Mariana Martínez Pelayo Fernando García Hernández

Biología 2

Elaborado según la Reforma curricular con un enfoque educativo centrado en el aprendizaje.

Elaborado según la Reforma curricular con un enfoque educativo centrado en el aprendizaje.

Biología 2
Mariana Martínez Pelayo Fernando García Hernández

El libro Biología 2 es una obra colectiva, creada y diseñada en el Departamento de Investigaciones Educativas de Editorial Santillana, con la dirección de Clemente Merodio López.

BIO2-DGB-U1.indd 1

2/21/08 11:36:33 AM

1

nidad 1
El libro Biología 2 fue elaborado en Editorial Santillana por el siguiente equipo:
edición coordinación editorial revisión técnica corrección de estilo diseño de interiores diseño de portada coordinación de arte y diseño coordinación de iconografía investigación iconográfica ilustrador fotografía diagramación

Catalina Pelayo Rojas Roxana Martín-Lunas Rodríguez • Laura Milena Valencia Escobar Tanya Marcela González Martínez Martha Johannsen Rojas Miguel Ángel Macías Sierra José Francisco Ibarra Meza José Francisco Ibarra Meza Germán Gómez López Paula Arroio Sandoval • Juan Miguel Bucio Trejo • Miguel Ángel Macías Sierra Miguel Ángel Macías Sierra Archivo Santillana • Science Photo • Stock Photos Miguel Ángel Macías Sierra

editora en jefe de bachillerato gerencia de investigación y desarrollo gerencia de procesos editoriales gerencia de diseño coordinación de arte y diseño coordinación de iconografía coordinación de procesos editoriales

Laura Milena Valencia Escobar Armando Sánchez Martínez Laura Milena Valencia Escobar Mauricio Gómez Morin Fuentes José Francisco Ibarra Meza Germán Gómez López Víctor Manuel Vallejo Paquini José Perales Neria • Gerardo Hernández Ortiz María Eugenia Guevara Sánchez

En la ciencia no es importante obtener datos nuevos como descubrir formas Gabriel Miranda Barrón nuevas de Atenco Enfotomecánica electrónicaes importante obtenerpensar nuevos como la ciencia no Benito Sayago Luna • Manuel Zea datos en esos datos. William Bragg descubrir formas nuevas de pensar en esos datos.
digitalización de imágenes

William Bragg
La presentación y disposición en conjunto y de cada página de Biología 2 son propiedad del editor. Queda estrictamente prohibida la reproducción parcial o total de esta obra por cualquier sistema o método electrónico, incluso el fotocopiado, sin autorización escrita del editor. D.R. © 2008 por EDITORIAL SANTILLANA, S. A. DE C. V. Av. Universidad 767, 03100, México, D. F. ISBN: 978-970-29-2041-0 Primera edición: marzo de 2008 Miembro de la Cámara Nacional de la Industria Editorial Mexicana. Reg. Núm. 802 Impreso en México.

2

BIO2-DGB-U1.indd 2

2/21/08 11:36:42 AM

Presentación
Todos los días me recuerdo a mí mismo que mi vida interior y exterior está cimentada en el trabajo de otros seres humanos, vivos y muertos, y que debo afanarme por dar en la misma medida en que he recibido y continúo recibiendo. Albert Einstein
La evolución biológica de los seres vivos en nuestro planeta ha trascendido la biodiversidad al tiempo que nos confirma a los seres humanos como parte de la Naturaleza. Ahora, hablamos de la evolución cultural del ser humano como resultado de los obstáculos biológicos y sociales que ha enfrentado en sus doce mil años de existencia. La cultura es la máxima expresión de la evolución biológica del ser humano en su interacción con el medio y los demás organismos vivos. Es el punto donde confluyen el esfuerzo mental y físico de todo un grupo de personas, hombres y mujeres; es el punto más álgido del trabajo conjunto con conciencia de sí. Esta conciencia nos obliga a hacernos responsables de todas nuestras decisiones, sobre todo con respecto al resto de los organismos. Estamos seguros de que Biología 2 te dará lo necesario para terminar de responder la interrogante “¿Biología para qué?”. Esperamos que esa respuesta más que estar en tus manos, se refleje en tu cultura y tu conciencia como ser humano. Esta obra es el resultado del esfuerzo y el afán de varias personas que se conjuntaron con la certeza de brindarte diversas oportunidades para tu aprendizaje. El contenido de Biología 2 consta de cuatro unidades, con la sección Para comenzar, y los recuadros Hacedores de biología, Haz biología, Conceptos, Para saber más, Actividad, Esto ya lo sabes, ¿Y en México, qué? Al final de cada unidad incluimos la Práctica de laboratorio, el Resumen, la Evaluación y el Artículo de divulgación. Esperamos que te apropies de esta obra y su contenido, y que la lleves más allá de tu aula y tu escuela, permitiéndole hacerse parte de tu forma de ver al mundo, como la máxima expresión de la evolución de la vida en tu planeta.
Los autores

3

BIO2-DGB-U1.indd 3

2/21/08 11:36:45 AM

Biología 2......
unidad

Reproducción y herencia 6
Para comenzar 8

1

unidad

Evolución 112
Para comenzar 114

2

unidad

1. Teorías evolutivas 118
Primeras ideas de la evolución 118 Evidencias de la evolución 121 Teoría de Darwin-Wallace 137

Estructura y función de las plantas 174
Para comenzar 176

3

1. Genética molecular 9
Estructura del adn 10 Replicación del adn 17 arn y síntesis de proteínas 24

1. Nutrición y transporte en plantas 179
Algunas tendencias evolutivas de las plantas 181 La hoja 184 El tallo 192 La raíz 196

2. Reproducción celular y en organismos 32
Ciclo celular 33 Mitosis 38 Reproducción asexual 45 Meiosis 49 Gametogénesis 54 Reproducción sexual 57 Ventajas de la reproducción sexual y asexual 59

2. La genética y la evolución 142
La teoría sintética de la evolución 142 Poza genética 144 Fuentes de variabilidad y factores causantes de cambio en las poblaciones 148

2. Reproducción en plantas angiospermas 201
Estructura y función de la flor 203 El fruto como estrategia adaptativa de dispersión 208 Práctica de laboratorio 211 Resumen 212 Evaluación 213 Artículo de divulgación 215

3. Origen de las especies 156
El concepto de especie 156 Especiación alopátrica y simpátrica 162 Práctica de laboratorio 167 Resumen 169 Evaluación 170 Artículo de divulgación 171

3. La herencia 63
Herencia mendeliana 63 Herencia posmendeliana 72 Teoría cromosómica 76 Herencia ligada al sexo 79 Mutaciones 83

4. La genética del siglo xxi 93

Logros y limitaciones del proyecto Genoma Humano 94 Biotecnología 96

Práctica de laboratorio 104 Resumen 107 Evaluación 108 Artículo de divulgación 110

4

4
2/21/08 11:36:48 AM

BIO2-DGB-U1.indd 4

.............................. 4
unidad

Procesos en los animales 218
Para comenzar 220

1. Digestión 230
La obtención de nutrimentos 232 Órganos y sus funciones 233 Anorexia y bulimia 247

5. Sistema endocrino 280
Glándulas endocrinas 281 Hormonas y su función 282 Diabetes como ejemplo de desorden hormonal 283

2. Sistema Respiratorio 251
Respiración celular y ventilación 251 Función de los órganos del sistema respiratorio 255 Daños al sistema respiratorio 258

6. Sistema Nervioso 286
Funcionamiento de la neurona 288 El sistema nervioso central 291 El sistema nervioso periférico (somático y autónomo) 294 Riesgos para el sistema nervioso: uso de drogas y alcohol 302

3. Sistema circulatorio 262
Función de los componentes de la sangre 262 Los órganos del sistema circulatorio 263 Hipertensión como factor de riesgo cardiovascular 268

7. Reproducción y desarrollo 305
Sistema reproductor masculino y femenino 305 Desarrollo Embrionario 324 Resumen 327 Evaluación 328 Artículo de divulgación 332

4. Sistema excretor 271
Sistemas homeostáticos 271 Órganos del sistema excretor 274 Función de la nefronas. Ultra filtración, reabsorción, excreción 276 Regulación de la función renal. Acción de los diuréticos 278

Anexo 335

55
BIO2-DGB-U1.indd 5 2/21/08 11:37:14 AM

Reproducción y herencia

Quedémonos ahora en esta vehemente sospecha de que el ansia de no morir, el hambre de inmortalidad personal, el conato con que tendemos a persistir indefinidamente en nuestro ser propio, y que es (...) nuestra misma esencia, eso es la base efectiva de todo conocer y el íntimo punto de partida personal de toda filosofía humana, fraguada por un hombre y para hombres.
Miguel de Unamuno

6

BIO2-DGB-U1.indd 6

2/21/08 11:37:38 AM

En esta unidad...
Identificarás los procesos genéticos en los seres
vivos;

analizarás los riesgos y beneficios de las
aplicaciones de la genética;

plantearás la importancia de la actitud ética y
el respeto para la conservación de los seres vivos.
1 Genética molecular
• Estructura del adn • Replicación del adn • arn y síntesis de proteínas

3 La herencia
• Herencia mendeliana • Herencia posmendeliana • Teoría cromosómica • Herencia ligada al sexo • Mutaciones

2 Reproducción celular y en organismos
• Ciclo celular • Mitosis • Reproducción asexual • Meiosis • Gametogénesis • Reproducción sexual • Ventajas de la reproducción sexual y asexual

4 La genética del siglo XXI
• Logros y limitaciones: proyecto Genoma Humano • Biotecnología

7

BIO2-DGB-U1.indd 7

2/21/08 11:37:42 AM

para comenzar
Unidad 1 Reproducción y herencia

¿T

e has puesto a pensar en los diferentes organismos que habitan la Tierra? En el curso de Biología I descubriste la gran biodiversidad en nuestro planeta y que también todos los organismos, por estar vivos, se rigen por una gran cantidad de reglas que les permiten vivir aquí y formar parte de la Naturaleza. Ahora tendrás la oportunidad de crear un ser vivo, uno que tal vez venga de otra galaxia, de tus miedos más profundos o del sueño más loco que hayas tenido.

haz tu bicho

Imagina un bicho, su forma, su tamaño, su color, ¿es terrestre o marino? Tal vez anfibio. ¿Cuántas patas tiene? ¿Tiene alas, plumas o pelo? ¿Corre o nada? En fin, imagina cada característica que pueda tener y descríbelo lo mejor que puedas. En el siguiente espacio describe a tu bicho, ponle nombre y dibújalo. Mi bicho se llama

8

BIO2-DGB-U1.indd 8

2/21/08 11:37:45 AM

1 Genética molecular
Revisa lo que viste en tu curso pasado de Biología sobre los ácidos nucleicos y contesta las siguientes preguntas.
• ¿Qué es un ácido nucleico? • ¿Qué tipos de ácidos nucleicos conoces? • ¿Cuáles son las moléculas que forman parte de la estructura de los ácidos nucleicos? • Describe la estructura del ácido desoxirribonucleico (adn). esto ya lo sabes 1 Genética molecular haz tu bicho

uando el monje alemán Gregor Mendel (1822-1884) describió las leyes de la herencia en 1810 no tuvo mucha resonancia. Sin embargo, un siglo después se retomaron sus estudios y se popularizaron. El estudio de estas leyes, de la manera en la que se regulan y del factor biológico en el que reside la herencia son el objeto de la genética. Con el reciente descubrimiento de los cromosomas, el ADN y su relación con la herencia se agregó el término molecular a la genética basada en las moléculas de la herencia. No obstante, ahora resulta un poco redundante hablar de genética molecular, ya que los factores genéticos residen en moléculas y siempre que las estudiemos estamos haciendo estudios moleculares. De hecho, se conoce mejor a esta rama con el nombre de biología molecular, porque lo que se estudia son moléculas. Ya sea que hayas pensado en tu bicho como unicelular o pluricelular, sus células deben tener adn y es necesario que pueda duplicarlo para que se regenere en caso de una herida o de la reproducción. • ¿Qué características tendría su material genético?

C

• ¿Cuántas cadenas tendría?

• ¿Cómo se duplicaría su material genético?

9

BIO2-DGB-U1.indd 9

2/21/08 11:37:53 AM

Estructura del adn
Como ya lo sabes, todas las células de todos los organismos, unicelulares o multicelulares, procariontes o eucariontes, contienen ácido desoxirribonucleico. El adn está formado por tres tipos de moléculas principales; • un grupo fosfato, • un azúcar (desoxirribosa), y • una base nitrogenada. Las bases nitrogenadas pueden ser de dos tipos. Las que se sintetizan a partir de la pirimidina: citosina y timina; y las que proceden de la purina: adenina y guanina. Cuando una molécula de desoxirribosa y una base nitrogenada están unidas por un enlace covalente se forma un nucleósido. Si este nucleósido se une a un grupo fosfato por un enlace tipo éster, se forma un nucleótido.
Extremo 3'
Puentes de hidrógeno

Unidad 1 Reproducción y herencia

Los nucleótidos se unen por medio de un enlace fosfodiéster y las bases nitrogenadas por un puente de hidrógeno.

Extremo 5' OH N T N N O O N N N H A N H N G N O
2.90 Å

O HO P = O O CH2 H H O

H O T H H H N N O H

11.90 Å

N H H H N N A N N H H

Extremo 3'

Extremo 5'

Ahora revisemos cómo se ensamblan los nucleótidos para formar al adn. Si pudiéramos observar un pedazo de adn, veríamos una

10

BIO2-DGB-U1.indd 10

HO P = O

O

2/21/08 11:37:55 AM

O

H3C

H

O

H

CH2

N

CH2

H

H

O

H

H

O

O

H

HO P = O

HO P = O

O

CH

2

H

O

H

O

H

H

H3C

HO P = O

O

H

H

H

H

H

O

O

N H

H

H

N

CH2

O

N

N H

CH2

O

C

H

H

O

N

H

H

H

HO P = O

H

O

H

as moléculas lineales de carbohidratos se numeran a partir del carbono unido a un oxígeno por doble enlace. Cuando estas moléculas se hacen cíclicas, se une el carbono con doble enlace con el penúltimo carbono de la cadena. Una vez formado el anillo, los carbonos siguen teniendo la misma numeración, es decir, se inicia a partir del oxígeno que permite que se forme el anillo.
Esquema de cómo se forma la ribosa
H
1C

L

para saber más...

O OH OH OH

5 CH 2 OH 4

H H H

2 3 4 5

C C C

C

OH
2

H

5 CH 2 OH 4

H H3C

1C O H C H

OH OH

H H3C

C

O

OH

OH OH

2

1C H H CH

CH 2 OH

Ambas cadenas se unen por medio de puentes de hidrógeno que se forman entre las bases nitrogenadas. Lo interesante es que cada base se acopla bajo reglas estrictas. Los nucleótidos formados por pirimidinas siempre se acoplarán a los nucleótidos con bases de purinas y, no sólo eso, cada base tiene un par específico. La guanina (base de purina) siempre se unirá a la citosina, (base de pirimidina); y la adenina siempre se unirá a una timina. Y si pones atención, podrás observar que entre la guanina y la citosina se forman tres puentes de hidrógeno; entre la adenina y la timina hay dos. Esta unión de las hebras mediante puentes de hidrógeno brinda suficiente estabilidad a la molécula de adn para ser funcional. Recuerda que este tipo de enlaces químicos no es demasiado fuerte y que puede romperse con cierta facilidad. Un ejemplo es la acción de

conceptos
Antiparalelas es la propiedad de las dos cadenas que forman el adn de llevar sentidos contrarios.

11

BIO2-DGB-U1.indd 11

2/21/08 11:37:56 AM

1 Genética molecular

espiral o hélice de dos hebras que se enrolla sobre sí misma; algo similar a una cuerda como las que a veces se utilizan en los tendederos. Cada hebra está formada por nucleótidos que se unen por medio de los grupos fosfato gracias a un enlace llamado fosfodiéster (véase la figura anterior). En la ilustración puedes darte cuenta de que el grupo fosfato está unido a la desoxirribosa en su carbono número 5, que se llama 5’; este grupo fosfato se une al siguiente nucleótido en el carbono 3’ de su azúcar. Por tanto, se dice que la hebra de adn tiene un sentido 5’-3’, y cada nucleótido nuevo que se agregue lo hará en el extremo 3’ de la cadena.

las enzimas. Esta propiedad permite al adn cumplir con todas sus funciones y además duplicarse, como lo veremos más adelante.

Unidad 1 Reproducción y herencia

esto ya lo sabes

Para comprender mejor esta propiedad esencial de la molécula del adn, revisa tus conocimientos de química. Investiga las diferencias entre los enlaces covalentes y los puentes de hidrógeno.
• ¿Sería posible obtener una molécula funcional de adn si las bases nitrogenadas se acoplaran mediante enlaces covalentes? Explica tu respuesta.

Aquí puedes apreciar que una cadena lleva los oxígenos del azúcar en un sentido y la otra los lleva en sentido opuesto. Ahora, fíjate en el carbono libre del azúcar en los extremos de cada cadena. Verás que una tiene libre el carbono 5, y en ese mismo extremo la otra tendrá libre el carbono 3. Por tanto, llevan sentidos contrarios y se llaman antiparalelas.

3´ OH

5´ P

D

T

A

D

P

P

D

A

T

D

P D

P Antiparalelas

D

C

G

P

P

D

G

C

D

P Complementarias OH 3´ 5´

12

BIO2-DGB-U1.indd 12

2/21/08 11:37:58 AM

El adn de tu bicho
• Ahora que sabes sobre las moléculas que forman el adn, explica qué diferencias tiene con el material genético de tu bicho.

haz tu bicho

• Para que tu bicho pueda vivir en este planeta es necesario que tenga adn como material genético, pero tal vez en otra galaxia pueda ser diferente. • Imagina por un momento que tu bicho vive en otro lugar del Universo, imagina cómo sería su material genético. • Descríbelo y dibújalo.

• Ahora hagamos un segmento del adn que tendría tu bicho para que pudiera vivir aquí. • Observa la imagen del Anexo. • Recorta cada imagen de las moléculas que forman el adn. • Con las moléculas que ahí se encuentran puedes hacer dos eslabones de una doble cadena. • Ahora tu misión es hacer una doble cadena de quince nucleótidos. Para ello, utiliza como molde las imágenes de las moléculas y haz las suficientes para completar la sección de adn que se te encomendó. • Ilumina con diferente color cada tipo de molécula. Un color para los grupos fosfato, un color para las desoxirribosas, un color para las citosinas, y así sucesivamente con las demás. • Ahora, arma la cadena de quince nucleótidos de largo. No pongas demasiada atención en el orden de las bases nitrogenadas a lo largo de la cadena.

13

BIO2-DGB-U1.indd 13

2/21/08 11:38:00 AM

1 Genética molecular

Unidad 1 Reproducción y herencia

• Arma otra cadena frente a la que ya tienes siguiendo las reglas de unión de las bases nitrogenadas. • Observa el ADN que armaste y contesta lo siguiente. • Escribe la secuencia de bases que pusiste en la primera cadena que armaste. Sólo anota las iniciales. Por ejemplo, suponiendo que tienes la siguiente secuencia: citosina – adenina – timina – adenina – guanina – citosina, sólo escribirás: C-A-T-A-G-C.

• Ahora escribe la secuencia de la segunda cadena que armaste.

• Si conoces la secuencia de una cadena, puedes identificar la secuencia de la segunda. Explica por qué.

para saber más...

El adn se compacta l igual que las proteínas, la molécula de adn se acomoda y se compacta en diferentes formas llamadas estructuras. Se pueden identificar tres estructuras en el adn. La estructura primaria se refiere a la secuencia específica de los nucleótidos a lo largo de la cadena. Esta doble cadena se enrolla formando una hélice característica del adn, y es la estructura secundaria.

A

14

BIO2-DGB-U1.indd 14

2/21/08 11:38:02 AM

Esta hélice se puede enrollar y forma la estructura terciaria conocida como adn superenrollado. Tomemos en cuenta que el adn extendido de una sola célula mide alrededor de dos metros, por lo que la estructura terciaria permite que el adn se enrolle y se compacte para poder acomodarse fácilmente dentro del núcleo de las células eucariontes. La forma en que se enrolla no sucede al azar, sino con la ayuda de diferentes proteínas. El primer paso es gracias a la participación de las proteínas llamadas histonas. La cadena de adn da dos vueltas completas a esta proteína y sigue hacia la siguiente proteína, en la que también se enrolla con dos vueltas. Cada histona con su segmento de adn enrollado y un segmento adyacente intermedio (adn espaciador) se conoce como nucleosoma, y mide 100 Å (armstrongs). Las histonas están unidas por 200 pares de bases; es decir, un segmento de adn de 200 pares de bases se enrolla en una histona y llega hasta la siguiente.
Segmento de una hélice de adn 2 nm

T

A

G

C

A

T

C

G

Collar de perlas

11 nm

Solenoide

30 nm

Fibra de los 300 Å

300 nm

Rosetas

700 nm

Cromosoma

1 400 nm

15

BIO2-DGB-U1.indd 15

2/21/08 11:38:03 AM

1 Genética molecular

Unidad 1 Reproducción y herencia

La cadena de nucleosomas se conoce como collar de perlas. Éste se enrolla sobre otro tipo de histona, la conocida como H. De seis en seis, los nucleosomas dan vuelta a la histona H y forman la estructura llamada solenoide. Todo el adn se organiza en solenoides y se forma la fibra de los 300 Å. Estas estructuras reducen la longitud del adn entre 35 y 40 veces. Pero es necesario compactar aún más al adn. Para explicarlo, se ha propuesto un modelo de empaquetamiento que describe que la fibra se enrolla en bucles, como cuando tuerces una cuerda tratando de enrollarla. Estos bucles se enrollan más y se forman, hasta que por último estas rosetas se enrollan en rodillos. Ésta es la forma final de empaquetamiento y se puede observar cuando se forman los cromosomas durante la mitosis o división celular.

adn espaciador

Nucleosoma

Collar de perlas

Unidad de 200 pares de bases

11 nm

Histonas

116 pares de bases de adn

esto ya lo sabes

Física 1, ¿la recuerdas? Durante ese curso aprendiste que la unidad de longitud básica es el metro. Pero para medir células, aún la milésima parte de un metro resulta demasiado grande. Revisa tus apuntes sobre micras (µ 10 -6 metros) y nanómetros (nm 10-9 metros). Un armstrong (Å) es aún más pequeño que el nanómetro. Toma en cuenta que 1 nm es igual a 10 Å.

16

BIO2-DGB-U1.indd 16

2/21/08 11:38:06 AM

Replicación del adn
• Imagina que una de las células de tu bicho se va a multiplicar. Describe cómo lo haría. haz tu bicho 1 Genética molecular conceptos
Replicación es el proceso de duplicación de adn del que se obtienen dos dobles cadenas de adn. Cromatina es la estructura compleja formada por adn, histonas y otras proteínas que encontramos en el núcleo de la célula

• Toma en cuenta que todas las células de tu bicho deben tener adn en la misma cantidad al ser la molécula que contiene toda la información necesaria para el funcionamiento de la célula. • Explica qué procesos deben suceder para que las células nuevas tengan adn en la misma cantidad y con la misma información.

El adn se encuentra en el núcleo de todas las células eucariontes y en el citoplasma de las células procariontes. Con contadas excepciones, como las neuronas, cada célula tiene la capacidad de reproducirse y formar dos células iguales a sí misma, es decir, se duplica. Entonces el adn también debería tener esta capacidad, ¿no es cierto? Pues así es. Una característica esencial del adn es su capacidad de duplicarse. Este proceso se conoce como replicación y por supuesto que no sucede espontáneamente. Al igual que en la mayoría de los procesos biológicos, en la replicación intervienen diversas moléculas y ocurren varios pasos. Para continuar hay que tener claras dos cuestiones. La primera es que en las células eucariontes el adn se duplica por secciones. Esto se debe a que para duplicarlo es necesario desenrollarlo, y todo el adn desenrollado no cabría en la célula. Así que por

17

BIO2-DGB-U1.indd 17

2/21/08 11:38:22 AM

conceptos
Enzimas son un grupo de proteínas cuya función es facilitar reacciones químicas dentro de los sistemas biológicos.

lo general el adn se va replicando por secciones, hasta desenrollarse completamente. De lo contrario, ocuparía demasiado espacio y, muy probablemente, no cabría en la célula. La segunda cuestión es que en las células eucariontes el adn se replica en varias secciones al mismo tiempo, pero conforme se copia se vuelve a enrollar la hebra de adn. Una vez que un segmento de adn está desenrollado y libre de histonas, una enzima llamada adn helicasa detecta un lugar específico en la hélice donde se iniciará la replicación, se une a ese sitio y comienza a separar la hélice rompiendo los puentes de hidrógeno entre las bases nitrogenadas de un segmento de la cadena de adn. Así, las dos hebras se separan en ese fragmento y el resultado es una estructura llamada burbuja de replicación. Al separarse las dos hebras, en las regiones cercanas a la burbuja, la hélice se va enrollando y torciendo. Entonces, un grupo de proteínas llamadas topoisomerasas se unen a los extremos de la burbuja y separan las cadenas en pequeñas secciones. Conforme se va avanzando en la replicación las topoisomerasas van uniendo las cadenas de nuevo, para evitar que la hélice se tuerza. Ahora sí está todo listo para comenzar a copiar. En la imagen puedes ver que en una burbuja de replicación hay dos hebras de adn libres. Esto permite que se copien ambas cadenas al mismo tiempo. Lo que hay que cuidar es el sentido en el que se copian pues recuerda que un nucleótido se une siempre a un extremo 3’ que se encuentre libre. ¿Qué sucedería si no hay una cadena a la que se una un nucleótido libre, cómo se comenzaría a copiar? La respuesta se encuentra en las otras moléculas que entran en acción.

Unidad 1 Reproducción y herencia

origen de replicación

helicasa

burbuja de replicación la replicación es bidireccional

cadena líder

cadena retardada

18

BIO2-DGB-U1.indd 18

2/21/08 11:38:27 AM

Primero que nada debes saber que la replicación es bidireccional. Esto quiere decir que se copian ambas cadenas al mismo tiempo pero en sentidos opuestos. Ahora bien, existe una enzima llamada adn polimerasa, que se encarga de hacer polímeros de adn. Su trabajo es tomar nucleótidos que están en el medio celular e irlos uniendo al inicio del segmento de adn existente que se va a replicar. ¿Cómo decide la adn polimerasa qué nucleótido unir? Depende de la secuencia de ácidos nucleicos de la cadena ya existente o cadena molde. Recuerda que una cadena de adn permite reconocer la base nitrogenada que unirá a ella como su contraparte. Si existe un nucleótido que tiene guanina, el nucleótido a unir es una citosina, y así sucesivamente. Por tanto, la adn polimerasa une a la cadena nueva los nucleótidos correspondientes a la cadena molde. La adn polimerasa, sin embargo, necesita un punto de partida para empezar su trabajo. El cebador (o primer, en inglés) es un pequeño segmento de arn que atrae a la polimerasa. El cebador se une al punto de inicio de replicación y es el indicador para que esta enzima comience a copiar el adn a partir de sus dos cadenas molde, una a cada lado de lo que era la hélice de adn. Esta enzima une nucleótidos a una cadena o segmento existente, siguiendo las instrucciones de la cadena molde, y forma la cadena complementaria o cadena nueva. En otras palabras, si en la cadena original
cebador

adn polimerasa
cadena conductora

topoisomerasa

adn polimerasa
fragmento de Okasaki helicasa

ligasa

cebador

En la replicación participan muchas enzimas que controlan cada paso.

19

BIO2-DGB-U1.indd 19

2/21/08 11:38:29 AM

1 Genética molecular

Las hélices que resultan de la replicación tienen una cadena original y una recién sintetizada, por ello se dice que la replicación es semiconservativa.

o molde hay una adenina, la polimerasa unirá un nucleótido que contenga timina. Al tiempo que forma la cadena nueva, la adn polimerasa también forma puentes de hidrógeno entre ambas cadenas. En conclusión, la adn polimerasa no puede copiar la cadena molde sin la presencia del cebador, pues el nucleótido libre es la señal para iniciar la copia. La enzima adn polimerasa es muy eficiente para copiar la cadena molde, pero únicamente puede agregar nucleótidos en un extremo 3’ libre de una cadena en formación. Facilita el enlace de un nucleótido al carbono 3’ de la cadena que ya existe y está creciendo. Lo que significa que sólo puede copiar en un sentido la cadena de adn. La adn polimerasa copia la cadena que lleva el sentido 3’-5’ de forma continua, a esta cadena se le conoce como cadena conductora o líder. Por otra parte, el segmento de adn que lleva un sentido 5’-3’ a partir del punto de inicio se copia en partes, pues la adn polimerasa no trabaja en ese sentido. Lo que sucede es que varios cebadores se unen para que la adn polimerasa copie pequeños segmentos de adn. A estos fragmentos de adn copiados se les llama fragmentos de Okasaki (nombre del investigador que descubrió este proceso). Como puedes darte cuenta el crecimiento de esta cadena es discontinuo por lo que se le conoce como cadena retardada o segmentada. Sin embargo, existen las enzimas llamadas ligasas, que ligan o unen estos fragmentos y dejan lista la cadena. En los organismos procariontes, con sólo un cromosoma lineal, la burbuja de replicación va avanzando hasta terminar la replicación de todo el cromosoma. En los cromosomas de los organismos eucariontes se inicia la replicación en varios sitios, como ya lo habíamos mencionado, de forma coordinada y la copia de todos los cromosomas termina antes de que la célula se divida en dos hijas. Analicemos un poco lo que acabamos de revisar. El adn se replica utilizando como molde a sus mismas cadenas, por tanto las dos copias resultantes llevan una cadena recién sintetizada o hija y una cadena molde o madre. Esto caracteriza a la replicación como semiconservativa. Así, la doble cadena resultante de la replicación se conserva de forma parcial debido a que ambas hélices resultantes llevan una cadena original y una copiada. Para que la adn polimerasa pueda realizar su función es necesario que en el núcleo celular se encuentren presentes nucleótidos que la célula previamente fabricó. Además, al igual que en una fábrica, cada paso de la replicación consume energía por lo que la célula necesita tener una buena reserva de atp para que todas las enzimas participantes puedan trabajar correctamente.

20

BIO2-DGB-U1.indd 20

Unidad 1 Reproducción y herencia

2/21/08 11:38:30 AM

Vuelve a leer el tema de replicación y completa el cuadro.
Enzima Helicasas

esto ya lo sabes
Función

Topoisomerasas

adn polimerasa

Ligasas

Con lo que ya sabes sobre la copia del adn, responde lo siguiente.
• ¿En qué se parece el proceso descrito aquí a lo que habías imaginado para tu bicho? • ¿Describe las diferencias? • ¿Cuántas cadenas de adn tenía el material genético de tu bicho? • ¿Cómo crees que se tendría que replicar un adn de tres cadenas?

haz tu bicho

Ahora escribe una definición que describa brevemente cada estructura.
Estructura Histonas Definición

Solenoide

Burbuja de replicación

21

BIO2-DGB-U1.indd 21

2/21/08 11:38:32 AM

1 Genética molecular

Estructura Cadena líder o conductora

Definición

Unidad 1 Reproducción y herencia

Cadena retardada o segmentada

Fragmentos de Okasaki

haz biología

En un papel que puedas recortar dibuja un modelo de cada enzima mencionada en la actividad anterior. Recorta los modelos. Con el modelo de adn que ya tienes y los modelos de las enzimas que acabas de recortar, recrea la replicación de tu adn. Date cuenta que necesitarás más moléculas que forman al adn para lograr la replicación de tu modelo, así que recorta las necesarias. Una vez terminada la recreación de la replicación, observa tu modelo y contesta lo siguiente.
• ¿Cuántas moléculas de adn obtuviste al final del ejercicio? • ¿Consideras que las moléculas resultantes tienen una cadena de tu cadena original y una nueva? ¿Por qué? • ¿Cómo se llama a esta propiedad de la replicación?

para saber más...

Los telómeros (del griego telos, final, y meros, fragmento) son segmentos
cortos de adn compuestos por una secuencia rica en timina (T) y guanina (G) que se repite muchas veces dependiendo de la especie. Se encuentran en las puntas de los cromosomas y no se replican durante la duplicación del adn. Protegen a los genes importantes ya que en cada replicación se pierden segmentos finales de los cromosomas. Esta pérdida se debe a que la enzima adn polimerasa no puede copiar todos los genes contenidos en cada cromosoma. Entonces, para evitar que se pierdan o dañen los genes que se transcriben en arn y después se traducen a proteínas, estas secuencias en los extremos de los cromosomas se eliminan durante la replicación. Se piensa que los telómeros funcionan como relojes biológicos de la duración de vida de las células porque determinan el número de divisiones

22

BIO2-DGB-U1.indd 22

2/21/08 11:38:34 AM

celulares totales. De hecho, se piensa que al envejecer, la célula va perdiendo longitud en los cromosomas y cuando éstos se eliminan por completo, la célula recibe la señal de morir. Una vez llegado este punto, la célula activa un proceso conocido como muerte celular programada que evita que las células vivan para siempre. Incluso existe la propuesta de que las células cancerígenas tienen atrofiados estos sistemas, tanto de degradación de telómeros como de detección de las señales bioquímicas internas y con sus vecinas que avisan que es hora de morir. Los telómeros se presentan sólo en los cromosomas de organismos eucariontes, que son lineales (los cromosomas procariontes, como recordarás, son circulares y por tanto no poseen extremos con telómeros). El número de repeticiones de una secuencia telomérica varía según la especie. Se ha determinado que en el ser humano (y probablemente todos los animales vertebrados) la secuencia TTAGGG se repite aproximadamente 2 000 veces. La enzima telomerasa produce todas las copias durante el desarrollo embrionario, pero deja de funcionar después del nacimiento. Se ha encontrado que en las células cancerosas se reactiva la actividad de la telomerasa, y altera el reloj biológico de la célula. Las células hijas producidas después de una división celular no controlan el número de veces ni los tiempos en los que deben dividirse, por lo que proliferan sin control y provocan un tumor maligno causante del temido cáncer. Anteriormente se pensaba, que ésa era la única función de los telómeros. En la actualidad se encontró que estas secuencias sí producen arn. Aún no se comprende por completo la función de este arn y de sus productos, pero se sabe que tiene que ver con la regulación de la estabilidad de los telómeros.

para saber más...

Cromosomas con telómeros

TTAGGG

Los cromosomas lineales característicos de los eucariontes presentan telómeros en sus extremos.

23

BIO2-DGB-U1.indd 23

2/21/08 11:38:35 AM

1 Genética molecular

arn y síntesis de proteínas
esto ya lo sabes

Unidad 1 Reproducción y herencia

Revisa de nuevo tus conocimientos del curso Biología I, y realiza lo siguiente.
• Describe brevemente la estructura del ARN. • Qué diferencias funcionales hay entre el ADN y el ARN.

haz tu bicho

Hasta ahora, sabes que además del adn existe el ARN en las células de los
organismos, y que la función del arn es producir proteínas. • Describe el proceso de producción de ARN de tu bicho. • Describe cómo producirá proteínas a partir de este arn.

O HC O O O O O CH 2 HC O C NH C O

N

Nucleótido

OH

OH

Una de las diferencias entre el adn y el arn es que este último utiliza uracilo en lugar de timina.

El ARN o ácido ribonucleico es un ácido nucleico formado por una cadena sencilla de nucleótidos. En general se parece mucho al ARN pues cada nucleótido está formado por un grupo fosfato, un molécula ribosa y una base nitrogenada. Sin embargo, el arn prefiere utilizar a la base uracilo (base nitrogenada del grupo de las pirimidinas) en lugar de la timina. Las moléculas que componen a los nucleótidos se unen gracias a los mismos tipos de enlaces químicos que participan en la unión de los nucleótidos del adn. Es decir, el grupo fosfato se une a la ribosa por un enlace éster; la ribosa se una a la base nitrogenada por un enlace covalente; y entre nucleótido y nucleótido hay un enlace fosfodiéster. Del adn al arn sólo hay un proceso l adn y el arn tienen mucho en común, no sólo por su estructura molecular sino por una relación casi de familia. Sucede que el adn se utiliza para fabricar al arn de manera más o menos similar a la replicación. Cuando una célula necesita una proteína específica, manda la orden para que se descubra el segmento de adn o gen que tiene la información de esta proteína y se produzca el arn correspondiente. Una vez encontrado el gen requerido se abre la hélice (como en la replicación) y se copia la cadena. Sin embargo, sólo se copia una de las cadenas porque el arn que se va a sintetizar consta de sólo una cadena.

para saber más...

E

24

BIO2-DGB-U1.indd 24

2/21/08 11:38:37 AM

arn polimerasa
gen de interés

arn

arn adn

Utiliza las moléculas del Anexo. A partir de tu modelo de adn anterior fabrica la molécula de arn que le correspondería. Tendrás que recortar las moléculas necesarias para lograrlo, así que antes de iniciar observa detenidamente tu modelo de adn y determina las moléculas que utilizarás.
Tipos de arn Como ya se mencionó, el ARN se produce a partir del ADN, por lo que esencialmente tiene la misma información. No obstante, existe una pequeña diferencia, tiene uracilos en lugar de timinas. Existen tres tipos de arn que realizan funciones especiales en la producción de proteínas. El arnm es el molde para producir las proteínas. Cuando un grupo de proteínas se copia del adn, lo llevan hacia el citoplasma, lo modifican un poco y lo preparan para servir como molde. El arnr hace alianza con algunas proteínas y juntos forman una estructura llamada ribosoma. Esta estructura está dividida en dos partes conocidas como subunidades y cada una tiene una función específica que revisaremos más adelante. En general, el ribosoma es la máquina en la que se fabrican las proteínas. Finalmente, el arnt se encarga de capturar los aminoácidos necesarios para ensamblar la proteína que se fabricará. Una vez fabricados dichos aminoácidos, se ubican en el citoplasma. El arnt los

haz biología

25

BIO2-DGB-U1.indd 25

2/21/08 11:38:39 AM

1 Genética molecular

La síntesis del arn corre a cargo de la enzima llamada arn polimerasa. Cuando esta enzima termina de copiar el arn deseado se separa del adn, el arn se libera y la hélice de adn se vuelve a formar. Al igual que en la replicación, la transcripción consume energía y los nucleótidos que se utilizarán para formar el arn deben fabricarse antes de que inicie este proceso. Por ello la célula invierte una buena cantidad de energía. La transcripción ocurre dentro del núcleo, pero el arn lleva a cabo su función en el citoplasma. Así que el arn debe transportarse hacia el citoplasma.

conceptos
Transcripción es el proceso de síntesis de arn copiado de una molécula de adn por medio del cual se transfiere información.

conceptos
Anticodón es la secuencia de tres nucleótidos presente en un arnt. Codón es una secuencia de tres nucleótidos de arnm que codifica para un aminoácido específico; es complementaria a la secuencia presente en un anticodón.

Unidad 1 Reproducción y herencia

toma y los lleva al ribosoma para ensamblarlos en forma de proteína. Observa en la figura que este arn tiene una forma extraña, parece una cuerda torcida. En un extremo de la cuerda lleva una secuencia de tres nucleótidos conocida como anticodón, en tanto que en el extremo opuesto lleva unido un aminoácido que corresponde a la secuencia del anticodón. La forma en la que corresponden los aminoácidos con las secuencias de nucleótidos se tratarán con detalle en la siguiente sección. arnm

Los tres tipos de arn tienen una función y estructura específica. El arnm sólo es una cadena de arn lineal, el arnt parece cuerda torcida y tiene una secuencia de nucleótidos (anticodón) y un aminoácido específicos, y el arnr se asocia con proteínas y forma el ribosoma, ambas subunidades.

ribosoma (contiene arnr) subunidad grande

subunidad pequeña

arnt
MET aminoácido acoplado anticodón

esto ya lo sabes

Recuerda que las proteínas son macromoléculas que funcionan como ladrillos para formar tejidos.

En tu cuaderno haz una lista de los nombres y las abreviaturas de las moléculas que forman a las proteínas.
conceptos
Triplete es un grupo de tres aminoácidos adyacentes en la cadena de arnm que codifica para un aminoácido. Código genético es el conjunto de reglas que especifican el aminoácido correspondiente a un triplete o codón de arn.

Código genético Seguramente ya intuyes la relación directa entre la secuencia de nucleótidos y la secuencia de los aminoácidos que forman a una proteína. Veamos qué tanto. Cuando se replica el adn o se transcribe el adn hacia arn es muy importante mantener la secuencia de aminoácidos lo más intacta posible. Por ello también es importante conocer la forma en que se aparean las bases nitrogenadas.

26

BIO2-DGB-U1.indd 26

2/21/08 11:38:40 AM

El código genético se refiere a la relación entre la secuencia de nucleótidos y el aminoácido al que corresponde. Una secuencia larga de nucleótidos de arn se divide en segmentos de tres, de manera que se va leyendo en tripletes. Por ejemplo, si tenemos la siguiente secuencia: AUGCGUGCA habrá que dividirla así: AUG-CGU-GCA Cada triplete indica un aminoácido en particular y se conoce como codón. Para que esta información se lea correctamente y se traduzca en proteínas, sólo se requiere que el arnm esté presente en un ribosoma, además de que se encuentre el codón de inicio AUG y uno de término que indique que está completa la proteína.
Segunda letra del triplete UUU U UUC UUA UUG Primera letra del triplete (5’—3’) CUU C CUC CUA CUG AUU A AUC AUA AUG GUU G GUC GUG GUA Phe UCU Phe UCC Leu UCA Leu UCG Leu CCU Leu CCC Leu CCA Leu CCG Ile ACU Ile ACC Ile ACA Met ACG Val GCU Val GCC Val GCA Val GCG Ser UAU Ser UAC Ser UAA Ser UAG Pro CAU Pro CAC Pro CAA Pro CAG Thr AAU Thr AAC Thr AAA Thr AAG Ala GAU Ala GAC Ala GAA Ala GAG

Para encontrar el aminoácido al que corresponde el triplete que buscas, halla la primera base del triplete en el lado izquierdo del cuadro; la segunda, en la parte superior; y la tercera en el extremo derecho. En un triplete AUG, busca la fila de la A en el lado izquierdo, luego busca la columna de la U en la parte superior, y te ubicas en el cuadro correspondiente. Ahí mismo busca el renglón de la G en la tercera posición, y encuentra la Met (abreviación de la metionina).

Tyr UGU Tyr UGC Stop UGA Stop UGG His CGU His CGC Gin CGA Gin CGG Asn AGU Asn AGC Lys AGA Lys AGG Asp GGU Asp GGC Glu GGA Glu GGG

Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly

U C A G G C A G U C G A U C G A Tercera letra del triplete (3’—5’)

Código genético no es lo mismo que genoma ni que adn. Es frecuente que en
los medios de comunicación se caiga en el error de utilizar estas palabras como sinónimos. Como ya has visto en tus cursos, el material genético se compone en su mayor parte de nucleótidos y hay diferentes tipos de material genético (adn y arn). Por otro lado, el genoma es el conjunto de todo el material genético de un organismo, en tanto que el código genético es la clave para leer una secuencia de tres ácidos nucleicos y saber a qué aminoácido corresponde. Cada organismo tiene todo su material genético contenido en su propio genoma. Pero el código genético es el mismo para todos los seres vivos.

para saber más...

27

BIO2-DGB-U1.indd 27

2/21/08 11:38:42 AM

1 Genética molecular

haz biología

Lo que está escrito a continuación es una secuencia de arnm.
AUGCCAAGUGGAUCGGCACGAAAUUUGGACUAA • Obsérvala con detenimiento, divídela en tripletes y escríbela en la línea de abajo.

Unidad 1 Reproducción y herencia

• Con ayuda del cuadro del código genético anota en la siguiente línea los aminoácidos que corresponden.

amino acil-arntsintetasa

enzima

aminoácido aa
x

atp
P P P A

arnt

3'

aax

arnt activado
Las moléculas en la traducción de una proteína. Recuerda que este proceso se lleva a cabo en el citoplasma celular.

Síntesis de proteínas El proceso de producción de proteínas se conoce con el nombre de traducción y es uno de los más importantes de la función celular. Cuando se requiere la información contenida en el genoma para realizar una función específica, la célula produce las proteínas necesarias. Entre las principales moléculas que se necesitan producir para la traducción están • arnm, que contiene toda la secuencia de la proteína que se va a traducir, • varios arnt, cada uno llevará su aminoácido correspondiente, • un ribosoma (arnr), ambas subunidades, la grande y la pequeña, • aminoácidos, que irán añadidos a los arnt • varias moléculas de atp, • la enzima amino acil-arnt-sintetasa, que permite la unión de los aminoácidos con el arnt correspondiente, y • la enzima peptidil-transferasa, que cataliza el enlace peptídico entre los aminoácidos al tiempo que transcurre la traducción. ¿Por qué es necesario contar con una cadena de arnm y no adn para iniciar la traducción? Si bien el adn tiene la información necesaria para traducir una proteína, las enzimas y toda la maquinaria celular responsable entienden y leen el mensaje en forma de arn, y lo traducen al código de las proteínas. Digamos que es similar a indicarle al operador de una máquina de ensamblaje los detalles de un automóvil para que él determine los códigos que harán funcionar a la máquina. Antes de iniciar es necesario que los aminoácidos estén activados, es decir, que estén unidos a su arnt correspondiente.

28

BIO2-DGB-U1.indd 28

2/21/08 11:38:44 AM

En la figura anterior observa U AG que el arnr está formado por fmet dos subunidades, una pequeña arn iniciador y la otra grande. También observa que dentro de estas estructuras hay espacios pequesitio P sitio A ños llamados el sitio A, donde se insertan los nuevos arnt subunidad pequeña con su aminoácido; el sitio P, ribosoma al que entran los arnt recién agregados y se forman los enlaces peptídicos, y en donde se inserta el primer aminoácido; por último está el sitio E, en el subunidad grande que se liberan los arnt utilizacodones o tripletes múltiples dos ya sin su nucleótido. La traducción consta de tres AUGUUCGGU AAGUGA fases: la iniciación, la elongaarnm ción o alargamiento de la cadena, y la finalización. Fase de iniciación. Para iniciar la traducción, el arnt que tiene el anticodón con la secuencia UAC y el aminoácido llamado metionina (Met) se unen a la subunidad pequeña del ribosoma en el sitio P, mismo que se une a la cadena de arnm que se va a traducir. Éste es el complejo de iniciación. En este momento, el arnt busca la secuencia correspondiente al código AUG, que es la señal de inicio de traducción en la cadena de arnm. Enseguida se une la subunidad grande del ribosoma, y el arnm queda en medio de éste. Ahora está formado el complejo activo, que continuará leyendo el arnm y ensamblando aminoácidos para formar la proteína. Fase de elongación. Ahora llega un arnt al sitio A del ribosoma; los aminoácidos de este arnt y del primero se unen mediante un enlace peptídico, gracias a la acción de la enzima peptidiltransferasa. En este momento el arnt sin aminoácido llega al sitio E del ribosoma. Utilizando la energía del atp, el arnm se desliza por el ribosoma de manera que el siguiente codón por leerse queda ubicado en el sitio A, y el arnt con los dos aminoácidos queda en el sitio P. Esta cadena de aminoácidos se une al aminoácido del nuevo arnt, el arnt sin aminoácidos pasa al sitio E, y en el sitio P queda el arnt que lleva la cadena peptídica en crecimiento. Esto sucede una y otra vez hasta traducir toda la secuencia de arnm.

anticodón

conceptos
Traducción es el proceso en el que se ensamblan los aminoácidos de una proteína siguiendo la secuencia de nucleótidos en un arnm que ocurre en un ribosoma.

El complejo de iniciación (arnt con metionina y la subunidad ribosómica pequeña) se une con el arnm, en el codón de incio (AUG), y se une la subunidad grande del ribosoma. Éste es el complejo activo.

Iniciación
AUGUUCGGU UAC AAGUGA

complejo de iniciación

1. El arntfmet iniciador se une al codón de arnm en el sitio P.

AUGUUCGGU UAC

AAGUGA

2. La subunidad grande se une al complejo;un nuevo arntse une al sitio A.
Durante la elongación, los aminoácidos que van trayendo los arnt se van añadiendo a la cadena peptídca.

29

BIO2-DGB-U1.indd 29

2/21/08 11:38:46 AM

1 Genética molecular

Unidad 1 Reproducción y herencia

En caso de que una cadena de arnm sea demasiado larga, se unen varios ribosomas en diferentes secciones del arnm para traducirla al mismo tiempo en varios lugares, lo que agiliza el proceso. Fase de finalización. Existe un grupo de tres codones (UAA, UAG y UGA) que ningún arnt puede reconocer. Entonces, el sitio A queda libre para que se unan moléculas conocidas como factores de liberación. Éstos permiten la liberación de la proteína que se acaba de armar. Junto con la proteína se libera el último arnt y se separan las subunidades grande y pequeña del ribosoma. Éste es el final de la traducción. Sin embargo, para una proteína compleja, es decir, una proteína formada por varias cadenas peptídicas, éste es el inicio de un proceso de asociación con las demás cadenas necesarias.

Ya elaboraste una secuencia de adn y la transcribiste en arn. Si este arn
haz biología que fabricaste fuera un arnm de tu bicho podrías traducirlo en una proteína que tu bicho quizá necesitaría en algún momento. Imagina que ahora tu bicho necesita esa proteína.

Primero fabrica las moléculas necesarias para traducir el gen de tu bicho. En una hoja de papel, ahora dibuja y recorta ribosomas, arnt y los aminoácidos necesarios para tu secuencia. Ahora que tienes las moléculas necesarias, representa la traducción de su secuencia y pega la proteína resultante en otra hoja de papel. Vuelve a leer el tema de traducción y relaciona ambas columnas.

A. Subunidad grande B. UAA C. Iniciación D. Sitio A E. UCA F. Sitio P G. Subunidad pequeña H. Elongación I. Sitio E J. Terminación

(

( (

( (

) El ARNm se une al sitio P de la subunidad pequeña del ribosoma en el lugar del triplete AUG; ahora se une la subunidad grande. ) Espacio en el ribosoma donde se colocan los ARNt que se van necesitando para la traducción. ) Espacio en el ribosoma donde se forman los enlaces peptídicos entre los aminoácidos que llevan los ARNt. ) Uno de los tripletes que indican terminación o alto de la traducción. ) El espacio en el ribosoma donde se desechan los ARNt que ya no tienen un aminoácido adherido.

30

BIO2-DGB-U1.indd 30

2/21/08 11:38:47 AM

Completa las frases del esquema.
El es la molécula donde se encuentra contenida toda la información genética de una célula. El proceso por el que se copia la molécula de adn a sí misma se llama: .

El arn sale del núcleo, en el caso de eucariontes, y se utiliza para producir una proteína en un proceso conocido como: .

A partir de esta molécula se puede producir arn a través de la: .

AA

AA

AA proteína

AA

AA

La relación que existe entre estos procesos se conoce con el nombre de dogma central de la biología molecular. El estudio de estos procesos y su relación con el funcionamiento celular son puntos centrales de la investigación en biología molecular.

31

BIO2-DGB-U1.indd 31

2/21/08 11:38:49 AM

1 Genética molecular

2 Reproducción celular y en organismos
Unidad 1 Reproducción y herencia
ntes de describir los procesos de reproducción analicemos los tipos de células según el número de copias del material genético que poseen. La mayoría de las células eucariontes tienen dos copias de su material genético, por lo que se les llama diploides. Este tipo de células tienen funciones especiales en los organismos; como parte de un tejido, por ejemplo, son parte de la piel o del hígado, pero no son reproductoras. Por tanto, se les llama somáticas y pueden multiplicar su material genético y dividirse originando dos células iguales y con la misma cantidad de material genético. Cuando una célula diploide especial se divide dos veces seguidas pero sólo duplica su material genético una vez, produce cuatro células llamadas haploides con un solo juego de cromosomas.

A

La mayoría de las células que nos forman son diploides y somáticas.

esto ya lo sabes

Observa la figura y completa las oraciones.

genes dos pares de cromosomas homólogos en el núcleo

adn
transcripción

arnm
complejo de traducción

ribosoma

traducción
Dentro de las largas cadenas de adn que puede tener una célula, se encuentran miles de genes. Cada cadena de adn se empaqueta hasta obtener la forma de un cromosoma.

proteína

32

BIO2-DGB-U1.indd 32

2/21/08 11:38:51 AM

Ciclo celular

Hasta el momento hemos definido el material genético de tu bicho.
• Describe el tipo de células que tendrá. • Imagina las células de tu bicho y dibújalas en tu cuaderno. • Describe cómo se multiplicarían estas células si fuera necesario, por ejemplo si tu bicho se cortara y necesitara regenerar el fragmento de piel. Desde el curso anterior de Biología, comprendiste que todos los organismos estamos formados por células, ya sea una sola célula en organismos unicelulares o millones de células, como en el ser humano. Por tanto, el correcto funcionamiento de un organismo depende, entre otras cosas, del desarrollo, el crecimiento y la proliferación de las células que lo forman. Si tomamos en cuenta que la mayoría de nuestras células no paran de reproducirse a lo largo de nuestra vida, a excepción de las células nerviosas, podemos apreciar la importancia interfase celular de la reproducción de las células. Por ejemplo, los eritrocitos, células citoplasma fase G1 que transportan oxígeno en sangre, núcleo replicación de viven 120 días aproximadamente y cromosoma poseemos alrededor de 250 billo(fase S) nes de ellos. Esto no quiere decir que todos mueren al mismo tiemfase G2 po y se deben reemplazar de igual profase prometafase manera, sino que el número debe metafase mitosis ser más o menos constante para anafase telofase poder asegurar que se mantengan eficientes las funciones corporales fase M por medio del aporte de oxígeno. Por ello debe haber una estricta recitocinesis gulación del número de células y el momento en el que deben renovarfase G1 se o reproducirse. Cada célula en nosotros se redos células hijas produce y vive siguiendo un ciclo

haz tu bicho

conceptos
Ciclo celular es el conjunto de sucesos ordenados que permiten a una célula crecer, acumular materiales nutritivos, duplicar su contenido, y dividirse en dos células hijas.

En las dos fases principales del ciclo celular, la división, cuando la célula se divide en dos, y la interfase, cuando la célula crece continuamente, se replica el adn y se duplican los organelos.

33

BIO2-DGB-U1.indd 33

2/21/08 11:39:05 AM

2 Reproducción celular y en organismos

Un es un segmento de adn que contiene la información necesaria para producir una proteína. Dentro del adn hay miles de genes. El adn se enrolla para poder caber en el . El nivel de máximo de empaquetamiento es el , que contiene un segmento grande del adn total de una célula.

Unidad 1 Reproducción y herencia

de sucesos, entre ellos la síntesis de moléculas, la duplicación de su material genético, el crecimiento y la división celular. En general, podemos dividir este ciclo en dos fases principales, la interfase y la fase de división. Interfase Durante la interfase la célula se encuentra en un estado basal de funcionamiento. En épocas anteriores se creía que era un estado de reposo, pero se descubrió que en esta fase la célula está en plena función. Además, es cuando se lleva a cabo la replicación del adn y la duplicación de sus organelos para tener un duplicado de todo su contenido justo antes de dividirse en dos células hijas. Cabe señalar que no todas las células están en continua división celular. Sólo las células de algunos tejidos se dividen constantemente. La interfase se divide a su vez en tres periodos principales conocidos como G1, S y G2. Las letras “G” corresponden a dos periodos en los que la célula aumenta de tamaño, la inicial se tomó de la palabra growth en inglés, que significa crecimiento. El periodo G1 comprende desde el fin de la división celular hasta el inicio del periodo S o de síntesis de material genético, cuando la célula duplica su adn. Una vez que terminó este periodo se inicia el segundo periodo de crecimiento o G2. La célula se asegura de que tanto el material genético como sus organelos estén duplicados por completo, antes de dividirse, y termina cuando la célula comienza la fase de división. La célula que se va a dividir tiene que duplicar su material genético durante el periodo S. Así, al momento de dividir todo su contenido, las células resultantes tienen la misma cantidad de adn. Ya que una buena parte de las células eucarióticas tienen dos juegos de adn, antes de llegar al periodo G2, la célula debe tener cuatro juegos idénticos de cromosomas para dividirse. El periodo G1 es el más variable entre las células porque puede durar horas, días, meses o incluso años. Cuando las células que se reproducen poco entran en G1, pueden detener su ciclo celular y entrar en un estado de reposo G0. En este estado pueden estar mucho tiempo antes de volver a iniciar el ciclo y dividirse. La duración del ciclo celular varía dependiendo del tipo de células. En células adultas el ciclo requiere al menos un promedio de 12 horas para terminar. No obstante, las células tienen los ciclos celulares más cortos que se conocen durante el desarrollo embrionario, pueden durar desde 8 hasta 60 minutos. Estas células prácticamente han eliminado los periodos G1 y G2, ya que no incrementan su volumen. Gracias a esto, pasan de la duplicación del adn a la división celular

34

BIO2-DGB-U1.indd 34

2/21/08 11:39:07 AM

mitosis 1 hr M 3 hr G2 división

24 horas

G1

5 hr

S 7 hr

interfase

La duración del ciclo celular en una célula típica es de 16 horas.

En células que se mantienen en cultivos se ha observado que el ciclo celular se termina en aproximadamente 16 horas en promedio, y lo dividen de la siguiente manera: G1 cinco horas, S siete horas, G2 tres horas, y 1 hora para la división celular.
Los tumores benignos de hipófisis que fabrican de manera excesiva y prolongada la hormona del crecimiento (HG) provocan en los niños, que todavía conservan su capacidad para crecer en estatura, una altura mayor de lo normal (gigantismo). En las personas adultas, que ya han perdido esa capacidad, producen el cuadro clínico conocido como acromegalia. La acromegalia es una enfermedad crónica cuyos efectos en la actualidad se pueden controlar y reducir de manera significativa. En muchos casos, no

y en México

qué...?

es hereditaria, así que no puede transmitirse a los hijos. En México existen alrededor de 5 000 a 6 000 pacientes y sólo 1 500 están diagnosticados. La asociación Acromegálicos en Lucha por su Recuperación, A.C. trabaja de manera voluntaria en la difusión y conocimiento de la acromegalia, así como en el acceso a un tratamiento y a servicios médicos oportunos y de calidad, como derecho de las personas que viven afectadas por este padecimiento. Visita el sitio www.acromegalia.org.mx/ para mayor información sobre las acciones de la asociación y las investigaciones sobre esta enfermedad.

35

BIO2-DGB-U1.indd 35

2/21/08 11:39:09 AM

2 Reproducción celular y en organismos

casi de manera directa. Esta forma de adaptar el ciclo celular resulta ventajosa para el desarrollo embrionario. Favorece la posibilidad de que el embrión incremente muy rápidamente su número de células a partir de una sola célula (el óvulo fecundado por el espermatozoide), y comience a formar los tejidos y órganos necesarios para formar un nuevo organismo completo. Esta adaptación se debe a las reservas nutrimentales de los óvulos, fuente de la energía necesaria para tantas divisiones.

conceptos

Unidad 1 Reproducción y herencia

Mitosis es el proceso de duplicación del material genético y división nuclear en células eucarióticas que produce dos células genéticamente idénticas.

División Durante la división la célula lleva a cabo la mitosis, que es otra forma de llamar a la división celular. Por tanto, esta fase del ciclo se conoce también como la fase M. La mitosis está dividida, a su vez, en varias fases que revisaremos un poco más adelante. Pero en general, la célula divide a la mitad todo su material, organelos y adn. Como resultado de esta fase se obtienen dos células idénticas a la que inició el proceso. Recuerda que cuando una célula se divide está produciendo nuevas células que regeneran o forman un tejido, como las células de la piel, por ejemplo, que se regeneran continuamente. Cabe enfatizar que el ciclo celular está estrictamente regulado por señales moleculares llamadas controles. Éstos aseguran que la célula

maquinaria de replicación del adn medio ¿está replicado todo el adn? ¿medio favorable? ¿tamaño suficiente de la célula? crecimiento celular control de G2 entrada a M M G2 ¿están los cromosomas alineados? Control de la metafase salida de M

maquinaria de la mitosis

controlador

G1

S inicio Control de G1 medio
Durante su ciclo, las células tienen controladores que verifican que la célula complete los procesos moleculares para continuar su avance a la siguiente fase.

¿tamaño suficiente de la célula? ¿medio favorable?

crecimiento celular

36

BIO2-DGB-U1.indd 36

2/21/08 11:39:11 AM

El cáncer y el ciclo celular

Todas las células se dividen siguiendo el ciclo celular. Además de los controles existen algunos genes que regulan este ciclo y la duración de la vida de una célula. Esto sucede sobre todo en los organismos pluricelulares, donde es necesario que las células colaboren entre ellas para que el organismo entero funcione correctamente. Por tanto, si una célula decide comenzar a reproducirse sin atender a las señales de otras células ni las propias, puede acarrear consecuencias graves para las células adyacentes y, más adelante, para todo el organismo. Cuando una célula pierde la capacidad de regular su propia división, es decir, cuando se reproduce sin control o incluso olvida cuándo debe morir, tenemos un cáncer. Un cáncer es un tejido de células sin función específica, hijas de una célula que perdió el control de su reproducción. ¿Qué sucede? Un cáncer se origina principalmente por una alteración en el adn, sobre todo en los genes que regulan la división celular, ya sean genes que organizan los momentos de inicio o en los que finalizan la división. La consecuencia es una célula que se divide constantemente. Tales alteraciones en esta clase de genes están provocadas ya sea por modificaciones o mutaciones, o bien por la acción de sustancias químicas conocidas como carcinógenos. Existen muchos carcinógenos con los que convivimos en la vida diaria. Son muchas razones las para explicar por qué no hemos muerto todos los seres humanos de cáncer ante una situación así. Una razón es que la mayoría de dichas sustancias tienen efectos cancerígenos cuando nos exponemos a cantidades enormes o de manera repetida. Otra razón es que nuestro cuerpo tiene la capacidad de encontrar células con características cancerígenas y eliminarlas. Además, nuestras células poseen un sistema de rastreo de alteraciones genéticas para arreglarlas antes de que sean un problema. De hecho, si en este momento pudiéramos revisar célula por célula en nuestro cuerpo, encontraríamos que muchísimas son cancerosas. El peligro de las células cancerosas es que toman los recursos de los grupos de células adyacentes que sí llevan a cabo funciones especializadas

para saber más...

37

BIO2-DGB-U1.indd 37

2/21/08 11:39:12 AM

2 Reproducción celular y en organismos

complete sus procesos en cada etapa para pasar a la siguiente. Son una especie de agentes aduanales en las fronteras revisando los papeles de los viajeros para pasar o seguir su viaje. Cuando la célula cumple con todos los requisitos moleculares, desata nuevos procesos moleculares que permiten iniciar una nueva fase o periodo. Lo más importante es que cuando una célula ha pasado un cierto punto de control, ya no puede regresar a una etapa anterior ni detener el avance del ciclo.

Unidad 1 Reproducción y herencia

en favor del organismo. Las cancerosas son vividoras del organismo, sólo consumen pero no producen. Al comenzar el desarrollo de un grupo de células, como éstas, se limita a una zona específica, pero cuando se reproducen muchas veces pueden comenzar a invadir otros tejidos y dañarlos.

Mitosis
esto ya lo sabes

Describe cada fase del ciclo celular. Si lo necesitas, vuelve a revisar el tema.

Cuando nuestro organismo debe regenerar un tejido, o después de una hemorragia, por pequeña que sea, es necesario reponer las células perdidas. Para ello, las células deben multiplicarse y producir copias de sí mismas. La mitosis es el proceso de división de la célula. Sucede durante la fase de división del ciclo celular. Para que una célula se divida es

38

BIO2-DGB-U1.indd 38

2/21/08 11:39:14 AM

Fases de la mitosis Profase. Es el inicio y se considera que ha comenzado cuando la membrana nuclear comienza a romperse, desaparecen los nucleolos y el adn está completamente condensado en cromosomas. Como recordarás, cuando una célula llega hasta este punto en el ciclo celular ya tiene el doble de adn (el original y la nueva copia) y, por lo tanto, el doble de cromosomas. En la figura se observa que cada cromosoma está unido con su par. En tu curso anterior de Biología viste que el citoesqueleto está formado por diferentes proteínas, entre ellas la tubulina. Durante esta etapa, las estructuras proteicas llamadas centriolos organizan a las tubulinas y forman algo parecido a cables, que servirán para atraer la copia de cada cromosoma hacia los extremos de la célula. A estos cables o fibras se les llama husos mitóticos, y se unen con otras proteínas llamadas centriolos. En esta etapa cada célula cuenta con cuatro centriolos formando dos pares. Cada par de centriolos unidos a sus husos mitóticos comienzan a migrar hacia polos opuestos de la célula. Cuando llegan al polo se les conoce como polo del huso. Prometafase. Inicia cuando la membrana nuclear se rompe por completo. Ahora, la parte central de los cromosomas, llamada centrómero, tiene una región rica en proteínas llamada cinetocoro en la que se unen los husos mitóticos a los cromosomas. En la figura se muestra que cada polo del huso está en su lugar respectivo y que cada par de cromosomas está unido al huso mitótico. Esta unión permite que los husos mitóticos lleven al cromosoma hacia su polo correspondiente, es decir, cada cromosoma se moverá en dirección opuesta a su par. Metafase. Cada cromosoma está unido a su huso mitótico, y se comienza a mover hasta llegar a una zona intermedia entre ambos centriolos, conocida como el ecuador celular. Esto es gracias a que las fibras y los centriolos se estiran y se aflojan, de modo que mueven a los cromosomas lo necesario para ubicarlos en el ecuador de la célula. Anafase. Los centriolos comienzan a tirar de las fibras del huso y en consecuencia de los cromosomas a los que están adheridos. Esto

Todas las células de nuestro organismo se dividen, la mayoría de ellas por medio de la mitosis.

39

BIO2-DGB-U1.indd 39

2/21/08 11:39:18 AM

2 Reproducción celular y en organismos

necesario haber duplicado su material genético y sus organelos, y en consecuencia aumenta su tamaño. Una vez realizado lo anterior, la célula comienza la mitosis, que consta de cinco fases: profase, prometafase, metafase, anafase y telofase. Al finalizar estas fases, la célula se divide en dos partes mediante el proceso llamado citocinesis, el cual es la última etapa de la división celular.

1 Profase citoplasma membrana plasmática centrosomas en separación

Unidad 1 Reproducción y herencia

nucleolo disperso centrómero

envoltura nuclear

cromosoma condensado con dos cromátidas

ruptura de la envoltura nuclear 2 Prometafase membrana plasmática microtúbulo polar cinetocoros microtúbulos del cinetocoro cromosoma

el cromosoma se mueve hacia la placa metafásica 3 Metafase

los cromosomas se alinean en la placa metafásica microtúbulos del cinetocoro

separación súbita de los cinetocoros pares, comienza la anafse

40

BIO2-DGB-U1.indd 40

2/21/08 11:39:22 AM

4 Anafase los microtúbulos del cinetocoro se acortan al tiempo que se jalan las cromátidas hacia el polo elongación del microtúbulo polar incremento de la separación de los polos

la envoltura nuclear se vuelve a formar 5 Telofase descondensación de los cromosomas sin los microtúbulos del cinetocoro

microtúbulos polares

la célula se divide en dos 6 Citocinesis

el núcleo reaparece

se completa la envoltura nuclear al tiempo que se descondensan los cromosomas

contracción del ecuador

los microtúbulos interfásicos se re acomodan en el centrosoma

La mitosis forma parte del ciclo celular y está dividida en cinco fases. Los pares de cromosomas se organizan y se separan, y la célula se alarga. Inmediatamente después comienza la citocinesis.

41

BIO2-DGB-U1.indd 41

2/21/08 11:39:23 AM

2 Reproducción celular y en organismos

Unidad 1 Reproducción y herencia

provoca que cada par de cromosomas se separe en dos mitades. Al tiempo que los centriolos llevan a todos los cromosomas desde el centriolo, a una misma velocidad, hacia un polo, los husos que no están unidos a un cromosoma interactúan con las del polo opuesto para alargar la célula. En la figura se ve cómo esta interacción logra que cada polo quede cada vez más alejado de su contrario. Telofase. Los cromosomas están en su polo respectivo y los centriolos se liberan de las fibras del huso, la membrana nuclear comienza a formarse a su alrededor y reaparecen los nucleolos. Las fibras libres del huso alargan aún más a la célula, y permiten que la célula se separe en dos. Este fenómeno es la citocinesis que veremos a continuación. Citocinesis Cuando los cromosomas migraron hacia los polos de la célula en división y la célula se alargó, fue necesario dividirla en dos. El proceso de separación de las dos nuevas células es la citocinesis. En las células animales se forma un anillo de microfilamentos (fibras proteicas) alrededor del ecuador o parte media de la célula. Con ello el citoplasma celular se comprime, de forma similar a tirar de la correa de una bolsa de plástico o de un pantalón deportivo. Observa en la figura que cuando se contrae por completo, el ecuador de la célula se divide el citoplasma de dos células hijas nuevas, cada una con aproximadamente la misma cantidad de citoplasma. Las células vegetales requieren procesos un poco más complejos ya que, como recordarás, además de membrana celular tienen una pared celular que impide que la membrana se contraiga y se divida. También es necesario que cada célula hija tenga su propia pared celular que la separe de la otra. En estas células el aparato de Golgi libera vesículas de carbohidratos que se ubican en el ecuador, se fusionan y forman una placa celular. Entonces, se forma una membrana celular a cada lado. En la figura se muestra cómo llega el momento en que

conceptos
Citocinesis es la división del citoplasma de una célula, posterior a la división nuclear.

La diferencia en la citocinesis de ambos tipos celulares radica en la presencia de pared celular en las células vegetales.

Los microfilamentos forman un anillo en torno al ecuador de la célula

El anillo de microfilamentos se contrae y constriñe la cintura de la célula.

La cintura se parte totalmente y se forman dos células hijas.

42

BIO2-DGB-U1.indd 42

2/21/08 11:39:25 AM

El número de cromosomas varía de una especie a otra. El siguiente cuadro
contiene el número de cromosomas en diferentes especies.
Especie Mosca común Rata Hombre Chimpancé Oveja Vaca Caballo Camello Llama Perro Pollo Ratón Cerdo Mosquito Gato Número de cromosomas 12 42 46 48 54 60 64 74 74 78 78 40 40 6 38

para saber más...

Observa que el camello y la llama tienen el mismo número. Este tipo de coincidencias sucede a menudo entre organismos evolutivamente cercanos. Es muy importante que los organismos mantengan el mismo número de cromosomas en sus células.

Completa el cuadro siguiente. Si es necesario revisa nuevamente el tema de ciclo celular y mitosis.
Fases del ciclo celular Periodos en que se dividen Sucesos

Interfase

G1

43

BIO2-DGB-U1.indd 43

2/21/08 11:39:27 AM

2 Reproducción celular y en organismos

esta placa se fusiona con la pared celular y las membranas se fusionan con la membrana original. Ya separadas, las células entran en interfase, por lo que pueden volver a comenzar el ciclo celular.

Fases del ciclo celular

Periodos en que se dividen S

Sucesos

Unidad 1 Reproducción y herencia

G2

División Celular/ Mitosis

Profase

Prometafase

Metafase

Anafase

Telofase

Citocinesis

haz tu bicho

Imagina a tu bicho y contesta lo siguiente.
Es muy probable que hayas descubierto que es muy importante que sus células puedan dividirse. Además de reparar una herida, ¿en qué otros procesos de tu bicho está involucrada la división celular? • Descríbelos.

Forma grupos de tres integrantes, analicen lo siguiente y contesten las preguntas.
• Además del desarrollo embrionario, ¿en qué otros procesos del cuerpo humano se lleva a cabo la división celular de manera activa?

44

BIO2-DGB-U1.indd 44

2/21/08 11:39:29 AM

• ¿En qué procesos es importante la división celular para ellos?

• ¿Los procesos humanos en los que la división celular es importante se parecen a los de tu bicho?

Reproducción asexual
Este tipo de reproducción permite que los organismos se multipliquen con rapidez, y se caracteriza por la ausencia de fusión de células especializadas y porque los organismos resultantes son genéticamente idénticos a su progenitor. Esto se realiza por medio de la división sucesiva del organismo completo en el caso de organismos unicelulares, o de la división por mitosis de algunas células de su cuerpo. La mayoría de los organismos que se reproducen asexualmente son unicelulares. No obstante, algunos pluricelulares utilizan esta estrategia para reproducirse en ciertos momentos de su vida. Ya que este tipo de reproducción está basado en la mitosis, no sólo facilita la multiplicación de organismos, sino que también tiene diversas funciones en el cuerpo humano, como la cicatrización.

Un grupo de organismos que se reproduce asexualmente son los procariontes. En Biología I revisaste las características principales de estos organismos.

esto ya lo sabes

Describe brevemente estas características en tu cuaderno.
Existen diferentes formas de reproducción asexual. Una de ellas es la fisión binaria, que quiere decir que una célula se divide en dos. Ésta es la forma más sencilla y la llevan a cabo los organismos procariontes. En general es un proceso muy similar a la mitosis, con la diferencia de que los procariontes tienen un solo cromosoma y no se forma un huso mitótico. La célula debe duplicar su cromosoma y cuando este proceso se completa, cada cromosoma se une a la membrana celular. El siguiente suceso es que la célula duplique sus componentes, y provoque que crezca. Por tanto, los cromosomas unidos a la membrana se separan. Ahora la célula sigue aumentando su vo-

45

BIO2-DGB-U1.indd 45

2/21/08 11:39:30 AM

2 Reproducción celular y en organismos

• Piensen en organismos como plantas, hongos, otros animales y bacterias. ¿Hay división celular en ellos? Expliquen su respuesta.

Unidad 1 Reproducción y herencia

lumen hasta duplicarlo, y se forma un pliegue en la membrana hacia el interior de la célula (este proceso se conoce como invaginación). La invaginación de la membrana continúa hasta que las membranas de ambos lados se fusionan y separan, dividiendo a la célula en dos células hijas idénticas.
1 pared celular punto de fijación

membrana plasmática 2

adn circular

3

4

La fisión binaria es una forma de mitosis evolutivamente menos desarrollada. Los organismos procariontes se valen de ella para reproducirse asexualmente.

Las anémonas, pertenecientes al phylum Cnidaria, se pueden reproducir por gemación.

Ya se ha mencionado que no sólo los organismos unicelulares pueden reproducirse asexualmente. Éstas son algunas estrategias asexuales de los organismos pluricelulares. Gemación. Ocurre gracias a la formación de un brote o yema (similar a los brotes de las plantas de donde salen nuevos tallos) en alguna parte del cuerpo del organismo que parece una miniatura del progenitor. La yema se alimenta del progenitor hasta que alcanza cierto tamaño y después se desprende para funcionar como un miembro independiente. La gemación produce organismos idénticos al progenitor. La realizan hongos como las levaduras y animales como las anémonas. Esporulación. Los hongos y algunos protozoarios se reproducen utilizando un tipo de células con una cubierta o cápsula protectora

46

BIO2-DGB-U1.indd 46

2/21/08 11:39:32 AM

y rígida llamadas esporas. Dichas esporas se producen por mitosis y, cuando han madurado, se liberan al medio. El objetivo es que lleguen a un lugar con condiciones favorables para que un organismo pueda vivir. Entonces germinan, es decir, rompen la cubierta y comienzan a dividirse y a formar un organismo nuevo. Reproducción vegetativa. Algunas plantas se reproducen de esta manera cuando las condiciones ambientales son muy estables y favorables para la planta. Así que no es necesario gastar energía en producir flores. Esto ocurre muy a menudo en selvas tropicales debido a que la planta, o el ser humano según sea el caso, puede enterrar una rama y ésta produce raíces. Esta forma se llama reproducción por acodos. Otra forma es que un fragmento de rama que cayó al suelo comience a generar raíces y de ahí un nuevo organismo; se conoce como estacas. Esta estrategia reproductiva la aprovecha el hombre cuando las características de una planta son muy favorables, por ejemplo en los viñedos, donde se busca que muchas plantas produzcan uvas con las mismas características de sabor para generar un vino específico. Fragmentación. Las estrellas de mar, los corales, las medusas, las lombrices de tierra y algunos gusanos planos tienen la capacidad de generar un organismo nuevo a partir de un fragmento de su cuerpo. Por lo general el organismo se divide en dos y cada fragmento regenera la parte que le falta, ambos quedan como organismos completos e idénticos entre sí. Partenogénesis. En algunas poblaciones de reptiles, como las lagartijas, en las que todos los organismos son hembras, se observa este tipo de reproducción. Cuando se estudió el fenómeno se dieron cuenta de que las hembras producían huevos que, al no ser fecundados, duplicaban su material genético y se producía una hembra. Toma en cuenta que los huevos son óvulos y por tanto tienen sólo la mitad del material genético de una célula somática. Este tipo de reproducción no es exclusiva de las lagartijas, también se ha encontrado en otros reptiles, en caracoles, en algunos crustáceos, y en insectos como abejas y pulgones de las rosas. En todos los casos, los óvulos no fecundados son capaces de activar su desarrollo y formar un nuevo

El ser humano ha explotado la reproducción vegetativa para obtener grandes plantaciones en las que todas las plantas tienen características idénticas.

47

BIO2-DGB-U1.indd 47

2/21/08 11:39:36 AM

2 Reproducción celular y en organismos

Unidad 1 Reproducción y herencia

individuo, por lo general una hembra. Muchos de estos organismos alternan la partenogénesis con la reproducción sexual. Esto depende de si se conservan las condiciones ambientales o si cambian, respectivamente. En conclusión, la mitosis permite que la mayoría de estas estrategias se puedan llevar a cabo. De hecho, la mitosis es un tipo de reproducción asexual que llevan a cabo todas las células de todos lo organismos, con la única excepción de las células reproductoras.

Es común encontrar en la Naturaleza organismos que nacieron de un óvulo no fecundado mediante un proceso llamado partenogénesis.

Vuelve a leer las diferentes formas de reproducción asexual y elabora un mapa conceptual en tu cuaderno.
haz tu bicho

Imagina que tu bicho se reproduce asexualmente.
• ¿Cuál de las estrategias asexuales llevaría a cabo tu bicho?

• Describe cómo sucedería.

• En tu cuaderno, elabora un esquema de este proceso.

48

BIO2-DGB-U1.indd 48

2/21/08 11:39:40 AM

La meiosis es un tipo de división celular especializado para producir células reproductoras o gametos, que son el óvulo y el espermatozoide y presentan características distintas al resto de las células del cuerpo.

Anteriormente, en este capítulo, revisamos las características que poseen
las células haploides y las células diploides.

esto ya lo sabes

Describe brevemente y con tus palabras estas características.
conceptos
Meiosis es el tipo de división celular que produce células con una sola copia del material genético y que comprende dos divisiones celulares sucesivas.

Esta meiosis la realizan cierto grupo de células destinadas a convertirse en gametos. Estas células están presentes en los tejidos especializados en la reproducción. En los mamíferos se llaman gónadas, en particular se les llama testículos, en el caso de los machos, y ovarios, en el caso de las hembras. Este proceso involucra dos divisiones celulares sucesivas y sólo una duplicación del material genético antes de iniciar. Una diferencia importante entre la meiosis y la mitosis se encuentra en la primera división. Los pares de cromosomas o cromosomas homólogos intercambian material genético (adn) cuando ocurre un suceso conocido como entrecruzamiento. El fenómeno de intercambio de material entre cromosomas homólogos es la recombinación, y gracias a ella las células que resultan de la meiosis tienen información genética diferente a la de las células que la originaron. Explicaremos esto un poco más adelante. En términos generales, la meiosis abarca una única replicación de adn seguida de dos divisiones celulares denominadas meiosis i y meiosis ii.
cromátidas hermanas enzimas de recombinación

La meiosis es el mecanismo de producción de los gametos.

49

BIO2-DGB-U1.indd 49

2/21/08 11:39:58 AM

2 Reproducción celular y en organismos

Meiosis

Profase I

leptoteno

zigoteno

paquiteno

diploteno

diacinesis

Durante el entrecruzamiento los cromosomas homólogos se unen en lugares específicos llamados quiasmas e intercambian material.

Meiosis i Antes de esta fase hay una interfase prolongada en la que hay una replicación del adn. Esta primera división celular comprende cuatro fases: profase i, metafase i, anafase i y telofase i. En la profase I ocurren muchos sucesos importantes y característicos de la meiosis, por lo que se ha subdividido en cinco etapas: leptoteno, zigoteno, paquiteno, diploteno y diacinesis. Profase i En esta fase se lleva a cabo el entrecruzamiento de los cromosomas y el intercambio de material genético de acuerdo con la siguiente secuencia. • Leptoteno (de origen griego, significa filamento delgado) El nombre se refiere a cómo se ve la cromatina en este momento de la división, ya que se condensa en una región de la célula y se acorta para formar los cromosomas. Éstos se organizan en pares con sus homólogos. Ya que en la interfase, antes de la meiosis, se duplicó el material genético. En este punto se pueden observar cuatro cromosomas de cada tipo, es decir, dos pares de cromosomas homólogos. • Zigoteno (del griego zygon, pareja) Su nombre se debe a que los cromosomas homólogos se alinean, como si se juntaran por parejas. En ese momento entre los cromosomas se forma una estructura llamada complejo sinaptonémico, compuesta de diferentes tipos de proteínas que mantienen unidas a las cuatro copias de cada cromosoma, formando tétradas. Este proceso de unión de las copias de cromosomas se conoce como sinapsis. • Paquiteno En la figura se observa que los cromosomas son como una hebra gruesa. Por ello esta fase se llama paquiteno, que significa filamento grueso. Esta fibra gruesa se forma porque los cromosomas se han unido a todo lo largo con intervención del complejo sinaptonémico. Si se observa más de cerca la estructura, luce como si los cromosomas estuvieran unidos por un cierre. Es justo ahora, cuando los cromosomas están unidos, que se da el entrecruzamiento. En ciertas regiones específicas de cada cromosoma se da el intercambio de segmentos de adn. Este lugar, donde se unen los cromosomas homólogos para intercambiar material, se llama quiasma. • Diploteno Ahora empiezan a separarse los cromosomas y se desintegra el complejo sinaptonémico. Sin embargo, permanecen unidos en la zona de los quiasmas. • Diacinesis Después de todo lo ocurrido, la diacinesis permite identificar los cuatro cromosomas homólogos, aunque se siguen manteniendo unidos por algunos de los quiasmas por haberse reducido su número.

50

BIO2-DGB-U1.indd 50

Unidad 1 Reproducción y herencia

2/21/08 11:40:00 AM

Metafase i Los husos mitóticos, aquellos cables o fibras de proteína que se extienden desde los polos de la célula, se anclan a los cromosomas ya acomodados en medio de la célula y todavía unidos por los quiasmas. También desaparece el nucleolo y la membrana nuclear. Anafase i Las fibras del huso atraen a cada cromosoma y lo separan completamente de su homólogo. Entonces cada cromosoma migra hacia extremos opuestos de la célula. Telofase i Al igual que en la mitosis, en esta etapa las fibras del huso desaparecen, y en algunas especies se forma la envoltura nuclear. Por lo general, en esta etapa se da la citocinesis. En el momento de la meiosis I se tienen dos células diploides, pero cada una con información genética diferente debido al entrecruzamiento. Comienza entonces una interfase, llamada intercinesis, en la que no hay duplicación del adn, sino la separación de las cromátidas desde el centrómero para que queden libres y migren de manera independiente. Meiosis ii La meiosis ii, que se asemeja mucho a una mitosis, consta también de varias etapas: la profase ii, la metafase ii, la anafase ii y la telofase ii. Profase ii Si se formó una membrana nuclear, desaparece en este momento y se forman las fibras del huso. Metafase ii Los cromosomas se alinean en el ecuador celular gracias a su unión con las fibras del huso. Anafase ii Las cromátidas hermanas se separan y migran a polos opuestos. Telofase ii La migración de los cromosomas termina y se forma la envoltura nuclear a su alrededor. Desaparecen las fibras del huso y los cromosomas se desbaratan, por lo que es difícil observarlos, la cromatina se ve laxa, es decir, el adn está empaquetado pero no por completo. Después, las dos células se dividen por diacinesis y se obtienen cuatro células con la peculiaridad de que cada una posee una sola copia de cada cromosoma. Por tanto, se dice que las cuatro células resultantes de la meiosis son células haploides. Recuerda que cuando una célula se divide por mitosis, el resultado son sólo dos células, cada una con dos copias de cada cromosoma, es decir, células diploides. Las células que conforman el cuerpo de un organismo eucarionte son siempre células diploides, las únicas células haploides que éste posee son las de los gametos. Cuando un gameto se fusiona con otro de su misma especie y de sexo contrario, la célula resultante, llamada cigoto, tiene otra vez dos copias de cada cromosoma, se dice que

quiasma los cinetocoros de las cromátidas hermanas permiten que se separen anafase I

metafase II

las fibras del cinetocoro de las cromátidas hermanas apuntan hacia direcciones opuestas

anafase II separación súbita de las cromátidas

Los cromosomas están unidos por los quiasmas en la metafase I y se separan los homólogos en la anafase I. En la metafase II cada cromátida se une a un huso en dirección contraria a su cromátida hermana, y en la anafase II se separan completamente y cada célula termina con un juego de cromosomas.

51

BIO2-DGB-U1.indd 51

2/21/08 11:40:02 AM

2 Reproducción celular y en organismos

metafase I

metafase I

Unidad 1 Reproducción y herencia

anafase I

telofase I

profase II

metafase II

anafase II telofase II

gametos haploides
La meiosis es un proceso de división celular de dos divisiones sucesivas y un entrecruzamiento de cromosomas que origina cuatro células hijas con información genética propia y diferente a la de su progenitora y a la de sus hermanas.

52

BIO2-DGB-U1.indd 52

2/21/08 11:40:04 AM

recupera la diploidía. El cigoto tiene un juego de cromosomas del padre y otro de la madre; es decir, un juego de cromosomas procede de un gameto y el otro juego del gameto del sexo opuesto. El cigoto tiene entonces la capacidad de originar un nuevo organismo gracias a que efectúa numerosas divisiones por mitosis para formar todas las células del futuro embrión. Cuando este nuevo organismo produzca gametos se intercambiará y mezclará la información de ambos padres durante el entrecruzamiento. El resultado serán gametos con información genética mezclada y diferente a la del resto de las células de este organismo. En este resultado radica la verdadera importancia de la meiosis: producir variantes de la información genética en los gametos, es decir, diferentes combinaciones que les otorga información genética propia y única a los gametos.

Ahora que conoces los procesos de meiosis y mitosis contesta las siguientes preguntas.
• ¿Qué tipo de células se dividen por mitosis?

• ¿Qué células se dividen por meiosis? • ¿Cuántas células hijas quedan después de que una célula se dividió por mitosis? • ¿Cuántas células hijas resultan de la división por meiosis? • Completa el cuadro.
Mitosis Meiosis

¿Qué tipo de células la realizan?

¿Hay duplicación del ADN antes de iniciar?

¿Cuáles son sus fases?

53

BIO2-DGB-U1.indd 53

2/21/08 11:40:06 AM

2 Reproducción celular y en organismos

Mitosis

Meiosis

Unidad 1 Reproducción y herencia

¿Cuántas divisiones celulares comprende?

¿Qué características tienen las células resultantes?

¿Cuál es el evento más destacado que sucede durante el proceso?

Gametogénesis
Como ya viste, todas las células reproductoras o gametos se originan por meiosis. Sin embargo, cada tipo de gameto, masculino o femenino, sigue procesos especiales que culminan con una maduración. Primero hay que entender que desde el desarrollo embrionario existen ciertas células que son anteriores a los gametos y que se dividen por mitosis, hasta que señales bioquímicas indican iniciar la meiosis que producirá gametos. No todas estas células inician la meiosis al mismo tiempo, sino un grupo a la vez.

54

BIO2-DGB-U1.indd 54

2/21/08 11:40:08 AM

Otra cuestión importante es que, en general, el inicio de la meiosis ocurre en el momento en que el organismo alcanza la madurez sexual. Sin embargo, en el caso de los mamíferos la meiosis inicia en momentos diferentes para el sexo masculino y el femenino. En los machos, las espermatogonias o células precursoras de los espermatozoides se dividen por meiosis hasta que el individuo alcanza la pubertad o madurez sexual. En las hembras, en cambio, las ovogonias, antecesoras de los óvulos, realizan la primera parte de la meiosis durante el desarrollo embrionario; luego se detienen en la profase I. La meiosis se reactiva cuando el organismo llega a la pubertad. El proceso de la gametogénesis forma los gametos; gametogénesis quiere decir generación de gametos. Existen dos tipos de gametogénesis, la espermatogénesis que origina gametos masculinos, espermatozoides, y la ovogénesis que produce gametos femeninos, óvulos. La diferencia entre ambos procesos está en la función de cada gameto. En tanto los gametos masculinos suelen tener muy poco citoplasma para ser lo más pequeños y móviles posible, los femeninos son muy grandes, acumulan muchos nutrimentos en su gran citoplasma y casi no se mueven, en realidad esperan a que el espermatozoide se encuentre con ellos. En todos los organismos los gametos masculinos se producen por miles y miles. Lo mismo ocurre con la mayoría de las hembras del reino animal. Sin embargo, la gran excepción son las hembras de reptiles, aves y mamíferos que producen sólo un número determinado (por lo general reducido) de gametos femeninos. Este hecho, además de afectar la forma en que se produce cada tipo de gameto, tiene un efecto en la conducta de cada sexo. Si te fijas, entre los vertebrados es común que los machos muestren comportamientos de lucha entre ellos, colores y cantos vistosos, o incluso llevar regalos a las hembras o construir los nidos; son las hembras quienes parecen elegir al macho que les conviene para invertir sus pocos óvulos disponibles. Espermatogénesis Después de muchas divisiones mitóticas dentro de los testículos, las espermatogonias se diferencian en espermatocitos primarios. Estas células inician la meiosis y al término de la meiosis I han formado dos células diploides llamadas espermatocitos secundarios, que iniciarán la meiosis II y cada uno formará dos células haploides llamadas espermátidas. Las espermátidas son espermatozoides inmaduros que sufrirán cambios en su estructura y componentes celulares para convertirse en espermatozoides activos y listos para nadar en busca de un óvulo.

conceptos
Gametogénesis es el proceso de formación de gametos por medio de la meiosis. Espermatogonias son las células precursoras de los espermatozoides.

55

BIO2-DGB-U1.indd 55

2/21/08 11:40:11 AM

2 Reproducción celular y en organismos

La espermatogénesis es el proceso de formación de los gametos masculinos o espermatozoides.

espermatogonia

Unidad 1 Reproducción y herencia

espermatocito primario

espermatocito secundario espermátida meiosis i meiosis ii espermatozoide maduración

Ovogénesis Una característica de la ovogénesis es que en los mamíferos inicia durante el desarrollo embrionario en los ovarios del feto. Un grupo de células llamadas ovogonias comienzan a dividirse por mitosis y producen ovocitos primarios. Los ovocitos primarios empiezan la meiosis, pero se interrumpe en la metafase I. Antes de que el desarrollo embrionario termine, ya no hay ovogonias en los ovarios y sólo quedan los ovocitos primarios que la hembra tendrá por el resto de su vida. Todos los ovocitos primarios tendrán el proceso de división detenido antes de completar la primera división meiótica. En las hembras humanas esto ocurre antes de llegar al tercer mes de desarrollo embrionario. Después del nacimiento, los ovocitos primarios empiezan a acumular sustancias nutritivas y por tanto aumentan mucho su tamaño. Así permanecen hasta que la mujer alcanza la pubertad. Entonces, mes con mes un ovocito reactiva la meiosis I y genera dos células diploides. Detengámonos un poco en este punto. Recuerda que uno de los objetivos del ovocito es acumular todos los nutrimentos posibles. Por esta razón las dos células que se producen después de la primera división meiótica tienen tamaños diferentes. Una de ellas se queda con casi todo el citoplasma y se llama ovocito secundario, y la otra célula, el cuerpo polar, prácticamente no tiene citoplasma y por tanto es mucho más pequeña. Esta célula pequeña tiene las mismas características genéticas que el ovocito secundario y también podría quedar fecundada, pero como no tiene una reserva de nutrimentos suficiente, no podría llevar a cabo el desarrollo embrionario. El cuerpo polar recibe su nombre porque la división de la célula original, el ovocito primario, ocurre cerca de una orilla o polo. Con ello se garantiza que

56

BIO2-DGB-U1.indd 56

2/21/08 11:40:13 AM

ovocito secundario ovogonia óvulo

La ovogénesis inicia durante el desarrollo embrionario y culmina hasta el momento de la fecundación.

cuerpo polar ovocito primario cuerpo polar cuerpo polar cuerpo polar meiosis ii meiosis i (después de la fecundación)

Dibuja en tu cuaderno un esquema donde compares la espermatogénesis con la ovogénesis. Anota los nombres de las células que inician el proceso. Reproducción sexual
La reproducción sexual involucra la producción de gametos tanto masculinos como femeninos por medio de la gametogénesis. Gracias a la fecundación, estos gametos se encuentran y se fusionan; finalmente se desarrolla el nuevo organismo. Podríamos definir la reproducción sexual como el tipo de reproducción que involucra la fusión de dos gametos de dos organismos de la misma especie y de sexo opuesto. Para ello es necesario que se encuentren dos organismos de la misma especie y del sexo opuesto en el momento indicado, para que cada

57

BIO2-DGB-U1.indd 57

2/21/08 11:40:15 AM

2 Reproducción celular y en organismos

sólo una de las células se quede con la mayor cantidad de citoplasma y con todos los organelos necesarios para el desarrollo de un nuevo organismo. Al terminar la meiosis i, el ovocito secundario inicia la meiosis ii sin pasar por ninguna interfase. El primer cuerpo polar también lleva a cabo la meiosis ii y produce dos cuerpos polares más. Así, al final de la meiosis de las células sexuales femeninas se obtiene un gameto de gran tamaño, y tres cuerpos polares que se desechan. Es importante mencionar que la meiosis ii se interrumpe al llegar a la metafase y sólo se reiniciará cuando el óvulo quede fecundado. En este momento se forma una célula grande llamada ovátida y otro cuerpo polar.

conceptos
Fecundación es la fusión del gameto masculino con el femenino cuyo resultado será la formación de una célula diploide, llamada cigoto, cuyas divisiones sucesivas la llevan a formar un nuevo organismo.

uno aporte sus gametos. En las plantas suele ser un problema que se soluciona con diferentes estrategias. Una, que fue de las primeras que se utilizaron, es aprovechar el aire para permitir que los granos de polen, que llevan los gametos masculinos, alcancen las estructuras femeninas y fecunden los óvulos. Otra estrategia es aprovechar insectos que lleven el polen de una flor a otra. Algunos animales logran acercar los espermatozoides al óvulo depositándolos dentro del aparato reproductor femenino. Esta estrategia se llama fecundación interna y la llevan a cabo sólo los mamíferos, las aves y los reptiles que, como recordarás, son los animales cuyas hembras producen pocos gametos. Esto tiene muchas ventajas ya que el macho se asegura de que la hembra que lo eligió aproveche su semen. Además, en el caso de animales que cuidan a sus crías, el macho puede estar seguro de que las crías que cuidará son sus hijos. Otra ventaja es que casi se puede asegurar la fecundación, ya que el semen se quedará en el aparato reproductor femenino y no se desperdiciará. Otra forma de fecundación en los animales es la externa, en la que los organismos depositan los óvulos y los espermatozoides en un lugar cercano para que los fecunden. Algunas especies, como los corales, liberan espermatozoides y óvulos un día específico del año.

Unidad 1 Reproducción y herencia

Las aves, los mamíferos y los reptiles se valen de la fecundación interna para incrementar las posibilidades de fertilización.

2 reacción acrosomal (inicia la penetración) 1 unión del espermatozoide a la zona pelúcida

membrana plasmática del óvulo zona pelúcida

3 penetración a través de la zona pelúcida

Cualquiera que sea la estrategia de la especie animal para fecundar un óvulo, el objetivo es el mismo, que un espermatozoide se fusione con un óvulo para iniciar el desarrollo de un nuevo individuo. Éste es un esquema de los sucesos cuando un espermatozoide encuentra un óvulo.

4 Fusión de las membranas plasmáticas 5 el núcleo del espermatozoide entra el citoplasma del óvulo

58

BIO2-DGB-U1.indd 58

2/21/08 11:40:17 AM

Esto ocasiona que el mar se llene de gametos que en algún momento se encontrarán y se fecundarán. Otras especies buscan más seguridad y una vez que se establece la pareja, la hembra deposita los óvulos en un lugar y sobre ellos el macho descarga el semen; de esta manera se asegura la fecundación de la mayoría de los óvulos. Otro ejemplo es el de algunas especies de ranas y sapos, el macho se coloca sobre la hembra y le da un tipo de abrazo llamado amplexo; esto es una señal para que la hembra deposite los óvulos al tiempo que el macho los baña con semen. Lo más importante de la fecundación es que se fusionan ambos gametos y el resultado es una célula con dos juegos de cromosomas, uno de ellos proveniente de la madre y el otro del padre. Estas dos copias del material genético se volverán a combinar durante la meiosis, y las células resultantes llevarán un solo juego de cromosomas con características combinadas del padre y de la madre.

Aunque ya viste cómo se reproduciría tu bicho de manera asexual, ahora imagina que se reproduce sexualmente.
• Identifica si tu bicho es un macho o una hembra. Describe las características que lo identifican con ese sexo. • Dibuja a tu bicho con sus características sexuales.

haz tu bicho

• Ahora imagina el sexo opuesto de tu bicho y dibújalo también.

Ventajas de la reproducción sexual y asexual
Si analizamos los dos tipos de reproducción desde el punto de vista de la velocidad para obtener nuevos organismos seguramente concluiremos que la reproducción asexual es mucho mejor. Este tipo de reproducción permite obtener muchas generaciones de individuos en poco tiempo. Si tomamos el ejemplo de las bacterias, que se reproducen por fisión binaria, notamos que pueden tardar tan solo veinte

59

BIO2-DGB-U1.indd 59

2/21/08 11:40:21 AM

2 Reproducción celular y en organismos

minutos en dividirse por lo que en poco tiempo tenderemos varias generaciones de bacterias. Por lo tanto, si lo que buscamos es rapidez, la reproducción asexual sale ganando. Otra ventaja de la reproducción asexual es que se invierte muy poca energía, ya que no es necesario producir gametos, muchos de los cuales se desperdiciarán y no originarán nuevos organismos. Por lo tanto es mucho más eficiente que la sexual. También resulta ventajoso que para reproducirse asexualmente el organismo no necesite buscar y encontrar a otro individuo de su misma especie y de sexo opuesto, lo que también ahorra energía. Con todas estas ventajas que aporta la reproducción asexual resulta difícil imaginar porqué la Naturaleza propició el desarrollo de la reproducción sexual. Sin embargo, resulta obvio pensar que debe tener alguna ventaja superior, ya que la mayoría de los organismos la llevan a cabo, al menos en alguna etapa de su vida. Esta ventaja radica en la alta probabilidad de originar organismos con características genéticas únicas dentro de su especie, lo que se logra gracias a la recombinación de genes que sucede durante la meiosis. Este evento provoca que cada gameto que se produce lleve cromosomas con pedacitos que provienen unos de la madre y otros del padre. Imagina que tienes un mazo de barajas con un estilo rojo en el reverso y otro con un estilo azul y los revuelves. Luego separas ambos mazos de barajas pero no te fijas en el estilo del reverso de los mazos sino únicamente en tener el mazo de cartas completo. Si revisas el reverso de cada mazo verás que tienes unas cartas con un diseño y otras con el otro. Por lo tanto tus mazos ahora son diferentes a los originales. Algo similar es lo que sucede en la recombinación.

Unidad 1 Reproducción y herencia
El genoma de un gameto se asemeja a un mazo de cartas completo que tiene dos patrones diferentes, tiene toda la información necesaria pero con pequeñas variaciones que lo hacen único.

60

BIO2-DGB-U1.indd 60

2/21/08 11:40:22 AM

Entonces todos los organismos producto de la reproducción sexual tienen características individuales, pero ¿para qué sirve esto? La respuesta se basa en el medio. Imagina un viñedo. Como ya hemos visto, las plantas que lo forman son todas idénticas, ya que provienen de una sola que se fue reproduciendo asexualmente por acodos. Si en la zona donde se encuentra el viñedo cambia el clima drásticamente, digamos que la temperatura promedio desciende unos cuantos grados y estas plantas no tienen la capacidad para soportar esas temperaturas, entonces el viñedo entero morirá. Esto no es muy grave en términos ecológicos, porque aún existirán otras plantas de vid en el planeta que sobrevivirán y de donde se restaurará este viñedo. Pero ahora planteemos este problema en una población natural, es muy poco probable que una población en la que no hay variabilidad genética sobreviva en caso de un cambio en el medio o incluso si tiene que migrar y vivir en un lugar diferente. Es necesario entonces que entre los individuos de una población haya pequeñas diferencias, ya que esto les permitirá adaptarse a posibles cambios en el medio. Entonces la reproducción sexual aporta variabilidad en una población a partir de la recombinación de los cromosomas, lo que resulta de gran importancia en las poblaciones de organismos. Esto se puede comprobar evaluando una estrategia que realizan las bacterias, la conjugación, que revisamos el curso pasado. El objetivo de esta estrategia es precisamente obtener variantes de los genes que ya tienen las bacterias, es la forma en que ellas resuelven el hecho de no reproducirse sexualmente. Otro ejemplo lo podemos observar en especies hermafroditas. Un organismo hermafrodita es aquel que tiene la capacidad de producir gametos femeninos y masculinos. Ejemplos de estos organismos son los caracoles, muchas plantas y algunos moluscos. Estos organismos no suelen autofecundarse, en lugar de esto, buscan otro organismo de su especie con quien intercambiar gametos y entonces reproducirse. Imagina toda la energía invertida en producir los gametos como para desperdiciarla en una autofecundación, la variabilidad se anularía.

conceptos
Variabilidad genética es la variación en el material genético de una población que otorga muchas posibilidades de fenotipo.

Aunque algunas flores produzcan óvulos y polen no suelen autofecundarse.

En tu cuaderno responde las siguientes preguntas:
• ¿Cuántos gametos útiles se producen en total a partir de una célula en la espermatogénesis? ¿Y en la ovogénesis? • ¿Cuál es la característica principal de la reproducción sexual? • Describe la importancia de la fecundación interna y de la externa. • Menciona y explica la ventaja más importante que para ti tienen los dos tipos de reproducción, la sexual y la asexual.

61

BIO2-DGB-U1.indd 61

2/21/08 11:40:26 AM

2 Reproducción celular y en organismos

haz tu bicho

hora que conoces las ventajas y desventajas de la reproducción asexual y de la sexual, decide qué tipo de reproducción tendrá tu bicho.

A

Unidad 1 Reproducción y herencia

Imagina todo el proceso completo e ilústralo en el siguiente cuadro.

• Describe las razones por las que elegiste este tipo de reproducción para tu bicho.

62

BIO2-DGB-U1.indd 62

2/21/08 11:40:30 AM

3 La herencia
3 La herencia

En tu cuaderno escribe una reseña de los estudios de Gregor Mendel sobre genética y cómo fue que se interesó en ellos. Si lo necesitas, regresa a tu libro del curso anterior de Biología y completa esa información con una investigación. Imagina que hay muchos organismos como tu bicho.
• ¿Cómo identificarías a los organismos que son hijos o hermanos? ¿Qué características tomarías en cuenta? Descríbelo.

esto ya lo sabes

haz tu bicho

T

odos sabemos de manera más o menos intuitiva lo que es la herencia. Por ejemplo, podemos identificar a los hijos de una pareja gracias a rasgos físicos semejantes. Incluso utilizamos expresiones como “tienes los ojos de tu abuela”. También lo podemos observar en los perros, las razas que conocemos en la actualidad son el resultado de una selección artificial de rasgos que resultaban benéficos para un propósito en particular, y que se fueron heredando de padres a hijos sin perderse, hasta la actualidad. ¿Cuáles son las bases de estos fenómenos?

Herencia mendeliana
Mendel fue el primero en descifrar las bases de la herencia utilizando como modelo la planta de los chícharos e identificando características que podía reconocer con facilidad. También acuñó muchos términos de genética que se utilizan en nuestros días en todos los niveles. Antes de entrar en materia revisemos algunos conceptos que utilizarás en este tema.

Tenemos conocimientos empíricos en cuanto a la herencia y los aplicamos cuando adivinamos el parentesco.

63

BIO2-DGB-U1.indd 63

2/21/08 11:40:31 AM

conceptos
Alelo es una de las posibles formas de un gen. Alelo dominante es la forma de un gen que determina el fenotipo aunque esté junto otra forma del gen. Alelo recesivo es la forma de un gen que sólo se expresa en el fenotipo cuando dos copias están en cromosomas homólogos. Homocigoto es una célula que tiene el mismo alelo de un gen en un par de cromosomas homólogos. Heterocigoto es la célula que tiene dos formas diferentes de un gen en un par de cromosomas homólogos.

Recuerda que los organismos poseen células diploides y que, por tanto, tienen dos juegos de cromosomas. Si recuerdas también que dentro de los cromosomas están los genes, entonces puedes deducir que hay dos copias de cada gen en cada una de nuestras células. Cada gen puede tener diferentes formas, por ejemplo, un gen para el color de las semillas puede tener las variantes café, negro o gris, aunque sigue siendo el mismo gen. Cada forma diferente del gen se llama alelo. Cuando un organismo tiene sus dos copias de un gen con el mismo alelo se dice que es homocigoto para ese gen. Si por el contrario tiene alelos diferentes se dice que es heterocigoto. Esto es lo que sucede en un organismo heterocigoto para un gen específico. Retomemos el color de las semillas, el organismo que vamos a analizar posee un alelo café y otro negro. ¿De qué color será la semilla? Digamos que la semilla es negra, esto indica que el alelo negro es el dominante, es decir, que se podrá observar en el físico del organismo siempre, aún cuando esté en la forma heterocigota. Por otro lado, el alelo café será un alelo recesivo ya que cuando se presenta en un organismo heterocigoto no es posible observarlo, aunque esté presente en los genes del individuo. Si te das cuenta estamos considerando las características físicas visibles y las características genéticas de los organismos. Las características físicas se conocen con el nombre de fenotipo, y son el resultado de los genes en las células de un individuo y de la interacción con el ambiente. Por otro lado, a las características genéticas se les llama genotipo y es el resultado de los genes que tiene una célula y que provienen de ambos padres. Ahora, revisemos los experimentos y conclusiones de Mendel. Trabajó con la planta de chícharos que presenta varias ventajas, entre ellas que es barata, produce mucha descendencia y se autofecunda. Esta última ventaja permite que quien trabaje con ella obtenga razas puras, es decir, organismos cuyos descendientes presentarán sus mismas características. Pero también se puede evitar que se autofecunde si se cortan los estambres de las flores, donde se produce el polen, y se pueden fecundar con el polen que se decida. Esto fue lo que hizo Mendel, las dejaba autofecundarse o las fecundaba según lo que quisiera investigar.

Unidad 1 Reproducción y herencia

haz tu bicho

Elige una característica para tu bicho, digamos el color de la piel o de los ojos, la estatura, o lo que tú quieras. Ahora determina dos formas posibles, por ejemplo dos colores diferentes. Estas formas que se pueden observar en tu bicho son el fenotipo.

64

BIO2-DGB-U1.indd 64

2/21/08 11:40:36 AM

La evolución biológica de los seres vivos, y su continuidad en una evolución cultural de los seres humanos hasta lograr dar cuenta de la responsabilidad de sobrevivir y preservar su hábitat, son temas de reflexión en Biología 2. La evolución cultural del ser humano como máxima expresión de los obstáculos biológicos y sociales que ha enfrentado en sus doce mil años de existencia también es materia de estudio de la biología. Es la convergencia del esfuerzo mental y físico de hombres y mujeres que dieron sentido a su propia existencia; es el punto más álgido del trabajo conjunto con conciencia de sí. Los autores esperan que el contenido de este libro trascienda los muros escolares, y que los jóvenes logren hacerlo parte de su concepción de mundo para que participen con todos los hombres y mujeres que los precedieron, bajo la perspectiva de ser la máxima expresión de la evolución de la vida en su planeta.

Sign up to vote on this title
UsefulNot useful