P. 1
MEDICINA LEGAL CRIMINALÍSTICA

MEDICINA LEGAL CRIMINALÍSTICA

|Views: 10.850|Likes:

More info:

Published by: Curso de Medicina Legal on Jan 03, 2010
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PPT, PDF, TXT or read online from Scribd
See more
See less

07/22/2015

pdf

text

original

MEDICINA LEGAL CRIMINALÍSTICA

Roger Velásquez G.

IDENTIFICACIÓN MÉDICO LEGAL DEFINICIÓN
La palabra identificación, o acción de identificar, proviene del verbo latino identificare, y este a su vez, de los vocablos identitas - atis, identidad y atis calidad de idéntico.

La identidad se define como “la cualidad inherente a todo ser de permanecer substancialmente él mismo y, a la vez, diferente de todos los demás” (1)

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

IDENTIFICACION
Conjunto de signos biosicosociales que permiten el reconocimiento de una persona, por parte de terceros, atribuyendo individualidad definida, característica e irrefutable.

IDENTIFICACIÓN MÉDICO LEGAL
IMPORTANCIA
 Una de las tareas más importantes del médico forense es determinar la identificación del cadáver.  Identificación apropiada de un individuo:
 Expedición adecuada de documentos (partida de defunción)  Establecer demandas de seguro  Registro adecuado de mortalidad del estado (2)

2. Dolinak. Forensic Pathology Principles and Practice. 2005. 1ra. ed. China. Elsevier.

IDENTIFICACION
1. Necesidad de reconocerse 2. Necesidad de comprobar su identidad 3. Protección de la sociedad(delincuentes) 4. Razones judiciales (proc. Penal) 5. Poner término a la existencia legal 6. Actos contractuales

IDENTIFICACION ¿ A quién se identifica?:
1. Vivos 2. Muertos 3. Desastres masivos-naturales

IDENTIFICACION
Situaciones en las que es necesaria la identificación: Filiación Delincuencia Desastre masivos - naturales Víctimas de violencia

1. 2. 3. 4.

IDENTIFICACION
En los delitos siempre se identifica a : 1. Víctimas 2. Agresores

IDENTIFICACION
1. 2. 3. 4. 5. Identificación médico legal: Filiación Edad fisiológica Cadáveres frescos, putrefactos y calcinados Restos cadavéricos: segmentos, trozos Osamentas: completas, aislados, R.O.

IDENTIFICACION
Áreas que involucra: 1. Antropología Forense 2. Tanatología 3. Odontología Legal 4. Genética Forense 5. Traumatología Forense 6. Laboratorio Bioquímica-Histología

IDENTIFICACIÓN
 En 1879 el antropólogo Alfonso Bertillon, figura de la investigación criminal, propuso el “Sistema Antropométrico”  Basaba su método en la fijeza casi absoluta de dimensiones del sistema óseo del cuerpo humano a partir de los 20 años y en que tales dimensiones, por el contrario, varían lo suficiente de una persona a otra.

IDENTIFICACIÓN
 Bertillon asoció después la fotografía a su sistema antropométrico con normas uniformes para la obtención de fotogramas con tanto acierto y precisión que su método fue admitido y continúa aún en uso en todos los países con denominación de “retrato hablado”, “fotografía de filiación” y “fotografía judicial”.

IDENTIFICACIÓN
 Sin importar si identifican a un cadáver o no se debe obtener:  Fotografía facial  Huellas digitales completas  Peso y talla.  Impresiones palmares; para compararlas con las impresiones latentes encontradas en la escena de un crimen. (2)

2. Dolinak. Forensic Pathology Principles and Practice. 2005. 1ra. ed. China. Elsevier.

Identificación del cadáver reciente (3)
EXÁMENES GENERALES Examen visual • Datos Fisonómicos
Descripción de rasgos fisonómicos constituye el medio más simple para su identificación Señalamiento descriptivo: fotografía signalética

• • • • • •

Sexo Peso Talla Edad: examen radiológico – odontológico Sistema piloso Caracteres cromáticos

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

Identificación del cadáver reciente (2)
7. Marcas particulares
Señales indelebles (morfología, situación y dimensiones. Cicatrices, defectos congénitos, deformidades o mutilaciones, tatuajes y estigmas profesionales

Examen de los vestidos
Conservarse , describirse y fotografiarse Además objetos: cartera, documentos, etc.

Exámenes médicos
Datos durante la autopsia (enfermedad, IQ) Toma de muestras

2. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

Identificación del cadáver reciente
HUELLAS DACTILARES
Impresiones que dejan los pulpejos de los dedos, manchados con tinta, sudor u otro líquido, sobre una superficie pulimentada o cartulina. Las HD forman dibujos constituidos por unas líneas entrantes y salientes (surcos y crestas), que dan lugar a multitud de figuras.

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

ANTROPOLOGÍA
 La Antropología es el estudio de los orígenes y evolución de la especie humana. Es una disciplina amplia que abarca lo social, lo cultural y lo biológico dentro del tiempo y el espacio.  En ese contexto intervienen otras disciplinas de la antropología como la Antropología Social y Cultural, la Arqueología y la Antropología Biológica. (1)
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ANTROPOLOGÍA
 La Antropología Sociocultural estudia el arte, las costumbres, el derecho y otros aspectos de la sociedad.  La arqueología analiza el tiempo pasado de las sociedades, excava e interpreta los vestigios materiales con el fin de interpretar los cambios socioculturales. Es la teoría fundamental de la que se vale la antropología forense para realizar las exhumaciones.
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

 La Antropología Biológica o Física analiza la diversidad biológica de la población humana, a través del estudio de restos óseos o momificados, desde el surgimiento de los primeros homínidos hasta los desaparecidos contemporáneos.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

En Europa la Antropología Biológica es conocida como Criminal, Legal, Judicial o Policial, y en el Policial ámbito americano se conoce como Antropología Forense. En Europa surgió en el siglo XIX por el Forense interés de identificar a delincuentes mediante su caracterización somática, según Alfonso Bertillon, y en América por la búsqueda de desaparecidos. desaparecidos

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ANTROPOLOGIA FORENSE
Estudio de restos óseos con el objeto de llegar a la identificación personal, averiguar la causa de muerte, edad, raza, sexo, talla, marcas profesionales, antiguas lesiones óseas, estudio de la cavidad bucal.

ANTROPOLOGÍA FORENSE
 “Rama de la Antropología Física que con fines forenses trata de la identificación de restos óseos humanos”  La Antropología Forense realiza estudios analíticos e interpretativos de los restos óseos humanos que se encuentran irreconocibles por el proceso de descomposición y en la que los métodos tradicionales de identificación no tienen aplicabilidad.
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ANTROPOLOGÍA FORENSE
 Disciplina encargada de la exhumación e identificación de restos óseos humanos de desaparecidos.
 Se realiza a través de un trabajo interdisciplinario conformado por profesionales en odontología, medicina, biología, química y geología forenses, además en áreas de la Criminalística como la fotografía, la topografía, balística y la investigación judicial con el fin de aunar esfuerzos en la identificación de los NN.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ANTROPOLOGÍA FORENSE
 Antropología forense en campo
Coordina desde la parte técnica las diligencias de prospección (búsqueda) y exhumación.

 Antropología forense en laboratorio
Efectúa las mediciones craneométricas y antropométricas para obtener la Cuarteta Básica de Identificación (edad, sexo, estatura y patrón racial), y rasgos individualizantes como lateralidad.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ANTROPOLOGÍA FORENSE
El peritaje forense sobre restos óseos humanos y su entorno, donde se incluye al proceso de identificación, la determinación de las causas y circunstancias de muerte. La reconstrucción de la biografía biológica antemortem del individuo (osteobiografía).

ANTROPOLOGIA FORENSE
Se apoya en: Crecimiento pre y postnatal Arqueología Anatomía e histología ósea Patología ósea, patología forense

1. 2. 3. 4.

ANTROPOLOGIA FORENSE
Durante la exhumación el proceder es diferente si se trata: 1. Restos superficiales 2. Restos enterrados

ANTROPOLOGIA FORENSE
El estudio en laboratorio se apoya en : 1. Radiografía 2. Análisis de imagen 3. Análisis de ADN

PLANOS DE HORIENTACIÓN
• Plano horizontal de Broca: o alvéolo-condíleo (tangente al prostion y a cóndilo occipital). • Plano horizontal de Frankfort: tangente a los puntos porion-orbital. • Cráneos incompletos: glabela-inion, nasion-inion, glabela-lambda

ESTADO DE CONSERVACIÓN
• Cráneo • Calvarium: sin maxilar. • Calvaria:bóved a craneana y región occipital. • Calota: sólo bóveda craneana.

DETERMINACIÓN DE DATA DE RESTOS
 Data de restos  Especie.  Individuo.  Raza.  Sexo.  Edad.  Talla.

 Morfológicos  Histotanatológic os  biológicos

CIERRE DE SUTURAS

SUTURA SAGITAL ESFENO-FRONTAL CORONAL CORONAL* LAMBDOIDEA LAMBDOIDEA* OCCIPITO-MASTOIDEA OCCIPITO-MASTOIDEA* ESFENO-PARIETAL ESFENO-TEMPORAL PARIETO-MASTOIDEA ESCAMOSA

COMIENZO 22 A 22 A 24 A 26 A 26 A 26 A 30 A 26 A 29 A 30 A 37 A 37 A

TERMINACIÓN 35 A 65 A 38 A 41 A 42 A 47 A 81 A 72 A 65 A 67 A 81 A 81 A

DESARROLLO
PRIMER PERIODO (0 - 5 años): Aparición de centros de osificación. Los dientes deciduales erupcionan; los permanentes se calcifican. Este es un período ontogenético estable pero crítico.

SEGUNDO PERIODO (5 -12/3 años):
Incremento en el tamaño, cambios en la configuración y forma, definición de detalles arquitectónicos en centros de osificación existentes. Finaliza con la unión de los elementos integrantes del acetábulo. Todos los dientes permanentes han erupcionado (excepto 3º molar). Período variable aunque menos crítico.

TERCER PERIODO (12/3 - 20 años) Período de unión epifisial en los huesos largos y de cambios iniciales en la sínfisis púbica y en las costillas del esternón. Este período se caracteriza por ser estable pero crítico.

CUARTO PERIODO (20 - 25 años): Final de unión epifisial, de centros vertebrales; cubre fases tempranas de la sínfisis púbica, metamorfosis de las costillas esternales e inicio de sinostosis de las suturas de la bóveda craneal. Estable y completamente crítico.

QUINTO PERIODO (25 -36 años)
Período de fases activas de sinostosis de suturas neurocraneales y de fases medias en los cambios costales y observados en sínfisis púbica. Variable aunque menos crítico.

SEXTO PERIODO (6 - 40 años) Cierre de suturas neurocraneales y sínfisis púbica. Costillas esternales y área circundante al meato auditivo en progreso. Superficies articulares de huesos empiezan a registrar cambios ontogenéticos (inicio de conformación de labios en fosa glenoidea y escápula). Menos crítico que el anterior.

SÉTIMO PERIODO (50 - + AÑOS)
Principio de la senilidad reflejada en el avance de la porosidad en los huesos planos y largos (superficies articulares). Radiográficamente la textura ósea muestra cambios trabeculares. Fase final costal y de suturas circundantes al meato auditivo. Extremadamente variable pero no crítico.

• El empleo de técnicas arqueológicas permite recuperar los restos óseos de manera completa y articulada. Las cintas de colores señalan los restos que corresponden a cada individuo, es necesario en primer lugar exponer toda la superficie de la fosa y trabajar desde afuera de la misma para no dañar o mover los hallazgos.

Húmero fracturado por disparos de arma de fuego, los proyectiles se encontraron in situ, asociados a las lesiones del húmero y tórax.

La dactiloscopia “consiste en el estudio de las imágenes obtenidas de las impresiones que dejan las crestas papilares de los dedos”

LOFOSCOPÍA … DACTILOSCOPÍA

DACTILOSCOPÍA
Griego: “daktylos”: dedo “skopein”: examen o estudio Proceso de identificación por medio de impresiones digitales se divide en dactiloscopía civil y criminal (4)

4. Carlos Kendy - Elemento Criminalístico

Identificación del cadáver reciente
Fundamentos de la clasificación dactiloscópica
Huellas dactilares o dactilogramas presentan características fundamentales. • Inmutabilidad: papilas dérmicas y poros aparecen a los 100 a 120 días de vida IU, alcanzan nitidez al 6º mes.

2. Inalterabilidad: no se modifican a menos que se afecten las capas profundas de la dermis 3. Variabilidad 4. Posibilidad de clasificación

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

Identificación del cadáver reciente
Caracteres Generales de los Dactilogramas
Se distinguen 3 sistemas de líneas. • Basilar: formado por un sistema de líneas transversales por encima del pliegue de flexión, que van del lado cubital al radial

2. Marginal: líneas que contornean el pulpejo, de un lado al otro, describiendo un arco. 3. Nuclear: puede existir o no. Queda entre los 2 anteriores. Pueden formar un circulo o un “asa”

Delta

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

DACTILOGRAMAS
• Se entiende por dactilograma “el conjunto de crestas papilares que se encuentran en la última falange de los dedos” • Dentro de los dactilogramas es posible distinguir tres grupos: los arcos, las presillas o lazos y arcos los verticilos. verticilos

El delta es “el punto de una cresta situado en la divergencia de las líneas directrices, o el punto más cercano y frente al centro de la divergencia de dichas directrices”78. Una bifurcación, una cresta corta o que finalice en forma abrupta, un punto, o dos crestas convergentes podrán ser catalogadas como deltas.

Los verticilos pueden definirse como aquellos dibujos dactilares en los que existen como mínimo dos deltas, con una recurva frente a cada delta.

Identificación del cadáver reciente
Clasificación de los Dactilogramas
1. Adeltos: Carecen de delta, y por tanto de sistema nuclear 2. Monodeltos
Dextrodeltos, situado el delta en el dactilograma a la derecha del observador en relación con el núcleo. Sinistrodeltos, si el delta está a la izquierda del observador del dactilograma en relación con el núcleo.

3. Verticilos: Según tengan dos o más deltas (Bideltos, Trideltos, etc.) En la fórmula decadactilar y en la monodactilar, se representan por letras si se trata de los dedos pulgares y por números para cualquiera de los otros cuatro dedos de la mano.

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

Identificación del cadáver reciente
Técnica Dactiloscópica
Pueden ser asiento de huellas del delincuente todas aquellas superficies pulimentadas, como maderas, vidrios, armas e incluso papeles.

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

Necrodactilia
Procedimiento de toma de las huellas dactilares de cada uno de los dedos, utilizando un pequeño rodillo, una almohadilla con tinta y una cartulina blanca, en la que se indica a que dedo de la mano corresponde cada huella El procedimiento variará según cada caso, en razón a factores, como el estado de conservación del cadáver; la causa de la muerte; data, etc

3. Gisbert Calabuig - Medicina Legal y toxicología . 6ta ed. España: Masson

Necrodactilia
 Muerte reciente  Rigidez cadavérica: Espátula de entinado y planchuela acanalada o cadavérica cuchara, la cual elimina la necesidad de hacer rodar los dedos del cadáver por cuanto su forma cóncava le da el efecto de rodamiento. Si no se logra una impresión completa de las papilas dactilares por arrugas en la piel, inyectar un reconstructor de tejidos (glicerina). Si no se logra una impresión completa de las papilas dactilares por arrugas en la piel, inyectar un reconstructor de tejidos (glicerina).

 Estado de descomposición: descomposición Colocar los dedos en solución de formaldehido al 10 – 15% x 1 hora  En quemados Fotografías  En maceración Alcohol o bencina

La toma de las impresiones dactilares permitirá al técnico encargado de un examen dactilar, clasificar las impresiones e iniciar la correspondiente búsqueda en los registros correspondientes, con el fin de obtener la identidad del individuo a través de la comparación de dichas impresiones con las impresiones de las personas identificadas que aparecen en los registros.

• • •

Huellas digitales Huellas palmares Pisadas o impresiones de neumático

“Dios pone un sello en la mano de todos los hombres para que cada uno conozca sus obras"
Job 37.7

ODONTOLOGÍA
El diente constituye la estructura más sólida del cuerpo humano y puede llegar a constituir, en algunos casos, la única parte del cuerpo de una persona que pueda ser utilizada como material de estudio para obtener una identificación positiva. La identificación a través de las características de los dientes es parte de la odontología forense.
Amoedo publicó la obra “El arte dental en medicina legal”

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ODONTOLOGÍA
La identificación a individuos por los dientes y otras características se conoce como Estomatología Legal, Odontología Legal o Estomatología Forense
 La inspección intraoral dará inicio con una primera fase de recolección de datos, la cual implicará un examen visual de la condición de los dientes y las características de los maxilares y los tejidos blandos adyacentes
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ODONTOLOGÍA
 La identificación de personas, vivas o muertas, individualmente o en desastres masivos.  Análisis de traumas dentales, lesiones o marcas dejadas por los dientes (mordidas).  Realización de estimaciones sobre la edad, sexo y grupo étnico.  Aclaración de problemas legales relacionados con la profesión estomatológica.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ODONTOLOGÍA
 El odontólogo forense asiste al proceso de identificación cuando la identificación visual no es posible, en casos como:  Incineración  Descomposición  Desfiguración severa
(lesiones de alto impacto, explosiones, tiro facial heridas, etc.), y

 Esqueletización

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

DENTICION TEMPORAL
 Incisivo Central: 6 a 8 meses  Incisivo Lateral: 8 a 12 meses  Canino: 15 a 20 meses  Primer Molar: 12 a 16 meses  Segundo Molar: 20 a 40 meses

DENTICION PERMANENTE
 Incisivo Central: 6 a 8 años  Incisivo Lateral: 6 a 8 años  Canino: 10 a 14 años  Primer Premolar: 9 a 12 años  Segundo Premolar: 10 a 13 años  Primer Molar: 6 a 7 años  Segundo Molar: 10 a 13 años  Tercer Molar: 16 a 30 años

ODONTOLOGÍA
La Odontología en la identificación de personas contribuye con datos sobre la estimación de sexo, edad, filiación poblacional y otros rasgos individualizantes.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

ODONTOLOGÍA
 Los métodos de análisis de la Estomatología Forense se basan en la concordancia entre los datos premortem y posmortem, en su mayoría acerca de los dientes (registros dentales: fotografías intrabucales, radiografías dentales, impresiones y modelos de estudio de los dientes, maxilares y dentadura), así como en las particularidades de las arcadas dentarias y rugosidades palatinas, que constituyen los rasgos característicos de cada individuo.

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

Odontología forense
 Tomar fotografías  Examen dental - Inspección intraoral visual  Dentograma  Radiografía de dientes y maxilares
La radiografía dental comparativa son los medios más exactos de la identificación dental

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

Protocolo Dental Postmortem
 Tomar fotografías  Examen dental - Inspección intraoral visual  Dentograma  Radiografía de dientes y maxilares
Son el medio más exacto de identificación dental

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

Protocolo Dental Postmortem
 Examen dental  Número de dientes  Restauraciones y prótesis: tipo de prótesis, tipo de material, diente comprometido  Fracturas y caries dental  Malposición y rotación  Formación anómala  Terapia del conducto radicular  Patrones del hueso  Endodoncia  Oclusión  Patología bucal  Tipo de mordida
1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

Identificación sin datos premortem

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

Identificación sin datos premortem

1. Fiscalía General de la Nación – Manual Único de Criminalística. Colombia.

INVESTIGACIÓN GENÉTICA A INDICIOS:
 La inclusión del análisis de los polimorfismos del ADN ha supuesto el mayor avance en la identificación criminal.  El ADN cumple con todos los requisitos que le son exigibles a cualquier prueba para su uso en ciencias forenses: Investigación forense de la paternidad Identificación de indicios criminales

ADN

ADN en la célula
Chromosome cell nucleus double-stranded DNA molecule

Target Region for PCR

Individual nucleotides

Ventajas del ADN en criminalística Cantidad de la muestra:
PCR y secuenciación

 Calidad de la muestra: Short tandem repeats STR  Aumento de la probabilidad de discriminación: Loci  Presencia en todos los indicios: En todos los núcleos celulares

Fuente de evidencias biológicas
• • • • • • • • Sangre Semen Saliva Orina Pelo Diente Bone Tejidos

Tipos de ADN según su herencia y uso en genética forense
 ADN nuclear autosómico
Existente en los 22 pares de cromosomas Sirve para establecer lazos de paternidad y maternidad Gran polimorfismo: muy variable, excepto en gemelos univitelinos

 ADN del cromosoma Y
Delitos contra la libertad sexual Estudio de paternidad “padre – hijo varón”

Tipos de ADN según su herencia y uso en genética forense
 ADN mitocondrial (ADN mt)
 En todos los casos procede de la madre  Marcador de relación madre – hijos (materno filial)  Uso cuando la cantidad ADN es muy limitada o muestras antiguas

Polimorfismo del ADN
La capacidad de identificación por medio del ADN se basa en la presencia de regiones (locus o loci) polimórficas o hipervariables. Las largas cadenas de ADN, compuestas por millones de pares de bases , presentan zonas en las que los pares de bases se repiten de una forma secuencial y determinada (repeticiones en tandem o tandem repeats), específicas en longitud y localización para cada persona.

 Restriction Fragment Length Polymorphism (RFLP)  PCR Analysis  STR Analysis  Mitochondrial DNA Analysis  Y-Chromosome Analysis

Técnicas Forenses de Análisis de ADN
 Extracción del ADN: Orgánica – con Chelex - Diferencial  Cuantificación del ADN extraído  Estudio de las regiones hipervariables por: a) Hibridación y southern-blotting de RFLP b) Amplificación por PCR c) Secuenciación de ADN mitocondrial

Steps Involved Collection
Specimen Storage

Steps in Forensic DNA Analysis
Usually 1-2 day process (a minimum of ~5 hours)
Slot Blot 1 ng 0.3 ng No DNA 0.5 ng 0.5 ng 0.7 ng 1 ng

Extraction
Blood Stain Buccal swab

Multiplex PCR

Genetics

STR Typing Interpretation of Results Database
Storage & Searching

Calculation of Match Probability

DNA Database Search

Technology

If a match occurs, comparison of DNA profile to population allele frequencies to generate a case report with probability of a random match to an unrelated individual

Biology

Quantitation

Sample Collection & Storage

DNA DNA Extraction Quantitation

1 ng

Multiplex PCR Amplification
DNA separation and sizing

STR Typing
Male: 13,14-15,16-12,13-10,13-15,16

Interpretation of Results

Short Tandem Repeat (STR) Markers
PCR primers anneal to unique sequences bracketing the variable STR repeat region
The overall PCR product size is measured
Fluorescent dye
PCR Product Size (bp)

PCR product size generated
Forward PCR primer

Allelic Ladder

DNA template containing STR marker

Reverse PCR primer

GATA

GATA

GATA

GATA

Sample #1

STR repeat region TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGA AGACAGGTGGATAGATAGATAGATAGATAGATAGATA GATAGATAGATAGATATCATTGAAAGACAAAACAGAGA TGGATGATAGATACATGCTTACAGATGCACAC

Sample #2

= 11 GATA repeats (“11” is all that is reported)

Position of Forensic STR Markers on Human Chromosomes
TPOX D3S1358 D8S1179 D7S820 TH01 VWA

13 Core U.S. STR Loci

1997

D5S818 FGA CSF1PO

8 STR loci overlap between U.S. and Europe

AMEL

Sex-typing
D13S317 D16S539 D18S51 D21S11 AMEL

Fluorescent dye-labeled primer
5′ 3′

Short Tandem Repeat (STR) Typing
STR Repeat Region
1
3′

2 3

3 4

4 5

5 6

6 7 8

(Maternal) (Paternal)
reverse primer hybridization region

5′

1

2

forward primer hybridization region

GATA

(size in bp)
75….80….100….120….140….160….180….200….220….240.…260….. 1000 RFUs 500
6 139bp 8 147bp

DNA Separation and Detection

PATERNITY TESTING
Family Inheritance of STR Alleles (D13S317)
PCR product size (bp)

11

14

Father

12

14

Child #1 Child #2 Child #3

8

14 11 12

8

12

Mother

Steps in DNA Sample Processing
Sample Obtained Sample Obtained from Crime Scene from Crime Scene or Paternity or Paternity Investigation Investigation DNA DNA Extraction Extraction

Biology
DNA DNA Quantitation Quantitation PCR Amplification PCR Amplification of Multiple STR markers of Multiple STR markers

Technology
Separation and Detection of PCR Products (STR Alleles) Sample Genotype Determination

Comparison of Sample Comparison of Sample Genotype to Other Genotype to Other Sample Results Sample Results

Genetics

Generation of Case Generation of Case Report with Probability of Report with Probability of Random Match Random Match

If match occurs, comparison of If match occurs, comparison of DNA profile to population DNA profile to population databases databases

MANUAL DE PROCEDIMIENTOS DE LA DILIGENCIA DE LEVANTAMIENTO DE CADAVER
Según Gisbert Calabuig, el levantamiento del cadáver es el primer tiempo de la autopsia médico legal. A lo que debemos agregar en concordancia con otros autores que constituye las 2/3 de la posterior e inmediata necroscopia de ley.

DEFINICIÓN
Es el estudio que realiza el médico legista y el equipo de profesionales de las ciencias forenses, de todo lo existente en el lugar de los hechos (tanto del continente como de su contenido) o el lugar del hallazgo, donde se encuentre (n) cadáver (es) o restos humanos con la finalidad de establecer si la muerte es de etiología violenta, natural o sospechosa de criminalidad.

OBJETIVOS
1. - Comprobar la Muerte. 2. - Estimar el Intervalo Post Mortem. 3. - Contribuir a determinar el modo, mecanismo, y manera de muerte. 4. - Contribuir con información sobre la presunta causa de muerte.

BASE LEGAL
 Constitución Política del Perú.  Ley de Creación del IML Leonidas Avendaño Ureta, Ley Nº 24128.  Resolución de la Fiscalía de la Nación Nº 192-94-MP-FN.  Nuevo Código Procesal Penal Decreto Legislativo Nº 957. Del 29 de Julio 2004.

BASE TÉCNICA CIENTÍFICA
“El levantamiento de cadáver en el lugar de los hechos, debe garantizar la perennización de la escena del hecho, describiendo la misma en su totalidad exhaustiva y detallada”

PRINCIPIOS DE INTERCAMBIO DE LOCARD
1. - El agresor se lleva rastros de la Escena y de la Victima. 2. - El agresor deja rastros en la escena y en la victima. 3. - La victima se queda con rastros del agresor y de la escena. 4. - la escena puede dejar rastros en el agresor y en la victima.

2.1.- Personal que asistirá a la pericia: Profesional: a) Medico Legista. b) Profesionales de las Ciencias Forenses disponibles de acuerdo a la Jurisdicción donde se suscite el hecho: Por Ej.: Biólogo, Toxicólogo, Antropólogo, Odontólogo, otros. Técnico: a) Técnico entrenado en Necropsias b) Técnico Criminalístico (en caso de contar con el recurso). c) Técnico perito para procedimientos Audio visuales, fotográficos, y gráficos, en caso de contar con el recurso. Administrativo: a) Técnico Administrativo. (Secretario / Chofer)

MOMENTO DEL RECONOCIMIENTO MEDICO LEGAL DEL CADAVER:
Con el Cadáver Desnudo: 4.2.1. Identificación: 4.2.2. Descripción de Signos de los Fenómenos Cadavéricos Presentes. Deshidratación Cadavérica, temperatura, rigidez cadavérica, livideces, enfriamiento cadavérico Signos de putrefacción Signos de conservación cadavérica Signos de Antropofagia cadavérica

MOMENTO DEL RECONOCIMIENTO MEDICO LEGAL DEL CADAVER: 4.2.3. Otros signos de interés:  Signos de Asfixia  Signos de atención médica  Signos de postración  Signos de cadáveres sumergidos  Signos externos de embarazo  Signos de toxicidad

MOMENTO DEL RECONOCIMIENTO MEDICO LEGAL DEL CADAVER: 4.2.3. Signos de violencia externa de reciente data  Cabeza  Cuello  Axilas  Tórax y abdomen  Extremidades superiores  Extremidades inferiores

MOMENTO FINAL DEL LEVANTAMIENTO
 Relación de Indicios y/o Evidencias recolectadas y personal responsable de la toma de muestra, conservación, protección y embalaje.  Lugar de destino de los indicios y/o evidencias recolectadas.  Cadena de Custodia.  Complementar Información.  Sobre la causa de la muerte

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->