Está en la página 1de 109

MEDICINA LEGAL

CRIMINALÍSTICA

Roger Velásquez G.
IDENTIFICACIÓN MÉDICO LEGAL

DEFINICIÓN
La palabra identificación, o acción de identificar,
proviene del verbo latino identificare, y este a su
vez, de los vocablos identitas - atis,
atis identidad y
calidad de idéntico.

La identidad se define como “la cualidad inherente a


todo ser de permanecer substancialmente él mismo
y, a la vez, diferente de todos los demás” (1)

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


IDENTIFICACION
Conjunto de signos
biosicosociales que
permiten el reconocimiento
de una persona, por parte
de terceros, atribuyendo
individualidad definida,
característica e irrefutable.
IDENTIFICACIÓN MÉDICO LEGAL

IMPORTANCIA
 Una de las tareas más importantes del médico forense
es determinar la identificación del cadáver.
 Identificación apropiada de un individuo:
 Expedición adecuada de documentos (partida de defunción)

 Establecer demandas de seguro

 Registro adecuado de mortalidad del estado (2)

2. Dolinak. Forensic Pathology Principles and Practice. 2005. 1ra. ed. China. Elsevier.
IDENTIFICACION
1. Necesidad de reconocerse
2. Necesidad de comprobar su
identidad
3. Protección de la
sociedad(delincuentes)
4. Razones judiciales (proc. Penal)
5. Poner término a la existencia legal
6. Actos contractuales
IDENTIFICACION
¿ A quién se identifica?:

1. Vivos
2. Muertos
3. Desastres masivos-naturales
IDENTIFICACION

Situaciones en las que es


necesaria la identificación:
1. Filiación
2. Delincuencia
3. Desastre masivos - naturales
4. Víctimas de violencia
IDENTIFICACION
En los delitos siempre se
identifica a :

1. Víctimas
2. Agresores
IDENTIFICACION
Identificación médico legal:
1. Filiación
2. Edad fisiológica
3. Cadáveres frescos, putrefactos y
calcinados
4. Restos cadavéricos: segmentos, trozos
5. Osamentas: completas, aislados, R.O.
IDENTIFICACION
Áreas que involucra:
1. Antropología Forense
2. Tanatología
3. Odontología Legal
4. Genética Forense
5. Traumatología Forense
6. Laboratorio
Bioquímica-Histología
IDENTIFICACIÓN
 En 1879 el antropólogo Alfonso
Bertillon, figura de la investigación
criminal, propuso el “Sistema
Antropométrico”
 Basaba su método en la fijeza casi
absoluta de dimensiones del sistema
óseo del cuerpo humano a partir de los
20 años y en que tales dimensiones,
por el contrario, varían lo suficiente de
una persona a otra.
IDENTIFICACIÓN
 Bertillon asoció después la fotografía a
su sistema antropométrico con normas
uniformes para la obtención de
fotogramas con tanto acierto y precisión
que su método fue admitido y continúa
aún en uso en todos los países con
denominación de “retrato hablado”,
“fotografía de filiación” y “fotografía
judicial”.
IDENTIFICACIÓN
 Sin importar si identifican a un
cadáver o no se debe obtener:
 Fotografía facial
 Huellas digitales completas
 Peso y talla.
 Impresiones palmares; para
compararlas con las impresiones
latentes encontradas en la escena
de un crimen. (2)

2. Dolinak. Forensic Pathology Principles and Practice. 2005. 1ra. ed. China. Elsevier.
Identificación del cadáver reciente (3)
EXÁMENES GENERALES
Examen visual
• Datos Fisonómicos
Descripción de rasgos fisonómicos constituye el
medio más simple para su identificación
Señalamiento descriptivo: fotografía signalética
• Sexo
• Peso
• Talla
• Edad: examen radiológico – odontológico
• Sistema piloso
• Caracteres cromáticos
3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson
Identificación del cadáver reciente (2)
7. Marcas particulares
Señales indelebles (morfología, situación y dimensiones.
Cicatrices, defectos congénitos, deformidades o mutilaciones,
tatuajes y estigmas profesionales

Examen de los vestidos


Conservarse , describirse y fotografiarse
Además objetos: cartera, documentos, etc.

Exámenes médicos
Datos durante la autopsia (enfermedad, IQ)
Toma de muestras

2. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson
3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson
Identificación del cadáver reciente
HUELLAS DACTILARES
Impresiones que dejan los pulpejos de los dedos,
manchados con tinta, sudor u otro líquido, sobre una
superficie pulimentada o cartulina.

Las HD forman dibujos constituidos por unas líneas


entrantes y salientes (surcos y crestas), que dan lugar
a multitud de figuras.

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


ANTROPOLOGÍA
 La Antropología es el estudio de los orígenes y
evolución de la especie humana. Es una disciplina
amplia que abarca lo social, lo cultural y lo
biológico dentro del tiempo y el espacio.

 En ese contexto intervienen otras


disciplinas de la antropología como la
Antropología Social y Cultural, la
Arqueología y la Antropología
Biológica. (1)

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ANTROPOLOGÍA
 La Antropología Sociocultural estudia el arte, las
costumbres, el derecho y otros aspectos de la
sociedad.
 La arqueología analiza el tiempo pasado
de las sociedades, excava e interpreta
los vestigios materiales con el fin de
interpretar los cambios socioculturales.
Es la teoría fundamental de la que se
vale la antropología forense para realizar
las exhumaciones.
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.
 La Antropología Biológica o
Física analiza la diversidad
biológica de la población
humana, a través del estudio
de restos óseos o
momificados, desde el
surgimiento de los primeros
homínidos hasta los
desaparecidos
contemporáneos.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


En Europa la Antropología Biológica es conocida
como Criminal, Legal, Judicial o Policial,
Policial y en el
ámbito americano se conoce como Antropología
Forense.
Forense En Europa surgió en el siglo XIX por el
interés de identificar a delincuentes mediante su
caracterización somática, según Alfonso
Bertillon, y en América por la búsqueda de
desaparecidos.
desaparecidos

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ANTROPOLOGIA FORENSE

Estudio de restos óseos


con el objeto de llegar a la
identificación personal,
averiguar la causa de
muerte, edad, raza, sexo,
talla, marcas
profesionales, antiguas
lesiones óseas, estudio de
la cavidad bucal.
ANTROPOLOGÍA FORENSE
 “Rama de la Antropología Física que con fines
forenses trata de la identificación de restos óseos
humanos”
 La Antropología Forense realiza estudios
analíticos e interpretativos de los restos
óseos humanos que se encuentran
irreconocibles por el proceso de
descomposición y en la que los métodos
tradicionales de identificación no tienen
aplicabilidad.
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.
ANTROPOLOGÍA FORENSE
 Disciplina encargada de la exhumación e
identificación de restos óseos humanos de
desaparecidos.
 Se realiza a través de un trabajo
interdisciplinario conformado por profesionales
en odontología, medicina, biología, química y
geología forenses, además en áreas de la
Criminalística como la fotografía, la topografía,
balística y la investigación judicial con el fin de
aunar esfuerzos en la identificación de los NN.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ANTROPOLOGÍA FORENSE
 Antropología forense en campo
Coordina desde la parte técnica las diligencias de prospección
(búsqueda) y exhumación.

 Antropología forense en laboratorio


Efectúa las mediciones craneométricas y
antropométricas para obtener la Cuarteta Básica
de Identificación (edad, sexo, estatura y patrón
racial), y rasgos individualizantes como
lateralidad.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ANTROPOLOGÍA
FORENSE
El peritaje forense sobre restos
óseos humanos y su entorno,
donde se incluye al proceso de
identificación, la determinación
de las causas y circunstancias de
muerte.
La reconstrucción de la biografía
biológica antemortem del
individuo (osteobiografía).
ANTROPOLOGIA FORENSE

Se apoya en:
1. Crecimiento pre y
postnatal
2. Arqueología
3. Anatomía e histología
ósea
4. Patología ósea,
patología forense
ANTROPOLOGIA FORENSE
Durante la exhumación
el proceder es diferente
si se trata:

1. Restos superficiales
2. Restos enterrados
ANTROPOLOGIA FORENSE
El estudio en
laboratorio se
apoya en :
1. Radiografía
2. Análisis de
imagen
3. Análisis de ADN
PLANOS DE
HORIENTACIÓN
• Plano horizontal de Broca:
o alvéolo-condíleo
(tangente al prostion y a
cóndilo occipital).
• Plano horizontal de
Frankfort: tangente a los
puntos porion-orbital.
• Cráneos incompletos:
glabela-inion, nasion-inion,
glabela-lambda
ESTADO DE CONSERVACIÓN
• Cráneo
• Calvarium: sin
maxilar.
• Calvaria:bóved
a craneana y
región occipital.
• Calota: sólo
bóveda
craneana.
DETERMINACIÓN DE DATA DE RESTOS
 Data de restos  Morfológicos
 Especie.  Histotanatológic
 Individuo. os
 biológicos
 Raza.
 Sexo.
 Edad.
 Talla.
CIERRE DE SUTURAS
SUTURA COMIENZO TERMINACIÓN
SAGITAL 22 A 35 A
ESFENO-FRONTAL 22 A 65 A
CORONAL 24 A 38 A
CORONAL* 26 A 41 A

LAMBDOIDEA 26 A 42 A
LAMBDOIDEA* 26 A 47 A
OCCIPITO-MASTOIDEA 30 A 81 A
OCCIPITO-MASTOIDEA* 26 A 72 A
ESFENO-PARIETAL 29 A 65 A
ESFENO-TEMPORAL 30 A 67 A
PARIETO-MASTOIDEA 37 A 81 A
ESCAMOSA 37 A 81 A
DESARROLLO
PRIMER PERIODO (0 - 5 años):
Aparición de centros de osificación. Los
dientes deciduales erupcionan; los
permanentes se calcifican. Este es un
período ontogenético estable pero
crítico.
SEGUNDO PERIODO (5 -12/3 años):

Incremento en el tamaño, cambios en


la configuración y forma, definición de
detalles arquitectónicos en centros de
osificación existentes. Finaliza con la
unión de los elementos integrantes del
acetábulo. Todos los dientes
permanentes han erupcionado
(excepto 3º molar). Período variable
aunque menos crítico.
TERCER PERIODO (12/3 - 20 años)

Período de unión epifisial en


los huesos largos y de
cambios iniciales en la sínfisis
púbica y en las costillas del
esternón. Este período se
caracteriza por ser estable
pero crítico.
CUARTO PERIODO (20 - 25 años):

Final de unión epifisial, de


centros vertebrales; cubre
fases tempranas de la sínfisis
púbica, metamorfosis de las
costillas esternales e inicio de
sinostosis de las suturas de la
bóveda craneal. Estable y
completamente crítico.
QUINTO PERIODO (25 -36
años)
Período de fases activas
de sinostosis de suturas
neurocraneales y de fases
medias en los cambios
costales y observados en
sínfisis púbica. Variable
aunque menos crítico.
SEXTO PERIODO (6 - 40 años)
Cierre de suturas
neurocraneales y sínfisis
púbica. Costillas esternales y
área circundante al meato
auditivo en progreso.
Superficies articulares de
huesos empiezan a registrar
cambios ontogenéticos (inicio
de conformación de labios en
fosa glenoidea y escápula).
Menos crítico que el anterior.
SÉTIMO PERIODO (50 - + AÑOS)

Principio de la senilidad reflejada


en el avance de la porosidad en
los huesos planos y largos
(superficies articulares).
Radiográficamente la textura ósea
muestra cambios trabeculares.
Fase final costal y de suturas
circundantes al meato auditivo.
Extremadamente variable pero no
crítico.
• El empleo de técnicas
arqueológicas permite
recuperar los restos
óseos de manera
completa y articulada.
Las cintas de colores
señalan los restos que
corresponden a cada
individuo, es necesario
en primer lugar exponer
toda la superficie de la
fosa y trabajar desde
afuera de la misma para
no dañar o mover los
hallazgos.
Húmero fracturado
por disparos de
arma de fuego, los
proyectiles se
encontraron in
situ, asociados a
las lesiones del
húmero y tórax.
LOFOSCOPÍA …
DACTILOSCOPÍA
La dactiloscopia “consiste en
el estudio de las imágenes
obtenidas de las
impresiones que dejan las
crestas papilares de los
dedos”
DACTILOSCOPÍA
Griego:
“daktylos”: dedo
“skopein”: examen o estudio

Proceso de identificación por


medio de impresiones digitales
se divide en dactiloscopía civil y
criminal (4)

4. Carlos Kendy - Elemento Criminalístico


Identificación del cadáver reciente
Fundamentos de la clasificación dactiloscópica
Huellas dactilares o dactilogramas presentan características
fundamentales.
• Inmutabilidad: papilas dérmicas y poros aparecen a los 100 a
120 días de vida IU, alcanzan nitidez al 6º mes.
2. Inalterabilidad: no se modifican a menos que se
afecten las capas profundas de la dermis

3. Variabilidad

4. Posibilidad de clasificación

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


Identificación del cadáver reciente
Caracteres Generales de los Dactilogramas
Se distinguen 3 sistemas de líneas.
• Basilar: formado por un sistema de líneas transversales por
encima del pliegue de flexión, que van del lado cubital al radial
2. Marginal: líneas que contornean el pulpejo, de un
lado al otro, describiendo un arco.

3. Nuclear: puede existir o no. Queda entre los 2


anteriores. Pueden formar un circulo o un “asa”

Delta

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


DACTILOGRAMAS
• Se entiende por dactilograma “el
conjunto de crestas papilares que
se encuentran en la última
falange de los dedos”
• Dentro de los dactilogramas es
posible distinguir tres grupos: los
arcos,
arcos las presillas o lazos y
los verticilos.
verticilos
El delta es “el punto de una
cresta situado en la
divergencia de las líneas
directrices, o el
punto más cercano y frente
al centro de la divergencia
de dichas directrices”78.
Una
bifurcación, una cresta corta
o que finalice en forma
abrupta, un punto, o dos
crestas
convergentes podrán ser
catalogadas como deltas.
Los verticilos pueden
definirse como aquellos
dibujos dactilares en los
que existen como
mínimo dos deltas, con
una recurva frente a
cada delta.
Identificación del cadáver reciente
Clasificación de los Dactilogramas
1. Adeltos: Carecen de delta, y por tanto de sistema nuclear

2. Monodeltos
Dextrodeltos, situado el delta en el dactilograma a la derecha del
observador en relación con el núcleo.
Sinistrodeltos, si el delta está a la izquierda del
observador del dactilograma en relación con el núcleo.

3. Verticilos: Según tengan dos o más deltas


(Bideltos, Trideltos, etc.) En la fórmula decadactilar y
en la monodactilar, se representan por letras si se
trata de los dedos pulgares y por números para
cualquiera de los otros cuatro dedos de la mano.

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


Identificación del cadáver reciente
Técnica Dactiloscópica
Pueden ser asiento de huellas del delincuente todas aquellas
superficies pulimentadas, como maderas, vidrios, armas e incluso
papeles.

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


Necrodactilia

Procedimiento de toma de las huellas dactilares de cada uno de los


dedos, utilizando un pequeño rodillo, una almohadilla con tinta y una
cartulina blanca, en la que se indica a que dedo de la mano corresponde
cada huella
El procedimiento variará según cada caso, en razón a factores, como el
estado de conservación del cadáver; la causa de la muerte; data, etc

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson


Necrodactilia
 Muerte reciente
 Rigidez cadavérica:
cadavérica Espátula de entinado y planchuela acanalada o
cuchara, la cual elimina la necesidad de hacer rodar los dedos del
cadáver por cuanto su forma cóncava le da el efecto de rodamiento.
Si no se logra una impresión completa de las papilas
dactilares por arrugas en la piel, inyectar un reconstructor de tejidos
(glicerina).

Si no se logra una impresión


completa de las papilas
dactilares por arrugas en la
piel, inyectar un reconstructor
de tejidos (glicerina).
 Estado de descomposición:
descomposición
Colocar los dedos en solución
de formaldehido al 10 – 15% x
1 hora
 En quemados
Fotografías
 En maceración
Alcohol o bencina
La toma de las impresiones dactilares
permitirá al técnico encargado de un
examen dactilar,
clasificar las impresiones e iniciar la
correspondiente búsqueda en los
registros
correspondientes, con el fin de obtener
la identidad del individuo a través de la
comparación de dichas impresiones con
las impresiones de las personas
identificadas que
aparecen en los registros.
• Huellas digitales
• Huellas palmares
• Pisadas o impresiones de neumático
“Dios pone un sello en la
mano de todos los hombres
para que cada uno conozca
sus obras"

Job 37.7
ODONTOLOGÍA
El diente constituye la estructura más sólida del cuerpo
humano y puede llegar a constituir, en algunos casos,
la única parte del cuerpo de una persona que pueda ser
utilizada como material de estudio para obtener una
identificación positiva.

La identificación a través de las características de los


dientes es parte de la odontología forense.

Amoedo publicó la obra “El arte dental en medicina legal”

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ODONTOLOGÍA
La identificación a individuos por los dientes y
otras características se conoce como
Estomatología Legal, Odontología Legal o
Estomatología Forense

 La inspección intraoral dará inicio con


una primera fase de recolección de
datos, la cual implicará un examen
visual de la condición de los dientes y
las características de los maxilares y
los tejidos blandos adyacentes

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ODONTOLOGÍA

 La identificación de personas, vivas o


muertas, individualmente o en desastres
masivos.
 Análisis de traumas dentales, lesiones o
marcas dejadas por los dientes (mordidas).
 Realización de estimaciones sobre la edad,
sexo y grupo étnico.
 Aclaración de problemas legales
relacionados con la profesión
estomatológica.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ODONTOLOGÍA
 El odontólogo forense asiste al proceso de identificación
cuando la identificación visual no es posible, en casos
como:
 Incineración

 Descomposición

 Desfiguración severa

(lesiones de alto impacto, explosiones, tiro facial heridas, etc.), y

 Esqueletización

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


DENTICION TEMPORAL
 Incisivo Central: 6 a 8
meses
 Incisivo Lateral: 8 a 12
meses
 Canino: 15 a 20 meses
 Primer Molar: 12 a 16
meses
 Segundo Molar: 20 a 40
meses
DENTICION PERMANENTE
 Incisivo Central: 6 a 8 años
 Incisivo Lateral: 6 a 8 años
 Canino: 10 a 14 años
 Primer Premolar: 9 a 12 años
 Segundo Premolar: 10 a 13
años
 Primer Molar: 6 a 7 años
 Segundo Molar: 10 a 13 años
 Tercer Molar: 16 a 30 años
ODONTOLOGÍA
La Odontología en la
identificación de
personas contribuye
con datos sobre la
estimación de sexo,
edad, filiación
poblacional y otros
rasgos
individualizantes.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


ODONTOLOGÍA
 Los métodos de análisis de la Estomatología Forense se
basan en la concordancia entre los datos premortem y
posmortem, en su mayoría acerca de los dientes (registros
dentales: fotografías intrabucales, radiografías dentales,
impresiones y modelos de estudio de los dientes,
maxilares y dentadura), así como en las particularidades
de las arcadas dentarias y rugosidades palatinas, que
constituyen los rasgos característicos de cada individuo.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


Odontología forense
 Tomar fotografías

 Examen dental - Inspección intraoral visual

 Dentograma

 Radiografía de dientes y maxilares

La radiografía dental comparativa son los medios más


exactos de la identificación dental

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


Protocolo Dental Postmortem
 Tomar fotografías

 Examen dental - Inspección intraoral visual

 Dentograma

 Radiografía de dientes y maxilares

Son el medio más exacto de identificación dental

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


Protocolo Dental Postmortem
 Examen dental
 Número de dientes
 Restauraciones y prótesis: tipo de prótesis, tipo de material, diente comprometido
 Fracturas y caries dental
 Malposición y rotación
 Formación anómala
 Terapia del conducto radicular
 Patrones del hueso
 Endodoncia
 Oclusión
 Patología bucal
 Tipo de mordida

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


Identificación sin datos
premortem

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


Identificación sin datos
premortem

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.


INVESTIGACIÓN GENÉTICA A
INDICIOS:
ADN
 La inclusión del análisis de los polimorfismos del ADN ha
supuesto el mayor avance en la identificación criminal.

 El ADN cumple con todos los requisitos que le son


exigibles a cualquier prueba para su uso en ciencias
forenses:

Investigación forense de la paternidad

Identificación de indicios criminales


ADN en la célula

Chromosome

cell nucleus

double-stranded
DNA molecule Target Region for PCR

Individual
nucleotides
Ventajas del ADN en

criminalística
Cantidad de la muestra:

PCR y secuenciación

 Calidad de la muestra:

Short tandem repeats STR

 Aumento de la probabilidad de discriminación:

Loci

 Presencia en todos los indicios:

En todos los núcleos celulares


Fuente de evidencias biológicas

• Sangre
• Semen
• Saliva
• Orina
• Pelo
• Diente
• Bone
• Tejidos
Tipos de ADN según su herencia
y uso en genética forense
 ADN nuclear autosómico
Existente en los 22 pares de cromosomas

Sirve para establecer lazos de paternidad y maternidad

Gran polimorfismo: muy variable, excepto en gemelos univitelinos

 ADN del cromosoma Y


Delitos contra la libertad sexual

Estudio de paternidad “padre – hijo varón”


Tipos de ADN según su herencia
y uso en genética forense
 ADN mitocondrial (ADN mt)
 En todos los casos procede de la madre

 Marcador de relación madre – hijos (materno filial)

 Uso cuando la cantidad ADN es muy limitada o muestras antiguas


Polimorfismo del ADN

La capacidad de identificación por medio del


ADN se basa en la presencia de regiones
(locus o loci) polimórficas o hipervariables. Las
largas cadenas de ADN, compuestas por
millones de pares de bases , presentan zonas
en las que los pares de bases se repiten de una
forma secuencial y determinada (repeticiones
en tandem o tandem repeats), específicas en
longitud y localización para cada persona.
 Restriction Fragment Length
Polymorphism (RFLP)
 PCR Analysis
 STR Analysis
 Mitochondrial DNA Analysis
 Y-Chromosome Analysis
Técnicas Forenses de Análisis de
ADN
 Extracción del ADN: Orgánica – con Chelex - Diferencial

 Cuantificación del ADN extraído

 Estudio de las regiones hipervariables por:

a) Hibridación y southern-blotting de RFLP

b) Amplificación por PCR

c) Secuenciación de ADN mitocondrial


Steps Involved Steps in Forensic DNA Analysis
Collection Usually 1-2 day process (a minimum of ~5 hours)
Slot Blot
1 ng
Specimen Storage 0.3 ng
No DNA
0.5 ng
0.5 ng
Extraction 0.7 ng
1 ng
Blood Stain Buccal swab
1 ng
Quantitation Sample Collection DNA DNA

Biology
& Storage
Extraction Quantitation
Multiplex PCR

STR Typing
Genetics

If a match occurs, comparison of


DNA profile to population allele Multiplex PCR Amplification
Interpretation frequencies to generate a case
report with probability of a random
of Results match to an unrelated individual DNA separation and sizing

Technology
Database
Storage & Searching DNA
Database STR Typing
Calculation of Search
Match Probability Male: 13,14-15,16-12,13-10,13-15,16
Interpretation of Results
Short Tandem Repeat (STR) Markers
PCR primers anneal to unique sequences
bracketing the variable STR repeat region PCR Product Size (bp)

The overall PCR product size is measured

Fluorescent PCR product size generated Allelic Ladder


dye
Forward DNA template
PCR primer containing STR marker

Reverse
PCR primer

Sample
GATA GATA GATA GATA #1
STR repeat region

TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGA
AGACAGGTGGATAGATAGATAGATAGATAGATAGATA Sample
#2
GATAGATAGATAGATATCATTGAAAGACAAAACAGAGA
TGGATGATAGATACATGCTTACAGATGCACAC

= 11 GATA repeats (“11” is all that is reported)


Position of Forensic STR Markers
on Human Chromosomes
TPOX 13 Core U.S. STR Loci
D3S1358

TH01 1997
D8S1179
D5S818 VWA
FGA D7S820
CSF1PO

8 STR loci overlap between U.S. and Europe


AMEL
Sex-typing
D13S317
D16S539 D18S51 D21S11 AMEL
Fluorescent
dye-labeled
primer
Short Tandem Repeat (STR) Typing
STR Repeat Region
3′
5′
1 2 3 4 5 6 (Maternal)
3′
5′
1 2 3 4 5 6 7 8 (Paternal)

forward primer GATA reverse primer


hybridization region hybridization region

(size in bp)
75….80….100….120….140….160….180….200….220….240.…260…..
1000
RFUs 500

6 DNA Separation and Detection


139bp
8
147bp
PATERNITY TESTING
Family Inheritance of STR Alleles (D13S317)
PCR product size (bp)

11 14
Father

12 14
Child #1

8 14
Child #2

11 12
Child #3

8 12
Mother
Steps in DNA Sample Processing
Sample
SampleObtained
Obtained
from
from CrimeScene
Crime Scene
ororPaternity
Paternity
Investigation
Investigation Biology
DNA
DNA DNA
DNA PCR
PCRAmplification
Amplification
Extraction
Extraction Quantitation
Quantitation ofofMultiple
MultipleSTR
STRmarkers
markers

Technology
Separation and Detection of Sample Genotype
PCR Products Determination
(STR Alleles)

Genetics
Comparison
Comparison of
of Sample
Sample Generation
Generation ofof Case
Case
Genotype to Other
Genotype to Other Report
Report with Probability of
with Probability of
Sample
Sample Results
Results Random
Random Match
Match
IfIf match
match occurs,
occurs, comparison
comparison of
of
DNA profile to population
DNA profile to population
databases
databases
MANUAL DE PROCEDIMIENTOS
DE LA DILIGENCIA DE
LEVANTAMIENTO DE CADAVER

Según Gisbert Calabuig, el levantamiento


del cadáver es el primer tiempo de la
autopsia médico legal. A lo que debemos
agregar en concordancia con otros autores
que constituye las 2/3 de la posterior e
inmediata necroscopia de ley.
DEFINICIÓN
Es el estudio que realiza el médico legista
y el equipo de profesionales de las
ciencias forenses, de todo lo existente en
el lugar de los hechos (tanto del continente
como de su contenido) o el lugar del
hallazgo, donde se
encuentre (n) cadáver (es) o restos
humanos con la finalidad de establecer si
la muerte es de etiología violenta, natural o
sospechosa de criminalidad.
OBJETIVOS
1. - Comprobar la Muerte.
2. - Estimar el Intervalo Post Mortem.
3. - Contribuir a determinar el
modo, mecanismo, y manera
de muerte.
4. - Contribuir con información
sobre la presunta causa de
muerte.
BASE LEGAL
 Constitución Política del Perú.
 Ley de Creación del IML Leonidas
Avendaño Ureta, Ley Nº 24128.
 Resolución de la Fiscalía de la Nación
Nº 192-94-MP-FN.
 Nuevo Código Procesal Penal Decreto
Legislativo Nº 957. Del 29 de Julio 2004.
BASE TÉCNICA CIENTÍFICA

“El levantamiento de cadáver


en el lugar de los hechos, debe
garantizar la perennización de
la escena del hecho,
describiendo la misma en su
totalidad exhaustiva y
detallada”
PRINCIPIOS DE INTERCAMBIO DE
LOCARD
1. - El agresor se lleva rastros de la
Escena y de la Victima.
2. - El agresor deja rastros en la escena
y en la victima.
3. - La victima se queda con rastros del
agresor y de la escena.
4. - la escena puede dejar rastros en el
agresor y en la victima.
2.1.- Personal que asistirá a la pericia:

Profesional:
a) Medico Legista.
b) Profesionales de las Ciencias Forenses disponibles de acuerdo a la
Jurisdicción donde se suscite el hecho: Por Ej.: Biólogo, Toxicólogo,
Antropólogo, Odontólogo, otros.

Técnico:
a) Técnico entrenado en Necropsias
b) Técnico Criminalístico (en caso de contar con el recurso).
c) Técnico perito para procedimientos Audio visuales, fotográficos, y
gráficos,
en caso de contar con el recurso.

Administrativo:
a) Técnico Administrativo. (Secretario / Chofer)
MOMENTO DEL RECONOCIMIENTO MEDICO
LEGAL DEL CADAVER:
Con el Cadáver Desnudo:
4.2.1. Identificación:
4.2.2. Descripción de Signos de los Fenómenos Cadavéricos
Presentes.
Deshidratación Cadavérica, temperatura, rigidez
cadavérica, livideces, enfriamiento cadavérico
Signos de putrefacción
Signos de conservación cadavérica
Signos de Antropofagia cadavérica
MOMENTO DEL RECONOCIMIENTO MEDICO
LEGAL DEL CADAVER:
4.2.3. Otros signos de interés:
 Signos de Asfixia
 Signos de atención médica
 Signos de postración
 Signos de cadáveres sumergidos
 Signos externos de embarazo
 Signos de toxicidad
MOMENTO DEL RECONOCIMIENTO MEDICO
LEGAL DEL CADAVER:

4.2.3. Signos de violencia externa de reciente data


 Cabeza
 Cuello
 Axilas
 Tórax y abdomen
 Extremidades superiores
 Extremidades inferiores
MOMENTO FINAL DEL LEVANTAMIENTO

 Relación de Indicios y/o Evidencias recolectadas y


personal responsable de la toma de muestra,
conservación, protección y embalaje.
 Lugar de destino de los indicios y/o evidencias
recolectadas.
 Cadena de Custodia.

 Complementar Información.

 Sobre la causa de la muerte