Está en la página 1de 100

i

H O A V IN E A i

U N IV E R SID A D N A C IO N A L AG RAR IA LA M O LIN A

MANUAL DE ,
MICROBIOLOGIA AGRICOLA

RH IZO BIU M , PGPRs,


IN D IC A D O R ES D E
FER TILID A D E IN O C U ID A D
DORIS ELIZABETH ZIGA DVILA

UNIVERSIDAD NACIONAL AGRARIA LA MOLINA

MANUAL DE
MICROBIOLOGA AGRCOLA
RHIZOBIUM, PGPRs,

INDICADORES DE FERTILIDAD E
INOCUIDAD

DORIS ELIZABETH ZIGA DVILA

2012

UNIVERSIDAD NACIONAL AGRARIA LA MOLINA

Dr. JESS ABEL MEJA MARCACUZCO


Rector
Dr. JORGE LUIS ALIAGA GUTIRREZ
Vicerrector Acadmico
Mg.Sc. EFRAN DONALD MALPARTIDAINOUYE
Vicerrector Administrativo
Mg.Sc. MARA BEATRIZ OLAYA MORALES
Jefe de EDIAGRARIA

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS,


INDICADORES DE FERTILIDAD E INOCUIDAD
Doris Elizabeth Ziga Dvila
Universidad Nacional Agraria La Molina
Av La Universidad s/n La Molina
Derechos reservados
ISBN: N 978-612-4147-04-3
Hecho el Depsito Legal en la Biblioteca Nacional del Per:
Registro: N 201206340
Primera Edicin: mayo del 2012 - Tiraje: 1 000 ejemplares
Impreso en Per - Printed in Per
Editor:
M ara Beatriz Olaya Morales
Diseo, diagramacin e impresin:
Q & P Impresores S.R.L
Av. Ignacio Merino 1546 Lince
Telf. 470-1788 - www.qypimpresores.com
Queda terminantemente prohibida por la Ley del Per la reproduccin total o parcial de
esta obra por cualquier medio, ya sea electrnico, mecnico, qumico, ptico, incluyendo
sistema de fotocopiado, sin autorizacin escrita de la Universidad Nacional Agraria La
Molina y la autora.
Todos los conceptos expresados en la presente obra son responsabilidad de la autora.

PRESENTACIN

ice el lema de la Universidad, quiero cultivar al hombre y al cam po,


como una forma de expresar la interrelacin entre la cultura y la
naturaleza; sabia combinacin que garantiza la existencia de la sociedad.
Para que sta se optimice, el hombre ha creado la ciencia, perenne y constante
preocupacin por su entorno, que garantiza el desarrollo y progreso de los pueblos
del mundo.

La Universidad Nacional Agraria La M olina, es el espacio donde se desarrollan


estas preocupaciones y retos en un ambiente de debate y consolidacin de la
tcnica, la ciencia y las humanidades. Sus profesores son los principales agentes
de la investigacin, cuyos resultados son m ateria de las clases en aulas, y fuera en
ella, en foros acadmicos, donde sale a la luz su excelente preparacin e idoneidad
experimental.
Bajo estos preceptos y antecedentes, me complace presentar este libro Manual
de Microbiologa Agrcola RMzobium, PGPRs, Indicadores de Fertilidad e
Inocuidad de Doris Elizabeth Ziga Dvila, destacada docente de nuestra
universidad, quien en este trabajo demuestra la agudeza de sus investigaciones y
comparte sus resultados, como una forma de optimizar el papel de la Universidad
para la com unidad universitaria y la sociedad en general.

D r . J ess A bel M eja M arcacuzco


R ector

A la Memoria de mis queridos padres


Celia y Francisco
por iluminar siempre m i sendero.

A mis hijos E th ely Eduardo


por todo su cario

A m i nietecita Adriana
Sol de m i vivir

COLABORADORES:
Laboratorio de Ecologa M icrobiana y Biotecnologa
M arino Tabusso - UNALM
Blga. Elena Ram os Vsquez
Blgo. M inora M atsubara Bautista
Blga. Katty Ogata Gutirrez
Bach. Blga. Stefany Cpeda Gonzles
Blga. N atalia Kohashikawa Takaezu
Blga. Pam ela Calvo Vlez
Centro de Ciencias Genmicas - UNA M (Cuernavaca, Mxico)
Dr. Ernesto Orm eo Orrillo
Coordinador de la Red Biofag - CYTED, Espaa
Dr. Juan Sanjun Pinilla (CSIC-EEZ, Granada)

Fotografas y diagrama de la portada

Fotografas laterales
(D. Ziga, E. Ramos y R. Santos)
1.
2.
3.
4.
5.

Efecto de la inoculacin de cepas de Azotobacter en plantas de papa.


Control de Rhizoctonia por cepas de Bacillus sp.
Produccin de cido indol actico por cepas aisladas de frijol.
Perfiles de amplificacin BOX-PCR de Bacillus aislados de papas
amargas.
Semillas germinadas de Phaseolus lunatus.

Diagrama central (D. Ziga)


Seales moleculares de la interaccin Rhizobium -leguminosa

INDICE

PRLOGO
I.

13

AISLAMIENTO Y CARACTERIZACION DE RHIZOBIOS

1.
2.
2.1.
2.2.
2.3.
3.
3.1.
3.2.

Recoleccin de nodulos
Aislamiento de rhizobios
Tratamiento de nodulos
Aislamiento de rhizobios a partir de nodulos
Mantenimiento y conservacin de rhizobios aislados
Pruebas de pureza
Crecimiento en agar levadura lactosa (LLA)
Crecimiento en agar peptona - glucosa con indicador
prpura de bromocresol (PGPBC)
3.3. Crecimiento en agar Luria Bertani (LB)
4.
Autenticacin de las cepas de rhizobios
4.1. Desinfeccin de semillas
4.2. Evaluacin de la germinacin
4.3. Preparacin del inoculo
4.4. Trasplante de semillas a tubos con solucin nutritiva
4.5. Inoculacin de las plntulas
5.
Caracterizacin fenotpica de cepas de rhizobios
5.1. Caracterizacin morfolgica de colonias
5.2. Produccin de acidez o alcalinidad en medio LMA
con azul de bromotimol (LMA-ABT) al 0.5%
5.3. Efecto de los agentes fsico-qumicos sobre el crecimiento
de las cepas de rhizobios
5.4. Tolerancia a iones metlicos Cu2+, Zn2+, Al3+, Mn2+
5.5. Crecimiento en diferentes fuentes de carbohidratos y aminocidos
5.6. Sensibilidad a antibiticos en disco

II.
6.
6.1.
6.2.
6.3.
6.4.
7.
7.1.
7.2.
7.3.
7.4.

17
17
17
17
18
19
19
19
19
20
20
20
20
20
21
22
22
22
23
24
26
26

AISLAMIENTO Y CARACTERIZACIN DE BACTERIAS PGPR


Aislamiento de bacterias promotoras de crecimiento (PGPR)
Procesamiento de las muestras de rizsfera
Aislamiento de Bacillus sp.
Aislamientos de Azotobacter sp.
Aislamiento de actinomicetos
Pruebas para bacterias promotoras de crecimiento
Deteccin de acido indol actico (ALA.)
Deteccin de bacterias solubilizadoras de fosfato
Pruebas de antagonismo contra hongos fitopatgenos
Efecto de la inoculacin con PGPRs en la germinacin
de diferentes cultivos.

31
31
31
31
32
32
33
34
34
36

III. CARACTERIZACIN MOLECULAR E INTERPRETACIN


DE DATOS MEDIANTE AMPLIFICACIN BOX-PCR
Introduccin
'8.
Notas generales para hacer PCR
9.
Extraccin de DNA por lisis alcalina
10. Verificacin de la calidad del DNA extrado
(Control de calidad)
11. Amplificacin BOX-PCR
12. Agrupamiento de perfiles BOX-PCR semejantes
13. Amplificacin del gen ribosomal 16s
14. Purificacin del producto de PCR
15. Secuenciamiento
16. Elaboracin de rboles filogenticos

39
39
40
41
42
45
46
47
47
50

IV. PRODUCCIN Y CONTROL DE CALIDAD DE BIOFERTILIZANTES


17.
17.1.
17.2.
17.3.
18.
18.1.
18.2.

Produccin de biofertilizantes
Produccin de biomasa del rhizobio
Preparacin del soporte slido
Presentacin del biofertilizante
Control de calidad del biofertilizante
Recuento de clulas viables de bacterias fijadoras de nitrgeno
Capacidad infectiva y efectiva de los inoculantes en
plntulas de leguminosas
18.3. Recuento de microorganismos contaminantes del biofertilizante
18.4. Anlisis fsico-qumico
19. Enumeracin de bacterias simbiticas fijadoras de
nitrgeno por nmero ms probable

53
53
53
55
56
56
56
56
56
58

V. INDICADORES DE LA FERTILIDAD BIOLOGICA DEL SUELO


Introduccin
20.
Preparacin de muestras y diluciones
21.
Recuento de bacterias
21.1. Recuento de bacterias aerobias mesfilas viables
21.2. Recuento de hetertrofos
22.
Recuento de hongos totales
23.
Recuento de bacterias anaerobias mesfilas
24.
Recuento de actinomicetos
25. Enumeracin de bacterias fijadoras de nitrgeno de vida libre
26. Actividad microbiana
26.1 Determinacin de la respiracin de los microorganismos del suelo
26.2 Determinacin de la actividad deshidrogenasa de los
microorganismos del suelo

63
65
66
66
66
69
70
71
72
73
73
73

VI. INDICADORES DE INOCUIDAD DE AGUA Y SUELO


Introduccin
27.
Enumeracin de coliformes totales
27.1. Enumeracin de coliformes totales (ICMSF, 2000)
27.2. Enumeracin de coliformes totales
(Standard Methods, 1998)
28.
Enumeracin de coliformes fecales
28.1. Enumeracin de coliformes fecales (ICMSF, 2000)
28.2. Enumeracin de coliformes fecales
(Standard Methods, 1998)
29.
Enumeracin de Escherichia coli
29.1. Tcnica para el aislamiento y purificacin de cultivos
29.2. Tcnica para la prueba del indol
29.3. Tcnica para la prueba del rojo de metilo
29.4. Tcnica para la prueba de Voges-Proskauer
29.5. Tcnica para la prueba del citrato sdico
30.
Determinacin de Salmonella
30.1. Enriquecimiento no selectivo de salmonelas
30.2. Enriquecimiento selectivo de salmonelas
30.3. Siembra en medios de agar selectivo para salmonelas
30.4. Bioqumica de Salmonella
30.5. Serologa somtica
REFERENCIAS BIBLIOGRFICAS
ANEXOS
N 1: Medios de cultivo y reactivos
N 2: Ensayos de sensibilidad a diferentes antibiticos
N 3: Tablas de nmero ms probable
N 4: Material de biologa molecular

79
81
81
83
86
86
88
90
90
90
90
90
91
92
92
92
92
92
93
95
99
100
106
107
111

A B R E V IA T U R A S
AP
APT
EC
LMC
CG
Brilla
CL
LST
SC
T-VB
TSC
CT
TY
M M - ABT
SS

Agua peptonada
Agua peptonada tam ponada
Caldo EC
Caldo extracto de levadura - m anitol
Caldo glucosa
Caldo lactosa bilis (2 %) verde brillante
Caldo lactosado
Caldo lauril sulfato triptosa
Caldo selenito cistina
Caldo tetrationato verde brillante
Caldo tripticasa de soya
Caldo triptona
Caldo triptona - extracto de levadura
M edio mineral sin nitrgeno con
indicador azul de bromotimol
Solucin salina 0.85 %

PRLOGO
a fertilidad del suelo generalmente est relacionada con la cantidad de nutrientes
disponibles para las plantas y los microorganismos juegan un rol importante en el
reciclaje de todos estos elementos nutricionales que muchas veces no se comprende.
A nivel mundial existen muchas investigaciones relacionadas con la dinmica de la
microflora de diferentes suelos y su relacin con la produccin de diferentes cultivos, pero
estos anlisis resultan an muy costosos.

En el primer manual Fertilidad Biolgica del Suelo con nfasis en el estudio del Rhizobium
editado en Junio del 2006 fue utilizado dentro del I Curso Internacional de Fertilidad
Biolgica del Suelo, auspiciado por la Red Biofag (Cyted Espaa). Despus de una revisin
e incorporacin de nuevas tcnicas como el aislamiento de bacterias promotoras de
crecimiento (PGPR) y pruebas de actividad microbiana investigados en nuestro laboratorio,
se propuso darle el ttulo de Microbiologa Agrcola: Rhizobium, PGPR, indicadores de
fertilidad e inocuidad, puesto que los ensayos se enfocan principalmente en el estudio de
los suelos para la produccin de diversos cultivos de manera sostenible.
Por otro lado, en los ltimos aos se ha incrementado la demanda de anlisis
microbiolgicos en suelos, agua de riego y residuos orgnicos, que nos indican la riqueza
natural de estos sustratos; y mas an por empresas que trabajan a nivel de exportacin de
cultivos, cuyas exigencias se basan en las normas de Eurepgap, son mayores cuando se
trata de productos orgnicos. Estas involucran las buenas prcticas agrcolas, seguridad
alimentaria, proteccin del ambiente y salud. Pero adems, los pequeos agricultores
cuya proyeccin es ofrecer productos nativos manejados de manera tradicional, tambin
requieren de estas tcnicas y conocimientos.
El presente manual se organiza en 6 captulos con un total de 30 temas. En primer
lugar se describe todo lo relacionado con el Rhizobium aislados de nodulos de diferentes
leguminosas, es decir, desde su aislamiento, purificacin, y autenticacin en plntulas
hasta su caracterizacin fenotpica: morfolgica y bioqumica.
En segundo lugar, se presentan las tcnicas de aislamiento de bacterias promotoras de
crecimiento con nfasis en Bacillus y Azotobacter no presentadas en el manual anterior de
Fertilidad Biolgica. As tambin se describen algunas tcnicas para evaluar la capacidad
promotora de crecimiento (PGPR), como solubilizacin de fosfato y produccin de cido
indol actico (AIA). En la presente obra, tambin se incluyen dos pruebas importantes
como es la capacidad antagnica de fitopatgenos y efecto de las bacterias en la germinacin
de semillas.
Todas estas pruebas, nos permite conocer no solo el potencial de la fijacin simbitica
de nitrgeno en diferentes ecosistemas, sino tambin diferentes bondades de las bacterias
PGPR que favorecen significativamente la produccin de leguminosas y otros cultivos.
13

La caracterizacin molecular que aparece como tercer captulo permite determinar la


diversidad intra e interespecficas de cepas bacterianas con nfasis en rhizobios, pero que
pueden ser aplicadas o adaptadas a bacterias PGPRs. Estas herramientas moleculares son
muy importantes para conocer con qu cepas bacterianas estamos trabajando y poderlas
aplicar sin riesgo para el agricultor, el ambiente y el consumidor.
Como cuarto captulo, se muestra la metodologa de produccin de inoculantes en soportes
slidos a nivel de laboratorio y algunas de las tcnicas para evaluar su control de calidad:
nmero de clulas viables en el soporte, capacidad infectiva y efectiva en el cultivo entre
otras.
En el quinto, se presentan algunos mtodos para la determinacin de la actividad
microbiana y poblaciones microbianas, como indicadores de la fertilidad del suelo.
En el ltimo captulo se describen las tcnicas de anlisis de coliformes y Salmonella, las
cuales son tiles para determinar el estado sanitario del suelo, residuos orgnicos, compost,
bioles, lodos y agua de riego. Es necesario resaltar que el LEMYB Marino Tabusso est
realizando investigaciones para validar estos mtodos ya que no existen todava normas
estandarizadas en nuestro pas y en otros, an estn en proceso de discusin.
Esperamos que el contenido de este segundo manual, resultado tambin de mucha
dedicacin y de investigacin sea til para diferentes investigadores, profesores, alumnos
y todas aquellas personas relacionadas con la agricultura, interesadas en incursionar
en el fascinante mundo de las bacterias fijadoras de nitrgeno y otros microorganismos
promotores de crecimiento que son clave en el manejo sustentable de los suelos.
Finalmente, quiero agradecer a todas las personas del laboratorio que hicieron posible la
publicacin del presente manual, en especial a Elena Ramos y Minoru Matsubara. As
tambin al Dr. Juan Sanjuan, coordinador de la Red Biofag (Cyted Espaa) y Dr. Ernesto
Ormeo, del Centro de Ciencias Genricas UNAM (Mxico).

Doris Ziga

14

I. AISLAMIENTO Y CARACTERIZACION
DE RHIZOBIOS

1. R eco lecci n de n o d u lo s
2. A islam ien to de rh izo b io s
3. P ru eb a s de p u re z a
4. A u te n tic a c i n de las cepas de rh izo b io s
5. C ara c te riz a c i n fen o tp ica de cepas de rh izo b io s

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

1.

RECOLECCION DE NODULOS

Esta metodologa se realiza de acuerdo al m anual del CIAT (1988).

2.

1.

Con ayuda de una lampa, extraer la planta que presente mejor aspecto.
Luego colectar entre 10 y 20 nodulos de la raz (Figura 1.1).

2.

Colocar los nodulos en frascos con silica gel y algodn para su posterior
conservacin, asignndoles a cada muestra un cdigo de acuerdo al lugar
de muestreo y nm ero de planta. Se recom ienda un tiempo mximo de
3 meses de almacenamiento bajo esta condicin.

3.

Posteriormente se trasladan al laboratorio para su tratam iento y


procesamiento respectivo.

AISLAMIENTO DE RHIZOBIOS

2.1. Tratamiento de los nodulos


*

Seleccionar 3 nodulos de cada frasco con silica gel.

Colocarlos en sobres de papel de filtro estril e hidratarlos en agua


destilada tam bin estril durante 30 m in (en caso que los nodulos estn
secos).

Desinfectar con alcohol al 70 % por espacio de 1 min en u n recipiente


estril.

Trasladar a otro recipiente que contenga leja (hipoclorito de sodio) al 3


% y dejar reposar durante 3 min (Figura 2.1)

Enjuagar con agua destilada estril durante 6 veces hasta que no se


perciba el olor a leja.

2.2. Aislamiento de rhizobios a partir de nodulos


*

Con ayuda de pinzas estriles, abrir los sobres que contienen los nodulos.

Colocar los nodulos en placas Petri estriles y con ayuda de una pipeta
agregar una gota de agua destilada estril a cada uno.

Con una bagueta proceder a la m aceracin del nodulo (es necesario que
por cada nodulo se utilice una bagueta).

17

D O RIS ELIZA B ETH Z IG A D V ILA

El macerado se siembra en placas Petri con medio agar levadura manitol


con rojo congo (LMA-RC) por estras paralelas.

Incubar las placas a 28 C por 24 - 72 horas (Rhizobium sp.) o 5 - 7 das


(Bradyrhizobium sp.).

U na vez observado el crecimiento, se procede a elegir las colonias de los


posibles rhizobios teniendo en consideracin las caractersticas tpicas
de estos (Tema 5.1). Posteriormente se reaslan de 2 - 3 veces en placas
Petri con LMA-RC hasta obtener colonias aisladas con crecimiento
homogneo.

2.3. Mantenimiento y conservacin de rhizobios aislados


*

Sembrar a partir de una sola colonia en medio LMA, incubar a 28 C por


3 - 1 0 das, y luego conservar a 4 C. Realizar el mismo procedimiento
cada 6 meses.

Para tener cultivos stocks, hacer crecer las cepas en Caldo Extracto de
Levadura - M anitol sin rojo congo (LMC) hasta una poblacin de
aproxim adam ente 108 cel/m L.

M ezclar 1 mL de este cultivo con 0,5 mL de glicerol al 87 % y guardar


a -80 C.

Desinfeccin: alcohol al 70 % x 1 min.

Desinfeccin: hipoclorito de sodio 3 % x 3 min.

I
Enjuague: 5 - 6 veces con H20

EfEEEzEE3
Triturado del nodulo y siembra por estra en medio
LMA-RC. Incubar a 28 C por 24 - 72 h 5 - 7 das

Reaislamiento del rhizobio en medio LMA-RC.


Incubar a 28 C por 24 - 72 h 5 - 7 das
T

Conservacin de cepas a 4 C

FIGURA 2.1. Aislamiento de rhizobios a partir de nodulos


18

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

3.

PRUEBAS DE PUREZA

Las pruebas de pureza siguen la metodologa em pleada por el CIAT (1988).


3.1. Crecimiento en agar - levadura - lactosa (LLA)

Sembrar los cultivos aislados en placas con LLA por estras paralelas.
Incubar a 28 C por 2 - 1 0 das (segn sea Khizobium sp. o Bradyrhizobium sp).
Observar el crecimiento de la bacteria.
Adicionar 5 m L del reactivo de Benedict, e incubar a tem peratura
ambiente por 10 min .

Observar el cambio de coloracin, de blanquecino a amarillento (Figura 3.1).

El cambio de color en el reactivo de Benedict a amarillo se debe a la produccin


de a-cetolactosa, caracterstico del gnero Agrobacterium y no de rhizobios.
3.2. Crecimiento en agar peptona - glucosa con
bromocresol (PG-PBC)

indicador prpura de

Sembrar los cultivos en medio PG-PBC mediante estras paralelas.

Incubar a 28 C por 2 - 1 0 das (segn sea Rdiizobium sp. o Bradyrhizobium sp.).

Observar el crecimiento y cambio de coloracin (Figura 3.1).

Generalmente los rhizobios no crecen o crecen poco virando ligeramente a


amarillo el medio de cultivo. Resultados diferentes a los antes descritos indicaran
el crecimiento de un microorganismo contaminante.
3.3. Crecimiento en agar Luria Bertani (LB)

Sembrar los cultivos en medio LB mediante estras paralelas.

Incubar a 28 C por 2-10 das.

Cepas de rhizobios

EEEEEj

5EEEE3

Siembra por estra


Medio PG-PBC

Siembra por estra


Medio LLA

Siembra por estra


Medio LB

Incubar a 28 C por 2 -10 das

Agregar 5 mL de
reactivo de.
Benedict e incubar
Evaluar crecimiento
y viraje de color

Evaluar crecimiento
Evaluar crecimiento
Rvo. Benedict.

FIGURA 3.1. Pruebas de pureza

19

D O R IS EL IZA B ETH Z IG A D V ILA

Observar crecimiento (Figura 3.1).

AI igual que en el medio PG-PBC, en este medio no se observa un buen


crecimiento de los rhizobios. Se ha observado excepcionalmente el
crecimiento de las cepas de Rhizobium tropici de frijol.
4.

AUTENTICACIN DE LAS CEPAS DE RHIZOBIOS

4.1. Desinfeccin de semillas

Escoger las semillas de inters para realizar la autenticacin.

Desinfectar utilizando hipoclorito de sodio al 2 % durante 5 min (de


acuerdo a la sensibilidad de la semilla).

Enjuagar con agua destilada estril varias veces cada 5 min.

La hidratacin de las semillas se realiza colocndolas en vasos de


precipitacin con 400 mL de agua destilada estril. Las semillas grandes
(mayor a 1 cm) se dejan hidratar por 3 - 4 h y las semillas pequeas
durante 1 - 2 h.

Con ayuda de pinzas estriles se tom an 10 semillas de cada variedad.

Colocar en placas Petri con la base recubierta de papel de filtro estril


hum edecido (Figura 4.1).

Cubrir las placas con papel para proteger de la luz.

Llevar a una estufa a 24 C por 24 - 72 h. (segn el tipo de semilla).

4.2.

Evaluacin de la germinacin
La germinacin de las semillas se evala cada doce horas, teniendo en
consideracin los siguientes parmetros: porcentaje de germinacin,
nmero de radculas con punta roma, nmero de radculas con punta fina.

4.3.

Preparacin del inoculo


*

De las cepas de rhizobios conservadas en refrigeracin, tom ar una asada.

Sembrar en caldo levadura manitol.

Incubar a 28 C por 2 - 7 das (segn la bacteria) con la finalidad de


obtener una poblacin de bacterias de 108 U F C /m L .

4.4.

Transplante de semillas a tubos con solucin nutritiva

Para la autenticacin se escogen las semillas que presentaron radculas


con punta fina.

Las semillas pequeas germinadas (trbol, alfalfa) se transfieren a tubos


de ensayo que contienen material de polipropileno, papel de filtro y
aproxim adam ente 10 mL de solucin nutritiva (Figura 4.2).

Las semillas grandes (pallar, frijol) colocarlas en placas Petri. Con ayuda
de un bistur y pinzas quitar el pericarpio.

Luego, transferirlas a tubos grandes con 25 m L de solucin nutritiva o a


jarras Leonard.

Los tubos que contienen las semillas se cubren con un papel en la parte
externa inferior para proporcionarle la oscuridad necesaria a la raz.
30

MANUAL P E MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES P E FERTILIDAD E INOCUIDAD

Colocarlos en gradillas y trasladarlos a u n a cm ara de crecimiento,


proporcionndoles 12 h de luz blanca y directa (utilizndose dos
fluorescentes de 40 watts cada uno) y 12 h de oscuridad, a u n a tem peratura
de 1 8 - 2 2 C.

4 .5 .Inoculacin de las plntulas

R ealizar la inoculacin de las plntulas a los 7 dias.

C olocar 1 m L del inoculo bacteriano cerca de la


plntula.

Regar las plntulas con la solucin nutritiva cada 3 o 5 das (si fuera
necesario).

O bservar la aparicin de nodulos, cada 7 das, por cinco sem anas


aproxim adam ente.

radcula de cada

L a pru eb a de autenticacin confirm a que la colonia aislada de Rhizobium es


capaz de n o d u lar (nod +).
Desinfeccin de semillas con hipoclorito de
sodio 2 % durante 5 min

Enjuagar las semillas con agua destilada


estril cada 5 min ( 5 - 7 veces)

Hidratar las semillas de leguminosa en agua estril


Semilla pequea: 1.5 - 2 h

Semilla grande: 3 - 4 h

i
Colocar las semillas en placas con papel filtro
humedecido con agua destilada estril
Semilla grande: 6 mL
Semilla pequea: 2 mL

i
Cubrir las semillas en placas y llevarlas a incubar a 24 C

l
Evaluacin de la germinacin

FIGURA 4.1. Desinfeccin y germinacin de semillas de leguminosas


21

D O RIS ELIZA B ETH Z IG A DVILA

Semillas de leguminosa pre germinadas

Transplante de las sem illas a tubos de ensayo


con solucin nutritiva

Llevar a cmara de crecimiento de 18 a 22 C

Inoculo de plntulas a los 7 das con cepas de


rhizobios (108 UFC/mL)

Observar la aparicin de nodulos cada 7 das por cinco


semanas.

FIGURA 4.2. Autenticacin

5.

CARACTERIZACION FENOTIPICA DE CEPAS DE RHIZOBIOS

La caracterizacin fenotpica se realiza en base a los protocolos recomendados


por Somasegaran y Hoben (1985), CIAT (1988), M atos et al. (1998) y Hungra
et al. (2001).
5.1. Caracterizacin morfolgica de colonias
"

Sembrar las cepas en el medio LM A - RC.

Incubar a 28 C por 2 - 1 0 das.

M edir dimetro, forma, apariencia y color de la colonia, as como la


cantidad, textura y consistencia de la gom a producida.

D e acuerdo a las- caractersticas evaluadas, las cepas en estudio pueden


agruparse en distintos gneros de rhizobios (Tabla 5.1).

5.2. Produccin de acidez o alcalinidad en medio LMA con azul de bromotimol


(LMA - ABT) al 0.5%

Sembrar las cepas de rhizobios en el medio LM A con azul de bromotimol


(ABT) al 0.5 %.
22

MANUAL DE MICROBIOLOGA AGRCOLA RKZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

Incubar a 28 C por 2 - 12 das (Figura 5.1).

El cambio de color de verde a amarillo o a azul depende del gnero del


rhizobio en estudio (Tabla 5.1).

TABLA 5.1. Caractersticas morfolgicas de rhizobios en medio LMA


(modificado de W ang y M artinez-Romero, 2005).
LMA-ABT

TIEMPO

DIMETRO

TEXTURA

APARIENCIA

COLOR

GOMA

A z o rh iz o b iu m

2 d as

> 2 mm

C re m o s o

Translcidas

B la n co

R e g u la r

B ra d y rh iz o b iu m

5-7 d a s

< 2 mm

Opacas

B la n co

P oco a
re g u la r

( lc a li)

M e s o rh iz o b iu m

3-7 d a s

2 -4 m m

C re m o s o

Semitranslcidas

B la n co

R e g u la r a

A m a rillo

L ig o so /

Semitranslcidas
u opacas

B la n co

R h iz o b iu m

2-5 d a s

L ig o so /
c re m o so

2 -4 m m

cre m o s o

b eige

a b u n d a n te
A b u n d a n te

A zu l
( lc a li)
A zu l

( cid o )
A m a rillo
( cid o )

Cultivo de rhizobios de 3 - 1 0 dias

i
Sembrar por estra en medio LMA
con azul de bromotimol

Incubar a 28 C x 3 -1 2 das

I
Evaluar viraje del medio:
amarillo: acidez / azul: alcalinidad
F IG U R A 5.1. Produccin de acidez o alcalinidad

5.3.

Efecto de los agentes fsico - qumicos sobre el crecimiento de las cepas


de rhizobios
Para realizar los siguientes ensayos es necesario tener las cepas previamente
crecidas en caldo LM C a una poblacin de aproximadamente 106- 108
U F C /m L (cultivos de rhizobios de 3 das de bradyrhizobios de 5 das)
23

D O RIS EL IZA B ETH Z IG A D V ILA

Luego, tom ar 5 pL con u n pipetor autom tico y colocarlo en la placa con


medio LM A a las diferentes condiciones a ensayar (pH, concentraciones
de NaCl). En caso de no contar con un pipetor, usar una asada del
cultivo lquido y realizar una pequea estra (Figura 5.2).

Cada placa Petri de 1 0 x 9 m m se divide en cuadrantes y sirve para 9


cepas de rhizobios 16 de bradyrhizobios.
5.3.1.

Crecimiento a varios niveles de pH

Sembrar las cepas en medio LM A a diferentes pH (4, 5, 8 y 9).

Incubar a 28 C y evaluar elcrecimiento de las cepas cada 24 o 48 h


por 10 das para los rhizobios y 15 das para los bradyrhizobios.
5.3.2.

Crecimiento a diferentes concentraciones de NaCl

Sembrar las cepas en medio LM A con diferentes concentraciones de


N aCl (0.25, 0.5, 1, 2 % a ms).
Incubar a 28 C y evaluar el crecimiento de las cepas en estudio
cada 24 o 48 horas por 10 das para Rhizobium y 10 - 15 das para
Bradyrhizobium.
5.3.3.

Crecimiento en diferentes temperaturas

* Sembrar las cepas en medio LMA.


Incubar a diferentes temperaturas: 8, 28, 37 y 40 C, y evaluar el
crecimiento de las cepas en estudio cada 24 o 48 horas por 10 das
para Rhizobium y 15 das para Bradyrhizobium. Luego, a los 15 y 20
das como evaluacin final.
5.4. Tolerancia a iones metlicos Cu2+, Zn2+, AP+, Mn2+

Sembrar las cepas en medio LM A con diferentes concentraciones de


Cu2+ y Zn2+ (10, 20 y 40 pg/m L); Al3+ (0.625, 1.25 y 2.5 pg/m L) y M n2+
(0.3125, 0.625 y 1.25 pg/m L). Los iones metlicos se obtienen a partir de
C uS0 4.5H20 y ZnSO4.7H20, A1C13.6H20 y M n S 0 4.H20.

Incubar a 28 C.

Evaluar el crecimiento de las respectivas cepas cada 24 horas por 12 das


(Figura 5.3).

24

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

/
Cultivo de rhizobios de 24 a 48 h

1
Inoculo (5 j jL d e lO 6 UFC/mL)

LMA con diferentes


concentraciones de
NaCI (0.5, 1 y 2 %)

LMA con diferentes


niveles de pH
(4, 5, 8, 9)

Incubar a 28 C x
3 a 15 das

LMA

Incubar a 8, 28, 37 y 40 C
por 3 a 20 das

Reportar el crecimiento: Abundante (++++), bueno (+++),


regular (++), escaso (+) y no crecimiento (-).

FIGURA 5.2. Crecimiento en diferentes niveles de NaCI, pH y temperatura

Cultivo de rhizobios de 24 a 48 h

LMA con diferentes


LMA con diferentes
LMA con diferentes
LMA con diferentes
concentraciones de
concentraciones de concentraciones de Al concentraciones de
Zn (40, 20,10 pg/mL) Cu (40, 20, 10 pg/mL)
Mn (1.5, 0.625,
(2.5, 1.25, 0.625
pg/mL)
0.3125 pg/mL)

Incubar a 28 C x 3 -1 2 das

Reportar el crecimiento: abundante (++++), bueno


(+++), regular (++), escaso (+) y no crecimiento (-).

FIGURA 5.3. Tolerancia a metales

25

D O RIS FJ.TZAHETH Z IG A DV tLA

5.5.

Crecimiento en diferentes fuentes de carbohidratos y aminocidos

Inocular una asada del cultivo fresco en el medio base de Bergersen


descrito por Somasegaran (1985) con el carbohidrato (1%) o aminocido
(0.1%) en estudio.

Incubar a 28 C por 2 a 10 das (Figura 5.4).

Evaluar cambio de color del medio:*Si vira a color amarillo la reaccin es


positiva (metabolismo del carbohidrato o aminocido). La turbidez del
medio tambin indica reaccin positiva).

Cultivo fresco de rhizobios de 24 a 48 h

i
Transferir una asada del cultivo fresco
ai medio base con el carbohidrato o
aminocido de inters

i
Incubar a 28 C x 2 a 10 das

i
Evaluar viraje del medio:

Amarillo: fermentacin del carbohidrato o aminocido


Evaluar crecimiento:
Turbidez: crecimiento positivo

FIGURA 5.4. Crecimiento en diferentes fuentes de carbohidratos y aminocidos

5.6.

Sensibilidad a antibiticos en disco

Sembrar las cepas de inters, por duplicado, en medio LMA, esto se


puede realizar con la ayuda de una esptula de vidrio o por el m todo de
incorporacin. El inoculo de rhizobios es de 106 U F C /m L .

Colocar los discos sobre el medio sembrado (de 2 a 4 discos por placa).

Los antibiticos pueden ser: rifampicina, penicilina, carbenicilina,


sulfatrimetropin, doxiciclina, lincomicina, cloramfenicol, eritromicina,
cexima, kanamicina, noroxacina, tetraciclina, estreptomicina (Len,
1998).
26

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

Incubar las placas a 28 C durante 3 a 10 das y evaluar el halo formado


alrededor del disco, medir el dimetro del halo en milmetros (Figura 5.5).

Siembra de Rhizobium y Bradyrhizobium


en caldo Levadura Manitol

I
Incubar a 28 C por 2 -1 0 das

Siembra del inoculo (10 cel/ml) en medio LMA

Colocacin de discos de antibiticos


4 discos por placa (2 repeticiones)

1
Incubar a 28 C por 2 - 1 2 das

i
Evaluacin de la sensibilidad o resistencia de las cepas
FIGURA 5.5. Sensibilidad a antibiticos en disco

27

II. AISLAMIENTO Y CARACTERIZACION


DE BACTERIAS PGPR
6. A islam iento de bacterias prom otoras de crecim iento (PG PR )
7. Pruebas para bacterias prom otoras de crecimiento.

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

6.

AISLAMIENTO DE BACTERIAS PROMOTORAS DE CRECIMIEN


TO (PGPR)

6.1. Procesamiento de las muestras de rizsfera


El procesamiento se realiza de acuerdo al Tema 20, con la diferencia de que la
muestra es tom ada de la porcin de suelo que se encuentra alrededor de las races
(rizsfera).
6.2. Aislamiento de Bacillus sp.
Para este ensayo se aplica la metodologa A PH A (1992) y M erck (1994), pue
de realizarse un pre-tratamiento trmico para eliminar la microflora no deseada,
quedndonos nicamente con las esporas bacterianas.
El tratam iento trmico consiste en calentar el frasco con la muestra a la dilucin
(-1) por 30 min en bao m ara a 80 C. Despus del tiempo indicado, se procede
a realizar las diluciones de m anera rutinaria.

Sembrar en placas Petri 1 m L de las diluciones (-2) hasta (-5) e incorporar


agar glucosa triptona extracto de carne (TGE) fundido tem perado a 45 C,
hom ogenizar bien e incubar a 28 C por 48 h.

Seleccionar colonias caractersticas de Bacillus y sembrar por estra en una


placa con medio TGE. Repetir este procedimiento por aproximadamente 2
veces hasta obtener un cultivo puro.

Para confirmar la pureza se debe realizar una tincin Gram. Se debe observar
la morfologa al microscopio para verificar la presencia de bacilos Gram posi
tivos.

U na vez obtenidos los aislamientos se deben guardar en agar TGE inclinado


a 4 C para su m antenim iento hasta un mximo de 6 meses.

Las colonias del gnero Bacillus sp. se caracterizan por ser blanquecinas mucosas
o secas con bordes irregulares. Algunas colonias van a presentarse ms compac
tas y otras ms dispersas dado que el microorganismo es mtil y pueden hallarse
colonias muy invasivas.
6.3. Aislamientos de Azotobacter sp.
El procesamiento de la muestra se realiza de igual m anera que en el Tema 20 y se
realizan diluciones para el aislamiento del microorganismo segn Zapater (1975).

Colocar 1 mL de las diluciones (-2) hasta (-5) en tubos que contienen medio
mineral sin nitrgeno con el indicador azul de bromotimol (ABT) al 0.5%
y por triplicado.

Incubar a 28 C por 7 - 1 0 das.

Los tubos se reportan como positivos cuando hay viraje de color a amarillo,
presencia de turbidez y formacin de un velo en la superficie del caldo.

Tomar una alcuota de los tubos positivos y estriar en una placa que contiene
medio mineral sin nitrgeno.

Incubar a 28 C por 3 - 5 das.

Repetir este procedimiento por 2 veces hasta obtener un cultivo puro.

Para confirmar la pureza, se debe realizar una tincin G ram y observar la


31

D O RIS ELIZA B ETH ZU N IG A D A V ILA

morfologa al microscopio para verificar la presencia de Azotobacter spp. que


son gram negativos.

U na vez obtenidos los aislamientos se deben guardar en cuas con medio


mineral sin nitrgeno a 4 C para su mantenimiento hasta un mximo de 6
meses.

En los tubos que contienen el medio sin nitrgeno es muy importante verificar la
formacin de velos que son estructuras en forma de pelcula o aspecto filamento
so entrelazados (observar al microscopio para no confundir con micelio de hon
gos). Adems de la formacin de turbidez en el medio, los tubos positivos sern
aquellos que presenten velo y /o turbidez.
Dado que el medio de cultivo no contiene nitrgeno, es bastante selectivo y solo per
mite que las bacterias que son fijadoras Ubres de nitrgeno puedan crecer. Las colo
nias de Azotobacter spp. en placa presentan en general una morfologa caracterstica,
son traslcidas, de consistencia mucosa, superficie hmeda y poco convexas.
6.4. Aislamiento de actinomicetos
Los actinomicetos son un grupo de bacterias filamentosas G ram positivas. Como
resultado de un adecuado crecimiento y ramificacin, se forma una estructura
ramificada de filamentos, denom inada micelio, el mismo que an siendo de di
mensiones bacterianas es anlogo al micelio que forman los hongos filamentosos.
M uchos actinomicetos forman esporas por esta razn. Las colonias son fciles de
reconocer por presentar una forma redondeada a m anera de costra; el color suele
ser muy variable: blancas, verdes, rojas, moradas, grises, marrones, entre otros y
su aspecto es espolvoreado en la superficie. Adicionalmente las placas que con
tienen actinomicetos suelen presentar un olor caracterstico a mohoso o a tierra
de campos recin arados.
Se sigue la metodologa del APHA-AWWA-WPCF (1998).
*

El procesamiento de la muestra se realiza de igual m anera que en el Tema 20


y se realizan diluciones sucesivas para el crecimiento del microorganismo y
su posterior aislamiento.

Sembrar por incorporacin, lm L de las diluciones (-2) hasta (-5) en placas con
medio de almidn-casena suplementado con fluconazol (al 0.25 % para inhi
bir el crecimiento de hongos), homogenizar e incubar a 28 C por 6 - 7das.

Seleccionar una colonia caracterstica de Actinomiceto y sembrar por estra


en una placa con medio alm idn - casena. Repetir este procedimiento por 2
veces hasta obtener un cultivo puro.

Para confirmar la pureza se debe observar el microscopio las colonias selec


cionadas y visualizar las estructuras caractersticas.

U na vez obtenidos los aislamientos se deben guardar en agar triptona glucosa


(TGA) inclinado a 4 C para su mantenimiento hasta un mximo de 6 meses.

7.

PRUEBAS PARA BACTERIAS PROMOTORAS D E CRECIMIENTO

Las siguientes pruebas: produccin de cido indol-actico, solubilizacin de fos


fato, antagonismo contra hongos fitopatgenos y ensayos de prom ocin de la
germinacin, son utilizadas para determ inar las capacidades prom otoras de cre
cimiento (PGPR), que en nuestro caso, se han utilizado de m anera eficiente en
Rhizobium, Bacillus y Azotobacter.

MANUAL DE MICROBIOLOGA AGRCOLA RH1ZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

7.1.

Deteccin de cido Indol Actico (AIA)

Se utiliza la metodologa para bacterias del grupo de Pseudomonas seguida por


N aik y Sakthivel (2005) y m odificada para cepas de Rhizobium y otros m icroorga
nismos PGPR.

Reactivar las cepas en estudio.

Sembrar una colonia de cada cepa en tubos con medio lquido especfico
para cada microorganismo y suplementado con 5 mM de L-triptofano.

Incubar aproximadamente por 5 - 7 das a 28 C.

Emplear controles positivos con cepas productoras de AIA y controles nega


tivos.

Evaluacin
*

Tomar una alcuota de 100 pL del caldo bacteriano respectivo y adicionar 400
pL del reactivo de Salkowski

Homogenizar con cuidado.

Incubar en oscuridad por 30 min.

Se reporta como positivo si el medio vira de amarillo claro a tonos rojizos


(Figura 7.1).

Reactivar las ceDas

Sembrar en un tubo con medio apropiado + 5 mM L- triptfano


Incubar a 28 C por 5 das
y tom ar 100 jjL del cultivo

Agregar 400 pL
reactivo Salkowski,

del

Incubar en oscuridad y observar cambio de coloracin

FIGURA 7.1. Mtodo de deteccin del cido indol actico


33

D O RIS ELIZA B ETH Z IG A D V ILA

7.2.

Deteccin de bacterias solubilizadoras de fosfato

La metodologa de solubilizadores de fosfatos se tom en base al protocolo utili


zado por Nautiyal (1999).

Reactivar las cepas en estudio.

Sembrar por estra en el medio de cultivo National Botanical Research Institutes


phosphate growth mdium (NBRIP) con fosfato bicalcico o tricalcico.

Incubar las placas por 5 - 1 5 das a 28 C

Evaluacin

Se tom arn como positivas las cepas que crezcan en el medio de cultivo y
muestren presencia de un halo transparente alrededor de la estra (Figura 7.2).

Cultivo en estudio

i
Sembrar la cepa con una estra en el
medio para solubilizadores de fosfatos

Observar crecimiento de la cepa y formacin


de halo alrededor.

FIGURA 7.2. Mtodo de deteccin de bacteria solubilizadoras de fosfato

7.3.

Prueba de antagonismo contra hongos ftopatgenos

Esta metodologa puede ser adaptada a las bacterias que se deseen probar, los
ensayos se realizan de acuerdo a A hm ed et al. (2005).
*

Reactivar las cepas de bacterias que se van a utilizar.


Dividir una placa con agar papa dextrosa (PDA) en un mxim o de 4 cuadran
tes m arcando el punto central de la placa y una lnea equidistante del centro
en cada cuadrante.

MANUAL DE MICROBIOLOGA AGRCOLA RJHIZOBIUM, PGFRS, INDICADORES DE FERTILIDAD E INOCUIDAD

En cada una de las lneas se sembrarn las diferentes cepas a probar y se


incubarn a 28 C hasta obtener su crecimiento (puede variar segn l genero
de bacteria a utilizar).

Simultneamente se har crecer en una placa con medio PDA el hongo fitopatgeno hasta obtener un crecimiento del micelio que llegue a cubrir toda
la placa.

Con un sacabocado de 1 cm. de dimetro retirar una porcin del micelio del
hongo ya crecido y colocarla boca abajo en el centro de la placa que contiene
las bacterias.

Se debe utilizar una placa control donde solo se sembrar el hongo sin bac
teria y placas donde se prueben cepas como controles positivos y negativos.
Todo el ensayo se realiza por duplicado.

Incubar a la tem peratura ptima del hongo.

Evaluar si hay inhibicin del crecimiento del hongo por las bacterias despus
de que la placa control haya completado su crecimiento (Figura 7.3).

M edir las reas de inhibicin alrededor de cada cepa bacteriana.

Micelio del hongo en placa de PDA

Reportar como cepas positivas


aquellas que presenten un halo
evidente alrededor de la bacteria

Placa control con micelio


del hongo.

FIGURA 7.3. Prueba de antagonismo contra hongos fitopatgenos


35

D O RIS ELIZA B ETH Z IG A D V ILA

7.4. Efecto de la inoculacin con PGPRs en la germinacin de diferentes cul


tivos.
Desinfeccin de semillas e inoculacin

Se utilizan semillas de diferentes cultivos a las que se les hace una prueba de
germinacin previa.

Las semillas se desinfectan en alcohol de 96 por 2 - 5 minutos dependiendo


del tam ao (Figura 4.1).

Se enjuagan con agua destilada estril hasta eliminar los residuos de alcohol.

Se procede a embeber las semillas con los inculos que contenga una pobla
cin bacteriana de 106 cel/m L.

El tiempo de inhibicin va a depender de cada tipo de semilla por ejemplo


para tom ate se inbebe por dos horas y para frijol por tres.

Con ayuda de pinzas estriles se tom an 20 semillas y se colocan en placas Petri de 18 x 140 m m con papel filtro y papel toalla, esterilizados. La cantidad
de semillas por placa depende del tam ao de la semilla.

U na vez colocadas las semillas en la placa asegurarse que el papel este h


medo, para eso se puede adicionar con pipeta agua destilada estril sobre el
papel.

El nmero de repeticiones recomendadas es de 4 placas por tratamiento.

Es im portante tener un control solo con agua destilada estril y otro con el
medio de cultivo sin bacteria.

Las placas se envuelven en papel y se colocan en una cm ara temperada, la


tem peratura adecuada va a depender de los requerimientos fisiolgicos de
cada semilla.

Evaluacin de la germinacin
La germinacin de semillas se evala cada 24 horas por un periodo determinado
de germinacin para cada tipo de semilla, teniendo en cuenta el porcentaje de
germinacin y la forma y tam ao de la radcula. Se sigui la metodologa de
M ishra (1998).

36

III.
CARACTERIZACIN MOLECULAR E
INTERPRETACIN DE DATOS MEDIANTE
AMPLIFICACIN BOX - PCR
8.

N o ta s generales p a ra h a c e r P C R

9.

E x trac ci n de A D N p o r lisis alcalin a

10. V erificacin de la ca lid ad del A D N extrado


(co n tro l de calidad)
11. A m p lificaci n B O X - P C R
12. A g ru p a m ie n to de perfiles B O X - P C R sem ejantes
13. A m p lificaci n del gen rib o so m al 16s
14. P u rificaci n del p ro d u c to de P C R
15. S ecu en ciam ien to
16. E la b o ra c i n de rboles filogenticos

INTRODUCCIN
Los microorganismos del suelo presentan un rol relevante para el m antenim ien
to de la vida, la fertilidad, la calidad y el equilibrio en el ecosistema. Estudiar
su diversidad resulta importante, porque estos microorganismos forman parte de
comunidades muy complejas y dinmicas conformadas por numerosas especies.
Para entender la funcin e interaccin de cada uno de los miembros que confor
m an estas comunidades en los nichos especficos es esencial la identificacin de
los mismos.
La tcnica de reaccin de la cadena polimerasa dirigida a rDNA 16s ha sido uti
lizada ampliamente en el estudio de la diversidad en procariotas. El m todo de
rep-PCR es utilizado en bacterias y proporciona un fingerprint de la estructura
cromosmica, la cual es considerada variable entre cepas y por comparacin, se
pueden detectar diferencias a nivel intra e interespecficas.

8. NOTAS GENERALES PARA HACER PCR


1. Trabajar siempre en un lugar limpio y de preferencia con guantes. Cualquier
contam inante puede ser una fuente de ADN.
2. Usar puntas (tips) nuevas y estriles.
3. Cambiar de punta siempre que se vaya a agregar el siguiente reactivo.
4. Los volmenes de los reactivos para las reacciones de P C R dependen de las
concentraciones de las soluciones stocks disponibles. De m anera que siempre
se m antengan las concentraciones especificadas en las condiciones de amplifi
cacin.
5. Incluir siempre un control positivo con un A D N en buen estado y un control
negativo sin ADN.
6. Usar agua de grado molecular autoclavada tres veces y dispensadas en alcuo
tas de 1.5 mL en tubos eppendorf.
7. Cuando se preparan las mezclas para PCR, m antener todos los reactivos, in
cluyendo las muestras, en hielo picado. G uardar los reactivos a -20 C lo ms
rpido posible despus de utilizarlos.
8. Si se tienen dos tampones de PCR [KC1 y S 0 4(NH4)2]. Usar por defecto en
reacciones rutinarias el que trae KC1. El otro se usa para amplificaciones que
empleen mayores concentraciones de MgClr
9. Seguir el siguiente orden al m om ento de agregar los reactivos a los tubos para
hacer PCR:
a. Agua milli-Q. Agua desionizada ultra pura.
b. Buffer KC1. Otorga las condiciones ptimas para la actividad de la Taq A D N
polimerasa.

39

D O RIS EL IZA B ETH Z IG A D V ILA

c. MgCl,. Influye en la fuerza de la interaccin entre los primers y el A D N molde.


d. Dimetil sulfxido (DMSO) -si es que es necesario-. Inhibe la formacin de
estructuras secundarias en el A D N molde o primers.
e. Desoxirribonucletidos trifosfato (dNTPs). Son las bases de nucletidos que
la Taq A D N polimerasa utiliza para la extensin de las cadenas de ADN.
f. M uestra
g. Primer(s). Fragmentos cortos de una cadena simple de A D N (15-30 nucle
tidos) que son complementarios a las secuencias que flanquean la regin de
A D N de inters. El propsito de los primers PCR es proveer un grupo libre
3-OH para que la A D N polimerasa pueda aadir dNTPs.
h. Taq A D N polimerasa. Aislada de la bacteria Thermus aquaticus. Puede sinteti
zar A D N de m anera eficiente bajo condiciones de calor intenso.
10. Cuando se trabajen ms de 3 muestras, es posible realizar una sola mezcla de
reaccin. Se multiplican todos los volmenes de los reactivos listados en el
punto anterior, por el nm ero de muestras que se vayan a ensayar, ms una
adicional. Luego de repartir la mezcla en los tubos para PCR, se agrega la
muestra respectiva.
11. Despus de adicionar todos los reactivos necesarios y la muestra en el tubo,
se dan unos ligeros golpes al tubo para homogeneizar la mezcla de reaccin,
evitar formar burbujas y centrifugar por 15 segundos a 13000 rpm. Finalmente
colocar los tubos en el termociclador.
9. EXTRACCIN DE A D N POR LISIS ALCALINA
El aislamiento del A D N genmico se basa en su liberacin a travs de lisis celular
y el aislamiento de protenas, polisacridos y lpidos. El mtodo se desarrolla se
gn lo establecido por Herrera-Cervera et al. (1999) y modificado por M atsubara
(2010). (Mtodo para lisis de bradyrhizobios).
A . Materiales y equipos
Cultivo microbiano de la noche anterior, crecido en caldo Triptona - Extracto
de levadura (TY)

M icrocentrfuga a 12000 rpm

Refrigeradora a 4 C

Bao de agua a 80 C

Bao de agua a 37 C

Vortex

N aO H 0.05 M

Dodecil sulfato de sodio (SDS) 0.25 %

2 (iL, 1 - 10 pL, 10 -100 pL y de 100 - 1000 pL

Tips de 10 pL, 100 pL y 1000 pL (estriles y de prim er uso)

Microtubos de 2 mL

40

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

B. Procedimiento
1.

Tomar con un palillo estril masa bacteriana fresca crecida en placa.

2.

Resuspender los microorganismos en un microtubo conteniendo 20 pL de


una solucin NaO H 0.05 M y SDS 0.25 %. Hom ogeneizar haciendo uso de
un vortex.

3.

Colocar en bao de agua a 80 C por 15 min.

4.

Colocar en bao de hielo por 10 min y homogeneizar con vortex.

5.

Agregar 200 pL de agua milli-Q estril. Homogeneizar.

6.

Centrifugar 5 min a 12000 revoluciones por minuto (rpm).

7.

Trasvasar el sobrenadante a un microtubo limpio y conservar a 4 C.

10.

VERIFICACIN DE LA CALIDAD DE A D N EXTRADO (CONTROL


DE CALIDAD)

A . Materiales y equipos

Balanza digital de 200 g de capacidad

Horno microondas

Probetas de 100 y 1000 mL

Micropipetas de 0.1 - 2 pL y 1 - 10 pL

Tips de 10 pL

Cmaras electroforticas con bandejas para gel de agarosa de 15 x 10 cm

Fuente de poder de voltaje y tiempo regulable

Transluminador de luz UV

Cm ara digital

Buffer de carga (6X D N A Loading dye, Fermentas Inc. USA)

M arcador molecular Lam bda A D N 500 pg, Fermentas Inc. USA

Buffer tris-borato-EDTA (TBE) IX

Agarosa

Solucin acuosa de bromuro de etidio (0.5 pg/m L)

Agua destilada

B. Procedimiento
B .l Preparacin del gel de agarosa 1%
1.

Pesar 0.75 g de agarosa y mezclar con agua destilada (c.s.p. 75 mL).

2.

Licuar el horno m icroondas hasta la completa disolucin de los cristales de


agarosa.

3.

Temperar a 50 C y vertir en una bandeja electrofortica de 15 x 10 cm, pre


viamente nivelada.

4.

Colocar el peine que marca los pocilios de la bandeja.

5.

Dejar solidificar, evitando la formacin de burbujas.

6.

Retirar las paredes de goma de la bandeja del gel y el peine, teniendo cuidado
de no daar los pocilios de vertido de la muestra.
41

3 Q R IS ELIZA B ETH ZK 1G A D V ILA

B.2 Corrida electrofortica de las muestras


7.

Transferir la bandeja con el gel a la cmara de electroforesis.

8.

La cmara de electroforesis es cargada con buffer TBE IX, hasta cubrir los
pocilios de muestra.

9.

M ezclar 1 pL de buffer de carga con 5 pL de la muestra.

10. M ezclar 1 pL del m arcador molecular con 1 pL de buffer de carga y 4 pL de


agua milli-Q.
11. Cargar las mezclas realizadas con una micropipeta de 1 - 10 pL, dispensando
cada muestra en un pocilio del gel.
12. Cerrar la cmara de electroforesis y conectar los cables en sus electrodos co
rrespondientes.
13. Se programa la fuente de poder a 80 V por 60 min.
14. Iniciar la corrida.
B.3 Tincin del gel
15. Concluido el tiempo de corrida, trasladar cuidadosamente el gel a una ban
deja de solucin acuosa de bromuro de etidio (0.5 pg/m L), dejando reposar
durante 15 min.
16. Trasladar el gel de agarosa a la bandeja con agua destilada y dejar reposar
durante 10 min para su lavado.
17. Colocar el gel sobre el translum inador y encender la luz UV.
18. El gel revelado es observado a travs el fotodocumentador.
11.

AMPLIFICACIN BOX - PCR

A . Materiales y equipos
*

Termociclador

Micropipetas de 0.1 - 2 pL, 1 - 10 pL, 10 - 100 pL y de 100 - 1000 pL

Tips de 10 pL, 100 pL y 1000 pL (estriles y de prim er uso)

M icrotubos de 1.5 mL

Tubos para PCR de 0.2 mL (estriles y de prim er uso)

Buffer de carga (6X DN A Loading dye, Fermentas)

Primer BOX A IR (5 - CTA CG G CA A G G CG A CG CTG A CG - 3) 10 pm ol/


mL

Buffer Taq KC1 10X

Dimetil sulfxido (DMSO) 100%

MgC12 25 mM

dNTPs (dATP, dCTP, dGTP, dTTP 10 m M cada uno)

Taq A D N polimerasa 5U /pL

Agua milli-Q

42

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

B. Procedimiento
B. 1 Mezcla de Reaccin
1.

Se realiza un master mix, multiplicando todos los volmenes requeridos (Ta


bla 11.1) por el nm ero de muestras a ensayar ms una adicional.

2.

Dispensar la mezcla obtenida en cada uno de los tubos de PCR.

3.

Se procede a colocar el volumen respectivo de A D N y agua milli-Q (c.s.p. 25


pL de reaccin).

NOTA: La cantidad de A D N depende de la concentracin del mismo en el


eluente de extraccin, el cual se evala previamente en la verificacin del ADN.

TABLA 11.1. Mezcla para reacciones de amplificacin BOX-PCR


Reactivos

Buffer KC1 (X)


MgCl2 (mM)
DMSO (%)
dNTPs (mM)
Primer BOX AIR (pmol/mL)
Taq ADN Polimerasa (U/pL)
ADN (pL)
Agua milli-Q (pL)

Concentracin Concentracin

Volumen

Inicial

Final

(25 pL)

10
25
100
25
10
5

1,00
7,50
10,00
1,25
0,80
0,08

2,50
7,50
2,50
1,25
2,00
0,40
5 -8
c.s.p. 25,00

B.2 Reaccin de amplificacin BOX-PCR


4. Introducir los tubos para PCR en el termociclador, previamente programado
para la reaccin de amplificacin BOX (Versalovic et al., 1991).
5. El perfil de temperaturas para el termociclador se muestra en la Tabla 11.2.
TABLA 11.2. Perfil de temperaturas para las reacciones de amplificacin
BOX-PCR
Desnaturalizacin inicial
25 ciclos

95 C por 3 min
desnaturalizacin

93 C por 45 segundos

annealing

53 C por 1 min

extensin

65 C por 8 min

Extensin final

65 C por 16 min

43

DORJS EL IZ A B E TH Z IG A DVILA

B.3 Comprobacin de la amplificacin por electroforesis


Materiales

equipos

Balanza digital de 200 g de capacidad

Probetas de 100 y 1000 mL

M icropipetas d e 0 . 1 - 2 p L y l - 1 0 p L

Tips de 10 pL

Cm aras electroforticas con bandejas para gel de agarosa de 15 x 15 cm

Fuente de poder de voltaje y tiempo regulable

Translum inador de luz UV

Cm ara digital

Buffer de carga (6X D N A Loading dye, Fermentas)

M arcador m olecular Gene Ruler 1 kb A D N Ladder Plus (Fermentas Inc.,


USA)

Buffer TBE IX

Agarosa

Solucin acuosa de bromuro de etidio (0.5 pg/m L)

Agua destilada

Agua milli-Q

Procedimiento
1. Preparar agarosa al 1.5 % en buffer TBE IX y vertir en una bandeja electrofortica para gel de 15 x 15 cm.
2. Introducir el gel dentro de la cmara de electroforesis conteniendo la misma
solucin buffer.
3. M ezclar 1 pL del buffer de carga con 5 pL del amplificado.
4. M ezclar 1 pL del m arcador Gene Ruler 1 kb A D N Ladder Plus con 1 pL de
buffer de carga y 4 pL de agua milli-Q.
5. Se carga cada uno de los pocilios con los amplificados, colocando los marca
dores moleculares a los extremos del gel.
6. Se cierra la cmara de electroforesis y se conectan los cables en sus electrodos
correspondientes.
7. Las muestras son corridas a 80 V por 180 min.
8. El gel es revelado y observado a travs del fotodocumentador.

44

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

12.

AGRUPAMIENTO DE PERFILES BOX-PCR SEMEJANTES

A . Materiales
-

Fotografas de los geles electroforticos revelados con los productos de ampli


ficacin BOX-PCR

Software de edicin fotogrfica.

B. Procedimiento
1. Alinear las imgenes de los geles en funcin a los marcadores de peso molecular.
2. Com parar los perfiles BOX de cada una de las cepas ensayadas, buscando
bandas en com n que muestren un mismo peso molecular.
3. Form ar agrupamientos de alta similitud, de m anera que los patrones de los
diferentes grupos obtenidos se diferencien unos de otros.
4. Para hacer comparaciones entre geles, se alinean las bandas de los marcadores
con un mismo peso molecular
Extraccin del ADN bacteriano

1
Verificacin de la calidad de ADN extrado

Am plificacin BOX - PCR


Prim er BOX A1R
(5-CTA CGG CAA GGC GAC GCT GAC G-3')

Gel de Agarosa al 1.5 %

Com probacin de la am plificacin por electroforesis


Revelado con Bromuro^de etidio, 0.5 pg/mL

Exposicin al translum inador y tom as fotogrficas


Agrupam iento de perfiles sim ilares

FIGURA 9. Caracterizacin molecular de cepas bacterianas


45

D O RIS EL IZ A B E TH Z IG A DVILA

13.

AMPLIFICACIN DEL GEN RIBOSOMAL 16s

La reaccin de amplificacin del gen ribosomal 16s se realiza con el fm de secuenciarlo y determ inar la identidad de las cepas ensayadas.
A. Materiales y equipos

Termociclador Eppendorf

M icropipetas de 0.1 - 2 pL, 1 -1 0 pL, 10 -100 pL y de 100 - 1000 pL

Tips de 10 pL, 100 pL y 1000 pL (estriles y de prim er uso)

M icrotubos de 1.5 mL

Tubos para PCR de 0.2 mL (estriles y de primer uso)

Buffer de carga (6X A D N Loading dye, Fermentas)

Primers:

fD 1: 5 - CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG - 3

rD l:

5 - CCCGG GATCCAAGCTTAAG GAGG TGATCCAGCC - 3

Buffer Taq KC110X

M gCl2 25 mM

dNTPs (dATP, dCTP, dGTP, dTTP 10 m M cada uno)

Taq A D N polimerasa 5U /pL

Agua milli-Q

B. Procedimiento
B .l Mezcla de Reaccin
1.

Rotular debidamente los tubos de PCR.

2.

Preparar una mezcla de reaccin de 25 pL para cada una de las muestras a


ensayar. E n la Tabla 13.1 se detalla la formulacin de la misma.
TABLA 13.1 Mezcla para reacciones de amplificacin 16S

Reactivos

Concentracin

Concentracin

Volumen

Inicial

Final

(25 pL)

10
25
10
10
10
5

1,00
1,50
0,50
0,50
0.50
0.50

2,50
1,50
0,20
0,20
0,20
0,10
5
c.s.p. 25,00

Buffer KC1(X)
MgCl2 (mM)
dNTPs (mM)
Primer fDl (pmol/mL)
Primer rDl (pmol/mL)
Taq ADN Polimerasa (U/pL)
ADN (pL)
Agua milli-Q (pL)
B. 2 Reaccin de amplificacin
3.

Introducir los tubos para PC R en el termociclador previamente programado


para la reaccin de amplificacin del gen ribosomal 16s.
46

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

4. El perfil de temperaturas para el termociclador se muestra en la Tabla 13.2.


TABLA 13.2 Perfil de temperaturas para las reacciones de amplificacin del
gen ribosomal 16s
Desnaturalizacin inicial
30 ciclos

93 C por 2 min
desnaturalizacin

93 C por 45 segundos

annealing

62 C por 45 segundos

extensin

72 C por 2 min.

Extensin final

72 C por 5 min.

B.3 Comprobacin de la amplificacin por electroforesis


Materiales y equipos
* Lo requerido en la seccin 11 - B.3, con la siguiente variante en la bandeja de
electroforesis y m arcador molecular:
Cmaras electroforticas con bandejas para gel de agarosa de 15 x 10 cm
M arcador m olecular Ladder A D N m arker (300 - 10000 pb), Fermentas Inc.
USA
Procedimiento
1. Preparar un gel de agarosa al 1 % en buffer TBE IX, en una bandeja electrofortica para gel de 15 x 10 cm. Colocar el peine y dejar solidificar.
2. Proceder como lo sealado en el Tema 11, B.3
3. M ezclar 1 pL del m arcador molecular con 1 pL de buffer de carga y 4 pL de
agua milli-Q.
4. Cargar las muestras en los pocilios del gel y los marcadores moleculares a los
extremos del gel.
5. Cerrar la cmara de electroforesis y conectar los cables en sus electrodos co
rrespondientes.
6. Correr las muestras a 60 V por 150 m in aproximadamente o hasta que la ban
da ms oscura del buffer alcance la m itad del largo del gel.
7. Revelar el gel con bromuro de etidio, enjuagarlo y observarlo a travs del trasluminador.
14. PURIFICACIN DEL PRODUCTO DE PCR
Puede hacerse uso de kits comerciales de purificacin de productos de PCR, los
cuales se basan en el empleo de columnas que contienen resinas con alta selectivi
dad y recuperacin de fragmentos de ADN. Remueve los primers no constituidos
(< 50 nucletidos), enzimas y mononucletidos o sin marcar.
15. SECUENCIAMIENTO
Para la identificacin por secuenciamiento del gen ribosomal 16s, las muestras son
enviadas a un laboratorio especializado en dichos servicios. En la Figura 15.1 se
muestra un cromatograma proporcionado como resultado del secuenciamiento.
47

DO RIS ELIZA B ETH Z IG A D V ILA

190
170
180
G C T T G 7 T T G .... CC GC. T G G T i C . . . C . . T . ' . . .

'

-A

:i <

. ;
! ':

J ; . ; L J J G & u ii.

10
290
300
G G ..G G G T G T C G G C C CACT 3G G

i \ -

32
CTG . G ..C

330

rl*L -4vJ^J 'LjlrJ

340

350

360

f ; ' |

L J s lM u ^ h
420

ilk ... m

L.

440

430

I ^

FIGURA 15.1. Seccin de nucletidos proporcionados por un cromatograma


Tras el envo de las secuencias, se procede de la m anera siguiente:
Se adquiere un banco de secuencias de las posibles especies a la que pertenece el
microorganismo en cuestin: N ational Center for Biotechnology Inform ation
(http://w w w .ncbi.nlm .nih.gov/).
Lim piar y unir las secuencias dadas por cada Prim er (fD l y rD l), empleando
los programas BioEdit versin 7.0.5.3 y Chromas Lite versin 2.01, as como el
banco de secuencias.
Los programas BioEdit y Chromas Lite son utilizados para alinear las secuen
cias de las muestras con secuencias de especies ya conocidas y detectar posibles
errores en el cromatograma (Figuras 15.2 a 15.4), ya que muchas veces este tiene
bases solapadas o extras y la correccin ayuda a la definicin de las posibles espe
cies con mayor afinidad.

FIGURA 15.2 Secuencias del banco de genes (genebank, NCBI) y cepa en estudio. Tras la obten
cin de secuencias similares a las secuencias en estudio por medio de la NCBI, se procede a limpiar
las secuencias por medio de los programas BioEdit (arriba) y CHROMAS Lite (abajo), el primero
se emplea para comparar la semejanza entre las bases de la secuencia de la muestra con las secuen
cia extradas de la NCBI y el segundo para corroborar esta informacin con el cromatograma, ya
que en este se pueden observar los posibles errores de secuenciamiento.
48

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

FIGURA 15.3 Aplicacin de ClustalW para la alineacin de secuencias. La aplicacin ClustalW


permite alinear todas las secuencias en el archivo, permitiendo as la comparacin entre estas.

FIGURA 15.4 Secuencias alineadas para la correccin de posibles errores. El programa CHROMAS, es determinante al momento de realizar las correcciones necesarias, ya que el cromatograma
permite determinar si la diferencia en una base es real o si existe un error en la lectura de este.

49

D O RIS ELIZA B ETH Z IG A D V ILA

16. ELABORACIN DE RBOLES FILOGENTICOS


1. Se obtienen los datos de las secuencias del gen ribosomal 16s de distintas ce
pas patrn del gnero en estudio.
2. Las secuencias obtenidas son alineadas con las secuencias limpias de las
muestras. La aplicacin ClustalW Mltiple Alignment del program a BioEdit
(Figura 16.1) es un sistema empleado para alinear secuencias homologas de
nucletidos. Para la alineacin de mltiples secuencias, ClustalW utiliza m
todos de alineacin progresiva, donde las secuencias ms parecidas se alinean
primero y luego los grupos de secuencias cada vez ms distantes hasta obtener
una alineacin global.
3. Alineadas las secuencias, se cortan los extremos para que todas las secuencias
tengan la misma longitud.
4. Posteriormente se emplea el program a M E G A versin 4, en la opcin Phylogeny se selecciona el m todo estadstico N EIG H B O R JO IN IN G , el cual
es empleado en estudios de evolucin basados en tcnicas moleculares. Este
tiene la capacidad de m anejar un amplio conjunto de datos, por lo que es uno
de los pocos mtodos que permite la rpida inclusin de todas las secuencias
homologas en un solo rbol. En resumen este m todo utiliza una matriz de
distancias, la cual va agrupando en parejas segn la divergencia promedio
hasta llegar a una base.
5. Para evaluar la fidelidad del rbol filogentico construido, se emplea el test
de filogenias inferidas bootstrap , el cual crea un nm ero arbitrario de posi
bles dendogramas por medio de cambios puntuales en diferentes bases de las
secuencias y elige uno de consenso, as, en cada divergencia se muestra un
porcentaje el cual representa el nm ero de ramas que se han repetido del total
de rboles creados.

FIGURA 16.1 Alineacin de cepas de referencia y cepas en estudio para la creacin del dendograma. Se emple nuevamente el programa BioEdit para la alineacin de todas las secuencias en estu
dio corregidas y las secuencias de cepas tipo o de referencia para la construccin del dendograma.

50

IV. PRODUCCIN Y CONTROL DE CALIDAD


DE BIOFERTILIZANTES

17.

P ro d u c c i n de b iofertilizantes

18.

C o n tro l de ca lid ad del b io fertilizan te

19.

E n u m e ra c i n de bacterias sim biticas fijadoras de


n itr g en o p o r n m e ro m s probable

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

17. PRODUCCION DE BIOFERTILIZANTES


De acuerdo a las necesidades, se pueden producir inoculantes lquidos o en so
portes slidos. Estos soportes pueden ser o no esterilizados. El LEMYB M arino
Tabusso produce inoculantes en soportes slidos segn Orm eo y Ziga (1999a)
y recientemente inoculantes lquidos. La produccin del inoculante slido consta
de dos partes, la prim era incluye el incremento de biom asa celular del rhizobio
en un medio lquido de bajo costo (Ormeo y Ziga, 1998) y la segunda incluye
la preparacin del soporte slido y la respectiva incorporacin de la poblacin
bacteriana en este.
17.1. Produccin de biomasa del rhizobio

Reactivar la cepa correspondiente en el medio LMA

Sembrar 2 asadas en 100 m L de caldo LM A e incubar en agitacin a 100 rpm


a 28 C por 24 a 48 h (cepa rpida) o 72 - 98 h (cepa lenta). Debe alcanzar una
concentracin de 108 cel/m L aproximadamente (fase logartmica).

Tomar 1 - 5 mL del caldo anterior y sembrar en matraces de 1000 o 5000 mL


conteniendo el medio modificado segn Orm eo y Ziga (1998) e incubar
de la misma m anera que el paso anterior.

Com probar la pureza de la cepa (observacin al microscopio) y concentra


cin de las clulas por densidad ptica o nm ero de clulas viables (Figura
17.1).

17.2. Preparacin del soporte slido

Secar el sustrato (suelo, compost, entre otros) a 60C por 24 horas.


Tam izar el sustrato en malla de 2.25 mm.
M ezclar los sustratos en la proporcin 2:3 (compost: suelo) y homogenizar.
Colocar 250 g de la mezcla en bolsas de polietileno.
Esterilizar tres veces consecutivas la bolsa con el soporte a 121C y 15 Ib de
presin por 30 m in (modificado de Orm eo y Ziga (1999a).
Inocular el sustrato con el cultivo lquido de rhizobios (106 - 109 cel/m L).
Incubar a 28C por 6 - 8 das.
Usar inm ediatam ente o refrigerar hasta su uso (4 - 8C) (Figura 17.1).

Cantidad de inoculante
250 g

Cantidad de semilla
35 kg (semilla mediana: frijol)

53

Diluyente (agua)
600 mL

D O R IS E L IZ A B E TH Z 1G A D V ILA

Cepa de Rhizobium

Siem bra en
m edio lquido

Siem bra en
m ayor
volum en
Em pacado en bolsas
de 250 g

Esterilizar a 121 C x
30 min por dos das

108- 109 cei/mL,


agitacin

I
M aduracin a 28 C
por 7 das

I
Alm acenam iento a 4o C
por 3 a 6 m eses

agitacin

FIGURA 17.1. Produccin de biofertilizantes

54

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

17.3

Presentacin del biofertilizante

17.3.1. Preparacin de la ficha tcnica


Deben considerarse los siguientes puntos para la presentacin del fertilizante
1. Nom bre del producto: ECORIZO, inoculante para leguminosas de grano
2. Bondades: Las bacterias simbiticas fijadoras de nitrgeno interaccionan con
diversas leguminosas formando nodulos en las races y que son capaces de
transform ar el nitrgeno atmosfrico en amonio. Este nutriente es asimilado
directamente por la planta favoreciendo su crecimiento, rendimiento y cali
dad de grano. Este inoculante disminuye los costos de produccin, porque
reemplaza el uso de fertilizantes qumicos y disminuye la contam inacin del
ambiente.
3. Nom bre del cultivo sobre el cual puede aplicarse el producto: En este caso los
inoculantes son especficos para cada cultivo, por ejemplo: cultivo de pallar,
cultivo de frijol, cultivo de arveja holantao, cultivo de haba, cultivo de soya.
4. Lugar: Los inoculantes pueden ser especficos dependiendo de la zona de cul
tivo, as, pueden haber inoculantes especficos para el cultivo de pallar en la
regin de lea y otros para la regin de Barranca; de m anera similar existen
cepas para frijol en zonas de costa que difieren de zonas altoandinas.
5. Presentacin: inoculantes en soporte slido de 250 g y lquidos de 40 mL con
una concentracin de 108 clulas/g 108 clulas/m L respectivamente.
17.3.2. Etiquetado
Debe m encionar el lote, fecha de produccin y fecha de vencimiento

E C O R IZ O - I n o c u la n te s s a lu d a b le s p a r a c u ltiv o s L a b o r a to r io d e E c o lo g a
M ic r o b ia n a y B io te c n o lo g a M a r in o T a b u s s o - U N A L M
I N O C U L A N T E P A R A A R V E JA H O L A N T A O

^
.

'

P r e s e n ta c i n

F r a s c o x 4 0 m L , r in d e p a r a 3 0 k g d e s e m illa

C o n c e n tr a c i n d e r h iz o b io s

10s c el/ m L

A p lic a c i n

M e z c la r u n if o r m e m e n te el in o c u la n te c o n 2 0 0 g d e s u e lo y la s e m i
lla. D e ja r s e c a r p o r 30 m in u to s b a jo la s o m b r a . S e m b ra r.
C o n s e r v a r e n re fr ig e r a c i n h a s ta s u u s o . N o e x p o n e r las s e m illa s

P r e c a u c io n e s

tr a ta d a s al s o l n i a v ie n to s d e s e c a n te s . U tiliz a r t o d o el p r o d u c to e n
el m o m e n to . U s a r g u a n te s p a r a la a p lic a c i n .

L o te

003

F e c h a d e P r o d u c c i n

1 5 -0 1 -2 0 1 2

F e c h a d e V e n c im ie n to

1 5 -0 3 -2 0 1 2

DO RIS EL IZ A B E TH Z IG A D V ILA

18. CONTROL D E CALIDAD DEL BIOFERTILIZANTE


18.1 Recuento de clulas viables de bacterias fijadoras de nitrgeno
Se utiliz la metodologa segn Ormeo y Ziga (1999b).

Suspender 10 g del inoculante en un m atraz conteniendo 90 m L de diluyente:


solucin salina al 0.85% (dilucin I d 1). Agitar vigorosamente por dos m inu
tos.

Con una pipeta estril tom ar una alcuota de 1 mL de la suspensin anterior y


transferir a un tubo con 9 m L del diluyente (dilucin 10'2). Realizar diluciones
sucesivas, hasta llegar a la dilucin 10'8 (Figura 18.1).

Transferir a placas Petri, por duplicado, alcuotas de 1 mL de cada una de las


diluciones realizadas. Incorporar el medio de cultivo LM A temperado. Dejar
solidificar.

Incubar las placas a 28 C por 2-10 das.

Transcurrido el tiempo de incubacin, realizar el conteo de colonias en pla


cas que contengan entre 30 y 300 colonias

Esta tcnica puede utilizarse para el recuento de bacterias fijadoras de nitrgeno


de vida libre as como para bacterias prom otoras de crecimiento considerando el
medio de cultivo especfico para cada caso.
Tambin se puede utilizar la tcnica del nmero ms probable para cuantificar
bacterias simbiticas fijadoras de nitrgeno (Tema 19).
18.2. Capacidad infectiva y efectiva de los inoculantes en plntulas de legu
minosas
Este ensayo se realiza para com probar que el rhizobio en forma comercial (sopor
te slido) mantiene su capacidad de nodular la planta y de fijar nitrgeno.

Inocular 1 g del inoculante almacenado durante el periodo de un mes, a cada


plntula cultivada en tubos de ensayos segn Ormeo y Ziga (1999b). Fre
cuentemente se usan de 8 a 10 tubos. Paralelamente se instalan de 8 a 10
plntulas controles sin inocular.

Las plntulas son mantenidas por u n periodo de 30 das con un fotoperiodo


de 12 h de luz.

Cuidar el riego de dichas plntulas.

Evaluar la nodulacin semanalmente (infectividad) y la m ateria seca a la co


secha (efectividad) y com parar los resultados con el control sin inocular.

18.3 Recuento de microorganismos contaminantes del biofertilizante

Recuento de bacterias aerobias mesfilas viables (descrito en el Tema 21.1)

"

Recuento de hongos totales (descrito en el Tema 22)

Recuento de actinomicetos (descrito en el Tema 23)

18.4 Anlisis fsico-qumico

Determ inacin de la hum edad, tem peratura y conductividad elctrica del


inoculante.

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

Inoculante
10 g

10"'

1 mL

Tubos con 9 mL
S.S. 0.85%

10

10

1 mL
r

10-4 ...
1 mL

i'

1 mL
ir

Incorporar
medio LMA

Incubar a 28 C por 2 -10 das

1
Elegir las placas con 30 - 300 colonias
y realizar el conteo

FIGURA 18.1. Control de calidad de biofertilizantes

57

1(T
1 mL
i

DO K IS ELIZA B ETH Z IG A D V ILA

19. ENUMERACIN DE BACTERIAS SIMBIOTICAS FIJADORAS DE


NITRGENO POR NMERO MS PROBABLE
Este m todo se emplea de acuerdo a Somasegaran y Hoben (1985).

Tomar 10 g de suelo o del inoculante y agregar a un m atraz con 90 mL de


solucin salina al 0.85% (diluyente). Agitar vigorosamente por dos minutos
(dilucin 10'), con una pipeta estril tom ar 1 m L de la suspensin y transfe
rir a un tubo con 9 m L de solucin salina al 0.85% (ducin 10'2) y as suce
sivamente hasta llegar a la dilucin 10'5.

Tomar 1 mL cada una de las diluciones e inocular a cada uno de los cuatro
tubos que contienen plantas de trbol blanco (Trifolium repens) de una semana
de crecimiento (Figura 19.1).

Incubar las plantas en la cm ara de crecimiento a 18 - 22 C por 4 semanas.

Luego de cuatro semanas evaluar la presencia o ausencia de nodulos en la


raz y utilizar la tabla de N m ero M s Probable (NMP) para la cuantificacin
(Anexo N 3, Tabla A .3.4).

58

m a n u a l d e m ic r o b io l o g a a g r c o l a r h iz o b iu m , pgprs , in d ic a d o r e s d e f e r t il id a d e in o c u id a d

Suelo
10 g
1

'

l
\
10-1

90 mL
S.S.0.85%

1 mL
1 mL

1 mL

Tubos con 9
mL S.S. 0.85%
10r3

1 0':

1 mL

10'4

1 mL

...

10'5

1 mL

Inocular cada dilucin en cuatro tubos con plntulas

u
i

Incubar a 22 - 24C

p o r 2 8 d a s

t
Evaluar la presencia de nodulos cada 7 das y
contar el nmero de plantas noduladas

i
Expresar los resultados en

N M P /g

FIGURA 19.1 Cuantificacin de Rhizobium por numero ms p ro b a b le .

59

1 1 mL

V. INDICADORES DE LA FERTILIDAD
BIOLOGICA DEL SUELO
20. Preparacin de muestras y diluciones
21. Recuento de bacterias
22. Recuento de hongos totales
23. Recuento de bacterias anaerobias mesfilas
24. Enumeracin de bacterias fijadoras de nitrgeno de vida libre
26. Actividad microbiana

INTRODUCCIN
l componente microbiolgico del suelo puede ser til como indicador del
estado general del suelo, pues una buena actividad microbiana, es reflejo
de condiciones fisicoqumicas ptimas para el desarrollo de procesos metablicos de microorganismos (bacterias, hongos y actinomicetos) que actan
sobre sustratos orgnicos y cultivos asociados.

Para evaluar la calidad del compost como inoculante, tambin se tom a en cuenta
el factor microbiano. El compost term inado debe contener al menos 108 U F C /g
de peso seco de bacterias aerobias y estar en relacin 10:1o mayor a las bacterias
anaerobias. Adems, la carga de mohos y levaduras debe estar en 103-104 U F C /g
y la de actinomicetos entre 106-108 U F C /g. U n compost de mala calidad puede
estar asociado a inm adurez del procesamiento y puede inhibir la germinacin de
semillas o causar una rpida disminucin del nitrgeno del suelo.
Por otro lado, la medicin de C 0 2 producido es una estimacin de la actividad y
por tanto de la presencia microbiana. Tal actividad vara en funcin de muchos
factores, como el uso del suelo, mineraloga, cobertura vegetal, prcticas de m ane
jo, calidad de los residuos que entran al sistema, factores ambientales, entre otros.
De esta m anera podem os afirmar que la actividad m icrobiana nos da idea de la
biota del suelo y puede ser un parm etro til para la medicin de su fertilidad.

63

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

20. PREPARACIN DE MUESTRAS Y DILUCIONES


20.1. Diluyente
M uchos diluyentes pueden ser utilizados, como el agua destilada, la solucin sali
na al 0.85 %, agua tam ponada, entre otros. Un diluyente de uso general es el agua
peptonada al 0.1 %.

Agua tam ponada

Disolver 34 g K H 2P 0 4 / L de agua destilada.


pH 7.2 0. 5.
Aadir 1.5 mL de esta solucin y 5 m L de una solucin de
MgCl2 (81.1 g de MgCl2.6H20 / l L ) en 1 L de agua.

Agua peptonada

1 g de peptona/ 1 L de agua destilada

N o deben suspenderse las bacterias en el diluyente por ms de 30 m in a tempera


tura ambiente ya que puede producir la muerte o la multiplicacin de las mismas.
20.2 Mtodo
La tcnica empleada va de acuerdo al Standard M ethods (1998)
*

Antes de proceder al estudio rotular cada tubo con el nmero de dilucin


correspondiente.
Pesar 10 g de muestra slida 10 mL de muestras lquidas y adicionarlo a 90
m L del diluyente, as se obtiene una dilucin 1 0 1 (Figura 20.1).
M ezclar cuidadosamente las muestras m ediante unos 25 movimientos com
pletos de arriba a abajo (y de delante a atrs). Tambin se puede utilizar un
agitador mecnico.
Tomar 1 mL de la dilucin 10'1y adicionarlo en u n tubo que contiene 9 mL
del diluyente, obtenindose una dilucin de 10 u Homogenizar.
Repetir el paso anterior hasta la dilucin conveniente de acuerdo a la muestra.
Nota: Al extraer la muestra, las pipetas no se introducen ms de 2.5 cm por deba
jo del nivel de la superficie de la dilucin.
1 mL

Muestra

10'1

1 mL

10'2

FIGURA 20.1. Preparacin de muestras y diluciones

65

103

DORIS ELIZABETH ZIGA DVILA

21.

RECUENTO DE BACTERIAS

21.1 RECUENTO DE BACTERIAS AEROBIAS MESOFILAS VIABLES


El procedimiento empleado (APHA, 1992), se realiza para la estimacin de bacte
rias mesfilas en muestras de suelo, humus, bioles, compost y otros relacionados.

Pesar 10 g de suelo y se agregar a un m atraz con 90 m L de solucin salina


al 0.85% (diluyente). Agitar vigorosamente por dos minutos (dilucin 104).

Con una pipeta estril, tom ar lm L de la suspensin y transferir a un tubo


con 9 mL de solucin salina al 0.85% (dilucin 10'2) y as sucesivamente hasta
llegar a la dilucin 106.

Transferir alcuotas de 1 mL de las diluciones realizadas a placas Petri est


riles (dos placas por dilucin) e incorporar el medio de cultivo Pate Count.
Homogenizar.

Incubar a 28 C por 48 h.

Hacer el recuento de colonias en placas que contengan entre 30 - 300 colonias.

Expresar los resultados en U F C /g de suelo seco (Figura 21.1)

21.2 RECUENTO DE HETERTROFOS


El Standard M ethods (2000) considera el m todo Pour pate (9215B), en la
estimacin del nm ero de bacterias heterotrficas viables en agua, tratamientos
de agua y aguas de piscina.

M edir 10 mL de muestra y agregar a un m atraz con 90 m L de agua peptonada 0.1% (diluyente). Hom ogenizar (dilucin 104).

Con una pipeta estril, tom ar lm L de la suspensin y transferir a un tubo


con 9 mL de solucin salina al 0.85% (dilucin 10 z) y as sucesivamente hasta
alcanzar el nm ero de diluciones necesarias.

Transferir alcuotas de 1 m L de las diluciones realizadas a placas Petri estri


les (dos placas por ducin). De ser conveniente, de acuerdo a la naturaleza
de la muestra, sembrar por duplicado, 1 m L de la muestra original.

Incorporar el medio de cultivo Pate Count. Homogenizar.

Incubar a 35 C por 48 h.

Hacer el recuento de colonias en placas que contengan entre 30-300 colonias.

Expresar los resultados en U F C /m L (Figura 21.2).

66

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

Muestra
10 g

1 mL

10-1

1 mL

1 mL

9 mL

9 mL

SS 0.85%

SS 0.85%

10-2
1 mL

10-3

9 mL
SS 0.85%

10-4

1 mL

1 mL

...

9 mL
SS 0.85%

10-6
1 mL

'

Incorporar agar pate count

1
Incubar a 28 C por 48 h

1
Elegir las placas que contengan entre 30 - 300 colonias

Expresin de resultados: UFC/g suelo seco

FIGURA 21.1. Recuento de bacterias aerobias mesfilas viables

67

D O RIS ELIZA B ETH ZTIGA D V ILA

10 mL

1 mL

1 mL

1 mL

1 mL
i

1 mL
r

1 mL
' r

Incorporar Agar Pate Count

i
Incubar a 35C por 48 h

i
Elegir las placas que contengan entre 30 - 300 colonias

i
Expresin de Resultados: UFC/mL

FIGURA 21.2. Recuento de hetertrofos

68

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

22.

RECUENTO DE HONGOS TOTALES

Se aplica la metodologa recom endada por M erck (1994).

Pesar 10 g de suelo y colocarlo en un m atraz con 90 mL de solucin salina


al 0.85 % (diluyente). Agitar vigorosamente por dos minutos (dilucin 1 0 1).

Con una pipeta estril tom ar 1 m L de la suspensin y transferir a un tubo


con 9 mL de solucin salina al 0.85% (dilucin 10'2) y as sucesivamente hasta
llegar a la dilucin 10'5.

Transferir alcuotas de lm L de las diluciones realizadas a placas Petri est


riles (dos placas por dilucin) e incorporar el medio de cultivo Czapeck o
papa-dextrosa-agar (PDA). Para inhibir la poblacin bacteriana se recomien
da bajar el pH del medio a 4 adicionar 30 m g / L de estreptomicina.

Incubar a 22 C por 3 - 5 das.

Hacer el conteo de colonias en las placas que contengan entre 8 - 8 0 colonias.

Expresar los resultados en U F C /g de suelo seco (Figura 21.1)

ii

it

ii

ii

ii

|i

i|

Incorporar agar - papa - dextrosa (APD)

i
Incubar a 22 C por 3-5 das

4
Elegir las placas que contengan entre 8 - 8 0 colonias

4
Expresin de resultados: UFC/g suelo seco

FIGURA 22.1. Recuento de hongos totales

69

D O RIS BLIZA BETH Z IG A DVILA

23.

RECUENTO DE BACTERIAS ANAEROBIAS MESFILAS

M erck (1994), recomienda la siguiente metodologa para el recuento de bacterias


anaerobias meslas:

*
*

Pesar 10 g de la m uestra y diluir con agua peptona, agitar por 2 min. Realizar
diluciones hasta 10'3.
Transferir 1 m L de cada dilucin por duplicado, adicionar agar triptona sulfito neom icina (TSN) y homogenizar.
Dejar solidificar. Invertir las placas e introducirlas en una jarra de anaerobiosis.
Incubar a 35 C durante 24 horas.
Hacer el conteo de colonias en placas que contengan de 30 - 300 colonias.
Expresar los resultados como U F C /g de suelo seco (Figura 23.1).

9 mL
A P 0 .1%

1 mL

'i.

....

ii

ii

ii

ii

In c o rp o ra r m e d io T S N

In c u b a r en ja rra de a n a e ro b io s is a 35 1 C p o r 2 4 h

I
R e a liza r el c o n te o en p la ca s q ue co n te n g a n e n tre 30 3 00 c o lo n ia s

i
E xp re si n de R e su lta d o s: U F C /g su e lo seco

FIGURA 23.1. Recuento de bacterias anaerobias mesfilas


70

MANUAL DE MICROBIOLOGA AGRICOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

24.

RECUENTO DE ACTINOMICETOS

Se sigue el m todo descrito en APHA-AWWA-WEF (1998)

Pesar 10 g de la muestra y diluir con agua peptona, agitar por 2 min. Realizar
diluciones hasta 10'5.
Transferir 1 m L de cada dilucin por duplicado, adicionar 18 mL de agar
alm idn - casena y homogenizar.
Sembrar por incorporacin usando 1 mL de las diluciones -2 hasta -5 con
agar alm idn - casena suplementado con fluconazol al 0.25 % para inhibir el
crecimiento de hongos.
Incubar a 28 C por 6 - 7 das.
Hacer el conteo de colonias en placas que contengan de 30 - 300 colonias.
Reportar como U F C /gram o de suelo seco (Figura 24.1).

Muestra

Incorporar agar almidn - casena suplementado con fluconazol 0.25 %

I
Incubar a 28 C por 6 - 7 das

Elegir las placas que contengan entre 30 - 300 colonias

i
Expresin de resultados: UFC/g suelo seco

FIGURA 24.1. Recuento de actinomicetos

71

D O RIS ELIZA B ETH /. IG A DVILA

25. ENUMERACIN DE BACTERIAS FIJADORAS DE NITRGENO


DE VIDA LIBRE
Recuento de Azotobacter sp.
*

Tomar 10 g de suelo de rizsfera y agregar en un m atraz con 90 mL de solu


cin salina 0.85 %. Agitar vigorosamente .
Se debe colocar lm L de las diluciones -2 hasta -4 en tubos que contienen cal
do sin nitrgeno (Zapater, 1975). Se consideran 3 tubos por dilucin.
Se incuba a 28C por 7 -10 das (Figura 25.1).
Se realiza el conteo de los tubos positivos de cada una de las diluciones ob
servando viraje de color, turbidez y la formacin de un velo en la superficie
del caldo, se expresa este conteo en N M P /g (gramo de rizsfera seca) (Anexo
N 3, Tabla A .3.1)

Suelo

Tubos con 9 mL
AP 0.1 %

1 mL /tb

1 mL /tb

.
|

1 mL /tb

10 mL caldo mineral
sin nitrgeno - ABT

Incubar a 28 + 1 C por 7 - 10 das

1
Viraie de color a amarillo se reoorta como positivos

i
Leer los tubos positivos y consultar la tabla de NMP
para reportar el resultado final
FIGURA 25.1. Enumeracin de bacterias fijadoras de nitrgeno de vida libre

72

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

26. ACTIVIDAD MICROBIANA


Pre - tratamiento de la Muestra
El suelo colectado debe ser gentilmente aireado, hasta alcanzar una hum edad
conveniente para el tamizado. Se procede al retiro de todo material o residuo
vegetal de la porcin de suelo obtenida.
Se realiza el tam izado del suelo a un tam ao m xim o de partcula de 500 gm y se
almacena en frascos de vidrio a tem peratura ambiente hasta el anlisis respectivo.
U na porcin de suelo es separada para ensayar el contenido de hum edad gravimtrica.
26.1. Determinacin de la respiracin de los microorganismos del suelo
Este ensayo se realiza de acuerdo a la metodologa de Anderson (1982).

Los sistemas a instalar consisten en un recipiente plstico de 250 g de capaci


dad, con 25 g de suelo tam izado (peso hmedo).

A cada sistema, se aade 0.5 mL de solucin de glucosa al 25%. M ezclar

Se introduce un pequeo vial conteniendo 3.5 mL de solucin N aO H 1N,


inmediatamente se cierra el sistema y se sella con cinta parafilm.

Del mismo m odo se instala un recipiente vaco que sirve como blanco.

Los sistemas, junto con el blanco, se incuban a 28C por 24 horas.

Cumplido el periodo de incubacin, se retira el vial del sistema colector y se


trasvasa su contenido y el de su agua de enjuague (agua destilada) hacia un
m atraz de 250 mL de capacidad.

Aadir 3.5 mL de BaCl2y el N aO H no combinado es titulado con HC10.25N


en presencia de fenolftalena (Figura 26.1).

Calcular los resultados:

Vol. N aO H convertido en N a ,C 0 3 (mL) = gasto HC1 blanco (mL) - gasto


HC1 sistema (mL)

C 0 2 (mg) = Vol. N aO H convertido en N a2C 0 3 (mL) x N HC1 x 22

Donde:
N: norm alidad del HC1
26.2. Determinacin de la actividad deshidrogenasa de los microorganismos
del suelo
La actividad deshidrogenasa en suelos, se determ ina por reduccin de sales tetrazolium, su extraccin y cuantificacin espectrofotomtrica de acuerdo al m todo
descrito por Casida (1977) y modificado para la presente obra (Ramos y Ziga,
2007).

Se tom an 10 g de suelo tam izado (peso hmedo), que son mezclados con 0.1
g de carbonato de calcio, C a C 0 3.

De esta mezcla se pesan 2 g en frascos estriles color m bar con cierre her
mtico.
73

D O R IS EL IZ A B E TH Z IG A D V ILA

Pesar 25g de suelo tamizado

Adicionar 0.5mL de
sol. glucosa 25%

i
Incubar a 28C por 24 horas

i
Trasvasar el contenido del vial a un matraz

Adicionar 3.5mL
de BaCI2 +
fenoftalena

Titular el NaOH no combinado (hasta el viraje


de rosa grosella a blanco)

i
Calcular la tasa de C 0 2 producido: mg C 0 2/g*h
FIGURA 26.1. Respiracin de los microorganismos del suelo

Para la instalacin del ensayo, se aade 1 m L de solucin de extracto de


levadura al 0.1% esterilizada por autoclavado y 1 mL de solucin de cloruro
de trifenil tetrazolium (TTC) al 3% esterilizada por filtracin a cada uno de
los sistemas; excepto para el suelo blanco, al cual se aade 1 m L de agua
destilada estril en lugar de adicionarle la solucin de TTC. Homogeneizar.

Cerrar los frascos y sellar con cinta parafilm.

Los sistemas son incubados a 37 1 C por 24 h.

Cumplido el periodo de incubacin, se extrae el trifenil form azn formado


74

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS. INDICADORES DE FERTILIDAD E INOCUIDAD

como producto de la reduccin microbiana. Se aaden 12 mL de etanol ab


soluto a cada frasco instalado. Se agita vigorosamente de m anera constante
por espacio de 5 minutos.

El sobrenadante es separado del suelo por filtracin al vaco.

Se efecta la lectura al espectrofotmetro de la solucin obtenida contra el


sobrenadante del blanco, a una longitud de onda de 485 nm (Figura 26.1).

El contenido de la sal reducida es cuantificado con la ayuda de una curva de


calibracin de formazn, en pg de form azn/ g suelo seco/ 24h.
20 g suelo tamizado + 0.2 g CaC03

i
Pesar 2 g

Muestra

+ 1 mL extracto de levadura 0.1 %

+ 1 mL agua

+ 1 mL TTC 3 %

Incubar a 37 1C / 24 horas

i
Aadir 12 mL de etanol absoluto y
agitar vigorosamente por 5min
Filtrar al vacio

i
Leer al espectrofotmetro a 485 nm

i
Cuantificar la cantidad de formazn haciendo uso
de una curva de calibracin

i
pg de formazn/ g suelo seco/ 24h
FIGURA 26.2. Determinacin de la actividad microbiana de los microorganismos del suelo

75

VI. INDICADORES DE INOCUIDAD DE


AGUA Y SUELO
27. Enumeracin de coliformes totales
28. Enumeracin de coliformes fecales
29. Enumeracin de E sch erich ia
30. Determinacin de

co li

S a lm o n ella

sp.

INTRODUCCIN
as pruebas de inocuidad en suelo y agua son ensayos que se realizan para
la determ inacin del estado sanitario de muestras de suelo, compost, bioles, agua y otros, para m inim izar los riesgos para la salud hum ana durante
su manejo para la produccin de cultivos.

Tradicionalmente se considera que los microorganismos coliformes y Salmonella,


son indicadores de contam inacin en el control de calidad de agua y suelo. Su
presencia es relevante desde el punto de vista de aporte de contam inacin a los
alimentos que crecen bajo y al ras del suelo y que son consumidos crudos y que
pueden originar enfermedades e infecciones gastrointestinales.
En nuestro pas, dentro del sistema agrcola de riego, es com n la utilizacin de
efluentes tratados y aguas residuales. Estos suelen aportar u na alta carga micro
biana. As mismo, el uso inadecuado de abonos y compost puede contam inar el
suelo. El riesgo sanitaro se encuentra latente y existe la necesidad de norm ar los
lmites permisibles para cada caso. Por decreto supremo N 002-2008-MINAM
se estableci como parm etros biolgicos de agua para riego de vegetales de tallo
bajo, la tolerancia no m ayor de 5 x 103 N M P /1 0 0 m L de coliform es totales y
1 x 103N M P /100 mL de fecales, as como la ausencia de Salmonella. En tanto que
el riego de vegetales de tallo alto admite hasta 2 x 103 N M P /100 mL coliformes
fecales y las mismas especificaciones para los otros parmetros.

79

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

27.

ENUMERACIN DE COLIFORMES TOTALES

27.1.

Enumeracin de coliformes totales (ICMSF, 2000)

La metodologa para la determinacin de los coliformes totales en muestras slidas


se realiza por la tcnica del nmero ms probable (NMP) - mtodo norteamericano.

Preparar la muestra como lo descrito en el Tema 20, Preparacin de muestras.


Pipetear 1 mL de cada una de las diluciones en tubos de caldo lauril sulfato
triptosa, utilizando tres tubos para cada dilucin.
Incubar los tubos a 35 - 37 C durante 24 y 48 horas.
Pasadas las 24 primeras horas, anotar los tubos que muestren produccin de gas.
Volver a la estufa los tubos negativos para su incubacin durante 24 horas ms.
Pasadas las 48 horas, anotar los tubos que muestren produccin de gas
Confirmar que los tubos de caldo lauril sulfato seleccionados en el paso ante
rior son positivos de organismos Coliformes, transfiriendo una asada de cada
tubo a otro de caldo lactosa bilis (2%) verde brillante.
Incubar durante 24-48 horas a 36 + 1C y observar la produccin de gas. La
formacin de gas confirma la presencia de coliformes (Figura 27.1).
Para determ inar el nm ero de microorganismos, consultar la Tabla del N M P
(Anexo N 3, Tabla A .3.1) y reportar como N M P /g.

Expresin de Resultados
Elegir la dilucin ms alta en la que sean positivos de formacin de gas los tres
tubos de una dilucin y tom ar en cuenta las diluciones superiores ms prximas.
Por ejemplo:
N de tubos positivos
Ejemplo
1
2
3
4

-1

-2

-3

-4

3/3
0/3
2/3
3/3

3/3
0/3
2 /3
3/3

1/3
0/3
1/3
3/3

0/3
0/3
1/3
3/3

Para la lectura en la tabla del Nm ero M s Probable, se tom aran las siguientes
combinaciones de tubos positivos:
Ejemplo
1
2
3
4

Combinacin
de positivos
3:1:0
0:0:0
2:1:1
3:3:3

Clave N M P
40
<3
20
1 100

N M P /g mL
400
<3
200
11 000

Calcular el N M P de organismos coliformes por gramo o mililitro de muestra,


para ello se multiplica el valor de la tabla por el factor de dilucin que le antecede.
En el ejemplo 1 : 40 x 10 = 400 N M P / g mL.

81

DORIS ELIZABETH ZIGA DVILA

Suelo

10 mL caldo lauril simple

i
Incubar a 36 + 1 C por 24 - 48 h

'i
Seleccionar los tubos positivos (presencia de gas) y transferir
una asada a caldo lactosa bilis (2%) verde brillante

II
|

10 mL caldo lactosa bilis (2 %) verde brillante

Incubar a 36 + 1 C por 24 - 48 h

I
Leer los tubos positivos y consultar la tabla de NMP
para reportar el resultado final
FIGURA 27.1. Enumeracin de coliformes totales (ICMSF, 2000)

82

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

27.2. Enumeracin de Coliformes Totales (Standard Methods, 1998)


La metodologa de Standard M ethods (1998), es aplicado a muestras lquidas.

Preparar la muestra como lo descrito en el Tema 20, Preparacin de muestras.

Pipetear 1 m L de cada una de las diluciones en tubos de caldo lauril sulfato


triptosa, utilizando cinco tubos para cada dilucin.

Para agua potable utilizar 10 tubos con caldo lauril sulfato triptosa a doble
concentracin y agregarle 10 mL de la muestra.

Si se trata de agua no potable, usar 5 tubos por dilucin, empezando con 5


tubos de caldo lauril sulfato triptosa de doble concentracin (10, 1, 0.1, 0.01
mL, etc.).

Incubar los tubos a 35 0.5 C durante 24 y 48 horas.

"

Pasadas las 24 primeras horas, anotar los tubos que muestren produccin
de gas. Volver a la estufa los tubos negativos para su incubacin durante 24
horas ms.

Pasadas las 48 horas, anotar los tubos que muestren produccin de gas.

Confirmar que los tubos de caldo lauril sulfato seleccionados en su lugar son
positivos de organismos coliformes, transfiriendo una asada de cada tubo a
otro de caldo lactosa bilis (2%) verde brillante (Figura 27.2).

Incubar durante 24 - 48 horas a 35 0.5 C y observar la produccin de gas.


La formacin de gas confirma la presencia de Coliformes.

Para establecer definitivamente la existencia de bacterias coliformes, realizar


la prueba completa en el 10% de tubos positivos, sembrndolos en agar Me
Conkey Endo Les.

Para determinar el nm ero de microorganismos, consultar la tabla de N M P


(Anexo N 3 Tabla A .3.2)

Expresin de Resultados

La tabla 9221IV indica los valores de N M P para combinaciones de 5 tubos


(10, 1, 0.1 mL). En caso de que las series decimales sean distintas hacer el
siguiente clculo:
NMP/100mL = valor de NMP (tabla) x ( --------------- --------------^ mayor volumen estudiado

Cuando se utilicen ms de tres diluciones en series de diluciones decimales,


slo se tom arn los resultados de tres de ellas para calcular el NMP. Para
seleccionar las tres diluciones a utilizar en la determinacin del ndice del
NMP, eljase la dilucin ms alta con resultado positivo entre las cincos estu
diadas (no hay ninguna dilucin m enor que haya dado un resultado negativo)
y las dos siguientes diluciones ms altas. Para calcular el ndice del NMP,
utilcense los resultados de estos tres volmenes.

83

DORIS ELIZABETH ZIGA DVILA

E je m p lo

1 mL

0 .1 m L

0 .0 1 m L

0 .0 0 1 m L

a
b
c

5/5
5/5
0/5

5/5
4/5
1/5

2/5
2/5
0/5

0/5
0/5
0/5

C o m b in a c i n d e

n d ic e

p o s itiv o s

N M P /lO O m L

5-2-0
5-4-2

5.000
2.200
20

0 -1 -0

E n los ejemplos siguientes, el num erador representa los tubos positivos, y el


denominador, el total de tubos estudiados; la combinacin de positivos indica
nicam ente el nm ero total de tubos positivos por dilucin.

E n el ejemplo c, seleccinese las primeras tres diluciones, de m anera que se


incluya el resultado positivo en la dilucin media.

Cuando se presenta un caso como ejemplificado en la lnea d, en que una di


lucin muestra un positivo mayor que las tres elegidas segn la regla general,
el resultado se incorporar a la mayor de las diluciones elegidas; se genera
entonces una com binacin como la del Ejemplo e:

E je m p lo

d
e

1mL

5 /5
5 /5

0 .1 m L

3/5
3/5

0 .0 0 1 m L

0 .0 1 m L

1/5
0/5

1/5
2 /5

84

C o m b in a c i n d e

n d ic e

p o s itiv o s

N M P /1 0 0 m L

5-3-2
5-3-2

1.400
1.400

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

10 mL

m
i ,
Muestra
original

10 mL /tb

10

10'

90 mL
AP 0.1%

Ctst

1 mL /tb

1 mL /tb

MI

lili

10 mL caldo lauril simple

10 mL caldo lauril doble

Incubar a 35 + 0.5 C por 24 - 48 h

" i
Seleccionar los tubos positivos (presencia de gas)

iii

10 mL caldo lactosa bilis (2%) verde brillante

1
Incubar a 35 + 0.5 C por 24 - 48 h

Leer los tubos positivos y consultar la tabla de NMP


para reportar el resultado final

FIGURA 27.2. Enumeracin de coliformes totales (Standard Methods, 1998)

85

DORIS ELIZABETH ZIGA DVILA

28.

ENUMERACIN DE COLIFORMES FECALES

28.1.

Enumeracin de coliformes fecales (ICMSF, 2000)

La metodologa para la determinacin de los coliformes fecales se realiza por la


tcnica del N M P y las siembras se hacen a partir de los tubos de caldo lauril sul
fato triptosa gas positivo. Este m todo se aplica a muestras slidas.

Tomar los tubos de caldo lauril sulfato triptosa gas positivo, presuntivas de
crecimiento coliforme.

Transferir una asada de cada tubo a otro de caldo E. coli.

Incubar los tubos de caldo E. coli a 44.5 + 0.2C y ver si son positivos (forma
cin de gas) a las 24 y 48 horas.

Se presume que los tubos de caldo E. coli que presenten gas son tam bin posi
tivos de organismos Coliformes de origen fecal (Figura 28.1).

Para determ inar el nm ero de microorganismos, entrar a la tabla del N M P


(Anexo N 3, Tabla A .3.1).

Expresin de Resultados
Similar a la expresin de coliformes totales (ICMSF, 2000).

86

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

1 mL

Tubos con 9 mL
AP 0.1%

10"
1 mL /tb

10-

10'2
|

1 mL/tb

1 mL /tb

i9 lll

10 mL Caldo Lauril Simple

1
Incubar a 36 + 1C por 24 - 48 horas

" i
Seleccionar los tubos positivos (presencia de gas) y transferir
una asada a caldo EC

919 99!
10 mL Caldo EC

i
Incubar a 44.5 + 0.2 C por 24 - 48 horas

i
Leer los tubos positivos y consultar la Tabla de NMP
para reportar el resultado final

FIGURA 28.1. Enumeracin de coliformes fecales (ICMSF, 2000)

87

DORIS ELIZABETH ZIGA DVTLA

28.2.

Enumeracin de coliformes fecales (Standard Methods, 1998)

Este mtodo se emplea para muestras de agua.

Tomar los tubos de caldo lauril sulfato triptosa gas positivo, procedentes de
las presuntivas de coliformes.

Transferir una asada de cada tubo de laur a otro de caldo EC

Incubar los tubos de caldo EC a 44.5 + 0.2C y observar si dan positivo (for
macin de gas) a las 24 y 48 horas (Figura 28.2).

Se presume que los tubos de caldo EC que presenten gas son positivos de
organismos coliformes de origen fecal.

Para determinar el nm ero de microorganismos coliformes fecales, consultar


la tabla de N M P (Anexo N 3, tabla A.3.2).

Expresin de Resultados
Similar a lo aplicado en coliformes totales (Standard Methods, 1998).

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS. INDICADORES DE FERTILIDAD E INOCUIDAD

10 mL

Muestra
original

90 mL
AP 0.1 %

10 m L/tb

1 mL /tb

10 mL caldo lauril doble

10'1

1 mL /tb

10 mL caldo lauril simple

Incubar a 35 + 0.5 C por 24 - 48 h

I
Seleccionar los tubos positivos (presencia de gas)

Transferir una asada de los tubos positivos a Caldo EC

10 mL Caldo EC

1
Incubar a 44,5 + 0.2 C por 24 - 48 h

I
Leer los tubos positivos y consultar la tabla de NMP
para reportar el resultado final

FIGURA 28.2. Enumeracin de coliformes fecales (Standard Methods, 1998)

89

DORIS ELIZABETH ZIGA DVILA

29. ENUM ERACIN DE Escherichia coli


La metodologa para la num eracin de E. coli (ICMSF, 2000), se realiza a partir
de los tubos de caldo EC positivos, aislando en Agar EMB y realizando luego las
pruebas bioqumicas IMVIC (indol, rojo de metilo, Voges - Proskauer y citrato de
Simmons) a las colonias sospechosas.
29.1. Tcnica para el aislamiento y purificacin de cultivos

Sembrar por estras una asada de cada tubo de caldo EC positivo con gas, en
placas de agar EMB o EN D O e Incubar por 2 4 h a 3 5 - 3 7 C (Figura 28.1).

Tomar una colonia representativa (nucleada con o sin brillo metlico) de cada
placa y sembrarla por estras en una placa de agar nutritivo. Incubar la placa
invertida durante 24 horas a 35 - 37 C.
Seleccionar colonias individuales y sembrar una asada en agar nutritivo incli
nado y en caldo lactosado. Incubar los cultivos durante 24 horas a 35 - 37 C.
A partir de los tubos con gas positivo en Caldo Lactosado, hacer una exten
sin y teir por el m todo de Gram para confirmar la presencia de bacilos
G ram negativos no esporulados.
Para inocular los medios IMVIC que se m encionan a continuacin, utilizar
un asa de Kolle y hacer siembras a partir de cultivos de 24 horas en agar nu
tritivo inclinado.

29.2. Tcnica para la prueba de indol

Inocular tubos de caldo triptona a partir de cultivos puros e incubar los tubos
sembrados a 35 - 37 C durante 24 horas (Figura 29.1)

A adir a cada tubo 0.2 - 0.3 mL del reactivo de Kovacs y agitar.


Esperar 10 minutos y observar los resultados. Si aparece un color rojo oscuro
en la superficie de la capa de alcohol amlico, la prueba es positiva. U n co
lor naranja indica la presencia posible de escatol y puede ser anotado como
reaccin negativa.

29.3. Tcnica para la prueba del rojo de metilo

Incubar tubos de caldo glucosa (M R - VP) a partir de cultivos puros e incubar


los tubos sembrados a 35 - 37 C durante 5 das (Figura 29.1).

Pipetear 5 mL de cada cultivo en tubos vacos y aadir a cada tubo 5 gotas de


la solucin de rojo de metilo (0.03 %). Agitar.
A notar como positivo si aparece un color rojo bien definido y como negativo
si el color es amarillo. Colores intermedios indican reaccin dudosa.

29.4. Tcnica para la prueba de Voges-Proskauer

Inocular tubos de caldo glucosa a partir de cultivos puros e incubarlos a 35 37 C durante 48 h (Figura 29.1).

Pipetear 1 mL de cada cultivo en tubos vacos y aadir a cada uno de ellos 0.6
mL de la solucin de a-naftol y 0.2 mL de la solucin de hidrxido potsico
al 40%.
Agitar los tubos y dejarlos en reposo durante 2 - 4 h. Observar los resultados.
La aparicin en la mezcla de un color carmes se anota como prueba positiva.

90

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

29.5. Tcnica para la prueba del citrato sdico

Inocular tubos de agar citrato de Simmons inclinado a partir de cultivos pu


ros, sembrar por picadura en la columna de agar y por estra en la superficie
inclinada (Figura 29.1).
Incubar el agar citrato de Simmons a 35 - 37 C durante 48 h.
A notar reaccin positiva si el crecimiento es visible y como negativa cuando
no lo es. El crecimiento se manifiesta, generalmente, por el cambio de color
verde claro del medio al color azul.

Expresin de resultados
Similar a la expresin de coliformes fecales.

Caldo EC positivo

A is la r co lo n ia s y p u rifica r

Colonia sospechosa de E. coli

Caldo Triptona

Caldo MR - VP
_______ I

Agar citrato
de Simmons

In c u b a r 2 4h a
3 5 -3 7 C

In c u b a r 5 d a s a
3 5 -3 7 C

A d ic io n a r
re a c tiv o de
K o va cs

A d ic io n a r sol.
rojo de m etilo
0 .0 3%

In cu b a r 48 h a
3 5 -3 7 C

In c u b a r 4 8 h a
3 5 -3 7 C

A 1 m L d e cultivo ,
a d ic io n a r 0 .6 mL
a -n a fto l + 0.2 mL
KO H 40 %
N e g a tivo : no hay
ca m b io de co lo r

P o s itiv o : fo rm a c i n
de un a n illo rojo

P o sitivo : c o lo ra ci n
roja

N e g a tivo : no hay
ca m b io de co lo r

Reacciones tpicas de E. c o li

i
Los tu b o s de EC q u e co n firm a n la p re se n cia de E. c o li son p o s itiv o s y se
le e n en la ta b la d e N M P p a ra re p o rta r el re su lta d o fin a l

FIGURA 29.1. Enumeracin de Escherichia coli

91

DORIS ELIZABETH ZIGA DVILA

30. DETERMINACIN DE Salmonella sp.


Todas las Salmonelas son consideradas como patgenas para el hombre. La nica
va de entrada de estos microorganismos en el cuerpo hum ano es la oral, por lo
que es de suma importancia su determinacin. Para su estudio la ICM SF (2000)
considera 5 etapas:
30.1. Enriquecimiento no selectivo de Salmonelas

M ezclar la muestra con 9 volmenes del medio de enriquecimiento escogido


- agua de peptona tam ponada, en proporcin peso/volum en.

Incubar el medio de enriquecimiento previo durante 18 - 24 h a 35 - 37 C.


(Figura 30.1).

30.2 Enriquecimiento selectivo de Salmonelas

Pipetear 1 mL del cultivo de pre - enriquecimiento en 10 mL de caldo Selenito Cistina. Incubar a 43 C, durante 24 horas.

Transferir 1 mL de cultivo de pre - enriquecimiento a 10 mL de Caldo Tetrationato Verde Brillante. Incubar a 43 C durante 24 horas.

30.3 Siembra en medios de agar selectivo para Salmonelas


*

Tomar una asada de cada uno de los medios de enriquecimiento selectivo


y estriarlo en la superficie de una placa de cada uno de los tres medios de
agar selectivo sealados a continuacin, de m anera que se obtengan colonias
aisladas.

Incubar las placas de agar verde brillante durante 24 horas a 35 - 37 C. Las


colonias tpicas de Salmonella son incoloras, rosa o fucsia o translcidas a
opacas, con el medio que las rodea de color rosa a rojo.

Incubar las placas de agar bismuto sulfito a 35 - 37C durante 48 horas. Las
colonias tpicas de Salmonella en agar bismuto sulfito aparecen marrones o
grises a negro, a veces con un brillo metlico. El medio que rodea las colonias
es, generalmente, m arrn al principio, cambiando a negro segn transcurre
el tiempo de incubacin. Algunas cepas producen colonias verdes, con el
medio que las rodea muy poco o nada oscurecido.

Incubar las placas de agar xilosa lisina desoxicolato (XLD) a 35 - 37 C du


rante 48 h. Las colonias tpicas de Salmonella son del mismo color que el
medio de cultivo, transparentes, a veces con centros negros (Figura 29.1).

30.4 Bioqumica de Salmonella sp.

Tomar con una aguja de Kolle estril dos o ms colonias de cada tipo sospe
choso del agar verde brillante, del agar sulfito bismuto y del medio XLD y
pasar a tubos de agar triple azcar hierro y agar lisina hierro inclinados.

Inocular los medios mediante siembra en estras en la superficie inclinada


y, a continuacin, por picadura en la colum na de agar. Inocular primero un
medio y sin flamear la aguja, inocular el segundo medio de la misma manera.

Incubar los tubos de ambos medios durante 24 horas a 35 - 37C. (Figura


30.1).

Los cultivos sospechosos de ser Salmonella muestran en la superficie del agar


triple azcar hierro, reaccin alcalina (color rojo) y en las columnas de medio.
92

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

reaccin cida (color amarillo), con o sin produccin de SH2, que da lugar al
ennegrecimiento del agar. La reaccin sospechosa en agar triple azcar hierro
indica que el organismo fermenta la glucosa (columna amarilla) pero que no
fermenta la lactosa ni la sacarosa (parte inclinada roja), reacciones tpicas de
las Salmonella. Sin embargo, algunas cepas pueden fermentar la sacarosa o la
lactosa y producir acidez (color amarillo) tanto en la parte inclinada como en
la colum na de medio. Los cultivos sospechosos de Salmonella presentan en el
agar lisina hierro una reaccin alcalina (color prpura) en todo el medio, con
o sin produccin de SH2 (ennegrecimiento).
30.5 Serologa somtica

Depositar una pequea cantidad de cultivo del medio TSI en una lm ina co
locar una gota de solucin salina fisiolgica y emulsionar el cultivo.

A adir una gota del antisuero y emulsionar con la ayuda del asa de Kolle.

Balancear la lm ina y observar la aglutinacin en un minuto.

Expresin de resultados
El resultado se expresa como presencia o ausencia del microorganismo en 25 g de
suelo mL de agua.

93

DORIS ELIZABETH ZIGA DVILA

225 mL APT

Incubar a 35 - 37 C por 24 horas


Adicionar 1 mL/tubo

10 mL Caldo
Tetrationato

10 mL caldo
Selenita Cistina
Incubar a 43C por 24 horas
AgarXLD

IL------ 1

AgarBPLS

IL------ 1

Agar BAS

IL

Estriar en cada uno de


los agares diferenciales
indicados

"1

1
Incubar a 35 - 37 C por 24 horas

Tomar una asada de una colonia caracterstica de cada placa y


sembrar en TSI, LIA inclinado. Incubar a 35 - 37 C x 24 h

Agar TSI

Agar LIA

Seleccionar los tubos positivos: TSI K/A++, LIA K/K

1
Serologa: somtica y flagelar

i
Expresin de Resultados: Presencia - Ausencia / 25g

FIGURA 30.1. Determinacin de Salmonella sp.

94

REFERENCIAS BIBLIOGRFICAS

Ahm ed Idris, H., Labuschagne, N., Korsten, L. 2007. Screening rhizobacteria


for biological control of Fusarium and crown rot of sorghum in Ethiopia.
Biological Control 40: 97-106.
Alberton, O., Kaschuk, G., Hungra, M. 2006. Sampling effects on the assessment of genetic diversity of rhizobia associated with soybean and comm on bean. Soil Biology and Biochemistry 38: 1298-1307.
APHA, AWWA, WPCF. 1975. Standart M ethods for Exam ination of Water
and Waste Water. 14 ed. W ashington DC.
APHA, AWWA, WPCF. 1998. Standart M ethods for Exam ination of Water
and Waste Water. 20 ed. W ashington DC.
American Public Health Association (APHA). 1992. Compendium of
M ethods for the Microbiological Exam ination of Foods. Third edition. USA.
Am erican Public Health Association (APHA). 2005. Standard methods for
the examination of water and wastewater 21 st Ed. Washington, DC: APHA.
Anderson, J. 1982. Soil Respiration. En: A.L. Page, R.M. Miller y D.R. Kenney (Eds). M ethods of Soil Analysis. Part II. Chemical and Microbiological
Properties. 2nd ed. American Society of Agronomy. N 9. M adison, Wisconsin, USA. 831-871.
Casida, L. 1977. Microbial M etabolic Activity in Soil as M easured by Dehydrogenase Determinations. Applied and Environmental Microbiology. 34:
630-636.
Centro Internacional de Agricultura Tropical (CIAT). 1988. Simbiosis Le
guminosa -Rizobio. M anual de Mtodos de Evaluacin, Seleccin y M anejo
Agronmico. Colombia.
Food & Drug Adm inistration (FDA). 1998. Bacteriological Analytical M a
nual, M edia Index. 8th Edition. USA.
Hernndez, J. y Mayo, I 2002. Infectividad y efectividad de cepas nativas de
rizobios aislados de la provincia de lea en Phaseolus lunatus var. Iqueo y var.
Sieva. Tesis de Bilogos. UNICA.
Herrera-Cervera, J., Caballero-Mellado, J., Laguerre, G., Tichy, H., Requena,
N., Amarger, N., Martnez-Romero, E., Olivares, J., Sanjun, J., 1999. A tleast
five rhizobial species nodulate Phaseolus vulgaris in a Spanish soil. FEMS M i
crobiology Ecology 30: 87-97.
Hungra, M ., Chueire, L., Coca, R., Megas, M. 2001. Preliminary characterization of fast growing rhizobial strains isolated from soybean nodules in
Brazil. Soil Biology & Biochemistry 33: 1349-1361.
International Commission on Microbiological Specifications for Foods (ICMSF). 2000. M icroorganismos de los alimentos. Tcnicas de anlisis microbiolgicos. 2da edicin. Vol 1. Traduccin de 1983. Editorial Acribia. Espaa.
Krieg, N. R. y Dobereiner, X 1984. Genus Azospirillum. pp. 94-103. En:
Bergeys M anual of Systematic Bacteriology, vol. I. N.R. Rrieg y XG Holt
(eds.). The Williams & Wilkins Co. Baltimore.
Laguerre, G., Allard, M. R., Revoy, F., Amarger, N. 1994. Rapid identification
o f rhizobia by restriction fragment length polym orphism analysis of PCR-amplified 16S rRNA genes. Applied and Environmental Microbiology 60: 56-63.
97

DORIS ELIZABETH ZIGA DVILA

Len, S. 1998. Identificacin de cepas de Rhizobium mediante la tcnica de


antibiticos. Tesis de Biologa. UNALM.

Luyo, C. 1992. Aislamiento, purificacin, autenticacin y seleccin de cepas


eficientes de Rhizobium leguminosarum en dos variedades de Phaseolus vulgas
(Bayo y Canario PF -210) in vitro. Tesis de Biologa. UNMSM.

Matos, G., Ormeo, E. y Ziga D. 1998. Diversidad de los rizobios que nodulan el cultivo de pallar (.Phaseolus lunatus L.) en la Costa Central del Per.
Ecologa Aplicada. 1:42-46.

Merck, 1994. Manual de Medios de Cultivo. E. Merck, Darmstadt, Alemania. 364 p.

Mishra. A., Choudhuri, M. A. 1998. M onitoring of phytoxicity of lead and


mercury from germination and early seelings growth indices in two rices cultivars. Water, A ir and Soil Pollution 114:339-346.

Naik, P. R. and Sakthivel, N. 2006. Functional characterization of a novel hydrocarbonoclastic Pseudomonas sp. strain PUP6 with plant-growth-promoting
traits and antifungal potential. Research in Microbiology 157: 538-546.

Nautiyal C. S. 1999. A n efficient microbiological growth mdium for screening phosphate solubilizing microorganisms. FEM S Microbiol. Lett. 170:
265-270.

Ormeo, E. y Ziga, D. 1998. M odification of YEM broth for mdium scale


production of legume inoculants. Revista Peruana de Biologa 5:83-89.

Ormeo-Orrillo, E. y Ziga-Dvila, D. 1999a. Optimizacin del tiempo de


esterilizacin de soportes basados en suelo y compost para la produccin de
inoculantes de leguminosa. Revista Peruana de Biologa 6: 181-184.
Ormeo-Orrillo, E. y Ziga-Dvila, D. 1999b. Supervivencia y caracters
ticas simbiticas de Bradyrhizobium sp. inoculado en una mezcla de suelo y
compost. Biota. 17: 41-49.
Ormeo-Orrillo, E ., Vinuesa, P., Ziga-Dvila, D., Martnez-Romero, E . 2006.
Molecular diversity of native bradyrhizobia isolated from lima bean (Phaseolus
lunatus L.) in Per. Systematic and Applied Microbiology 29: 253-262.

Ramos, E. y Ziga, E. 2007. Determ inacin de la actividad microbiana en la


rizosfera del cultivo de pallar. Enviado

Somasegaran, P. and Hoben, J. 1985. M ethods in Legume-Rhizobium Tech


nology. University of Hawaii. Niftal Project and MIRCEN. 367 p.

Versalovic, J., Koeuth, T., Lupski, J. R. 1991. Distribution of repetitive A D N


sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Research 19: 6823 - 6831.

Vincent, J. M. 1970. A M anual for the Practical of Root-Nodule Bacteria.


Vincent J.M. (ed). Blackwell Scientific Publications. Oxford. 164 p

Wang, E.T., M artnez Romero, J. 2005. La taxonom a de Rhizobium. En:


Microbios en lnea. Ed: M artnez Romero, E y M artnez Romero, J.C. h ttp ://
www.microbiologia.org.m x/m icrobiosenlinea/

Zapater, J. 1975. Evaluacin en el maz del coeficiente rizsfera - suelo (R /S)


referidos a bacterias libres fijadoras de N 2. Anales cientficos de la UNALM
13:45-57.
98

ANEXOS
ANEXO N 1 Medios de cultivo y reactivos
ANEXO N 2

Ensayos de sensibilidad a diferentes antibiticos

ANEXO N 3

Tablas de nmero ms probable

ANEXO N 4

Material de biologa molecular

DORIS ELIZABF.TH ZIGA DVILA

ANEXO N l . MEDIOS Y REACTIVOS


1. MEDIO LEVADURA-MANITOL-AGAR (LMA)
M anitol
Extracto de levadura
k 2h p o 4
M g S 0 4. 7H20
NaCl
Agar
Agua destilada
Colorantes*
pH

10.00 g
0.50 g
0.50 g
0.10g
0.20 g
15.00 g
1000 mL
6.8

*Colorantes:
Rojo congo al 0.0025 %
10 m L /L de LM A
Azul de Bromotimol 0.5% en alcohol al 70%
5 m L /L de LM A

MEDIO LACTOSA LEVADURA AG AR (LLA)


Lactosa
Extracto de levadura
k 2h p o 4
M g S 0 4.7H20
NaCl
Agar
Agua destilada
pH

10.00 g
0.50 g
0.50 g
0.10g
0.20 g
15.00 g
1000 mL
6.8

REACTIVO DE BENEDICT
Solucin A
Citrato de Sodio
Carbonato de Sodio
Agua destilada

17.3 g.
10.0 g.
10.0 m L .

Solucin B
Sulfato de Cobre
Agua destilada

1.73 g
10.0 mL

M ezclar la solucin A con la solucin B al momento de usar y envasar


hasta 100 mL con agua destilada.

MEDIO PEPTONA-GLUCOSA (PG)


Glucosa
Peptona
Agar
Prpura de bromocresol
Agua destilada
pH

5.00 g
10.00 g
15.00 g
10.00 mL
1000 mL
6.8

100

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

5. MEDIO LB
Triptona
Extracto de levadura
NaCl
Agar
Agua destilada
pH

10.00 g
5.00 g
5.00 g
15.00 g
1000 mL
6.8 - 7.0

6. SOLUCIN NUTRITIVA DE BROUGHTON Y DILLWORTH (SNBD)


Solucin 1
Solucin 2
CaCl2.2H20
294,1 g /L
k h 2p o 4
136,1 g /L
Solucin 3
FeCl3
M g S 0 4 .7 H ,0
k 2s o 4
M n S O4,.H2,0

Solucin 4
13.26 g /L
123.3 g /L
87 g /L
0.338 g /L

H 3B 0 3

Z n S 0 4. 7H20
C u S 0 4. 5H20
CoSO4. 7HzO
N a2M o 0 2. 2H20

0.247
0.288
0.100
0.056
0.048

g /L
g /L
g /L
g /L
g /L

Tomar 5mL cada solucin stock y aadir 10L de agua destilada, ajustar
el pH a 6.6 - 6.8 para prepar solucin nutritiva N +, aadir KN03(0.05%).
7. MEDIO BASE BERGENSEN
k 2h p o 4
k h ,p o 4
M g S 0 4.7H20
NaCl
CaCl2
d jF e
Glutam ato monosodico
Tiam ina
Biotina
Pentotenato clcico
M anitol
Azul de bromotimol (sol. al 5% en etanol 70 %)
Agua destilada
pH

0.3 g
0.3 g
0.15 g
0.05 g
0.05 g
6 mg
11 g
0.1 mg
0.2 mg
0.1 mg
10g
5 mL
1000 mL
7

8. NATIONAL BOTANICAL RESEARCH INSTITUYES PHOSPHATE


GROWTH M EDIUM (NBRIP):
Empleado para la identificar bacterias solubilizadoras de fosfato
Glucosa
Ca3(P 0 4)2
(NH4)2S 0 4
M g S 0 4*7H20
KC1
MgCl2*6H ,0
Agar
Agua destilada
pH

10.0 g
5.0 g
o.i g
0.25 g
0.2 g
5.0 g
15.0 g
1000 mL
7.0

Se ajusta el pH a 7.0 y se esteriliza a 121 C durante 15 min


101

D O RIS ELIZA B ETH Z IG A D V ILA

9. SOLUCIN DE SALKOWSKY
2% de FeCl3 0.05M en 35% de Acido Perclrico.
10. MEDIO GLUCOSA TRIPTONA EXTRACTO DE CARNE (TGE)
Utilizado para el aislamiento de bacterias del gnero Bacillus.
Triptona
Extracto de carne
D-Glucosa
Agar
pH

5.0 g
3.0 g
LOg
15 g
7 . 0 + /- 0 . 1

11. MEDIO MINERAL SIN NITRGENO


Este medio se utiliza tanto lquido como en agar para el aislamiento de Azotobacter.
K ,H P 0 4
M g S 0 4.7H20
NaCl
CaCl,
Cl3Fe(0.1% en solucin)
N a M o 0 4(H20 )
K H ,P 0 4
M anitol
Agar
Sacarosa
Azul de Bromotimol (sol. al 0.5% en etanol 70 %)
pH

0.655 g
0.2 g
0.02 g
0.01 g
3.4 g
0.0108 g
0.15 g
10 g
15.0 g
10 g
5 mL
7

12. AGAR PAPA DEXTROSA


Para cultivo de hongos.
Infusin de papa (preparada a partir
de 200 g de papa)
D-Glucosa
Agar
pH

4.0
20.0 g
15.0 g
5.6+/-0.1

13. MEDIO ALM IDN CASENA


Alm idn
Casena
Nitrato de potasio
NaCl
K2H P 0 4
M g S 0 4.7H20
C aC 03
F eS 0 4.7H20
Agar
Agua destilada

10.0 g
0.3 g
2.0 g
2.0 g
2.0 g
0.05 g
0.02 g
0.01 g
15.0 g
1000mL

Se ajusta el pH a 7.0 y se esteriliza a 121 C durante 15 min


102

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

14.

MEDIO PLATE COUNT PARA BACTERIAS


Triptona
Extracto de carne
Dextrosa
Agar
Agua destilada

5.0 g
2.5 g
1.0 g
15.0 g
1000 mL

Se ajusta el pH a 7.0 y se esteriliza a 121 C durante 15 min


15. MEDIO CZAPEK PARA HONGOS
30.0 g
3.0 g
LO g
0.5 g
0.018 g
1.0 g
13.0 g
0.05 g
1000 mL
7.3

Sacarosa
N itrato sdico N a N 0 3
M g S 0 4.7H20
KC1
2 F eS 0 4.7H20
k 2h p o 4
Agar
Rosa de Bengala
Agua destilada
pH
16. A G A R T SN
Para recuento de bacterias anaerobias
Peptona de casena
Extracto de Levadura
Sulfito sdico
Citrato de Hierro III
Polimixina B sulfato
Neomicina Sulfato
Agar
Agua destilada
pH

15.0 g
10.0 g
1.0 g
0.5 g
0.02 g
0.05 g
13.5 g
1000 mL
7.2 0.2

Esterilizar en autoclave (121C x 10 min) verter en placas


17.

CALDO LACTOSADO.
Este medio de cultivo est exento de sustancias inhibidoras para el ensayo
previo de bacterias Coliformes, especialmente E. coli. Utilizado para el enri
quecimiento de Salmonella. Composicin (g/L):
Peptona de g elatin a.................................... 5.0
Extracto de c a rn e ........................................ 3.0
L a c to sa ..........................................................5.0
Disolver y distribuir en tubos de ensayo provistos de campanas D urham y
esterilizar en autoclave (15 minutos a 121C). El caldo preparado es claro e
incoloro. pH: 6.9 + 0.1

18.

CALDO SELENITO CISTINA.


Este medio es utilizado para el enriquecimiento de Salmonella a partir de
heces, alimentos y otros materiales.
103

DORIS ELIZABETH ZIGA DVILA

Composicin (g/L):
Peptona de C asen a.........................................................5.0
L(-) - cistin a....................................................................... 0.01
L a c to sa .............................................................................. 4.0
Fosfato s d ico .................................................................. 2.0
Hidrgenoselenito s d ic o ............................................. 4.0
Disolver a temperatura ambiente. En caso necesario calentar brevemente
como mximo a 60C, esterizar por filtracin, si se prevee un almacenamien
to prolongado y distribuir en tubos. N o esterilizar en autoclave. pH: 7.0 + 0.2
19.

CALDO TETRATIONATO.
Este caldo es utilizado para el enriquecimiento selectivo de Salmonelas.
Composicin (g/L):
Peptona de C asen a..........................................................2.5
Peptona de C a rn e ............................................................. 2.5
M ezcla de sales b ilia res.................................................... 1.0
Carbonato de c a lc io ........................................................10.0
Tiosulfato de so d io ..........................................................30.0
Disolver los ingredientes y en caso necesario, calentar brevemente y enfriar
rpidamente. Queda un sedimento de Carbonato de Calcio. N o necesita este
rilizar. pH: 7.0 + 0.1

20.

AG AR XLD (AGAR XILOSA - LISINA - DESOXICOLATO).


Este agar es utilizado para el aislamiento y diferenciacin de Enterobacteriaceas patgenas, especialmente de especies de Shigella y Salmonella. Com
posicin (g/L):
Extracto de levadura
NaCl
D (+) - xilosa
Lactosa
Sacarosa
L(+) - lisina
Desoxicolato sdico
Tiosulfato de sodio
Citrato de am onio y hierro (III)
Rojo de fenol
Agar

3.0
5.0
3.5
7.5
7.5
5.0
2.5
6.8
0.8
0.08
13.5

Disolver rpidamente y totalmente y verter en placas. Las placas con medio


de cultivo son de color rojo y casi siempre claras. N o esterilizar en autoclave.
pH: 7.4 + 0.2
21.

AG ARBPLS
Selectivo para el aislamiento de Salmonella a partir de materiales patolgi
cos, alimentos, etc. Composicin en (g/L):
Peptona de carne
5.0
Peptona de casena
5.0
Extracto de carne
5.0
104

MANUAL DE MICROBIOLOGA AGRCOLA RH1ZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

Cloruro de sodio
Hidrogenofosfato disdico
Lactosa
Sacarosa
Rojo de fenol
Verde brilante
Agar
pH:

3.0
2.0
10.0
10.0
0.8
0.0125
12
6.9 0. 1

Disolver los ingredientes y esterilizar en autoclave (15 m in a 121C). Verter


en placas.
22.

AG AR BSA (BISMUTO SULFITO AGAR)


Selectivo para el aislamiento de Salmonella. Composicin (g/L)
Extracto de carne
Peptona
Glucosa
Fosfato disdico
Sulfato ferroso
Indicador sulfito bismuto
Verde brillante (sol. Acuosa 0.5 % p /v )
Agar

5.0
10.0
5.0
4.0
0.3
8.0
5 mL
20.0

Disolver todos los componentes en un litro de agua destilada, calentar hasta


ebullicin con agitacin frecuente. N o autoclavar. Verter en placas.
23.

AGAR TSI (AGAR HIERRO TRES AZCARES)


Para la identificacin de Enterobacteriacea, segn Sulkin y Willet (1940),
modificado por Hajna, 1945). Composicin (g/L):
Peptona de casena
Peptona de carne
Extracto de carne
Extracto de levadura
Cloruro sdico
Lactosa
Sacarosa
D(+)Glucosa
Am onio de Hierro (III) citrato
Tiosulfasto sodio
Rojo de Fenol
Agar

15
5.0
3.0
3.0
5.0
10
10
1.0
0.5
0.3
0.024
12

Disolver los ingredientes, distribuir en tubos y esterilizar en autoclave (15


min. a 121C). Dejar solidificar en posicin inclinada. E l p H e s de 7.4 0.1.
El medio de cultivo es claro y de color rojo anaranjado.
24.

AGAR U S IN A HIERRO (LIA)


Agar para la demostracin simultnea de lisina descarboxilasa (LD) y de
la formacin de cido sulfhdrico (H2S) para la identificacin de Enterobac
teriacea, sobre todo de Salmonella y rizona, segn Edwards y Fife (1961).

105

DORIS ELIZABETII ZIGA DVILA

Composicin (g/L)
Peptona de carne
Extracto de levadura
D(+)Glucosa
L-Lisina m onoclorhidrata
Tiosulfato sdico
Citrato de amonio y hierro (III)
Prpura de Bromocresol
Agar

5
3
1.0
10.0
0.04
0.5
0.02
12.5

Disolver, distribuir en tubos y esterilizar en autoclave (15 min. 121 C). D e


jar en posicin inclinada de form a que, al solidificar, se produzca una co
lum na de unos 3 cm de altura, y sobre ella una superficie inclinada de, por
lo menos, la misma longitud. El pH es de 6.7 + 0.1. El medio de cultivo es
claro y de color gris violeta.

ANEXO N 2
Tabla A .2.1 Ensayos de Sensibilidad a diferentes antibiticos
Sigla

Potencia

Resistente

Susceptible

10 mcg

<13mm

>17mm

CFM

5 mcg

<15mm

>19mm

30 mcg

<12mm

>18mm

DXS

30 mcg

<12mm

>16mm

EM

15 mcg

<13mm

>23mm

Estreptomocina

10 mcg

< llm m

>15mm

Kanamicina

30 mcg

<13mm

>18mm

Lincomicina

2 mcg

<16mm

>21mm

Norfloxacino

OR

10 mcg

<12mm

>17mm

Penicilina

10UOF

<19mm

>20mm

Rifampicina

5 mcg

<16mm

>20mm

Sulfatrimetoprim

SX

25 mcg

<10mm

>16mm

Tetraciclina

30 mcg

<14mm

>19mm

Agente microbiano
Ampicilina
Cefixima
Cloranfenicol
Doxiciclina
Eritromicina

106

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

ANEXO N 3. TABLAS DE NMERO MS PROBABLE

Tabla A .3.1
Indice NMP para varias combinaciones de resultados positivos cuando son
usados tres tubos por dilucin (1 0 1, 1 0 2, 1 0 3) (ICMSF, 2000)

Combinaciones de tubos positivos


0 .1

0
0
0
0
1
1
1
1
1
2
2
2
2
2
2
2
3
3
3
3
3
3
3
3
3
3
3
3

0 .0 1

0 .0 0 1

0
0
1
2
0
0
1
1
2
0
0
1
1
2
2
3
0
0
0
1
1
1
2
2
2
3
3
3

0
1
0
0
0
1
0
1
0
0
1
0
1
0
1
0
0
1
2
0
1
2
0
1
2
0
1
2

107

N M P /g

<3
3
3
6
4
7
7
11
11
9
14
15
20
21
28
29
23
39
64
43
75
120
93
150
210
240
460
1100

DORIS ELIZABETH ZIGA DVILA

Tabla A .3.2
TABLA 922: IV. Indice NMP y lmites de confianza para varias
combinaciones de resultados positivos cuando son usados cinco tubos por
dilucin (10 mL, 1.0 mL, 0.1 mL) (Standard Methods, 2005)
C o m b in a c i n
d e P o s itiv o s

n d ic e

L m ite s

C o n fia n z a

P / 1 0 0
m L

In fe rio r

d e

C o m b in a c i n
d e

P o s itiv o s

S u p e rio r

n d ic e

L m ite s

C o n fia n z a

P / 1 0 0

m L

In fe rio r

d e

S u p e rio r

6 .8

4 -0 -3

2 5

9 .8

7 0

1 .8

0 .0 9 0

6 .8

4 -1 -0

1 7

6 .0

4 0

0 -1 -0

1 .8

0 .0 9 0

6 .9

4 -1 -1

2 1

6 .8

4 2

0 -1 -1

3 .6

0 .7 0

10

4 -1 -2

2 6

9 .8

7 0

0 -2 -0

3 .7

0 .7 0

10

4 -1 -3

31

1 0

7 0

0 -2 -1

5 .5

1 .8

15

4 -2 -0

2 2

6 .8

5 0
7 0

0 -0 -0
0 -0 -1

<

1 .8

0 -3 -0

5 .6

1 .8

15

4 -2 -1

2 6

9 .8

1 -0 -0

2 .0

0 .1 0

1 0

4 -2 -2

3 2

1 0

7 0

1 -0 -1

4 .0

0 .7 0

10

4 -2 -3

3 8

1 4

1 0 0
7 0

1 -1 -2

6 .0

1 .8

15

4 -3 -0

2 7

9 .9

1 -1 -0

4 .0

0 .7 1

12

4 -3 -1

3 3

1 0

7 0

1 -1 -1

6 .1

1 .8

15

4 -3 -2

3 9

1 4

1 0 0

1 -1 -2

8 .1

3 .4

2 2

4 -4 -0

3 4

1 4

1 0 0

1 -2 -0

6 .1

1 .8

15

4 -4 -1

4 0

1 4

1 0 0

1 -2 -1

8 .2

3 .4

2 2

4 -4 -2

4 7

1 5

1 2 0

1 -3 -0

8 .3

3 .4

2 2

4 -5 -0

4 1

1 4

1 0 0

1 -3 -1

1 0

3 .5

2 2

4 -5 -1

4 8

1 5

1 2 0

1 -4 -0

1 0

3 .5

2 2

5 -0 -0

2 3

6 .8

7 0

2 -0 -0

4 .5

0 .7 9

15

5 -0 -1

31

1 0

7 0

2 -0 -1

6 .8

1 .8

15

5 -0 -2

4 3

1 4

1 0 0

2 -0 -2

9 .1

3 .4

2 2

5 -0 -3

5 8

2 2

1 5 0

2 -1 -0

6 .8

1 .8

17

5 -1 -0

3 3

1 0

1 0 0

2 -1 -1

9 .2

3 .4

2 2

5 -1 -1

4 6

1 4

1 2 0

2 -1 -2

1 2

4 .1

2 6

5 -1 -2

6 3

2 2

1 5 0

2 -2 -0

9 .3

3 .4

2 2

5 -1 -3

8 4

3 4

2 2 0

2 -2 -1

1 2

4 .1

2 6

5 -2 -0

4 9

15

1 5 0

2 -2 -2

1 4

5 .9

3 6

5 -2 -1

7 0

2 2

1 7 0

2 -3 -0

1 2

4 .1

2 6

5 -2 -2

9 4

3 4

2 3 0

2 -3 -1

14

5 .9

3 6

5 -2 -3

1 2 0

3 6

2 5 0

2 -4 -0

15

5 .9

3 6

5 -2 -4

1 5 0

5 8

4 0 0

3 -0 -0

7 .8

2 .1

2 2

5 -3 -0

7 9

2 2

2 2 0

3 -0 -1

11

3 .5

2 3

5 -3 -1

1 1 0

3 4

2 5 0

3 -0 -2

13

6 .5

3 5

5 -3 -2

1 4 0

5 2

4 0 0

3 -1 -0

11

3 .5

2 6

5 -3 -3

1 7 0

7 0

4 0 0

3 -1 -1

1 4

5 .6

3 6

5 -3 -4

2 1 0

7 0

4 0 0

3 -1 -2

1 7

6 .0

3 6

5 -4 -0

1 3 0

3 6

4 0 0

3 -2 -0

1 4

5 .7

3 6

5 -4 -1

1 7 0

5 8

4 0 0

3 -2 -1

17

6 .8

4 0

5 -4 -2

2 2 0

7 0

4 4 0

3 -2 -2

2 0

6 .8

4 0

5 -4 -3

2 8 0

1 0 0

7 1 0

3 -3 -0

1 7

6 .8

4 0

5 -4 -4

3 5 0

1 0 0

7 1 0

3 -3 -1

2 1

6 .8

4 0

5 -4 -5

4 3 0

1 5 0

1 1 0 0

3 -3 -2

2 4

9 .8

7 0

5 -5 -0

2 4 0

7 0

7 1 0

3 -4 -0

2 1

6 .8

4 0

5 -5 -1

3 5 0

1 0 0

1 1 0 0

3 -4 -1

2 4

9 .8

7 0

5 -5 -2

5 4 0

1 5 0

1 7 0 0

3 -5 -0

2 5

9 .8

7 0

5 -5 -3

9 2 0

2 2 0

2 6 0 0

4 -0 -0

13

4 .1

3 5

5 -5 -4

1 6 0 0

4 0 0

4 6 0 0

4 -0 -1

1 7

5 .9

3 6

5 -5 -5

4 -0 -2

2 1

6 .8

4 0

108

>

1 6 0 0

7 0 0

MANUAL DE MICROBIOLOGA AGRCOLA RHIZOBIUM, PGPRS, INDICADORES DE FERTILIDAD E INOCUIDAD

Tabla A .3.3
TABLA 922: HI. ndice NM P y lmites de confianza al 95% para todas las
combinaciones de resultados positivos y negativos cuando son usadas diez
porciones de 10 mL (Standard Methods, 2005)
N de Tubos
Positivos (10 mL)
0

Indice
NMP/lOOmL
<

Lmites de Confianza al 95%


Superior
Inferior

1 .1

3 .4

1 .1

0 .0 5 1

5 .9

2 .2

0 .3 7

8 .2

3 .6

0 .9 1

9 .7

5 .1

1 .6

1 3

6 .9

2 .5

1 5

9 .2

3 .3

1 9

1 2

4 .8

2 4

1 6

5 .8

3 4

2 3

8 .1

1 0

> 2 3

1 3

109

5 3

DORIS ELIZABETH ZIGA PV1LA

Tabla A .3.4
Estimacin de la cantidad de rhizobiosa
C a n tid a d

d e r h iz o b io s

(m , v e r f rm u la ) e s tim a d a
d ilu c io n e s

d e

s e g n

1 /1 0

(A

e l re c u e n to

Tubos positivos
n

Etapas de dilucin(es)

s =

>

2 0

4 0

d e p la n ta s in fe c ta d a s :

1 0 )*

10

1 0 8

3 9
3 8

19

6 .9

18

1 .8

3 .4

3 7
3 6

1 .0

35
17

3 4

5 .9

1 0 7

3 .1

3 3
16

3 2

s =

1 0

>

1 .7
1 .0

31
3 0

5 .8

15

2 9
14

2 8

6 .9

1 0 6

3 .1

3 .4

1 .7

1 .8
1 .0

1 .0

2 7
13

2 6

5 .8

2 5
12

2 4
2 3
2 2

11

1 .0

1 .0
5 .8

lO 3

1 0

15
14

6 .9
3 .4

1 .7

1 .8

11
10
9
4

8
7
6
5

1 .7

1 .0

1 .0

1 .0

102

5 .8

5 .8

x
3 .4

1 .7

1 .7

1 .7

1 .0

1 .0

1 .0

1 0 1

5 .8

10*

a p ro x im a d a

d e

lo s lm ite s

C o c h r a n e , B io m e tric s ,

1 0 1

3 .1

1 .7

1 .7

1 .7

1 .7

1 .0

1 .0

1 .0

5 .8

<

5 .8

3 .1

1 .7

1 .7

1 .7

1 .7

1 .0

1 .0

1 .0

0 .6

0 .6

0 .6

0 .6

< 0 .6

< 0 .6

1 0 7

V III2

1 9 5 0 , c a p . 6 , p .

5 .8

3 .1

- ) :

e l c u a d ro

1 .0
1

3 .1

1 0 5

1 0 3

c o n fia n z a * *

d e : V in c e n t. L . M .

1 .0
5 .9

3 .1

n
s e g n

6 .9

3 .1

(X ,

c a lc u la d o

1 0 2

3 .1

109

d e

7 x

1 .8

5 .8 x 1 0 '

A m p litu d

s =
>

1 0 2

3 .1

0 .6

3 .1

< 0 .6

x lO

1 .0
1 0 3

3 .1

1 .0

1 .7

5 .9

3 .1

3 .1

1 .0
1 0 3

1 .7

5 .8

3 .1

5 .8

5 .8

1 0 3

12

1 0 '1

1 .7

5 .8

13

3 .1

17

a. T o m a d o

>

3 .1

5 .8

16

* *

s =

1 .7

1 .0

18

C u a d ro

1 0 5

1 .7

19

x
3 .1

10

2 0

5 .9

1 0 5

3 .1

5 .8

21

F a c to r, 9 5 %

6 .6

3 .8

d e

F is h e r y

10 5 .

1 9 7 0

11

Y a te s

(1 9 6 3 )

M A N U A L D E M IC R O B IO LO G A A G R C O L A R H IZO B IU M , PGPRS, IN D IC A D O R ES D E F E R T IL ID A D E IN O C U ID A D

Donde:
n : cantidad de repeticiones por dilucin
s : cantidad de diluciones trabajadas
Consideraciones para la lectura de la Tabla de Estimacin de la Cantidad de
Rhizobios
1. Sumar la cantidad total de tubos positivos (presencia de nodulos) en todas las
diluciones trabajadas.
2. El nm ero obtenido en el paso anterior debe ser buscado en la columna de
tubos positivos para el n y s adecuados.
3. Calcular el nm ero de clulas de Rhizobium / g de suelo.

vxn

m : nm ero ms probable (por mL) en la primera dilucin considerada,


d : primera dilucin considerada
v : volumen inoculado
n : peso del suelo o del inoculante

ANEXO N 4. MATERIAL DE BIOLOGA MOLECULAR


A .4.1 Buffer TBE (Tris-borato-EDTA) 10X:

El buffer TBE tiene mayor capacidad de am ortiguam iento que el buffer TAE.

Es recom endado para electroforesis de cidos nucleicos menores a 1500 bp,


de esta m anera es usado para anlisis de molculas de A D N /A R N pequeas.
Tris base
Acido Brico
EDTA 0.5 M pH 8.0
Agua destilada en csp

108 g
55 g
40 mL
1000mL

Alm acenar a tem peratura ambiente

Buffer TAE (Tris-acetato-EDTA) 10X

El buffer TAE es recom endado para electroforesis de cidos nucleicos m a


yores a 1500 bp, de esta m anera es recom endado para resolucin de A D N
genmico, molculas de A D N /A R N mayores a 1500 bp A D N superenrollado.
Tris base
Acido actico glacial
EDTA 0.5 M p H 8.0
Agua destilada en csp

48.40 g
11.42 mL
20 mL
1000mL

ni

DORIS ELIZABETH ZIGA DVILA

A .4.2 Solucin de Bromuro de etidio


Solucin stock (10 m g/m L )
Agua destilada

100 pL
1000 mL

A .4.4 Porcentajes de agarosa para fragmentos de distintos tamaos


Concentracin de agarosa recomendado para la separacin de fragmentos de
A D N de varios tam aos

0.5
0.7
1.0
1.2
1.5
2.0

1 .0 -3 0
0 .8 - 1 2
0 .5 - 1 0
0 .4 - 3 .0
0 .2 - 3 .0

112

Tamao del fragmento


de ADN (kb)

O
O
1

Concentracin
de Agarosa (%)

FE DE ERRATAS
PG INA 69
DICE: Expresar los resultados en U F C /g de suelo seco (Figura 21.1).
DEBE DECIR: Expresar los resultados en U F C /g de suelo seco (Figura 22.1).
PGINA 75
DICE: Se efecta la lectura al espectrofotmetro de la solucin obtenida contra el
sobrenadante del blanco, a una longitud de onda de 485 nm (Figura 26.1).
DEBE DECIR: Se efecta la lectura al espectrofotmetro de la solucin obtenida
contra el sobrenadante del blanco, a una longitud de onda de 485 nm (Figura 26.2).
PG INA 92
DICE: Incubar las placas de agar xilosa Usina desoxicolato (XLD) a 35 - 37 C
durante 48 h. Las colonias tpicas de Salmonella son del mismo color que el medio
de cultivo, transparentes, a veces con centros negros (Figura 29.1).
DEBE DECIR: Incubar las placas de agar xilosa lisina desoxicolato (XLD) a 35
- 37 C durante 48 h. Las colonias tpicas de Salmonella son del mismo color que el
medio de cultivo, transparentes, a veces con centros negros (Figura 30.1).

DORIS ELIZABETH ZIGA DVILA


Profesor Principal del Departamento de Biologa de la Universidad Nacional
Agraria La Molina - UNALM. Jefe del Laboratorio de Ecologa Microbiana
y Biotecnologa Marino Tabusso. Sus estudios profesionales de Biologa los
realiz en la Universidad Nacional Agraria La Molina y los de Maestra en la
Especialidad de Suelos en la Escuela de Post Grado de la misma universidad. El
grado de Doctor en Biologa fue obtenido en la Universidad de Granada, Espaa.
Coordinador Nacional de la Red Iberoamericana de Biofertilizantes Microbianos
para la Agricultura y el Medio Ambiente - Biofag, Cyted - Espaa. Coordinador
Regional de la Asociacin Latinoamericana de Rizobiologa - ALAR, Miembro
de la Internacional Society for Microbial Ecologv - ISME. Miembro de la Red
ICPCNanoNet, Red Peruana de Nanotecnologa y Sociedad Peruana de la
Ciencia del Suelo. Premio Mujer por la Ciencia otorgado por LOreal - UNESCO
- CONCYTEC.
Sus principales publicaciones en los ltimos aos:
Characterization of rhizospheric bacteria isolated from maca (Lepidium meyenii
W.) in the highlands of Junin-Peru y Effect of different rhizospheric bacterias
in the growth of Gossypium barbadense L. in Per, ambos en Microorganisms in
Industry and Environment. From scientific and industrial research to consumer
products (2011). Characterization of Bacillus isolates of potato rhizosphere
from Andean soils of Per and ther potential PGPR characteristics, Braziliam
Journal of Microbiology (2010). Growth and motilitv of plant growth
promoting rhizobacteria isolated from maca rhizophere, en Biological Nitrogen
Fixation and Plant Associated Microorganisms (2010). Fertilizers-Peru, en
FAO Biotechnology Forum Learning from the past: Successes and failures with
agricultural biotechnologies in developing countries over the last 20 years (2009).
Leguminosas y produccin de biofertilizantes en el Per, en Biofertilizantes
en Iberoamrica: Una visin tcnica, cientfica y empresarial (2007). Phaseolus
lunatus is nodulated by a phosphate solubilizing strain of Sinorhizobium meliloti
in a Peruvian soil, en Serie: Developments in Plant and Soil Sciences (2007).

* H O a VIN'EAV

jm

s\ Ws EDIAGRARIA
'S > o

v i*1*

9 786124

147043