P. 1
Acidos Nucleicos

Acidos Nucleicos

4.57

|Views: 43.417|Likes:
Publicado porquimicoupagu

More info:

Published by: quimicoupagu on Apr 28, 2008
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PPT, PDF, TXT or read online from Scribd
See more
See less

06/26/2015

pdf

text

original

ÁCIDOS NUCLEICOS

Q.F. PATRICIA I. MINCHÁN HERRERA

CONCEPTO

Químicamente los Ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los ácidos nucleicos son compuestos de elevado peso molecular (son macromoléculas)

LOS NUCLEÓTIDOS: COMPONENTES
Los nucleótidos están formados por:
  

Una base nitrogenada: BN, Un azúcar (pentosa): A y Ácido fosfórico: P

Unidos en el siguiente orden: P A BN

Los Ácidos Nucleicos están formados por:

La unión de bioelementos tales como: C, H, O, N y P.

Unidades estructurales que son los nucleótidos.

ESTRUCTURA DE UN NUCLEÓTIDO

ESTRUCTURA DE UN NUCLEÓTIDO
Para formar un nucleótido, el ácido fosfórico se une al carbono 5 del azúcar mediante un enlace Fosfoéster y el azúcar se une a la base nitrogenada mediante un enlace N-glicosídico.

Enlace Nglicosídico

COMPONENTES
La pentosa puede ser:
 

RIBOSA DESOXIRRIBOSA.

La base Nitrogenada puede ser:
    

ADENINA GUANINA CITOSINA TIMINA URACILO

A G C T U

BASES NITROGENADAS

Son sustancias derivadas de dos compuestos químicos: la purina y la pirimidina. Las que derivan de la purina son las bases púricas: la adenina (A) y la guanina (G). Las que derivan de la pirimidina se llaman pirimidínicas: la citosina (C), la timina (T) y el uracilo (U).

AZÚCAR (GLÚCIDO)

El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o la desoxirribosa (DR). Ambas son aldopentosas y las encontraremos en los nucleótidos como ß-furanosas. Conviene destacar que la única diferencia entre ambas está en que en el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del grupo alcohol (-OH).

PROPIEDADES
IONIZACIÓN:

El comportamiento ácido-base de los nucleótidos es una de las características más importantes. Éste determina su carga, su estructura tautomérica y su habilidad de actuar como dador/aceptor de puentes de hidrógeno. En el rango fisiológico de pH (5<pH<9), las bases nitrogenadas son neutras. Las pentosas, sólo pueden perder el protón del grupo hidroxilo en medios extremadamente básicos (pH>12). El grupo fosfato, en cambio, se encuentra con carga negativa (carga –1). Cuando el grupo fosfato se une a dos nucleósidos, éste sólo tiene un único hidroxilo ionizable con un pKa≈1 y tan solo cuando se trata de un monoéster, puede perder un segundo protón a pH 6-7 25. Así que a pH fisiológico, los ácidos nucleicos son polianiones.

PROPIEDADES
TAUTOMERÍA

Un fenómeno que afecta a las bases es la tautomería y resulta ser una de las claves para entender la funcionalidad de los ácidos nucleicos. El equilibrio tautomérico prototrópico implica estructuras alternativas que sólo difieren en la localización de los átomos de hidrógeno. Las bases nitrogenadas de los ácidos nucleicos disponen de un equilibrio ceto-enol y de un equilibrio amino-imino

PROPIEDADES
DISTRIBUCIÓN DE CARGA:

Las bases nitrogenadas son estructuras polares que presentan una distribución de carga muy localizada en determinados átomos, presentando momentos dipolares elevados. Esta distribución de carga justifica las interacciones no covalentes entre bases, tan importantes en el reconocimiento molecular, como son los puentes de hidrógeno. Los grupos –NH de las bases nitrogenadas -donde se concentra las carga positiva- son buenos dadores de puentes de hidrógeno y los pares libres del oxígeno de los grupos –C=O y de los nitrógenos del anillo -donde se concentra las carga negativa- son buenos aceptores de puentes de hidrógenos.

REACTIVIDAD
PROTONACIÓN:

Las reacciones de protonación/desprotonación en las bases nitrogenadas son las de mayor transcendencia funcional. Primero porque este tipo de reacciones es básico en numerosas reacciones enzimáticas. Esta protonación tiene un papel importante para explicar determinados tipos de estructuras de ácidos nucleicos, como la triple hélice. Además, se piensa que este tipo de reacción puede estar detrás de determinados procesos mutagénicos.

REACTIVIDAD
HIDRATACIÓN:

Las bases tienden a agregarse en agua mediante interacciones de apilamiento. Pero en baja concentración presentan una muy buena capacidad de hidratación. La reacción de hidratación es importante en la vida celular, ya que a menudo resulta una de las primeras etapas del proceso de degradación de nucleósidos no deseados.

REACTIVIDAD
SUSTITUCIÓN NUCLEÓFILA:

El ataque de grupos nucleófilos, generalmente con carga negativa, a las bases puede dar lugar a dos reacciones mayoritarias que compiten: la abstracción de un protón (normalmente unido a un átomo de N) o la sustitución nucleófila. La primera es una reacción que tiene lugar en el plano molecular, mientras que la segunda es una reacción donde el nucleófilo ataca en el plano perpendicular a la molécula.

ÁCIDO DESOXIRRIBONUCLEICO (ADN O DNA)
CONCEPTO.

Químicamente son polinucleótidos constituidos por los ácidos desoxiadenílico, guanílico, citidílico y timidílico unidos por enlaces de éster fosfórico entre el 3’-OH de una D-ribosa y el 5’-OH de la siguiente. Aislado por primera vez en 1869, pero hasta 1950 no se empezó a conocer su estructura.

ÁCIDO DESOXIRRIBONUCLEICO (ADN O DNA)

En el núcleo de células eucariotas asociado a proteínas (histonas y otras) formando la cromatina. También hay ADN en ciertos orgánulos celulares (plastos y mitocondrias). Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons; por ejemplo: el genoma humano está formado por 3x10 9 pares de nucleótidos.

Figura 3: Estructura molecular básica del ADN.

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA: Se pueden distinguir 3 niveles estructurales:
  

Estructura primaria: La secuencia de los nucleótidos. Estructura secundaria: La doble hélice. Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado. En las células eucariotas, a partir de la estructura 3ª, se dan otros niveles de empaquetamiento de orden superior.

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA PRIMARIA DEL ADN:

Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica. Así, por ejemplo:

5'ACGTTTAACGACAAGGACAAGTATTAA3'

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA SECUNDARIA DEL ADN:
 

La concentración de bases varía de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo Las densidades y viscosidades corresponden a la existencia de enlaces de hidrógeno entre los grupos NH y los grupos CO. La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina.

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA SECUNDARIA DEL ADN:

Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas. El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice. Ambas cadenas serían antiparalelas, una iría en sentido 3‘-5' y la otra en sentido inverso, 5' - 3'.

 

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA SECUNDARIA DEL ADN:

Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula. Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre sí y las bases de cada una de las hélices estarían apareadas con las de la otra asociándose mediante puentes de hidrógeno. El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la guanina Y la citosina, por la otra. Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra, ambas cadenas serían complementarias.

ÁCIDO DESOXIRRIBONUCLEICO (ADN)

ÁCIDO DESOXIRRIBONUCLEICO (ADN)

ÁCIDO DESOXIRRIBONUCLEICO (ADN)

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS:

Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupando así menos espacio en el núcleo celular y además como mecanismo para preservar su transcripción. En las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: nucleoproteínas, formando la cromatina.

ÁCIDO DESOXIRRIBONUCLEICO (ADN)
ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS:

En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas a su alrededor (200 pares de bases). Si no está más empaquetado aún, forma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Según el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.

ÁCIDO DESOXIRRIBONUCLEICO (ADN)

ÁCIDO DESOXIRRIBONUCLEICO (ADN)

ÁCIDO DESOXIRRIBONUCLEICO (ADN)

Replicación del DNA: replicación es el proceso por el cual el DNA se copia para poder ser transmitido a nuevos individuos.

a) Formación de una horquilla de replicación b) Síntesis por la DNA-polimerasa de la hebra conductora (izquierda) y de la hebra seguidora en fragmentos de Okazaki (derecha) c) Unión de todos los fragmentos por la DNA-ligasa

ÁCIDO RIBONUCLEICO (ARN)
CONCEPTO: Son polímeros de los ribonucleótidos, cuya azúcar, la ribosa, tiene 3 grupos –OH libres (2’, 4’ y 5’).

La unión de los nucleósidos con el fosfórico es entre 3’ y 5’, como en el ADN, quedando libre el –OH 2’.

Un solo filamento polinucleotidico.
 Las

A,U.

bases usuales son: G, C y

ÁCIDO RIBONUCLEICO (ARN)
Existen 3 tipos de RNA polimerasa:
   

Tipo I: transcribe ARN ribosómico (ARNr) Tipo II: transcribe ARN mensajero (ARNm) Tipo III: transcribe ARNt transferencia (ARNt) Tipo IV: ARN np- ARN nuclear pequeño: Con proteínas, forma complejos que son usados en el proceso de ARN en las células eucarióticas (no se
encuentra en las células procarióticas).

Es sintetizado por una plantilla o molde de DNA por acción de la RNA polimerasa.

ÁCIDO RIBONUCLEICO (ARN)

ÁCIDO RIBONUCLEICO (ARN)
ESTRUCTURA:

Cadena sencilla plegada sobre sí misma No tienen aplicación las reglas de Chargaff Distintos tipos de estructura secundaria • Bucles, horquillas, brazos • Regiones dúplex con apareamientos C-G (tres enlaces de H) y A=U (dos enlaces de H) entre zonas palindrómicas de complementariedad –Forman hélices dextrógiras similares a las del DNA Globalmente adoptan una estructura terciaria compleja, por asociación de hélices y bucles

MECANISMO DE REPLICACIÓN, TRANSCRIPCIÓN Y TRADUCCIÓN

CUADRO COMPARATIVO ENTRE EL ADN Y ARN

Caracteres pentosa Bases nitrogenadas

DNA Desoxirribosa Adenina, Guanina Citosina, Timina

RNA Ribosa Adenina, Guanina Citosina, Uracilo

Numero de polinucleotidos Función

2 Almacena la información biológica de los seres vivos

1 Permite la expresión de la información biológica

Ubicación

Núcleo, mitocondrias, cromatina, cloroplastos, cromosoma

Núcleo, ribosomas.

Estructura

Doble hélice

Lineal, globular y trébol

NUCLEÓTIDOS DE INTERÉS BIOLÓGICO

NUCLEÓTIDOS QUE INTERVIENEN EN LAS TRANSFERENCIAS DE ENERGÍA: AMP (adenosina-5'-monofosfato) A-R-P ADP (adenosina-5'-difosfato) A-R-P-P ATP (adenosina-5'-trifosfato) A-R-P-P-P GDP (guanosidina-5'-difosfato) G-R-P-P GTP (guanosidina-5'-trifosfato) G-R-P-P-P

    

NUCLEÓTIDOS DE INTERÉS BIOLÓGICO
1.

NUCLEÓTIDOS QUE INTERVIENEN PROCESOS DE ÓXIDO-REDUCCIÓN:

EN

LOS

  

NAD+ /NADH (Nicotinamida-adenina-dinucleótido) oxidado y reducido, respectivamente. NADP+ /NADPH (Nicotinamida-adenina-dinucleótido-fosfato), oxidado y reducido. FAD/FADH2 (Flavina-adenina-dinucleótido), oxidado y reducido.

7.

NUCLEÓTIDOS REGULADORES DE PROCESOS METABÓLICOS.
AMPc (adenosina-3',5'-monofosfato) o AMP cíclico,

IMPORTANCIA BIOLÓGICA DE LOS ÁCIDOS NUCLEICOS:

Principalmente se encuentran en el núcleo celular, contienen los genes responsables de los rasgos biológicos y son capaces de transmitirlos de una generación a otra. También se encuentran libres en las células.

Pueden sufrir cambios o mutaciones, lo cual permite la evolución continua de los seres vivos. Las especies que tienen estructuras y funciones similares quizás tengan un origen o antecesor común.

Constituyen la base de los cromosomas y el fundamento de la forma de expresarse la información genética en la síntesis de las proteínas de cada individuo.

La utilización de técnicas para comparar ácidos nucleicos permiten determinar el parentesco familiar y la investigación.

ES IMPORTANTE RECORDAR QUE:

Los polinucleótidos son polímeros de nucleótidos que presentan extremos 5’ y 3’.

La información genética de cada célula somática es prácticamente idéntica. La distinción entre una célula cerebral, muscular o hepática depende del patrón de genes expresados en estas células, las así llamada expresión especifica de tejido.

El flujo de la información genética obedece a la secuencia DNA → RNA →proteina. La información genética de la región estructural de un gen se transcribe en una molécula de RNA de modo que la secuencia de este último es complementaria de la del ADN.

La capacidad de un organismo para responder a retos del medio ambiente dependen de su habilidad para regular, en forma positiva o negativa, cuales genes serán expresados.

GRACIAS

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->