Está en la página 1de 52

ÁCIDOS

NUCLEICOS

Q.F. PATRICIA I. MINCHÁN HERRERA


CONCEPTO
 Químicamente los Ácidos nucleicos son polímeros
constituidos por la unión mediante enlaces químicos de
unidades menores llamadas nucleótidos.

 Los ácidos nucleicos son compuestos de elevado peso


molecular (son macromoléculas)
LOS NUCLEÓTIDOS:
COMPONENTES
Los nucleótidos están formados por:

 Una base nitrogenada: BN,


 Un azúcar (pentosa): A y
 Ácido fosfórico: P

Unidos en el siguiente orden:

P A BN
Los Ácidos Nucleicos están formados por:

 La unión de
bioelementos
tales como:
C, H, O, N y
P.

 Unidades
estructurales
que son los
nucleótidos.
ESTRUCTURA DE UN
NUCLEÓTIDO
ESTRUCTURA DE UN
NUCLEÓTIDO

 Para formar un
nucleótido, el ácido
fosfórico se une al
carbono 5 del
azúcar mediante un
enlace Fosfoéster
y el azúcar se une a
la base nitrogenada
mediante un enlace
N-glicosídico.

Enlace N-
glicosídico
COMPONENTES
La pentosa puede ser:

 RIBOSA
 DESOXIRRIBOSA.

La base Nitrogenada puede ser:

 ADENINA A
 GUANINA G
 CITOSINA C
 TIMINA T
 URACILO U
BASES NITROGENADAS
 Son sustancias derivadas de dos compuestos
químicos: la purina y la pirimidina.

 Las que derivan de la purina son las bases


púricas: la adenina (A) y la guanina (G).

 Las que derivan de la pirimidina se llaman


pirimidínicas: la citosina (C), la timina (T) y el
uracilo (U).
AZÚCAR (GLÚCIDO)
 El azúcar que interviene en los
nucleótidos puede ser o la
ribosa (R) o la desoxirribosa
(DR).

 Ambas son aldopentosas y las


encontraremos en los
nucleótidos como ß-furanosas.

 Conviene destacar que la


única diferencia entre ambas
está en que en el carbono 2 de
la desoxirribosa hay un
hidrógeno (-H) en lugar del
grupo alcohol (-OH).
PROPIEDADES
IONIZACIÓN:

 El comportamiento ácido-base de los nucleótidos es una de las


características más importantes.

 Éste determina su carga, su estructura tautomérica y su habilidad de actuar


como dador/aceptor de puentes de hidrógeno.

 En el rango fisiológico de pH (5<pH<9), las bases nitrogenadas son


neutras. Las pentosas, sólo pueden perder el protón del grupo hidroxilo en
medios extremadamente básicos (pH>12). El grupo fosfato, en cambio, se
encuentra con carga negativa (carga –1).

 Cuando el grupo fosfato se une a dos nucleósidos, éste sólo tiene un único
hidroxilo ionizable con un pKa≈1 y tan solo cuando se trata de un
monoéster, puede perder un segundo protón a pH 6-7 25. Así que a pH
fisiológico, los ácidos nucleicos son polianiones.
PROPIEDADES
TAUTOMERÍA

 Un fenómeno que afecta a las bases es la tautomería y


resulta ser una de las claves para entender la
funcionalidad de los ácidos nucleicos.

 El equilibrio tautomérico prototrópico implica estructuras


alternativas que sólo difieren en la localización de los
átomos de hidrógeno.

 Las bases nitrogenadas de los ácidos nucleicos


disponen de un equilibrio ceto-enol y de un equilibrio
amino-imino
PROPIEDADES
DISTRIBUCIÓN DE CARGA:

 Las bases nitrogenadas son estructuras polares que presentan una


distribución de carga muy localizada en determinados átomos,
presentando momentos dipolares elevados.

 Esta distribución de carga justifica las interacciones no covalentes


entre bases, tan importantes en el reconocimiento molecular, como
son los puentes de hidrógeno.

 Los grupos –NH de las bases nitrogenadas -donde se concentra las


carga positiva- son buenos dadores de puentes de hidrógeno y los
pares libres del oxígeno de los grupos –C=O y de los nitrógenos del
anillo -donde se concentra las carga negativa- son buenos
aceptores de puentes de hidrógenos.
REACTIVIDAD
PROTONACIÓN:

 Las reacciones de protonación/desprotonación en las bases


nitrogenadas son las de mayor transcendencia funcional.

 Primero porque este tipo de reacciones es básico en numerosas


reacciones enzimáticas.

 Esta protonación tiene un papel importante para explicar


determinados tipos de estructuras de ácidos nucleicos, como la
triple hélice.

 Además, se piensa que este tipo de reacción puede estar detrás de


determinados procesos mutagénicos.
REACTIVIDAD
HIDRATACIÓN:

 Las bases tienden a agregarse en agua mediante


interacciones de apilamiento.

 Pero en baja concentración presentan una muy buena


capacidad de hidratación.

 La reacción de hidratación es importante en la vida


celular, ya que a menudo resulta una de las primeras
etapas del proceso de degradación de nucleósidos no
deseados.
REACTIVIDAD
SUSTITUCIÓN NUCLEÓFILA:

 El ataque de grupos nucleófilos, generalmente con


carga negativa, a las bases puede dar lugar a dos
reacciones mayoritarias que compiten: la abstracción de
un protón (normalmente unido a un átomo de N) o la
sustitución nucleófila.

 La primera es una reacción que tiene lugar en el plano


molecular, mientras que la segunda es una reacción
donde el nucleófilo ataca en el plano perpendicular a la
molécula.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN O DNA)
CONCEPTO.

 Químicamente son polinucleótidos


constituidos por los ácidos
desoxiadenílico, guanílico, citidílico y
timidílico unidos por enlaces de éster
fosfórico entre el 3’-OH de una D-ribosa y
el 5’-OH de la siguiente.

 Aislado por primera vez en 1869, pero


hasta 1950 no se empezó a conocer su
estructura.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN O DNA)
 En el núcleo de células eucariotas asociado a proteínas
(histonas y otras) formando la cromatina.

 También hay ADN en ciertos orgánulos celulares


(plastos y mitocondrias).

 Los ADN celulares tienen una elevada masa molecular,


muchos millones de daltons; por ejemplo: el genoma
humano está formado por 3x10 9 pares de nucleótidos.
Figura 3: Estructura molecular básica del ADN.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA:

Se pueden distinguir 3 niveles estructurales:

 Estructura primaria: La secuencia de los nucleótidos.


 Estructura secundaria: La doble hélice.
 Estructura terciaria: Collar de perlas, estructura
cristalina, ADN superenrollado.

 En las células eucariotas, a partir de la estructura 3ª, se


dan otros niveles de empaquetamiento de orden
superior.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA PRIMARIA DEL ADN:

 Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la


estructura primaria del ADN viene determinada por el orden de los
nucleótidos en la hebra o cadena de la molécula.

 Para indicar la secuencia de una cadena de ADN es suficiente con


los nombres de las bases o su inicial (A, T, C, G) en su orden
correcto y los extremos 5' y 3' de la cadena nucleotídica.

Así, por ejemplo:

5'ACGTTTAACGACAAGGACAAGTATTAA3'
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA SECUNDARIA DEL ADN:

 La concentración de bases varía de una especie a otra.

 El porcentaje de A, G, C y T es el mismo en los individuos de la


misma especie y no por esto el mensaje es el mismo

 Las densidades y viscosidades corresponden a la existencia de


enlaces de hidrógeno entre los grupos NH y los grupos CO.

 La concentración de Adenina es igual a la de Timina, y la de


Citosina a la de Guanina.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA SECUNDARIA DEL ADN:

 Las dos primeras establecen dos puentes de hidrógeno entre ellas,


y las últimas tres puentes.

 La cantidad de purinas es igual a la cantidad de pirimidinas.

 El ADN estaría constituido por dos cadenas o hebras de


polinucleótidos enrolladas helicoidalmente en sentido dextrógiro
sobre un mismo eje formando una doble hélice.

 Ambas cadenas serían antiparalelas, una iría en sentido 3‘-5' y la


otra en sentido inverso, 5' - 3'.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA SECUNDARIA DEL ADN:

 Los grupos fosfato estarían hacia el exterior y de este modo sus


cargas negativas interaccionarían con los cationes presentes en el
nucleoplasma dando más estabilidad a la molécula.

 Las bases nitrogenadas estarían hacia el interior de la hélice con


sus planos paralelos entre sí y las bases de cada una de las hélices
estarían apareadas con las de la otra asociándose mediante
puentes de hidrógeno.

 El apareamiento se realizaría únicamente entre la adenina y la


timina, por una parte, y la guanina Y la citosina, por la otra. Por lo
tanto, la estructura primaria de una cadena estaría determinada por
la de la otra, ambas cadenas serían complementarias.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS
EUCARIOTAS:

 Las grandes moléculas de ADN de las células


eucariotas están muy empaquetadas ocupando así
menos espacio en el núcleo celular y además como
mecanismo para preservar su transcripción.

 En las células eucariotas el ADN se encuentra en el


núcleo asociado a ciertas proteínas: nucleoproteínas,
formando la cromatina.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS:

 En la cromatina, la doble hélice de ADN se enrolla alrededor de unas


moléculas proteicas globulares, las histonas, formando los nucleosomas.

 Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos


vueltas a su alrededor (200 pares de bases).

 Si no está más empaquetado aún, forma una estructura arrosariada


llamada collar de perlas.

 Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un


grosor de 30 nm (fibra de 30 nm).

 Según el modelo del solenoide las fibras se forman al enrollarse seis


nucleosomas por vuelta alrededor de un eje formado por las histonas H1.
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
ÁCIDO DESOXIRRIBONUCLEICO
(ADN)
Replicación del DNA: replicación es el proceso por el cual el DNA se
copia para poder ser transmitido a nuevos individuos.
a) Formación de una horquilla de replicación
b) Síntesis por la DNA-polimerasa de la hebra conductora (izquierda) y de la
hebra seguidora en fragmentos de Okazaki (derecha)
c) Unión de todos los fragmentos por la DNA-ligasa
ÁCIDO RIBONUCLEICO (ARN)
CONCEPTO:

 Son polímeros de los


ribonucleótidos, cuya azúcar, la
ribosa, tiene 3 grupos –OH libres
(2’, 4’ y 5’).

 La unión de los nucleósidos


con el fosfórico es entre 3’ y 5’,
como en el ADN, quedando libre
el –OH 2’.

 Un solo filamento
polinucleotidico.

Las bases usuales son: G, C y


A,U.
ÁCIDO RIBONUCLEICO (ARN)
Existen 3 tipos de RNA polimerasa:
 Tipo I: transcribe ARN ribosómico (ARNr)

 Tipo II: transcribe ARN mensajero (ARNm)

 Tipo III: transcribe ARNt transferencia (ARNt)

 Tipo IV: ARN np- ARN nuclear pequeño: Con proteínas, forma complejos
que son usados en el proceso de ARN en las células eucarióticas (no se
encuentra en las células procarióticas).

Es sintetizado por una plantilla o molde de DNA por


acción de la RNA polimerasa.
ÁCIDO RIBONUCLEICO (ARN)
ÁCIDO RIBONUCLEICO (ARN)
ESTRUCTURA:


Cadena sencilla plegada sobre sí misma

 No tienen aplicación las reglas de Chargaff


Distintos tipos de estructura secundaria
• Bucles, horquillas, brazos
• Regiones dúplex con apareamientos C-G (tres enlaces de H)
y A=U (dos enlaces de H) entre zonas palindrómicas de
complementariedad
–Forman hélices dextrógiras similares a las del DNA

 Globalmente adoptan una estructura terciaria compleja, por


asociación de hélices y bucles
MECANISMO DE REPLICACIÓN,
TRANSCRIPCIÓN Y TRADUCCIÓN
CUADRO COMPARATIVO ENTRE EL ADN Y ARN

Caracteres pentosa DNA Desoxirribosa RNA Ribosa

Bases nitrogenadas Adenina, Guanina Adenina, Guanina


Citosina, Timina Citosina, Uracilo

Numero de polinucleotidos 2 1

Función Almacena la información Permite la expresión de la


biológica de los seres vivos información biológica

Ubicación Núcleo, mitocondrias, Núcleo, ribosomas.


cromatina, cloroplastos,
cromosoma

Estructura Doble hélice Lineal, globular y trébol


NUCLEÓTIDOS DE INTERÉS
BIOLÓGICO

 NUCLEÓTIDOS QUE INTERVIENEN EN LAS


TRANSFERENCIAS DE ENERGÍA:

 AMP (adenosina-5'-monofosfato) A-R-P


 ADP (adenosina-5'-difosfato) A-R-P-P
 ATP (adenosina-5'-trifosfato) A-R-P-P-P
 GDP (guanosidina-5'-difosfato) G-R-P-P
 GTP (guanosidina-5'-trifosfato) G-R-P-P-P
NUCLEÓTIDOS DE INTERÉS
BIOLÓGICO

1. NUCLEÓTIDOS QUE INTERVIENEN EN LOS


PROCESOS DE ÓXIDO-REDUCCIÓN:

 NAD+ /NADH (Nicotinamida-adenina-dinucleótido) oxidado y


reducido, respectivamente.
 NADP+ /NADPH (Nicotinamida-adenina-dinucleótido-fosfato),
oxidado y reducido.
 FAD/FADH2 (Flavina-adenina-dinucleótido), oxidado y reducido.

7. NUCLEÓTIDOS REGULADORES DE PROCESOS


METABÓLICOS.

 AMPc (adenosina-3',5'-monofosfato) o AMP cíclico,


IMPORTANCIA BIOLÓGICA DE LOS
ÁCIDOS NUCLEICOS:
 Principalmente se encuentran en  Pueden sufrir cambios o
el núcleo celular, contienen los mutaciones, lo cual permite la
genes responsables de los rasgos evolución continua de los seres
biológicos y son capaces de vivos. Las especies que tienen
transmitirlos de una generación a estructuras y funciones
otra. También se encuentran similares quizás tengan un
libres en las células. origen o antecesor común.

 Constituyen la base de los


cromosomas y el fundamento de  La utilización de técnicas para
la forma de expresarse la comparar ácidos nucleicos
información genética en la síntesis permiten determinar el
de las proteínas de cada parentesco familiar y la
individuo. investigación.
ES IMPORTANTE RECORDAR QUE:

 Los polinucleótidos son polímeros  La información genética de cada


de nucleótidos que presentan célula somática es prácticamente
extremos 5’ y 3’. idéntica. La distinción entre una
célula cerebral, muscular o
hepática depende del patrón de
genes expresados en estas
células, las así llamada expresión
especifica de tejido.
 El flujo de la información genética
obedece a la secuencia DNA →
RNA →proteina. La información
genética de la región estructural
de un gen se transcribe en una
molécula de RNA de modo que la
secuencia de este último es  La capacidad de un organismo
complementaria de la del ADN. para responder a retos del medio
ambiente dependen de su
habilidad para regular, en forma
positiva o negativa, cuales genes
serán expresados.
GRACIAS

También podría gustarte