice, o una hoja) que resulta del plegamiento espontáneo de una cadena polipeptídica a medida que se forma; mantenida por los puentes de hidrógeno y otras fuerzas débiles. 129. Estructura terciaria de una proteína. - Estructura compleja habitualmente globular, que resulta de un plegamiento ulterior de la estructura secundaria de una proteína; se forma espontáneamente debido a las atracciones y repulsiones entre los aminoácidos con cargas distintas en sus grupos R. 130. Eucromatina.- Región de un cromosoma eucariótico que se tiñe más difusamente. Corresponde a la cromatina menos condensada. 131. Exón.- Segmento de DNA de un gen interrumpido que es tá presente en el RNA maduro.

132. F2.- La progenie resultante de cruzar a los miembros de la generación F 1 entre sí. 133. Fagosomas.- Nombre con el que se designan a las vaculas cuando efectúan procesos digestivos en su interior. Si degradan estructuras propias de la célula, se llaman autofagosomas. 134. Fecundación.- Fusión de los gametos y restablecimiento del número diploide de cromosomas. 135. Fenotipo.- Características observables de un organismo que resultan de las interacciones entre el genotipo y el ambiente. Universidad Católica los Ángeles de Chimbote - ULADECH 280

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

136. Fosfolípidos.- Moléculas orgánicas semejantes en estructura a las grasas, en las cuales un grupo fosfato, en lugar de estar unido a un grupo ácido graso lo está al tercer carbono de la molécula de glicerol; como resultado, la molécula tiene una “cabeza” hidrofílica y una “cola” hidrofóbica. Los fosfolípidos forman la estructura básica de las membranas de las células y de las organelas. 137. Fosforilación a nivel de sustrato. - Formación de ATP por transferencia directa de un grupo fosfato "de alta energía," procedente de un compuesto orgánico fosforilado, hasta el ADP. 138. Fosforilación oxidativa. - Producción de ATP, a expensas de la fuerza protón -motriz generada entre la matriz mitocondrial y el espacio intermembranoso, gracias a las ATP sintasas de la membran a mitocondrial interna. 139. Fotofosforilación.- Formación de ATP, en las ATP sintasas de la membrana tilacoidal de los cloroplastos, durante la fase luminosa de la fotosíntesis. 140. Fragmentos de Okazaki. - En la replicación del DNA, los segmentos discontinuos en los cuales se sintetiza la cadena 3' a 5' (la cadena rezagada) de la doble hélice de DNA, típicamente, de l.000 a 2.000 nucleótidos de longitud en los procariotas y de l00 a 200 nucleótidos de longitud en los eucariotas.

141. Gameto.- Célula especializada para la reproducción sexual.Célula reproductora haploide cuyo núcleo se fusiona con el de otro gameto de un tipo de apareamiento –o sexo– opuesto (fecundación); la célula resultante (cigoto) puede desarrollar un individuo diploide nuevo o, en algunos pr otistas y hongos, puede sufrir meiosis y formar células somáticas haploides. 142. Gen.- La unidad de la herencia en un cromosoma; secuencia de nucleótidos en la molécula de DNA que desempeña una función específica, tal como codificar una molécula de RNA o un polipéptido. 143. Gen alelo.- Cada uno de los genes que ocupan el mismo locus en la pareja de cromosomas homólogos. 144. Gen estructural.- Codifica para cualquier RNA o proteína que no actúan como reguladoras de la expresión de otros genes. 145. Gen regulador.- Codifica para un RNA o proteína cuya función es el control de la expresión de otros genes. 146. Genoma.- La totalidad de la información genética de un organismo en particular. 147. Genotipo.- La constitución genética de una sola célula o de un organismo con referenci a a una sola característica o a un conjunto de características; la suma total de todos los genes presentes en un individuo. 148. Glucagón.- Hormona producida en el páncreas que eleva la concentración del azúcar sanguíneo. 149. Glucógeno.- Carbohidrato complejo (polisacárido); una de las principales sustancias alimenticias almacenadas en la mayoría de los animales y hongos; se convierte en glucosa por hidrólisis. 150. Glucolípidos.- Moléculas orgánicas de estructura semejante a las grasas, en las cuales en lugar de un ácido graso, una cadena corta de carbohidratos está unida al tercer carbono de la molécula de glicerol; como resultado, la molécula tiene una “cabeza” hidrofílica y una “cola” hidrofóbica. Los glucolípidos son constituyentes importantes de las membranas de las células y de las organelas. 151. Glucólisis.- Proceso por el cual una molécula de glucosa se convierte anaeróbicamente en dos moléculas de ácido pirúvico, liberando una pequeña cantidad de energía útil; catalizada por enzimas citoplasmáticas. 152. Glucoproteína.- Proteína con una o más cadenas de carbohidratos unidos covalentemente. 153. Glucosa.- Azúcar de 6 carbonos (C 6H12O6); el monosacárido más común en los animales. 154. Golgi, Camillo.- Histólogo italiano. Compartió el premio Nobel de Fisiología y Medicina e n 1906 con Ramón y Cajal por su teoría de la neurona. 155. Griffith, Frederick.- Bacteriólogo inglés.

156. Haeckel, Ernst.- Biólogo alemán. Acuñó el término ecología. 157. Haploide.- Que tiene un solo juego de cromosomas, es decir, un solo cromosoma de cada tipo . 158. Hematopoyesis.- Proceso de formación de los componentes de la sangre. 159. Hemoglobina.- Heteroproteína con hierro que se encuentra en los glóbulos rojos y sirve para transportar oxígeno. 160. Herencia.- Transmisión de características del progenitor a los hijos . 161. Herencia dominante.- Herencia de una caracterísica génica reconocida tanto en el estado homocigótico como en el heterocigótico. 162. Herencia intermedia.- Herencia en la que un carácter cuantitativo aparece en un híbrido con una intensidad intermedia entre la de sus parentales. Universidad Católica los Ángeles de Chimbote - ULADECH 281

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

163. Heterocigoto.- Organismo diploide que lleva dos alelos diferentes en uno o más loci génicos. 164. Heterocromatina.- Región del cromosoma eucariótico que permanece condensada durante la interfase y que es transcripcionalmente inactiva. 165. Heterótrofo.- Organismo que debe alimentarse de sustancias orgánicas sintetizadas por otros organismos para obtener energía y pequeñas moléculas estructurales; opuesto a autótrofo. Los animales, los hongos y muchos organismos unicelulares son heterótrofos . 166. Hidrofílico.- Que tiene afinidad por el agua; aplicable a las moléculas polares o a las regiones polares de las moléculas grandes. 167. Hidrofóbico.- Que no tiene afinidad por el agua; se aplica a las moléculas no polares o a las regiones no polares de las moléculas. 168. Hidrolasas.- Tipo de enzimas contenidos en los lisosomas, y que se encargan de catalizar reacciones de degradación hidrolítica en los fagosomas. Son enzimas digestivos. 169. Hidrólisis.- Escisión de una molécula en dos por la adición de iones H+ y OH- a partir de agua. 170. Hipertónico.- De dos soluciones de concentración diferente, la que contiene la mayor concentración de partículas de soluto; el agua se mueve a través de una membrana selectivamente permeable hacia la solución hipertónica. 171. Hipotónica.- Disolución que contiene menor concentración de solutos con respecto a otra. 172. Hipotónico.- De dos soluciones de diferente concentración, aquella que contiene la menor concentración de partículas de soluto; el agua se mueve a través de una membrana selec tivamente permeable desde una solución hipotónica. 173. Histonas.- Grupo de cinco moléculas polipeptídicas básicas, relativamente pequeñas, que se encuentran unidas al DNA de las células eucarióticas. 174. Homólogos.- Los dos miembros de cada par cromosómico que p oseen las células diploides. Llevan los mismos genes y se aparean durante la primera etapa de la meiosis; los dos miembros del par derivan de sendos padres. 175. Hormona.- (Gr. hormaein serie en movimiento) producto de secreción de células o de ciertas glándul as como respuesta a determinados estímulos, que transportado por los líquidos circulantes actúa como regulador de diversas funciones. 176. Horquilla de replicación. - En la síntesis de DNA, la estructura con forma de Y que se forma en el punto donde se separan las dos cadenas de la molécula original y donde se sintetizan las cadenas complementarias. 177. Huso.- En las células eucarióticas en división, la estructura formada por los microtúbulos que se extienden de un polo a otro. Los microtúbulos cinetocóricos se une n al cinetocoro, estructura que se forma en el centrómero de cada cromosoma duplicado, y maniobran los cromosomas en el huso, llevándolos a la posición que ocupan durante la metafase y atrayendo a los cromosomas recién separados hacia los polos durante la anafase. Los microtúbulos polares separan los polos del huso, y los astrales posicionan los polos en relación al resto de la célula. 178. Huso acromático.- Estructura de fibras proteínicas derivadas de los centríolos, que se forma durante la mitosis y sirve para la separación de las cromátidas de los cromosomas.

179. In vitro.- Locución latina que significa "en el vidrio" y se refiere a los experimentos que se hacen con sustancias o microorganismos en el laboratorio, en probetas, tubos, matraces y placas de cu ltivo, pero no en organismos humanos o animales. Algunos fármacos que muestran actividad in vitro no necesariamente la corroboran en organismos humanos o animales vivos. Los estudios de medicamentos deben hacerse en el laboratorio antes de pasar a la fase clínica. 180. In vivo.- Expresión que designa a toda reacción fisiológica que se verifica en un organismo vivo. Estudio clínico para comprobar los resultados de los efectuados in vitro. 181. Ingeniería genética.- Conjunto de técnicas con las que se consigue transf erir genes de unas especies a otras o entre individuos de la misma especie. 182. Inmune.- Que es resistente a una enfermedad específica. Nombre que se da al sistema Inmunológico. Relacionado con este sistema. Ver Inmunidad. 183. Interacción alostérica.- Interacción en que interviene una enzima que tiene dos sitios de unión, el sitio activo y otro al que se une otra molécula, un efector alostérico; la unión del efector cambia la configuración de la enzima, activándola o inactivándola. Las interacciones alostéricas desempeñan también un papel en los procesos de transporte en que intervienen las proteínas integrales de membrana. 184. Interfase.- Período del ciclo celular que ocurre antes de que comience la mitosis o la meiosis; incluye las fases G1, S y G2.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

185. Intolerancia a la lactosa.- Una persona con intolerancia a la lactosa carece de una enzima que es necesaria para digerir el azúcar de la leche, lo que causa síntomas tales como gases, pesadez de estómago y dolor abdominal. La intolerancia a la lactosa no es una reacció n alérgica dado que no afecta al sistema inmunológico. 186. Intrón.- Segmento de DNA que es transcripto a RNA, pero es eliminado enzimáticamente de esta última molécula para dar el RNA maduro; conocido también como secuencia interpuesta. 187. Isotónico.- Que tiene la misma concentración de solutos que otra solución. Si se separan dos soluciones isotónicas por una membrana selectivamente permeable no habrá flujo neto de agua a través de la membrana. 188. Isótopo.- Átomo de un elemento que difiere de otros átomos del mi smo elemento en el número de neutrones presentes en el núcleo atómico; los isótopos difieren así en peso atómico. Algunos isótopos son inestables y emiten radiación.

189. Koch, Robert.- Médico alemán. Aisló el bacilo de la tuberculosis. Por este hallazgo Por este hallazgo, Koch recibió el Premio Nobel de Fisiología y Medicina en 1905. 190. Krebs, Hans Adolf.- Bioquímico inglés de origen alemán. Recibió el Premio Nobel en Fisiología y Medicina en 1953 por dilucidar lo que se conoce como el Ciclo de Krebs, una d e las etapas de la respiración celular. Compartió el premio con F. Lipmann quien reconoció la estructura del ATP.

191. Lámina nuclear.- Estructura constituida por filamentos intermedios que se encuentra en la cara interna de la membrana nuclear; se interrumpe en los poros nucleares. Actúa como soporte de la membrana nuclear interna. 192. Landsteiner, Kart.- Médico austríaco. Recibió el Premio Nobel de Fisiología y Medicina en 1930 por demostrar que la sangre humana podía clasificarse en cuatro grupos lo cual e staba relacionado con las transfusiones. 193. Leeuwenhoek, Antoni van. - Tendero holandés. Construyó microscopios más potentes que los de sus antecesores. 194. Lípido.- Una entre una gran variedad de sustancias orgánicas insolubles en solventes polares como el agua , pero que se disuelven fácilmente en solventes orgánicos no polares; incluye grasas, aceites, ceras, esteroides, glucolípidos, fosfolípidos y carotenos. 195. Lisis.- Desintegración de una célula por la ruptura de su membrana celular. 196. Lisosoma.- Organela limitada por membrana que contiene enzimas hidrolíticas. 197. Loci.- En genética, la posición de un gen en un cromosoma; para cualquier locus dado puede haber varios alelos posibles. 198. Locus.- Lugar que ocupa en el cromosoma el gen para un rasgo dado; por ejemplo, un segmento del DNA cromosómico que contiene información la cual controla algún carácter del organismo.

199. Macromolécula.- Molécula extremadamente grande, se refiere específicamente a las proteínas, ácidos nucleicos, polisacáridos y sus complejos. 200. Maduración del ARNm.- Proceso por el que se corta y se empalma la molécula de ARN ecucariótico con el fin de eliminar los intrones existente entre los exones. 201. Matriz mitocondrial.- Interior de la mitocondria, rodeado de doble membrana, y donde se efectúan lo s procesos del ciclo de Krebs. También contiene moléculas pequeñas de DNA y y RNA y ribosomas 70 S. 202. Meiosis.- Proceso en el cual una célula 2n (diplode) experimenta dos divisiones nucleares sucesivas (meiosis I y II), con la potencialidad de producir cuat ro núcleos n (haploide); conduce a la formación de gamentos en aminales y esporas en las plantas. 203. Mendel, Gregor.- Botánico austríaco. Considerado el padre de la genética. Como resultado de experimentos con guisantes publicó las conocidas como Leyes de Me ndel que explican los principios básicos de la herencia. 204. Metabolismo.- La suma de todas las transformaciones físicas y químicas que ocurren dentro de una célula o un organismo. 205. Metabolito.- Cada uno de los compuestos que participan como intermediarios o se forman en las diferentes reacciones del metabolismo. 206. Minisatélites.- Regiones del ADN que presentan secuencias de nucleótidos repetidas en tándem (unas a continuación de otras). Su detección sirve para obtener la huella genética de una persona.

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

207. Mitocondria.- Organela limitada por una doble membrana en el cual ocurren las reacciones del ciclo de Krebs, el transporte terminal de electrones y la fosforilación oxidativa, dando como resultado la formación de CO 2, H2O y ATP a partir de la acetil CoA y ADP. L as mitocondrias son las organelas en las cuales se produce la mayor parte del ATP de la célula eucariótica. 208. Monocistrónico.- RNA mensajero que codifica para una sola proteína. 209. Monómero.- Una molécula simple, relativamente pequeña, que puede ligarse a otr as y formar un polímero. 210. Monosacárido.- Azúcar simple como la glucosa, la fructosa y la ribosa, son los carbohidratos más simples. 211. Mutación.- El término mutación se refiere tanto al proceso por el cual el material genético (genes o cromosomas) sufre alteraciones, como al resultado final (el propio cambio) de dicho proceso. 212. Mutaciones cromosómicas. - Alteraciones en la estructura de alguno de los cromosomas puesto que la variación afecta a fragmentos de uno o más cromosomas. 213. Mutaciones génicas.- Alteración que afecta a un solo gen. Suelen ser cambios en la secuencia de bases o cambios químicos en los nucleótidos. 214. Mutaciones genómicas. - Alteraciones que afectan al número de cromosomas de una dotación (aneuploidía) o al número de dotaciones (euploidía).

215. NAD.- Abreviatura de nicotinamida adenina dinucleótido, coenzima que funciona como aceptor de electrones. 216. Nucleoide.- En las células procarióticas, la región en la cual se localiza el cromosoma. 217. Nucléolo.- Región densa, pequeña, visible en el núcleo d e las células eucarióticas que no están en división; formado por moléculas de rRNA, proteínas ribosómicas y bucles de cromatina a partir de los cuales se transcriben las moléculas de rRNA. 218. Nucleosoma.- Estructura básica de la cromatina que se expresa (se transcribe), formada por una doble vuelta de DNA sobre un grupo de 8 proteínas histonas (octámero de histonas). 219. Nucleótido.- Molécula compuesta por un grupo fosfato, un azúcar de cinco carbonos (ribosa o desoxirribosa) y una base púrica o pirimídica; los nucleótidos son los bloques estructurales de los ácidos nucleicos.

220. Oparin, Alexandr Ivánovich. - Bioquímico ruso. Propuso el primer conjunto de hipótesis verificables acerca del origen de la vida, al mismo tiempo que Haldane J. B. Haldane. 221. Operador.- Segmento del DNA que actúa en interacción con una proteína represora y regula la transcripción de los genes estructurales de un operón. 222. Operón.- Unidad de expresión y regulación de genes bacterianos. En el cromosoma bacteriano, un segmento de DNA que consiste en un promotor, un operador y un grupo de genes estructurales adyacentes que codifican para proteínas involucradas en una vía metabólica. Los genes estructurales se transcriben en una sola molécula de mRNA y su transcripción es regulada por una prote ína represora. 223. Organela.- Cuerpo rodeado por membrana que se encuentra en el citoplasma de una célula. 224. Ósmosis.- Paso de agua a través de membranas semipermeables desde una disolución hipotónica a una hipertónica. 225. Oxidación.- Pérdida de electrones por p arte de un átomo o molécula. En la práctica esos electrones suelen ir acompañados de protones, por lo que equivale a deshidrogenación. 226. Oxidasas.- Tipo de enzimas contenidos en los gioxisomas vegetales y en los peroxisomas con los que se degradan diversos materiales (ácidos grasos, sustancias tóxicas, etc.) mediante reacciones oxidativas que no producen ATP (energía).

227. Pared celular.- Estructura rígida o plástica producida por la célula o situada fuera de la membrana celular en la mayoría de las plantas, algas, hongos y procariotas; en las células vegetales consiste mayormente en celulosa. 228. Pasteur, Louis.- Químico y biólogo francés. Fundó la ciencia de la microbiología; demostró la teoría de los microorganismos como causantes de enfermedades (patógenos ); inventó el proceso que lleva su nombre y desarrolló vacunas contra varias enfermedades, incluida la rabia. 229. Peroxisoma.- Organela rodeada por membrana que contiene las enzimas que catalizan las reacciones de formación de peróxido y destrucción de peróxi do; en las células vegetales, durante la fotorrespiración, el sitio donde ocurre la oxidación del ácido glicólico. Universidad Católica los Ángeles de Chimbote - ULADECH 284

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

230. pH.- Símbolo que denota la concentración de iones hidrógeno en una solución; los valores de pH van de 0 a 14; cuanto más bajo sea el valor, más ácida será una solución, o sea, contendrá mayor cantidad de iones hidrógeno; el pH=7 es neutro, el inferior a 7 es ácido, y el superior a 7 es alcalino. Es un número que nos indica la concentración de hidrogeniones de una disolución. Dado un pH cualqui era, por ejemplo, 7, la concentración de iones H3O+ será de 10 elevado a - el número de pH, por ejemplo, en este caso: 10 -7. Si el pH es 7 la disolución es neutra (igual número de iones H 3O+ que de iones OH-. Si el pH es mayor que 7 la disolución es básica , también llamada alcalina; y si el pH es menor que 7 la disolución es ácid a. 231. Pinocitosis.- Acción de “beber" por parte de la célula. 232. Pirimidina.- Base nitrogenada como la citosina, la timina o el uracilo, con una estructura química característica de un solo anillo; uno de los componentes de los ácidos nucleicos. 233. Placa metafísica.- Plano imaginario, perpendicular al huso mitótico y equidistante de ambos polos, en el que se sitúan los cromosomas durante la división celular. 234. Plasma.- Fluido claro, incoloro, componente de la sangre de los vertebrados; contiene iones, moléculas y proteínas plasmáticas disueltas. 235. Plásmido.- Molécula de ADN circular presente en algunas bacterias , independiente del cromosoma bacteriano, es empleado como vector génico para tra nsferir genes extraños entre bacterias. 236. Plasmólisis.- Efecto de salida de agua desde el interior de la célula al exterior, por un proceso de ósmosis, cuando se encuentra en un medio hipertónico (alta concentración salina), para igualar las concentraciones interna y externa. La célula perderá volumen y se lisará si el proceso es muy acusado. 237. Policistrónico.- RNA mensajero que incluye regiones codificantes para más de una proteína. 238. Polímero.- Una molécula grande compuesta por muchas subunidades moleculares similares o idénticas. 239. Polirribosomas.- Dos o más ribosomas unidos a una molécula de mRNA, traduciendo proteínas en forma simultánea; polisoma. 240. Poros nucleares.- Estructuras proteínicas en la membrana nuclear, organizadas en forma de poros que permiten el intercambio de materiales entre el citoplasma y el carioplasma. 241. Potencial de membrana.- Diferencia de voltaje a través de la membrana plasmática, producida por un exceso de iones positivos de un lado y de iones negativos del otro. 242. Potencial de reposo.- Diferencia de potencial eléctrico de todas las células entre su interior y exterior, debido a la desigual distribución de iones, su valor es de -70 mV. 243. Potencial eléctrico.- La diferencia en la cantidad de carga eléctrica entre una región de carga posit iva y una región de carga negativa. El establecimiento de los potenciales eléctricos a través de la membrana de las células y de las organelas hace posible que ocurran varios fenómenos, como la síntesis quimiosmótica de ATP, la conducción de impulsos nerviosos y la contracción muscular. 244. Potencial osmótico.- Tendencia del agua a pasar a través de una membrana relativamente permeable que impide –o dificulta– el pasaje de los solutos disueltos. Se determina midiendo la presión que se requiere para detener el movimiento osmótico de agua hacia la solución; cuanto mayor sea la concentración de solutos, mayor será el potencial osmótico de la solución. 245. Primera ley de Mendel.- Cada individuo lleva un par de factores o variantes alternativas para cada característica y los miembros del par se separan durante la formación de los gametos (segregación genética). En su formulación actual, los alelos segregan en la meiosis. 246. Prion.- Agente infeccioso formado sólo por proteína. 247. Promotor.- Segmento específico de DNA al cual se une la RNA polimerasa para iniciar la transcripción del mRNA desde un operón. 248. Proteína transportadora.- Proteína transmembrana que se une a una molécula facilitando su transporte a través de la membrana plasmática, de forma pasiva o activa. 249. Proteínas intrínsecas.- Proteínas de la membrana unidas a componentes lipídicos y que atraviesan la matriz lipídica de la membrana. 250. Proteínas periféricas.- Proteínas libres de la membrana, que se localizan en las zonas periféricas interna y externa de la matriz lipídica de la membrana. 251. Protómero.- Cada una de las subunidades que forman las proteínas con estructura cuaternaria. 252. Prueba del ADN.- Técnica consistente en la detección de minisatélites en el ADN de las personas para su identificación, puesto que con ell a se obtiene la huella génética.

253. Quiasma.- Conexión entre los cromosomas homólogos apareados en la meiosis. Sitio que evidencia el lugar en el que ocurrió el entrecruzamiento. Universidad Católica los Ángeles de Chimbote - ULADECH 285

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

254. Quimiosíntesis.- Proceso de formación de materia orgánica a partir de sus tancias inorgánicas, utilizando la energía que se libera en la oxidación de diversos sustratos inorgánicos. La realizan únicamente algunas especies de bacterias.

255. Radicales libres.- Compuestos altamente reactivos que interaccionan rápida y agresivam ente con otras moléculas. Químicamente, son moléculas en cuya última órbita existe un electrón impar, inestable, altamente reactivo, que necesita "robar" o "donar" un electrón a otro átomo, que, a su vez, se transforma en un radical libre, lo que genera una reacción en cadena. Los radicales libres están implicados en muchas funciones celulares y son un componente común de los organismos vivos. Por ejemplo, son un subproducto de la respiración celular aeróbica, del metabolismo lípidico, de la desintoxicación a través del hígado, etc. También podemos acumularlos a causa de factores exógenos como el humo de los cigarros (una bocanada produce un trillón de radicales libres), la contaminación atmosférica por la combustión de combustibles fósiles, las dietas ricas en carnes rojas, los rayos ultravioleta o el alcohol. 256. Reacción en cadena de la polimerasa. - Técnica usada para crear un gran número de copias de un segmento de DNA, que utiliza ciclos de desnaturalización, apareamiento con cebadores y extensión por una D NA polimerasa termoresistente. 257. Reloj biológico.- Factor o factores internos de los organismos, que gobieran las funciones que ocurren rítmicamente en ausencia de estímulos externos. 258. Replicación.- Proceso por el cual se sintetiza una nueva cadena de ADN, utilizando como molde la otra cadena, conservándose así la información genética en ella codificada. También ocurre con el ARN. 259. Represor.- En genética, una proteína que se une al operador impidiendo que la RNA polimerasa se una al promotor y transcriba los genes estructurales del operón; lo codifica un gen conocido como regulador. 260. Reproducción asexual. - Cualquier proceso reproductor, como la gemación o la división de una célula o de un organismo en dos o más partes aproximadamente iguales, en que no interv iene la unión de gametos. 261. Reproducción sexual.- Reproducción en que intervienen la meiosis y la fecundación. 262. Respiración celular.- Proceso catabólico en el que la materia orgánica se oxida por completo y el aceptor final de electrones es una sustancia in orgánica. Si esa sustancia es el oxígeno se trata de la respiración celular aerobia; si es un compuesto inorgánico diferente del oxígeno, sería una respiración celular anaerobia (no confundir con fermentación). 263. Retículo endoplásmico. - Sistema extenso de membranas, presente en la mayor parte de las células eucarióticas, que divide el citoplasma en compartimientos y canales; frecuentemente cubierto por ribosomas. 264. Ribosoma.- Organela pequeña compuesta por proteína y ácido ribonucleico; sitio de traducción en la síntesis de proteínas; en las células eucarióticas, unido frecuentemente al retículo endoplásmico. Un conjunto de ribosomas unidos a una sola cadena de mRNA constituye un polirribosoma o un polisoma. 265. RNA.- Polinucleótido de ribosa, normalmente formado por una sóla cadena abierta con estructura primaria. El RNA se forma a partir del DNA (transcripción), y se traducirán en proteínas. 266. RNA de transferencia.- Clase de RNA pequeños con dos sitios funcionales; uno reconoce un aminoácido específico activado; el otro lleva el triplete de nucleótidos (anticodón) para ese aminoácido. Cada tipo de tRNA acepta un aminoácido activado específico y lo transfiere a una cadena polipeptídica naciente, según lo especifica la secuencia de nucleótidos del mRNA que está sien do traducido. 267. RNA mensajero.- Un tipo de moléculas de RNA, cada una de las cuales es complementaria de una hebra de DNA. Lleva la información genética del cromosoma a los ribosomas, donde se traduce a proteína. 268. RNA ribosómico.- Tipo de molécula de RNA qu e se encuentra junto con proteínas características en los ribosomas; se transcribe a partir del DNA de los bucles de cromatina que forman el nucléolo.

269. Sacarosa.- Azúcar de caña; disacárido común que se encuentra en muchas plantas constituido por una molécula de glucosa unida a una molécula de fructosa. Forma principal en que se transportan los azucares a través del floema. 270. Secuencia de aminoácidos. - Número, tipo y orden de colocación de los aminoácidos que forman una proteína. La secuencia de a'as forma la estructura primaria de la proteína. 271. Secuencia de bases.- Número, tipo y orden de colocación de las bases nitrogenadas (nucleótidos, en rigor) de un ácido nucleíco. Constituye la estructura primaria de los ácidos nucléicos. 272. Secuencia de reconocimie nto.- Secuencia específica de nucleótidos en las cuales la enzima de restricción corta la molécula de DNA. Universidad Católica los Ángeles de Chimbote - ULADECH 286

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

273. Segunda ley de Mendel.- La herencia de un par de factores o variantes alternativas para una característica es independiente de la herencia de los fa ctores para cualquier otra; estos factores "segregan independientemente" como si no hubiese otros factores presentes. Esta ley fue modificada posteriormente por el descubrimiento del ligamiento. En su formulación actual: los alelos de genes diferentes segr egan independientemente. 274. Senescencia.- Fenómeno por el cual el número de veces que una célula puede dividirse disminuye. Luego de superar un determinado número de divisiones, la célula entra en G0, fase de la cual nunca sale. 275. Sinapsis.- Unión especializada entre dos neuronas donde la actividad de una influye en la actividad de la otra; puede ser química o eléctrica, excitadora o inhibidora. También se aplica a la unión entre una fibra nerviosa y una muscular (sinapsis neuromuscular). 276. Sitio activo.- La región de la molécula de una enzima que se une temporariamente al sustrato durante la reacción catalizada por la enzima. 277. Splicing.- Del inglés corte y empalme. Proceso de remoción de intrones y unión de exones en el RNA. 278. Sustrato.- l. Base a la cual está unido un organismo. 2. Sustancia sobre la cual actúa una enzima.

279. Tablero de Punnett.- El diagrama en tablero de ajedrez utilizado para analizar la segregación de los alelos. 280. Telofase.- La última etapa de la mitosis y la meiosis durante la cual los cr omosomas se reorganizan en dos nuevos núcleos. 281. Telomerasa.- Enzima involucrada en la síntesis de los telómeros. 282. Telómero.- Parte distal de los brazos cromosómicos. En cada división celular el telómero se va acortando por acción de un enzima (la telomeras a), y cuando se llega a un determinado acortamiento, la célula deja de dividirse. 283. Teoría celular.- De acuerdo con esta teoría, todos los seres vivos están compuestos por células; una célula surge sólo de otras células. No se conoce ninguna excepción a est os dos principios desde que fueron propuestos por primera vez hace más de un siglo. 284. Terapia génica.- Modalidad de curación de enfermedades genéticas producidas por un solo gen defectuoso, o curación de enfermedades con introducción de genes extraños que p roporcionen caracteres saludables. 285. Tétrada.- En genética, par de cromosomas homólogos que se han replicado y se han apareado en la profase I de la meiosis; está formada por cuatro cromátides. 286. Traducción.- Proceso que acontece en los ribosomas por el que la información contenida en el ARNm (secuencia formada a partir de cuatro nucleótidos) se transfiere a una cadena polipeptídica (secuencia formada a partir de veinte aminoácidos). 287. Transcripción.- Proceso por el cual se sintetiza una molécula de ARN a part ir de una cadena de ADN que actúa como molde. 288. Transcripción inversa.- Proceso por el que se sintetiza ADN a partir de ARN que actúa como molde. 289. Transducción.- 1. La transferencia de material genético (DNA) de una célula a otra por un virus. 2. La convers ión de una forma de energía a otra; por ejemplo, la conversión de energía de un estímulo químico a energía de un potencial de acción. 290. Transformación.- Transferencia natural o artificial de ADN extraño entre bacterias usando vectores génicos que la facilitan. 291. Translocación.- Desplazamiento del ribosoma hacia el codon siguiente del ARNm, una vez que ha tenido lugar la formación del enlace peptídico en la síntesis de proteínas. 292. Transportador de electrones. - Molécula especializada, tal como un citocromo, que puede perder y ganar electrones reversiblemente, oxidándose y reduciéndose alternativamente. 293. Transporte activo.- Mecanismo de paso de sustancias a través de la membrana plasmática en contra del gradiente electroquímico, con necesidad de una enzima transportadora y gastando energía. 294. Transporte de electrones. - El movimiento de electrones a lo largo de una serie de moléculas transportadoras que los mantienen en niveles energéticos ligeramente diferentes. A medida que los electrones descienden su nivel energético, la energía liberada se usa para formar ATP a partir de ADP y fosfato. El transporte de electrones desempeña un papel esencial en la etapa final de la respiración celular y en las reacciones que capt uran energía en la fotosíntesis. 295. Transposón.- Fragmento de ADN que puede desplazarse de un lugar a otro del genoma de un organismos, lo que provoca mutaciones y recombinaciones de genes. 296. Triplete.- Grupo de tres nucleótidos (abreviadamente, bases) de RNA que funcionan codificando aminoácidos (RNAm) ó complementándose con otros tripletes (RNAt). 297. Turgencia.- Efecto de entrada de agua al interior de la célula cuando se encuentra en un medio hipotónico (baja concentración salina), por un proceso de ósmosis. La célula se inchará, aumentando de volumen y puede llegar a romperse si el proceso es muy acusado. Universidad Católica los Ángeles de Chimbote - ULADECH 287

Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

298. Unisexual.- Que produce un solo tipo de gametos.

299. Virión.- Unidad estructural de los virus. Consta fundamentalmente de dos estructuras imprescind ibles: un ácido nucleico (ADN o ARN) y una envoltura proteica (cápside). A estas estructuras básicas se añade en algunos casos una envoltura lipídica (peplos) y/o espículas de glucoproteína. 300. Viroides.- Agente causal de ciertas enfermedades de las plantas denominado así por su semejanza con los virus, de los que se diferencia por carecer de cápside. Se trata de ácido nucleico envuelto por una membrana procedente de la célula en la que se replicó. Por extensión se aplicaba a lo que hoy se denomina priones. 301. Virus.- Entidad acelular infecciosa que, aunque puede sobrevivir extracelularmente, es un parásito absoluto porque solamente es capaz de replicarse en el seno de células vivas específicas, pero sin generar energía ni ninguna actividad metabólica. Los comp onentes permanentes de los virus son ácido nucleico (ADN o ARN, de una o de dos cadenas) envuelto por una cubierta proteica llamada cápside. 302. Virus vector.- Clase de virus que se emplea para transferir ADN extraño entre bacterias o a células eucariotas.

303. Xenobiótico.- Compuesto externo a un organismo vivo que interacciona con él, generalmente a través de alteraciones metabólicas.

304. Zoonosis.- Infección que se transmite en forma natural entre el hombre y animales vertebrados y viceversa

Universidad Católica los Ángeles de Chimbote - ULADECH


Mblgo. Luis Alberto Sánchez Angu lo / Mblgo. José Luis Gutierrez Aponte

Biología Celular y Molecular

o Alberts, B.; Bray, D.; Lewis, J.; Raff, M. ; Roberts, K. y J. Watson. 1983. Biología Molecular de la Célula. 2da edición. ediciones Omega, S.A. Barcelona – España. o Asociación Educativa ADUNI. 2004. Biología Una perspectiva Evolutiva. 2da. Edición. Lumbreras Editores, Lima – Perú. o Curtis, H. y S. Barnes. 2002. Biología. 6ta. Edición. Editorial Panamericana. Buenos Aires – Argentina. o De Robertis, E. y E. De Robertis 1997. Biología Celul ar y Molecular. 12ava edición. Editorial El Ateneo. Buenos Aires – Argentina. o Gardner, E. Principios de Genética. 5ta Edición. Editorial Limusa S.A. de C.V. México D.F. 1985. o Jimeno, A. Biología. Editorial Santillana S.A. Madrid – España. 1983. o Karp, G. 2003. Biología Celular y Molecular. McGraw – Hill Interamericana. México D. F. o Solomon, E.; Berg. L. y D. Martin. 2001. Biología. 5ta. Edición. McGraw -Hill Interamericana. o Sánchez, L. y J. Gutierrez. Manual de Prácticas de Biología Celular y Molecular. 2da Edic. ULADECH. Chimbote – Perú. 2006. o Villee, C. Biología. 7ma edición. Nueva Editorial Interamericana, S.A., México D.F. 1995. o Aula virtual de Biología: Universidad de Murcia. Departamento de Biología o Facultad de Ciencias Biológicas. Introducción a la Biología.

o Biología Bachillerato. o Proyecto biósfera. Ministerio de Educación y Ciencia (Biología y Geología). España.

Universidad Católica los Ángeles de Chimbote - ULADECH


Sign up to vote on this title
UsefulNot useful