Está en la página 1de 68

Mariana Martínez Pelayo

Fernando García Hernández

1
Biología 2
1 La evolución biológica de los seres vivos, y su continuidad en una evolución cultural de
los seres humanos hasta lograr dar cuenta de la responsabilidad de sobrevivir y preser-
var su hábitat, son temas de reflexión en Biología 2.

Biología 2
La evolución cultural del ser humano como máxima expresión de los obstáculos
biológicos y sociales que ha enfrentado en sus doce mil años de existencia también es
materia de estudio de la biología. Es la convergencia del esfuerzo mental y físico de
hombres y mujeres que dieron sentido a su propia existencia; es el punto más álgido
del trabajo conjunto con conciencia de sí.
Los autores esperan que el contenido de este libro trascienda los muros escolares, y
que los jóvenes logren hacerlo parte de su concepción de mundo para que participen
con todos los hombres y mujeres que los precedieron, bajo la perspectiva de ser la
máxima expresión de la evolución de la vida en su planeta.

BACHILLERATO

Elaborado según la Reforma curricular


con un enfoque educativo centrado
en el aprendizaje.

Biologia 2 DGB cover.indd 1 2/18/08 1:51:43 PM


Elaborado según la Reforma curricular
con un enfoque educativo centrado en el aprendizaje.

Biología 2 Mariana Martínez Pelayo


Fernando García Hernández

El libro Biología 2 es una obra colectiva,


creada y diseñada en el Departamento de Investigaciones Educativas
de Editorial Santillana, con la dirección de Clemente Merodio López.

BIO2-DGB-U1.indd 1 2/21/08 11:36:33 AM


1 nidad 1
El libro Biología 2 fue elaborado en
Editorial Santillana por el siguiente equipo:
edición

coordinación editorial

revisión técnica

corrección de estilo

diseño de interiores

diseño de portada
Catalina Pelayo Rojas
Roxana Martín-Lunas Rodríguez • Laura Milena Valencia Escobar
Tanya Marcela González Martínez
Martha Johannsen Rojas
Miguel Ángel Macías Sierra
José Francisco Ibarra Meza
coordinación de arte y diseño
José Francisco Ibarra Meza
coordinación de iconografía
Germán Gómez López
investigación iconográfica
Paula Arroio Sandoval • Juan Miguel Bucio Trejo • Miguel Ángel Macías Sierra
ilustrador
Miguel Ángel Macías Sierra
fotografía
Archivo Santillana • Science Photo • Stock Photos
diagramación
Miguel Ángel Macías Sierra

editora en jefe de bachillerato


Laura Milena Valencia Escobar
gerencia de investigación y desarrollo
Armando Sánchez Martínez
gerencia de procesos editoriales
Laura Milena Valencia Escobar
gerencia de diseño
Mauricio Gómez Morin Fuentes
coordinación de arte y diseño
José Francisco Ibarra Meza
coordinación de iconografía
Germán Gómez López
coordinación de procesos editoriales

digitalización de imágenes
En la ciencia no es importante obtener
Víctor Manuel Vallejo Paquini
José Perales Neria • Gerardo Hernández Ortiz
datos nuevos como descubrir formas
María Eugenia Guevara Sánchez
Enfotomecánica
la ciencia no es
electrónica
importante
Gabriel nuevas
Miranda Barrón deZeapensar
obtener
• Manuel datos en esoscomo
Atenco nuevos datos.
Benito Sayago Luna
descubrir formas nuevas de pensar en esos datos.
William Bragg
William Bragg
La presentación y disposición en conjunto y de cada
página de Biología 2 son propiedad del editor.
Queda estrictamente prohibida la reproducción
parcial o total de esta obra por cualquier sistema
o método electrónico, incluso el fotocopiado,
sin autorización escrita del editor.
D.R. © 2008 por EDITORIAL SANTILLANA, S. A. DE C. V.
Av. Universidad 767, 03100, México, D. F.
ISBN: 978-970-29-2041-0
Primera edición: marzo de 2008
Miembro de la Cámara Nacional de la Industria Editorial Mexicana. Reg. Núm. 802
Impreso en México.
2

BIO2-DGB-U1.indd 2 2/21/08 11:36:42 AM


Presentación
Todos los días me recuerdo a mí mismo que mi vida interior y exterior está ci-
mentada en el trabajo de otros seres humanos, vivos y muertos, y que debo afa-
narme por dar en la misma medida en que he recibido y continúo recibiendo.
Albert Einstein

La evolución biológica de los seres vivos en nuestro planeta ha trascendido la bio-


diversidad al tiempo que nos confirma a los seres humanos como parte de la
Naturaleza. Ahora, hablamos de la evolución cultural del ser humano como re-
sultado de los obstáculos biológicos y sociales que ha enfrentado en sus doce
mil años de existencia. La cultura es la máxima expresión de la evolución biológi-
ca del ser humano en su interacción con el medio y los demás organismos vivos.
Es el punto donde confluyen el esfuerzo mental y físico de todo un grupo de
personas, hombres y mujeres; es el punto más álgido del trabajo conjunto con
conciencia de sí. Esta conciencia nos obliga a hacernos responsables de todas
nuestras decisiones, sobre todo con respecto al resto de los organismos.
Estamos seguros de que Biología 2 te dará lo necesario para terminar de respon-
der la interrogante “¿Biología para qué?”. Esperamos que esa respuesta más que
estar en tus manos, se refleje en tu cultura y tu conciencia como ser humano.
Esta obra es el resultado del esfuerzo y el afán de varias personas que se conjun-
taron con la certeza de brindarte diversas oportunidades para tu aprendizaje.
El contenido de Biología 2 consta de cuatro unidades, con la sección Para co-
menzar, y los recuadros Hacedores de biología, Haz biología, Conceptos, Para
saber más, Actividad, Esto ya lo sabes, ¿Y en México, qué? Al final de cada unidad
incluimos la Práctica de laboratorio, el Resumen, la Evaluación y el Artículo de
divulgación.
Esperamos que te apropies de esta obra y su contenido, y que la lleves más allá
de tu aula y tu escuela, permitiéndole hacerse parte de tu forma de ver al mun-
do, como la máxima expresión de la evolución de la vida en tu planeta.

Los autores

BIO2-DGB-U1.indd 3 2/21/08 11:36:45 AM


Biología 2......
unidad
Reproducción
1 unidad
2
Evolución 112
unidad
3
Estructura y función de
y herencia 6 Para comenzar 114
las plantas 174
Para comenzar 8 1. Teorías evolutivas 118 Para comenzar 176
1. Genética molecular 9 Primeras ideas de
la evolución 118
1. Nutrición y transporte en
Estructura del adn 10 plantas 179
Replicación del adn 17 Evidencias de la evolución 121
Teoría de Darwin-Wallace 137 Algunas tendencias evolutivas
arn y síntesis de proteínas 24 de las plantas 181
2. La genética La hoja 184
2. Reproducción celular El tallo 192
y en organismos 32 y la evolución 142
La teoría sintética de La raíz 196
Ciclo celular 33
Mitosis 38 la evolución 142
Poza genética 144 2. Reproducción en
Reproducción asexual 45 plantas angiospermas 201
Meiosis 49 Fuentes de variabilidad y
factores causantes de cambio Estructura y función de la flor 203
Gametogénesis 54 El fruto como estrategia
Reproducción sexual 57 en las poblaciones 148
adaptativa de dispersión 208
Ventajas de la reproducción
sexual y asexual 59 3. Origen de las especies 156
El concepto de especie 156 Práctica de laboratorio 211
Especiación alopátrica Resumen 212
3. La herencia 63 Evaluación 213
Herencia mendeliana 63 y simpátrica 162
Artículo de divulgación 215
Herencia posmendeliana 72
Teoría cromosómica 76 Práctica de laboratorio 167
Herencia ligada al sexo 79 Resumen 169
Mutaciones 83 Evaluación 170
Artículo de divulgación 171
4. La genética
del siglo xxi 93
Logros y limitaciones del
proyecto
Genoma Humano 94
Biotecnología 96

Práctica de laboratorio 104


Resumen 107
Evaluación 108
Artículo de divulgación 110
4 4
BIO2-DGB-U1.indd 4 2/21/08 11:36:48 AM
..............................
4 unidad
Procesos en
los animales 218
Para comenzar 220 5. Sistema endocrino 280
1. Digestión 230 Glándulas endocrinas 281
La obtención de nutrimentos 232 Hormonas y su función 282
Órganos y sus funciones 233 Diabetes como ejemplo de
Anorexia y bulimia 247 desorden hormonal 283

2. Sistema Respiratorio 251 6. Sistema Nervioso 286


Respiración celular Funcionamiento de la neurona 288
y ventilación 251 El sistema nervioso central 291
Función de los órganos El sistema nervioso periférico
del sistema respiratorio 255 (somático y autónomo) 294
Daños al sistema respiratorio 258 Riesgos para el sistema nervioso:
uso de drogas y alcohol 302
3. Sistema circulatorio 262
Función de los componentes 7. Reproducción y desarrollo 305
de la sangre 262 Sistema reproductor masculino
Los órganos del sistema circulatorio 263 y femenino 305
Hipertensión como factor Desarrollo Embrionario 324
de riesgo cardiovascular 268
Resumen 327
4. Sistema excretor 271 Evaluación 328
Sistemas homeostáticos 271 Artículo de divulgación 332
Órganos del sistema excretor 274
Función de la nefronas. Anexo 335
Ultra filtración, reabsorción,
excreción 276
Regulación de la función renal.
Acción de los diuréticos 278

55
BIO2-DGB-U1.indd 5 2/21/08 11:37:14 AM
Reproducción
y herencia

Quedémonos ahora en esta vehemente sospecha de que el ansia


de no morir, el hambre de inmortalidad personal, el conato con
que tendemos a persistir indefinidamente en nuestro ser propio,
y que es (...) nuestra misma esencia, eso es la base efectiva de
todo conocer y el íntimo punto de partida personal de toda
filosofía humana, fraguada por un hombre y para hombres.
Miguel de Unamuno

BIO2-DGB-U1.indd 6 2/21/08 11:37:38 AM


En esta unidad...
Identificarás los procesos genéticos en los seres
vivos;
analizarás los riesgos y beneficios de las
aplicaciones de la genética;
plantearás la importancia de la actitud ética y
el respeto para la conservación de los seres
vivos.

1 Genética molecular 3 La herencia


• Estructura del adn • Herencia mendeliana
• Replicación del adn • Herencia posmendeliana
• arn y síntesis de proteínas • Teoría cromosómica
• Herencia ligada al sexo
2 Reproducción celular • Mutaciones
y en organismos
• Ciclo celular 4 La genética del siglo XXI
• Mitosis • Logros y limitaciones: proyecto
• Reproducción asexual Genoma Humano
• Meiosis • Biotecnología
• Gametogénesis
• Reproducción sexual
• Ventajas de la reproducción sexual y
asexual

BIO2-DGB-U1.indd 7 2/21/08 11:37:42 AM


para
comenzar ¿T e has puesto a pensar en los diferentes organismos que ha-
bitan la Tierra? En el curso de Biología I descubriste la gran
biodiversidad en nuestro planeta y que también todos los organis-
mos, por estar vivos, se rigen por una gran cantidad de reglas que les
Unidad 1 Reproducción y herencia

permiten vivir aquí y formar parte de la Naturaleza.


Ahora tendrás la oportunidad de crear un ser vivo, uno que tal vez
venga de otra galaxia, de tus miedos más profundos o del sueño más
loco que hayas tenido.

haz Imagina un bicho, su forma, su tamaño, su color, ¿es terrestre o mari-


tu bicho
no? Tal vez anfibio. ¿Cuántas patas tiene? ¿Tiene alas, plumas o pelo?
¿Corre o nada? En fin, imagina cada característica que pueda tener y
descríbelo lo mejor que puedas.
En el siguiente espacio describe a tu bicho, ponle nombre y dibújalo.
Mi bicho se llama

BIO2-DGB-U1.indd 8 2/21/08 11:37:45 AM


1 Genética molecular
esto ya
Revisa lo que viste en tu curso pasado de Biología sobre los ácidos lo sabes
nucleicos y contesta las siguientes preguntas.
• ¿Qué es un ácido nucleico?

1 Genética molecular
• ¿Qué tipos de ácidos nucleicos conoces?

• ¿Cuáles son las moléculas que forman parte de la estructura de los ácidos
nucleicos?

• Describe la estructura del ácido desoxirribonucleico (adn).

C uando el monje alemán Gregor Mendel (1822-1884) describió


las leyes de la herencia en 1810 no tuvo mucha resonancia. Sin
embargo, un siglo después se retomaron sus estudios y se popula-
rizaron. El estudio de estas leyes, de la manera en la que se regulan
y del factor biológico en el que reside la herencia son el objeto de
la genética. Con el reciente descubrimiento de los cromosomas, el
ADN y su relación con la herencia se agregó el término molecular a la
genética basada en las moléculas de la herencia. No obstante, ahora
resulta un poco redundante hablar de genética molecular, ya que los
factores genéticos residen en moléculas y siempre que las estudiemos
estamos haciendo estudios moleculares. De hecho, se conoce mejor
a esta rama con el nombre de biología molecular, porque lo que se
estudia son moléculas.

Ya sea que hayas pensado en tu bicho como unicelular o pluricelular, sus haz
tu bicho
células deben tener adn y es necesario que pueda duplicarlo para que se
regenere en caso de una herida o de la reproducción.

• ¿Qué características tendría su material genético?

• ¿Cuántas cadenas tendría?

• ¿Cómo se duplicaría su material genético?

BIO2-DGB-U1.indd 9 2/21/08 11:37:53 AM


Estructura del adn

Como ya lo sabes, todas las células de todos los organismos, unicelulares o


multicelulares, procariontes o eucariontes, contienen ácido desoxirribonu-
Unidad 1 Reproducción y herencia

cleico. El adn está formado por tres tipos de moléculas principales;


• un grupo fosfato,
• un azúcar (desoxirribosa), y
• una base nitrogenada.
Las bases nitrogenadas pueden ser de dos tipos. Las que se sinteti-
zan a partir de la pirimidina: citosina y timina; y las que proceden de
la purina: adenina y guanina.
Cuando una molécula de desoxirribosa y una base nitrogenada
están unidas por un enlace covalente se forma un nucleósido. Si este
Los nucleótidos se unen por medio de un enlace
fosfodiéster y las bases nitrogenadas por un
nucleósido se une a un grupo fosfato por un enlace tipo éster, se for-
puente de hidrógeno. ma un nucleótido.

Extremo 5' Extremo 3'


Puentes de hidrógeno
OH H O
H
HO P = O H H
O N H O N
N H H
O
CH2 C N
N H G CH2
O
H H N N H
N
O
O
H H H HO P = O
2.90 Å
O H
H
HO P = O H O
H N N
O H3C O H H
O N A N
CH2 T N H
H H
N
N
CH
2
H H O
O
H H O

O H HO P = O

HO P = O 11.90 Å
H O

O O
H H
O H H
CH2
N
N
H N T
H H N A N O
CH2

H H H
O H3C O
N N
O H HO P = O
H

Extremo 3' Extremo 5'

Ahora revisemos cómo se ensamblan los nucleótidos para formar


al adn. Si pudiéramos observar un pedazo de adn, veríamos una

10

BIO2-DGB-U1.indd 10 2/21/08 11:37:55 AM


espiral o hélice de dos hebras que se enrolla sobre sí misma; algo si-
milar a una cuerda como las que a veces se utilizan en los tendederos.
Cada hebra está formada por nucleótidos que se unen por medio
de los grupos fosfato gracias a un enlace llamado fosfodiéster (véase
la figura anterior). En la ilustración puedes darte cuenta de que el

1 Genética molecular
grupo fosfato está unido a la desoxirribosa en su carbono número 5,
que se llama 5’; este grupo fosfato se une al siguiente nucleótido en el
carbono 3’ de su azúcar. Por tanto, se dice que la hebra de adn tiene
un sentido 5’-3’, y cada nucleótido nuevo que se agregue lo hará en
el extremo 3’ de la cadena.

para saber más...


L as moléculas lineales de carbohidratos se numeran a partir del carbono
unido a un oxígeno por doble enlace. Cuando estas moléculas se hacen
cíclicas, se une el carbono con doble enlace con el penúltimo carbono
de la cadena. Una vez formado el anillo, los carbonos siguen teniendo la
misma numeración, es decir, se inicia a partir del oxígeno que permite que
se forme el anillo.

Esquema de cómo se forma la ribosa

1C O 5 CH 2 OH
H 5 CH 2 OH
OH
OH O
H C OH C 1C C 1C
2 4 H H O 4 H H H
H C OH C H CH
3 H3C 2 H3C 2
H C OH OH OH OH OH
4

5
CH 2 OH

Ambas cadenas se unen por medio de puentes de hidrógeno que


se forman entre las bases nitrogenadas. Lo interesante es que cada
base se acopla bajo reglas estrictas. Los nucleótidos formados por
pirimidinas siempre se acoplarán a los nucleótidos con bases de puri-
nas y, no sólo eso, cada base tiene un par específico. La guanina (base
de purina) siempre se unirá a la citosina, (base de pirimidina); y la conceptos
adenina siempre se unirá a una timina. Y si pones atención, podrás
observar que entre la guanina y la citosina se forman tres puentes de Antiparalelas es la propiedad de las dos
hidrógeno; entre la adenina y la timina hay dos. cadenas que forman el adn de llevar
sentidos contrarios.
Esta unión de las hebras mediante puentes de hidrógeno brinda
suficiente estabilidad a la molécula de adn para ser funcional. Re-
cuerda que este tipo de enlaces químicos no es demasiado fuerte y
que puede romperse con cierta facilidad. Un ejemplo es la acción de

11

BIO2-DGB-U1.indd 11 2/21/08 11:37:56 AM


las enzimas. Esta propiedad permite al adn cumplir con todas sus
funciones y además duplicarse, como lo veremos más adelante.

esto ya
lo sabes Para comprender mejor esta propiedad esencial de la molécula del
Unidad 1 Reproducción y herencia

adn, revisa tus conocimientos de química. Investiga las diferencias


entre los enlaces covalentes y los puentes de hidrógeno.

• ¿Sería posible obtener una molécula funcional de adn si las bases nitroge-
nadas se acoplaran mediante enlaces covalentes? Explica tu respuesta.

Aquí puedes apreciar que una cadena lleva los


oxígenos del azúcar en un sentido y la otra los lle-
va en sentido opuesto. Ahora, fíjate en el carbono
libre del azúcar en los extremos de cada cadena.
Verás que una tiene libre el carbono 5, y en ese
mismo extremo la otra tendrá libre el carbono 3. 3´
Por tanto, llevan sentidos contrarios y se llaman OH
antiparalelas.

P

D T A D

P P

D A T D

P
P

Antiparalelas
D C G D

P P

D G C D

P
Complementarias 5´

OH

12

BIO2-DGB-U1.indd 12 2/21/08 11:37:58 AM


El adn de tu bicho haz
tu bicho

• Ahora que sabes sobre las moléculas que forman el adn, explica qué
diferencias tiene con el material genético de tu bicho.

1 Genética molecular
• Para que tu bicho pueda vivir en este planeta es necesario que tenga adn
como material genético, pero tal vez en otra galaxia pueda ser diferente.
• Imagina por un momento que tu bicho vive en otro lugar del Universo,
imagina cómo sería su material genético.
• Descríbelo y dibújalo.

• Ahora hagamos un segmento del adn que tendría tu bicho para que pu-
diera vivir aquí.
• Observa la imagen del Anexo.
• Recorta cada imagen de las moléculas que forman el adn.
• Con las moléculas que ahí se encuentran puedes hacer dos eslabones de
una doble cadena.
• Ahora tu misión es hacer una doble cadena de quince nucleótidos. Para
ello, utiliza como molde las imágenes de las moléculas y haz las suficientes
para completar la sección de adn que se te encomendó.
• Ilumina con diferente color cada tipo de molécula. Un color para los gru-
pos fosfato, un color para las desoxirribosas, un color para las citosinas, y
así sucesivamente con las demás.
• Ahora, arma la cadena de quince nucleótidos de largo. No pongas de-
masiada atención en el orden de las bases nitrogenadas a lo largo de la
cadena.

13

BIO2-DGB-U1.indd 13 2/21/08 11:38:00 AM


• Arma otra cadena frente a la que ya tienes siguiendo las reglas de unión
de las bases nitrogenadas.
• Observa el ADN que armaste y contesta lo siguiente.
• Escribe la secuencia de bases que pusiste en la primera cadena que armas-
Unidad 1 Reproducción y herencia

te. Sólo anota las iniciales. Por ejemplo, suponiendo que tienes la siguien-
te secuencia: citosina – adenina – timina – adenina – guanina – citosina,
sólo escribirás: C-A-T-A-G-C.

• Ahora escribe la secuencia de la segunda cadena que armaste.

• Si conoces la secuencia de una cadena, puedes identificar la secuencia de


la segunda. Explica por qué.

para saber más... El adn se compacta


A l igual que las proteínas, la molécula de adn se acomoda y se compacta
en diferentes formas llamadas estructuras. Se pueden identificar tres estruc-
turas en el adn. La estructura primaria se refiere a la secuencia específica
de los nucleótidos a lo largo de la cadena. Esta doble cadena se enrolla
formando una hélice característica del adn, y es la estructura secundaria.

14

BIO2-DGB-U1.indd 14 2/21/08 11:38:02 AM


Esta hélice se puede enrollar y forma la estructura terciaria conocida como
T A G C
adn superenrollado.
Tomemos en cuenta que el adn extendido de una sola célula mide alre-
dedor de dos metros, por lo que la estructura terciaria permite que el adn A T C G
se enrolle y se compacte para poder acomodarse fácilmente dentro del

1 Genética molecular
núcleo de las células eucariontes. La forma en que se enrolla no sucede al
azar, sino con la ayuda de diferentes proteínas.
El primer paso es gracias a la participación de las proteínas llamadas
histonas. La cadena de adn da dos vueltas completas a esta proteína y sigue
hacia la siguiente proteína, en la que también se enrolla con dos vueltas.
Cada histona con su segmento de adn enrollado y un segmento adyacente
intermedio (adn espaciador) se conoce como nucleosoma, y mide 100 Å
(armstrongs). Las histonas están unidas por 200 pares de bases; es decir,
un segmento de adn de 200 pares de bases se enrolla en una histona y
llega hasta la siguiente.

Segmento de una hélice 2 nm


de adn

Collar de perlas 11 nm

Solenoide 30 nm

Fibra de los 300 Å 300 nm

Rosetas 700 nm

Cromosoma 1 400 nm

15

BIO2-DGB-U1.indd 15 2/21/08 11:38:03 AM


La cadena de nucleosomas se conoce como collar de perlas. Éste se
enrolla sobre otro tipo de histona, la conocida como H. De seis en seis,
los nucleosomas dan vuelta a la histona H y forman la estructura llamada
solenoide. Todo el adn se organiza en solenoides y se forma la fibra de los
Unidad 1 Reproducción y herencia

300 Å. Estas estructuras reducen la longitud del adn entre 35 y 40 veces.


Pero es necesario compactar aún más al adn. Para explicarlo, se ha pro-
puesto un modelo de empaquetamiento que describe que la fibra se enro-
lla en bucles, como cuando tuerces una cuerda tratando de enrollarla. Estos
bucles se enrollan más y se forman, hasta que por último estas rosetas se
enrollan en rodillos. Ésta es la forma final de empaquetamiento y se puede
observar cuando se forman los cromosomas durante la mitosis o división
celular.

adn espaciador Nucleosoma

Collar de perlas

Unidad de 200 pares de


bases

11 nm

Histonas

116 pares de bases de adn

esto ya
lo sabes Física 1, ¿la recuerdas? Durante ese curso aprendiste que la unidad de longi-
tud básica es el metro. Pero para medir células, aún la milésima parte de un
metro resulta demasiado grande. Revisa tus apuntes sobre micras (µ 10 -6 me-
tros) y nanómetros (nm 10-9 metros). Un armstrong (Å) es aún más pequeño
que el nanómetro. Toma en cuenta que 1 nm es igual a 10 Å.

16

BIO2-DGB-U1.indd 16 2/21/08 11:38:06 AM


Replicación del adn

• Imagina que una de las células de tu bicho se va a multiplicar. Describe haz


tu bicho
cómo lo haría.

1 Genética molecular
• Toma en cuenta que todas las células de tu bicho deben tener adn en la
misma cantidad al ser la molécula que contiene toda la información nece-
saria para el funcionamiento de la célula.
• Explica qué procesos deben suceder para que las células nuevas tengan
adn en la misma cantidad y con la misma información.

El adn se encuentra en el núcleo de todas las células eucariontes


y en el citoplasma de las células procariontes. Con contadas excep- conceptos
ciones, como las neuronas, cada célula tiene la capacidad de repro-
ducirse y formar dos células iguales a sí misma, es decir, se duplica. Replicación es el proceso de duplicación
de adn del que se obtienen dos dobles
Entonces el adn también debería tener esta capacidad, ¿no es cierto? cadenas de adn.
Pues así es. Una característica esencial del adn es su capacidad de
Cromatina es la estructura compleja for-
duplicarse. Este proceso se conoce como replicación y por supuesto
mada por adn, histonas y otras proteínas
que no sucede espontáneamente. Al igual que en la mayoría de los que encontramos en el núcleo de la
procesos biológicos, en la replicación intervienen diversas moléculas célula

y ocurren varios pasos.


Para continuar hay que tener claras dos cuestiones.
La primera es que en las células eucariontes el adn se duplica por
secciones. Esto se debe a que para duplicarlo es necesario desenro-
llarlo, y todo el adn desenrollado no cabría en la célula. Así que por

17

BIO2-DGB-U1.indd 17 2/21/08 11:38:22 AM


lo general el adn se va replicando por secciones, hasta desenrollarse
conceptos completamente. De lo contrario, ocuparía demasiado espacio y, muy
probablemente, no cabría en la célula.
Enzimas son un grupo de proteínas cuya La segunda cuestión es que en las células eucariontes el adn se
Unidad 1 Reproducción y herencia

función es facilitar reacciones químicas


dentro de los sistemas biológicos. replica en varias secciones al mismo tiempo, pero conforme se copia
se vuelve a enrollar la hebra de adn.
Una vez que un segmento de adn está desenrollado y libre de
histonas, una enzima llamada adn helicasa detecta un lugar espe-
cífico en la hélice donde se iniciará la replicación, se une a ese sitio
y comienza a separar la hélice rompiendo los puentes de hidrógeno
entre las bases nitrogenadas de un segmento de la cadena de adn.
Así, las dos hebras se separan en ese fragmento y el resultado es una
estructura llamada burbuja de replicación.
Al separarse las dos hebras, en las regiones cercanas a la burbuja, la
hélice se va enrollando y torciendo. Entonces, un grupo de proteínas
llamadas topoisomerasas se unen a los extremos de la burbuja y sepa-
ran las cadenas en pequeñas secciones. Conforme se va avanzando en
la replicación las topoisomerasas van uniendo las cadenas de nuevo,
para evitar que la hélice se tuerza.
Ahora sí está todo listo para comenzar a copiar. En la imagen pue-
des ver que en una burbuja de replicación hay dos hebras de adn li-
bres. Esto permite que se copien ambas cadenas al mismo tiempo. Lo
que hay que cuidar es el sentido en el que se copian pues recuerda que
un nucleótido se une siempre a un extremo 3’ que se encuentre libre.
¿Qué sucedería si no hay una cadena a la que se una un nucleótido
libre, cómo se comenzaría a copiar? La respuesta se encuentra en las
otras moléculas que entran en acción.

origen de replicación

helicasa

burbuja de replicación
la replicación es bidireccional

cadena retardada
cadena líder

18

BIO2-DGB-U1.indd 18 2/21/08 11:38:27 AM


Primero que nada debes saber que la replicación es bidireccional.
Esto quiere decir que se copian ambas cadenas al mismo tiempo pero
en sentidos opuestos.
Ahora bien, existe una enzima llamada adn polimerasa, que se
encarga de hacer polímeros de adn. Su trabajo es tomar nucleótidos

1 Genética molecular
que están en el medio celular e irlos uniendo al inicio del segmento
de adn existente que se va a replicar.
¿Cómo decide la adn polimerasa qué nucleótido unir? Depende
de la secuencia de ácidos nucleicos de la cadena ya existente o cadena
molde. Recuerda que una cadena de adn permite reconocer la base
nitrogenada que unirá a ella como su contraparte. Si existe un nu-
cleótido que tiene guanina, el nucleótido a unir es una citosina, y así
sucesivamente.
Por tanto, la adn polimerasa une a la cadena nueva los nucleóti-
dos correspondientes a la cadena molde.
La adn polimerasa, sin embargo, necesita un punto de partida
para empezar su trabajo. El cebador (o primer, en inglés) es un pe-
queño segmento de arn que atrae a la polimerasa. El cebador se
une al punto de inicio de replicación y es el indicador para que esta
enzima comience a copiar el adn a partir de sus dos cadenas molde,
una a cada lado de lo que era la hélice de adn.
Esta enzima une nucleótidos a una cadena o segmento existente,
siguiendo las instrucciones de la cadena molde, y forma la cadena com-
plementaria o cadena nueva. En otras palabras, si en la cadena original
cebador

adn polimerasa
cadena conductora

topoisomerasa

adn polimerasa
fragmento de Okasaki helicasa

ligasa cebador

En la replicación participan muchas enzimas que


controlan cada paso.

19

BIO2-DGB-U1.indd 19 2/21/08 11:38:29 AM


o molde hay una adenina, la polimerasa unirá un nucleótido que con-
tenga timina. Al tiempo que forma la cadena nueva, la adn polimera-
sa también forma puentes de hidrógeno entre ambas cadenas.
En conclusión, la adn polimerasa no puede copiar la cadena mol-
Unidad 1 Reproducción y herencia

de sin la presencia del cebador, pues el nucleótido libre es la señal


para iniciar la copia.
La enzima adn polimerasa es muy eficiente para copiar la cadena
molde, pero únicamente puede agregar nucleótidos en un extremo 3’
libre de una cadena en formación. Facilita el enlace de un nucleóti-
do al carbono 3’ de la cadena que ya existe y está creciendo. Lo que
significa que sólo puede copiar en un sentido la cadena de adn. La
adn polimerasa copia la cadena que lleva el sentido 3’-5’ de forma
continua, a esta cadena se le conoce como cadena conductora o líder.
Por otra parte, el segmento de adn que lleva un sentido 5’-3’ a
partir del punto de inicio se copia en partes, pues la adn polimera-
sa no trabaja en ese sentido. Lo que sucede es que varios cebadores
se unen para que la adn polimerasa copie pequeños segmentos de
adn. A estos fragmentos de adn copiados se les llama fragmentos
de Okasaki (nombre del investigador que descubrió este proceso).
Como puedes darte cuenta el crecimiento de esta cadena es discon-
tinuo por lo que se le conoce como cadena retardada o segmentada.
Sin embargo, existen las enzimas llamadas ligasas, que ligan o unen
estos fragmentos y dejan lista la cadena.
En los organismos procariontes, con sólo un cromosoma lineal, la
burbuja de replicación va avanzando hasta terminar la replicación de
todo el cromosoma. En los cromosomas de los organismos eucarion-
tes se inicia la replicación en varios sitios, como ya lo habíamos men-
cionado, de forma coordinada y la copia de todos los cromosomas
termina antes de que la célula se divida en dos hijas.
Analicemos un poco lo que acabamos de revisar. El adn se re-
plica utilizando como molde a sus mismas cadenas, por tanto las
dos copias resultantes llevan una cadena recién sintetizada o hija y
una cadena molde o madre. Esto caracteriza a la replicación como
semiconservativa. Así, la doble cadena resultante de la replicación
se conserva de forma parcial debido a que ambas hélices resultantes
llevan una cadena original y una copiada.
Para que la adn polimerasa pueda realizar su función es necesario
que en el núcleo celular se encuentren presentes nucleótidos que la
célula previamente fabricó. Además, al igual que en una fábrica, cada
Las hélices que resultan de la replicación paso de la replicación consume energía por lo que la célula necesita
tienen una cadena original y una recién
sintetizada, por ello se dice que la replicación
tener una buena reserva de atp para que todas las enzimas partici-
es semiconservativa. pantes puedan trabajar correctamente.

20

BIO2-DGB-U1.indd 20 2/21/08 11:38:30 AM


esto ya
Vuelve a leer el tema de replicación y completa el cuadro. lo sabes

Enzima Función

Helicasas

1 Genética molecular
Topoisomerasas

adn polimerasa

Ligasas

Con lo que ya sabes sobre la copia del adn, responde lo siguiente. haz
tu bicho
• ¿En qué se parece el proceso descrito aquí a lo que habías imaginado para
tu bicho?

• ¿Describe las diferencias?

• ¿Cuántas cadenas de adn tenía el material genético de tu bicho?

• ¿Cómo crees que se tendría que replicar un adn de tres cadenas?

Ahora escribe una definición que describa brevemente cada estructura.

Estructura Definición

Histonas

Solenoide

Burbuja de replicación

21

BIO2-DGB-U1.indd 21 2/21/08 11:38:32 AM


Estructura Definición

Cadena líder o conductora


Unidad 1 Reproducción y herencia

Cadena retardada o segmentada

Fragmentos de Okasaki

haz En un papel que puedas recortar dibuja un modelo de cada enzima


biología mencionada en la actividad anterior. Recorta los modelos.
Con el modelo de adn que ya tienes y los modelos de las enzimas que
acabas de recortar, recrea la replicación de tu adn.
Date cuenta que necesitarás más moléculas que forman al adn para
lograr la replicación de tu modelo, así que recorta las necesarias.
Una vez terminada la recreación de la replicación, observa tu modelo
y contesta lo siguiente.

• ¿Cuántas moléculas de adn obtuviste al final del ejercicio?

• ¿Consideras que las moléculas resultantes tienen una cadena de tu cadena


original y una nueva? ¿Por qué?

• ¿Cómo se llama a esta propiedad de la replicación?

para saber más...


Los telómeros (del griego telos, final, y meros, fragmento) son segmentos
cortos de adn compuestos por una secuencia rica en timina (T) y guanina
(G) que se repite muchas veces dependiendo de la especie. Se encuentran
en las puntas de los cromosomas y no se replican durante la duplicación
del adn. Protegen a los genes importantes ya que en cada replicación se
pierden segmentos finales de los cromosomas. Esta pérdida se debe a que
la enzima adn polimerasa no puede copiar todos los genes contenidos en
cada cromosoma. Entonces, para evitar que se pierdan o dañen los genes
que se transcriben en arn y después se traducen a proteínas, estas secuen-
cias en los extremos de los cromosomas se eliminan durante la replicación.
Se piensa que los telómeros funcionan como relojes biológicos de la
duración de vida de las células porque determinan el número de divisiones

22

BIO2-DGB-U1.indd 22 2/21/08 11:38:34 AM


celulares totales. De hecho, se piensa que al envejecer, la célula va perdien- para saber más...
do longitud en los cromosomas y cuando éstos se eliminan por completo,
la célula recibe la señal de morir. Una vez llegado este punto, la célula activa
un proceso conocido como muerte celular programada que evita que las
células vivan para siempre. Incluso existe la propuesta de que las células

1 Genética molecular
cancerígenas tienen atrofiados estos sistemas, tanto de degradación de
telómeros como de detección de las señales bioquímicas internas y con
sus vecinas que avisan que es hora de morir.
Los telómeros se presentan sólo en los cromosomas de organismos eu-
cariontes, que son lineales (los cromosomas procariontes, como recordarás,
son circulares y por tanto no poseen extremos con telómeros). El número
de repeticiones de una secuencia telomérica varía según la especie.
Se ha determinado que en el ser humano (y probablemente todos los
animales vertebrados) la secuencia TTAGGG se repite aproximadamente
2 000 veces. La enzima telomerasa produce todas las copias durante el
desarrollo embrionario, pero deja de funcionar después del nacimiento. Se
ha encontrado que en las células cancerosas se reactiva la actividad de la
telomerasa, y altera el reloj biológico de la célula. Las células hijas produ-
cidas después de una división celular no controlan el número de veces ni
los tiempos en los que deben dividirse, por lo que proliferan sin control y
provocan un tumor maligno causante del temido cáncer.
Anteriormente se pensaba, que ésa era la única función de los telóme-
ros. En la actualidad se encontró que estas secuencias sí producen arn. Aún
no se comprende por completo la función de este arn y de sus productos,
pero se sabe que tiene que ver con la regulación de la estabilidad de los
telómeros.

Cromosomas con telómeros

TTAGGG

Los cromosomas lineales característicos de


los eucariontes presentan telómeros en sus
extremos.

23

BIO2-DGB-U1.indd 23 2/21/08 11:38:35 AM


arn y síntesis de proteínas
esto ya
lo sabes Revisa de nuevo tus conocimientos del curso Biología I, y realiza lo
siguiente.
Unidad 1 Reproducción y herencia

• Describe brevemente la estructura del ARN.

• Qué diferencias funcionales hay entre el ADN y el ARN.

haz
tu bicho
Hasta ahora, sabes que además del adn existe el ARN en las células de los
organismos, y que la función del arn es producir proteínas.

• Describe el proceso de producción de ARN de tu bicho.

• Describe cómo producirá proteínas a partir de este arn.

El ARN o ácido ribonucleico es un ácido nucleico formado por una


O
cadena sencilla de nucleótidos. En general se parece mucho al ARN
C
HC NH pues cada nucleótido está formado por un grupo fosfato, un molécu-
O HC C la ribosa y una base nitrogenada. Sin embargo, el arn prefiere utili-
N
O O O CH 2 O zar a la base uracilo (base nitrogenada del grupo de las pirimidinas)
O
en lugar de la timina.
O
Las moléculas que componen a los nucleótidos se unen gracias
a los mismos tipos de enlaces químicos que participan en la unión
Nucleótido OH OH
de los nucleótidos del adn. Es decir, el grupo fosfato se une a la
ribosa por un enlace éster; la ribosa se una a la base nitrogenada por
Una de las diferencias entre el adn y el arn es
que este último utiliza uracilo en lugar de timina. un enlace covalente; y entre nucleótido y nucleótido hay un enlace
fosfodiéster.

para saber más... Del adn al arn sólo hay un proceso


E l adn y el arn tienen mucho en común, no sólo por su estructura mole-
cular sino por una relación casi de familia. Sucede que el adn se utiliza para
fabricar al arn de manera más o menos similar a la replicación. Cuando una
célula necesita una proteína específica, manda la orden para que se descu-
bra el segmento de adn o gen que tiene la información de esta proteína y
se produzca el arn correspondiente. Una vez encontrado el gen requerido
se abre la hélice (como en la replicación) y se copia la cadena. Sin embargo,
sólo se copia una de las cadenas porque el arn que se va a sintetizar consta
de sólo una cadena.

24

BIO2-DGB-U1.indd 24 2/21/08 11:38:37 AM


La síntesis del arn corre a cargo de la enzima llamada arn polimerasa.
Cuando esta enzima termina de copiar el arn deseado se separa del adn, el conceptos
arn se libera y la hélice de adn se vuelve a formar. Al igual que en la repli-
cación, la transcripción consume energía y los nucleótidos que se utilizarán Transcripción es el proceso de síntesis de
arn copiado de una molécula de adn por
para formar el arn deben fabricarse antes de que inicie este proceso. Por medio del cual se transfiere información.

1 Genética molecular
ello la célula invierte una buena cantidad de energía.
La transcripción ocurre dentro del núcleo, pero el arn lleva a cabo su
función en el citoplasma. Así que el arn debe transportarse hacia el cito-
plasma.

arn polimerasa

gen arn
de
interés

arn
adn

Utiliza las moléculas del Anexo. haz


A partir de tu modelo de adn anterior fabrica la molécula de arn que biología
le correspondería. Tendrás que recortar las moléculas necesarias para
lograrlo, así que antes de iniciar observa detenidamente tu modelo de
adn y determina las moléculas que utilizarás.

Tipos de arn
Como ya se mencionó, el ARN se produce a partir del ADN, por lo
que esencialmente tiene la misma información. No obstante, existe
una pequeña diferencia, tiene uracilos en lugar de timinas.
Existen tres tipos de arn que realizan funciones especiales en la
producción de proteínas.
El arnm es el molde para producir las proteínas. Cuando un gru-
po de proteínas se copia del adn, lo llevan hacia el citoplasma, lo
modifican un poco y lo preparan para servir como molde.
El arnr hace alianza con algunas proteínas y juntos forman una
estructura llamada ribosoma. Esta estructura está dividida en dos
partes conocidas como subunidades y cada una tiene una función
específica que revisaremos más adelante. En general, el ribosoma es
la máquina en la que se fabrican las proteínas.
Finalmente, el arnt se encarga de capturar los aminoácidos ne-
cesarios para ensamblar la proteína que se fabricará. Una vez fabri-
cados dichos aminoácidos, se ubican en el citoplasma. El arnt los

25

BIO2-DGB-U1.indd 25 2/21/08 11:38:39 AM


toma y los lleva al ribosoma para ensamblarlos en forma de proteína.
conceptos Observa en la figura que este arn tiene una forma extraña, parece
una cuerda torcida. En un extremo de la cuerda lleva una secuencia
Anticodón es la secuencia de tres nucleó- de tres nucleótidos conocida como anticodón, en tanto que en el
Unidad 1 Reproducción y herencia

tidos presente en un arnt.


extremo opuesto lleva unido un aminoácido que corresponde a la
Codón es una secuencia de tres nucleó- secuencia del anticodón. La forma en la que corresponden los ami-
tidos de arnm que codifica para un ami-
noácidos con las secuencias de nucleótidos se tratarán con detalle en
noácido específico; es complementaria a
la secuencia presente en un anticodón. la siguiente sección.

arnm
Los tres tipos de arn tienen una función y
estructura específica. El arnm sólo es una
cadena de arn lineal, el arnt parece cuerda
torcida y tiene una secuencia de nucleótidos
(anticodón) y un aminoácido específicos, y
el arnr se asocia con proteínas y forma el
ribosoma, ambas subunidades. ribosoma
(contiene arnr)
subunidad
grande

subunidad
pequeña

arnt
MET
aminoácido
acoplado

anticodón

esto ya
lo sabes Recuerda que las proteínas son macromoléculas que funcionan como la-
drillos para formar tejidos.
En tu cuaderno haz una lista de los nombres y las abreviaturas de las
moléculas que forman a las proteínas.
conceptos
Código genético
Triplete es un grupo de tres aminoácidos Seguramente ya intuyes la relación directa entre la secuencia de nu-
adyacentes en la cadena de arnm que
codifica para un aminoácido. cleótidos y la secuencia de los aminoácidos que forman a una proteí-
na. Veamos qué tanto.
Código genético es el conjunto de reglas
Cuando se replica el adn o se transcribe el adn hacia arn es
que especifican el aminoácido corres-
pondiente a un triplete o codón de arn. muy importante mantener la secuencia de aminoácidos lo más intac-
ta posible. Por ello también es importante conocer la forma en que se
aparean las bases nitrogenadas.

26

BIO2-DGB-U1.indd 26 2/21/08 11:38:40 AM


El código genético se refiere a la relación entre la secuencia de nu-
cleótidos y el aminoácido al que corresponde. Una secuencia larga de
nucleótidos de arn se divide en segmentos de tres, de manera que se
va leyendo en tripletes. Por ejemplo, si tenemos la siguiente secuencia:
AUGCGUGCA

1 Genética molecular
habrá que dividirla así: Para encontrar el aminoácido al que corresponde
el triplete que buscas, halla la primera base
AUG-CGU-GCA
del triplete en el lado izquierdo del cuadro; la
Cada triplete indica un aminoácido en particular y se conoce segunda, en la parte superior; y la tercera en
el extremo derecho. En un triplete AUG, busca
como codón. Para que esta información se lea correctamente y se
la fila de la A en el lado izquierdo, luego busca
traduzca en proteínas, sólo se requiere que el arnm esté presente en la columna de la U en la parte superior, y te
ubicas en el cuadro correspondiente. Ahí mismo
un ribosoma, además de que se encuentre el codón de inicio AUG y
busca el renglón de la G en la tercera posición, y
uno de término que indique que está completa la proteína. encuentra la Met (abreviación de la metionina).

Segunda letra del triplete

UUU Phe UCU Ser UAU Tyr UGU Cys U


UUC Phe UCC Ser UAC Tyr UGC Cys C
U
UUA Leu UCA Ser UAA Stop UGA Stop A
UUG Leu UCG Ser UAG Stop UGG Trp G
Primera letra del triplete (5’—3’)

Tercera letra del triplete (3’—5’)


CUU Leu CCU Pro CAU His CGU Arg G
CUC Leu CCC Pro CAC His CGC Arg C
C
CUA Leu CCA Pro CAA Gin CGA Arg A
CUG Leu CCG Pro CAG Gin CGG Arg G
AUU Ile ACU Thr AAU Asn AGU Ser U
AUC Ile ACC Thr AAC Asn AGC Ser C
A
AUA Ile ACA Thr AAA Lys AGA Arg G
AUG Met ACG Thr AAG Lys AGG Arg A
GUU Val GCU Ala GAU Asp GGU Gly U
GUC Val GCC Ala GAC Asp GGC Gly C
G
GUG Val GCA Ala GAA Glu GGA Gly G
GUA Val GCG Ala GAG Glu GGG Gly A

para saber más...


Código genético no es lo mismo que genoma ni que adn. Es frecuente que en
los medios de comunicación se caiga en el error de utilizar estas palabras como
sinónimos. Como ya has visto en tus cursos, el material genético se compone
en su mayor parte de nucleótidos y hay diferentes tipos de material genético
(adn y arn). Por otro lado, el genoma es el conjunto de todo el material gené-
tico de un organismo, en tanto que el código genético es la clave para leer una
secuencia de tres ácidos nucleicos y saber a qué aminoácido corresponde. Cada
organismo tiene todo su material genético contenido en su propio genoma.
Pero el código genético es el mismo para todos los seres vivos.

27

BIO2-DGB-U1.indd 27 2/21/08 11:38:42 AM


haz Lo que está escrito a continuación es una secuencia de arnm.
biología
AUGCCAAGUGGAUCGGCACGAAAUUUGGACUAA
Unidad 1 Reproducción y herencia

• Obsérvala con detenimiento, divídela en tripletes y escríbela en la línea


de abajo.

• Con ayuda del cuadro del código genético anota en la siguiente línea los
aminoácidos que corresponden.

amino acil-arnt-
sintetasa Síntesis de proteínas
El proceso de producción de proteínas se conoce con el nombre de
traducción y es uno de los más importantes de la función celular.
enzima
Cuando se requiere la información contenida en el genoma para reali-
zar una función específica, la célula produce las proteínas necesarias.
aminoácido atp Entre las principales moléculas que se necesitan producir para la
x
aa P P P A traducción están
• arnm, que contiene toda la secuencia de la proteína que se va a
traducir,
• varios arnt, cada uno llevará su aminoácido correspondiente,
• un ribosoma (arnr), ambas subunidades, la grande y la pequeña,
arnt • aminoácidos, que irán añadidos a los arnt
• varias moléculas de atp,
• la enzima amino acil-arnt-sintetasa, que permite la unión de
los aminoácidos con el arnt correspondiente, y
3'
• la enzima peptidil-transferasa, que cataliza el enlace peptídico
entre los aminoácidos al tiempo que transcurre la traducción.
¿Por qué es necesario contar con una cadena de arnm y no adn
para iniciar la traducción? Si bien el adn tiene la información ne-
cesaria para traducir una proteína, las enzimas y toda la maquinaria
celular responsable entienden y leen el mensaje en forma de arn,
aax
y lo traducen al código de las proteínas. Digamos que es similar a
arnt activado indicarle al operador de una máquina de ensamblaje los detalles de
un automóvil para que él determine los códigos que harán funcionar
Las moléculas en la traducción de una proteína.
Recuerda que este proceso se lleva a cabo en el a la máquina.
citoplasma celular. Antes de iniciar es necesario que los aminoácidos estén activados,
es decir, que estén unidos a su arnt correspondiente.

28

BIO2-DGB-U1.indd 28 2/21/08 11:38:44 AM


anticodón
En la figura anterior observa U AG

que el arnr está formado por conceptos


dos subunidades, una pequeña fmet

y la otra grande. También ob- arn iniciador Traducción es el proceso en el que se en-
samblan los aminoácidos de una proteína
serva que dentro de estas es- siguiendo la secuencia de nucleótidos en

1 Genética molecular
tructuras hay espacios peque- un arnm que ocurre en un ribosoma.
sitio P sitio A
ños llamados el sitio A, donde
se insertan los nuevos arnt subunidad pequeña
con su aminoácido; el sitio P,
al que entran los arnt recién ribosoma
agregados y se forman los en-
laces peptídicos, y en donde se
inserta el primer aminoácido;
por último está el sitio E, en el
subunidad grande
que se liberan los arnt utiliza-
El complejo de iniciación (arnt con metionina
dos ya sin su nucleótido. codones o tripletes múltiples
y la subunidad ribosómica pequeña) se une
La traducción consta de tres con el arnm, en el codón de incio (AUG), y se
AUGUUCGGU AAGUGA une la subunidad grande del ribosoma. Éste
fases: la iniciación, la elonga- arnm es el complejo activo.
ción o alargamiento de la cade-
na, y la finalización.
Fase de iniciación. Para iniciar la traducción, el arnt que tiene
el anticodón con la secuencia UAC y el aminoácido llamado me-
tionina (Met) se unen a la subunidad pequeña del ribosoma en el
sitio P, mismo que se une a la cadena de arnm que se va a tradu-
cir. Éste es el complejo de iniciación. En este momento, el arnt
busca la secuencia correspondiente al código AUG, que es la señal Iniciación
de inicio de traducción en la cadena de arnm. Enseguida se une
AUGUUCGGU AAGUGA
la subunidad grande del ribosoma, y el arnm queda en medio de UAC

éste. Ahora está formado el complejo activo, que continuará leyen-


complejo de iniciación
do el arnm y ensamblando aminoácidos para formar la proteína. 1. El arntfmet iniciador se une al
Fase de elongación. Ahora llega un arnt al sitio A del riboso- codón de arnm en el sitio P.
ma; los aminoácidos de este arnt y del primero se unen mediante
un enlace peptídico, gracias a la acción de la enzima peptidil-
transferasa. En este momento el arnt sin aminoácido llega al AUGUUCGGU
UAC
AAGUGA

sitio E del ribosoma. Utilizando la energía del atp, el arnm se


desliza por el ribosoma de manera que el siguiente codón por
leerse queda ubicado en el sitio A, y el arnt con los dos ami-
noácidos queda en el sitio P. Esta cadena de aminoácidos se une 2. La subunidad grande se une
al complejo;un nuevo
al aminoácido del nuevo arnt, el arnt sin aminoácidos pasa al arntse une al sitio A.
sitio E, y en el sitio P queda el arnt que lleva la cadena peptídica
Durante la elongación, los aminoácidos que van
en crecimiento. Esto sucede una y otra vez hasta traducir toda la trayendo los arnt se van añadiendo a la cadena
secuencia de arnm. peptídca.

29

BIO2-DGB-U1.indd 29 2/21/08 11:38:46 AM


En caso de que una cadena de arnm sea demasiado larga, se unen
varios ribosomas en diferentes secciones del arnm para traducirla al
mismo tiempo en varios lugares, lo que agiliza el proceso.
Fase de finalización. Existe un grupo de tres codones (UAA, UAG
Unidad 1 Reproducción y herencia

y UGA) que ningún arnt puede reconocer. Entonces, el sitio A


queda libre para que se unan moléculas conocidas como factores de
liberación. Éstos permiten la liberación de la proteína que se acaba
de armar. Junto con la proteína se libera el último arnt y se separan
las subunidades grande y pequeña del ribosoma. Éste es el final de la
traducción. Sin embargo, para una proteína compleja, es decir, una
proteína formada por varias cadenas peptídicas, éste es el inicio de
un proceso de asociación con las demás cadenas necesarias.

Ya elaboraste una secuencia de adn y la transcribiste en arn. Si este arn


haz que fabricaste fuera un arnm de tu bicho podrías traducirlo en una proteína
biología que tu bicho quizá necesitaría en algún momento. Imagina que ahora tu
bicho necesita esa proteína.

Primero fabrica las moléculas necesarias para traducir el gen de tu


bicho. En una hoja de papel, ahora dibuja y recorta ribosomas, arnt y
los aminoácidos necesarios para tu secuencia.
Ahora que tienes las moléculas necesarias, representa la traduc-
ción de su secuencia y pega la proteína resultante en otra hoja de
papel.

Vuelve a leer el tema de traducción y relaciona ambas columnas.

A. Subunidad grande ( ) El ARNm se une al sitio P de la subunidad pe-


B. UAA queña del ribosoma en el lugar del triplete AUG;
C. Iniciación ahora se une la subunidad grande.
D. Sitio A ( ) Espacio en el ribosoma donde se colocan los
E. UCA ARNt que se van necesitando para la traducción.
F. Sitio P ( ) Espacio en el ribosoma donde se forman los
G. Subunidad pequeña enlaces peptídicos entre los aminoácidos que
H. Elongación llevan los ARNt.
I. Sitio E ( ) Uno de los tripletes que indican terminación o
J. Terminación alto de la traducción.
( ) El espacio en el ribosoma donde se desechan
los ARNt que ya no tienen un aminoácido adhe-
rido.

30

BIO2-DGB-U1.indd 30 2/21/08 11:38:47 AM


Completa las frases del esquema.

El es la molécula donde El proceso por el que se copia la


se encuentra contenida toda la molécula de adn a sí misma se
información genética de una llama: .
célula.

1 Genética molecular
El arn sale del núcleo, en el caso A partir de esta molécula se
de eucariontes, y se utiliza para puede producir arn a través de
producir una proteína en un proceso la: .
conocido como: .

AA AA AA AA AA
proteína

La relación que existe entre estos procesos se conoce con el nombre


de dogma central de la biología molecular. El estudio de estos proce-
sos y su relación con el funcionamiento celular son puntos centrales
de la investigación en biología molecular.

31

BIO2-DGB-U1.indd 31 2/21/08 11:38:49 AM


2 Reproducción celular y en organismos

A ntes de describir los procesos de reproducción analicemos los


tipos de células según el número de copias del material genético
Unidad 1 Reproducción y herencia

que poseen.
La mayoría de las células eucariontes tienen dos copias de su ma-
terial genético, por lo que se les llama diploides. Este tipo de célu-
las tienen funciones especiales en los organismos; como parte de un
tejido, por ejemplo, son parte de la piel o del hígado, pero no son
La mayoría de las células que nos forman son
diploides y somáticas. reproductoras. Por tanto, se les llama somáticas y pueden multiplicar
su material genético y dividirse originando dos células iguales y con
la misma cantidad de material genético.
Cuando una célula diploide especial se divide dos veces seguidas
pero sólo duplica su material genético una vez, produce cuatro célu-
las llamadas haploides con un solo juego de cromosomas.

esto ya
lo sabes Observa la figura y completa las oraciones.

genes

dos pares de cromosomas


homólogos en el núcleo

adn
transcripción

arnm
complejo de traducción

ribosoma

traducción
Dentro de las largas cadenas de adn que puede
tener una célula, se encuentran miles de genes.
Cada cadena de adn se empaqueta hasta proteína
obtener la forma de un cromosoma.

32

BIO2-DGB-U1.indd 32 2/21/08 11:38:51 AM


Un es un segmento de adn que contiene la

2 Reproducción celular y en organismos


información necesaria para producir una proteína. Dentro del adn hay miles
de genes. El adn se enrolla para poder caber en el . El
nivel de máximo de empaquetamiento es el , que
contiene un segmento grande del adn total de una célula.

Ciclo celular

Hasta el momento hemos definido el material genético de tu bicho. haz


tu bicho

• Describe el tipo de células que tendrá.


• Imagina las células de tu bicho y dibújalas en tu cuaderno.
• Describe cómo se multiplicarían estas células si fuera necesario, por ejem-
plo si tu bicho se cortara y necesitara regenerar el fragmento de piel.

Desde el curso anterior de Biología, comprendiste que todos los or-


ganismos estamos formados por células, ya sea una sola célula en conceptos
organismos unicelulares o millones de células, como en el ser huma-
no. Por tanto, el correcto funcionamiento de un organismo depende, Ciclo celular es el conjunto de sucesos
ordenados que permiten a una célula
entre otras cosas, del desarrollo, el crecimiento y la proliferación de crecer, acumular materiales nutritivos,
las células que lo forman. Si tomamos en cuenta que la mayoría de duplicar su contenido, y dividirse en dos
células hijas.
nuestras células no paran de reproducirse a lo largo de nuestra vida,
a excepción de las células nerviosas, podemos apreciar la importancia
de la reproducción de las células. interfase celular
Por ejemplo, los eritrocitos, células citoplasma
que transportan oxígeno en sangre, fase G1
núcleo
viven 120 días aproximadamente y replicación de
cromosoma
poseemos alrededor de 250 billo- (fase S)
nes de ellos. Esto no quiere decir
que todos mueren al mismo tiem- fase G2
po y se deben reemplazar de igual profase
manera, sino que el número debe prometafase
mitosis metafase
ser más o menos constante para anafase
telofase
poder asegurar que se mantengan
eficientes las funciones corporales fase M
por medio del aporte de oxígeno.
Por ello debe haber una estricta re-
citocinesis
gulación del número de células y el
momento en el que deben renovar-
se o reproducirse. fase G1 En las dos fases principales del ciclo celular, la
división, cuando la célula se divide en dos, y la
Cada célula en nosotros se re- interfase, cuando la célula crece continuamente,
dos células hijas
produce y vive siguiendo un ciclo se replica el adn y se duplican los organelos.

33

BIO2-DGB-U1.indd 33 2/21/08 11:39:05 AM


de sucesos, entre ellos la síntesis de moléculas, la duplicación de su
material genético, el crecimiento y la división celular.
En general, podemos dividir este ciclo en dos fases principales, la
interfase y la fase de división.
Unidad 1 Reproducción y herencia

Interfase
Durante la interfase la célula se encuentra en un estado basal de
funcionamiento. En épocas anteriores se creía que era un estado de
reposo, pero se descubrió que en esta fase la célula está en plena fun-
ción. Además, es cuando se lleva a cabo la replicación del adn y la
duplicación de sus organelos para tener un duplicado de todo su
contenido justo antes de dividirse en dos células hijas. Cabe señalar
que no todas las células están en continua división celular. Sólo las
células de algunos tejidos se dividen constantemente. La interfase se
divide a su vez en tres periodos principales conocidos como G1, S y
G2. Las letras “G” corresponden a dos periodos en los que la célula
aumenta de tamaño, la inicial se tomó de la palabra growth en inglés,
que significa crecimiento. El periodo G1 comprende desde el fin de la
división celular hasta el inicio del periodo S o de síntesis de material
genético, cuando la célula duplica su adn. Una vez que terminó este
periodo se inicia el segundo periodo de crecimiento o G2. La célula
se asegura de que tanto el material genético como sus organelos estén
duplicados por completo, antes de dividirse, y termina cuando la
célula comienza la fase de división.
La célula que se va a dividir tiene que duplicar su material genético
durante el periodo S. Así, al momento de dividir todo su contenido,
las células resultantes tienen la misma cantidad de adn. Ya que una
buena parte de las células eucarióticas tienen dos juegos de adn,
antes de llegar al periodo G2, la célula debe tener cuatro juegos idén-
ticos de cromosomas para dividirse.
El periodo G1 es el más variable entre las células porque puede
durar horas, días, meses o incluso años. Cuando las células que se
reproducen poco entran en G1, pueden detener su ciclo celular y
entrar en un estado de reposo G0. En este estado pueden estar mucho
tiempo antes de volver a iniciar el ciclo y dividirse.
La duración del ciclo celular varía dependiendo del tipo de células.
En células adultas el ciclo requiere al menos un promedio de 12 ho-
ras para terminar. No obstante, las células tienen los ciclos celulares
más cortos que se conocen durante el desarrollo embrionario, pue-
den durar desde 8 hasta 60 minutos. Estas células prácticamente han
eliminado los periodos G1 y G2, ya que no incrementan su volumen.
Gracias a esto, pasan de la duplicación del adn a la división celular

34

BIO2-DGB-U1.indd 34 2/21/08 11:39:07 AM


casi de manera directa. Esta forma de adaptar el ciclo celular resulta

2 Reproducción celular y en organismos


ventajosa para el desarrollo embrionario. Favorece la posibilidad de
que el embrión incremente muy rápidamente su número de células a
partir de una sola célula (el óvulo fecundado por el espermatozoide),
y comience a formar los tejidos y órganos necesarios para formar un
nuevo organismo completo. Esta adaptación se debe a las reservas
nutrimentales de los óvulos, fuente de la energía necesaria para tantas
divisiones.

mitosis
1 hr
M
3 hr
G2 división

G1
24 horas 5 hr

S interfase
7 hr

La duración del ciclo celular en una célula típica


es de 16 horas.

En células que se mantienen en cultivos se ha observado que el


ciclo celular se termina en aproximadamente 16 horas en promedio,
y lo dividen de la siguiente manera: G1 cinco horas, S siete horas, G2
tres horas, y 1 hora para la división celular.

y en México Los tumores benignos de hipófisis que fabri- es hereditaria, así que no puede transmitirse a los hijos. En México existen
qué...? can de manera excesiva y prolongada la hor- alrededor de 5 000 a 6 000 pacientes y sólo 1 500 están diagnosticados.
mona del crecimiento (HG) provocan en los La asociación Acromegálicos en Lucha por su Recuperación, A.C. trabaja
niños, que todavía conservan su capacidad de manera voluntaria en la difusión y conocimiento de la acromegalia, así
para crecer en estatura, una altura mayor de lo normal (gigantismo). En las como en el acceso a un tratamiento y a servicios médicos oportunos y de
personas adultas, que ya han perdido esa capacidad, producen el cuadro calidad, como derecho de las personas que viven afectadas por este pade-
clínico conocido como acromegalia. cimiento.
La acromegalia es una enfermedad crónica cuyos efectos en la actualidad Visita el sitio www.acromegalia.org.mx/ para mayor información sobre las
se pueden controlar y reducir de manera significativa. En muchos casos, no acciones de la asociación y las investigaciones sobre esta enfermedad.

35

BIO2-DGB-U1.indd 35 2/21/08 11:39:09 AM


División
Durante la división la célula lleva a cabo la mitosis, que es otra forma
conceptos de llamar a la división celular. Por tanto, esta fase del ciclo se conoce
también como la fase M.
Unidad 1 Reproducción y herencia

Mitosis es el proceso de duplicación del La mitosis está dividida, a su vez, en varias fases que revisaremos
material genético y división nuclear en
células eucarióticas que produce dos cé- un poco más adelante. Pero en general, la célula divide a la mitad
lulas genéticamente idénticas. todo su material, organelos y adn. Como resultado de esta fase se
obtienen dos células idénticas a la que inició el proceso. Recuerda
que cuando una célula se divide está produciendo nuevas células que
regeneran o forman un tejido, como las células de la piel, por ejem-
plo, que se regeneran continuamente.
Cabe enfatizar que el ciclo celular está estrictamente regulado por
señales moleculares llamadas controles. Éstos aseguran que la célula

maquinaria de replicación
del adn
maquinaria de la mitosis
medio
¿está replicado todo el adn?
¿medio favorable? ¿están los cromosomas
alineados?
¿tamaño suficiente de la célula?
control de G2 Control de la metafase
crecimiento celular

entrada a M salida de M

G2
controlador

G1

S
inicio

Control de G1
medio ¿tamaño suficiente de la célula?

¿medio favorable?
Durante su ciclo, las células tienen controladores
que verifican que la célula complete los procesos
moleculares para continuar su avance a la crecimiento celular
siguiente fase.

36

BIO2-DGB-U1.indd 36 2/21/08 11:39:11 AM


complete sus procesos en cada etapa para pasar a la siguiente. Son

2 Reproducción celular y en organismos


una especie de agentes aduanales en las fronteras revisando los pape-
les de los viajeros para pasar o seguir su viaje.
Cuando la célula cumple con todos los requisitos moleculares,
desata nuevos procesos moleculares que permiten iniciar una nue-
va fase o periodo. Lo más importante es que cuando una célula ha
pasado un cierto punto de control, ya no puede regresar a una etapa
anterior ni detener el avance del ciclo.

El cáncer y el ciclo celular para saber más...


Todas las células se dividen siguiendo el ciclo celular. Además de los con-
troles existen algunos genes que regulan este ciclo y la duración de la vida
de una célula. Esto sucede sobre todo en los organismos pluricelulares,
donde es necesario que las células colaboren entre ellas para que el or-
ganismo entero funcione correctamente. Por tanto, si una célula decide
comenzar a reproducirse sin atender a las señales de otras células ni las
propias, puede acarrear consecuencias graves para las células adyacentes y,
más adelante, para todo el organismo. Cuando una célula pierde la capaci-
dad de regular su propia división, es decir, cuando se reproduce sin control
o incluso olvida cuándo debe morir, tenemos un cáncer. Un cáncer es un
tejido de células sin función específica, hijas de una célula que perdió el
control de su reproducción.
¿Qué sucede? Un cáncer se origina principalmente por una alteración
en el adn, sobre todo en los genes que regulan la división celular, ya sean
genes que organizan los momentos de inicio o en los que finalizan la di-
visión. La consecuencia es una célula que se divide constantemente. Tales
alteraciones en esta clase de genes están provocadas ya sea por modifica-
ciones o mutaciones, o bien por la acción de sustancias químicas conocidas
como carcinógenos. Existen muchos carcinógenos con los que convivimos
en la vida diaria. Son muchas razones las para explicar por qué no hemos
muerto todos los seres humanos de cáncer ante una situación así. Una
razón es que la mayoría de dichas sustancias tienen efectos cancerígenos
cuando nos exponemos a cantidades enormes o de manera repetida. Otra
razón es que nuestro cuerpo tiene la capacidad de encontrar células con
características cancerígenas y eliminarlas. Además, nuestras células poseen
un sistema de rastreo de alteraciones genéticas para arreglarlas antes de
que sean un problema. De hecho, si en este momento pudiéramos revisar
célula por célula en nuestro cuerpo, encontraríamos que muchísimas son
cancerosas.
El peligro de las células cancerosas es que toman los recursos de los
grupos de células adyacentes que sí llevan a cabo funciones especializadas

37

BIO2-DGB-U1.indd 37 2/21/08 11:39:12 AM


en favor del organismo. Las cancerosas son vividoras del organismo, sólo
consumen pero no producen. Al comenzar el desarrollo de un grupo de
células, como éstas, se limita a una zona específica, pero cuando se repro-
ducen muchas veces pueden comenzar a invadir otros tejidos y dañarlos.
Unidad 1 Reproducción y herencia

Mitosis
esto ya
lo sabes Describe cada fase del ciclo celular. Si lo necesitas, vuelve a revisar el
tema.

Cuando nuestro organismo debe regenerar un tejido, o después de una


hemorragia, por pequeña que sea, es necesario reponer las células perdidas.
Para ello, las células deben multiplicarse y producir copias de sí mismas.
La mitosis es el proceso de división de la célula. Sucede durante
la fase de división del ciclo celular. Para que una célula se divida es

38

BIO2-DGB-U1.indd 38 2/21/08 11:39:14 AM


necesario haber duplicado su material genético y sus organelos, y en

2 Reproducción celular y en organismos


consecuencia aumenta su tamaño. Una vez realizado lo anterior, la
célula comienza la mitosis, que consta de cinco fases: profase, prome-
tafase, metafase, anafase y telofase. Al finalizar estas fases, la célula se
divide en dos partes mediante el proceso llamado citocinesis, el cual
es la última etapa de la división celular.

Fases de la mitosis
Profase. Es el inicio y se considera que ha comenzado cuando la
membrana nuclear comienza a romperse, desaparecen los nucleolos
y el adn está completamente condensado en cromosomas. Como
recordarás, cuando una célula llega hasta este punto en el ciclo celular
ya tiene el doble de adn (el original y la nueva copia) y, por lo tanto,
el doble de cromosomas. En la figura se observa que cada cromoso-
ma está unido con su par. En tu curso anterior de Biología viste que
Todas las células de nuestro organismo se
el citoesqueleto está formado por diferentes proteínas, entre ellas la dividen, la mayoría de ellas por medio de la
tubulina. Durante esta etapa, las estructuras proteicas llamadas cen- mitosis.

triolos organizan a las tubulinas y forman algo parecido a cables, que


servirán para atraer la copia de cada cromosoma hacia los extremos
de la célula. A estos cables o fibras se les llama husos mitóticos, y
se unen con otras proteínas llamadas centriolos. En esta etapa cada
célula cuenta con cuatro centriolos formando dos pares. Cada par
de centriolos unidos a sus husos mitóticos comienzan a migrar hacia
polos opuestos de la célula. Cuando llegan al polo se les conoce como
polo del huso.
Prometafase. Inicia cuando la membrana nuclear se rompe por
completo. Ahora, la parte central de los cromosomas, llamada cen-
trómero, tiene una región rica en proteínas llamada cinetocoro en
la que se unen los husos mitóticos a los cromosomas. En la figura
se muestra que cada polo del huso está en su lugar respectivo y que
cada par de cromosomas está unido al huso mitótico. Esta unión
permite que los husos mitóticos lleven al cromosoma hacia su polo
correspondiente, es decir, cada cromosoma se moverá en dirección
opuesta a su par.
Metafase. Cada cromosoma está unido a su huso mitótico, y se
comienza a mover hasta llegar a una zona intermedia entre ambos
centriolos, conocida como el ecuador celular. Esto es gracias a que
las fibras y los centriolos se estiran y se aflojan, de modo que mue-
ven a los cromosomas lo necesario para ubicarlos en el ecuador de la
célula.
Anafase. Los centriolos comienzan a tirar de las fibras del huso y
en consecuencia de los cromosomas a los que están adheridos. Esto

39

BIO2-DGB-U1.indd 39 2/21/08 11:39:18 AM


1 Profase
centrosomas en
citoplasma separación
membrana plasmática

nucleolo disperso
Unidad 1 Reproducción y herencia

centrómero

envoltura nuclear

cromosoma condensado con dos


cromátidas

ruptura de la
envoltura nuclear

2 Prometafase

membrana plasmática
microtúbulo polar
cromosoma
cinetocoros
microtúbulos del
cinetocoro

el cromosoma se
mueve hacia la placa
metafásica
3 Metafase

los cromosomas
se alinean en la
placa metafásica
microtúbulos del
cinetocoro

separación súbita de
los cinetocoros pares,
comienza la anafse

40

BIO2-DGB-U1.indd 40 2/21/08 11:39:22 AM


4 Anafase

2 Reproducción celular y en organismos


los microtúbulos del
cinetocoro se acortan
al tiempo que se jalan
las cromátidas hacia
el polo

incremento de la
elongación del separación de los polos
microtúbulo polar

la envoltura nuclear
se vuelve a formar

5 Telofase

descondensación de
los cromosomas sin
los microtúbulos del
cinetocoro

microtúbulos polares

la célula se
divide en dos
6 Citocinesis

se completa la envoltura
el núcleo reaparece nuclear al tiempo que
se descondensan los
cromosomas

contracción del ecuador

La mitosis forma parte del ciclo celular y


los microtúbulos está dividida en cinco fases. Los pares de
interfásicos se re cromosomas se organizan y se separan, y la
acomodan en el célula se alarga. Inmediatamente después
centrosoma comienza la citocinesis.

41

BIO2-DGB-U1.indd 41 2/21/08 11:39:23 AM


provoca que cada par de cromosomas se separe en dos mitades. Al
tiempo que los centriolos llevan a todos los cromosomas desde el
centriolo, a una misma velocidad, hacia un polo, los husos que no
están unidos a un cromosoma interactúan con las del polo opuesto
Unidad 1 Reproducción y herencia

para alargar la célula. En la figura se ve cómo esta interacción logra


que cada polo quede cada vez más alejado de su contrario.
Telofase. Los cromosomas están en su polo respectivo y los cen-
triolos se liberan de las fibras del huso, la membrana nuclear comien-
za a formarse a su alrededor y reaparecen los nucleolos. Las fibras
libres del huso alargan aún más a la célula, y permiten que la célula
se separe en dos. Este fenómeno es la citocinesis que veremos a con-
tinuación.

Citocinesis
Cuando los cromosomas migraron hacia los polos de la célula en di-
conceptos visión y la célula se alargó, fue necesario dividirla en dos. El proceso
de separación de las dos nuevas células es la citocinesis.
Citocinesis es la división del citoplasma En las células animales se forma un anillo de microfilamentos (fi-
de una célula, posterior a la división nu-
bras proteicas) alrededor del ecuador o parte media de la célula. Con
clear.
ello el citoplasma celular se comprime, de forma similar a tirar de la
correa de una bolsa de plástico o de un pantalón deportivo. Observa
en la figura que cuando se contrae por completo, el ecuador de la cé-
lula se divide el citoplasma de dos células hijas nuevas, cada una con
aproximadamente la misma cantidad de citoplasma.
Las células vegetales requieren procesos un poco más complejos
ya que, como recordarás, además de membrana celular tienen una
pared celular que impide que la membrana se contraiga y se divida.
También es necesario que cada célula hija tenga su propia pared celu-
lar que la separe de la otra. En estas células el aparato de Golgi libera
vesículas de carbohidratos que se ubican en el ecuador, se fusionan y
La diferencia en la citocinesis de ambos tipos
celulares radica en la presencia de pared celular
forman una placa celular. Entonces, se forma una membrana celular
en las células vegetales. a cada lado. En la figura se muestra cómo llega el momento en que

Los microfilamentos El anillo de microfilamentos La cintura se parte


forman un anillo en torno se contrae y constriñe la totalmente y se forman dos
al ecuador de la célula cintura de la célula. células hijas.

42

BIO2-DGB-U1.indd 42 2/21/08 11:39:25 AM


esta placa se fusiona con la pared celular y las membranas se fusionan

2 Reproducción celular y en organismos


con la membrana original.
Ya separadas, las células entran en interfase, por lo que pueden
volver a comenzar el ciclo celular.

para saber más...


El número de cromosomas varía de una especie a otra. El siguiente cuadro
contiene el número de cromosomas en diferentes especies.

Número de
Especie
cromosomas
Mosca común 12
Rata 42
Hombre 46
Chimpancé 48
Oveja 54
Vaca 60
Caballo 64
Camello 74
Llama 74
Perro 78
Pollo 78
Ratón 40
Cerdo 40
Mosquito 6
Gato 38

Observa que el camello y la llama tienen el mismo número. Este tipo de


coincidencias sucede a menudo entre organismos evolutivamente cerca-
nos. Es muy importante que los organismos mantengan el mismo número
de cromosomas en sus células.

Completa el cuadro siguiente. Si es necesario revisa nuevamente el tema


de ciclo celular y mitosis.

Fases del ciclo celular Periodos en que se dividen Sucesos

Interfase G1

43

BIO2-DGB-U1.indd 43 2/21/08 11:39:27 AM


Fases del ciclo celular Periodos en que se dividen Sucesos

S
Unidad 1 Reproducción y herencia

G2

División Celular/ Profase


Mitosis

Prometafase

Metafase

Anafase

Telofase

Citocinesis

haz Imagina a tu bicho y contesta lo siguiente.


tu bicho
Es muy probable que hayas descubierto que es muy importante que sus
células puedan dividirse.
Además de reparar una herida, ¿en qué otros procesos de tu bicho está
involucrada la división celular?
• Descríbelos.

Forma grupos de tres integrantes, analicen lo siguiente y contesten


las preguntas.

• Además del desarrollo embrionario, ¿en qué otros procesos del cuerpo
humano se lleva a cabo la división celular de manera activa?

44

BIO2-DGB-U1.indd 44 2/21/08 11:39:29 AM


• Piensen en organismos como plantas, hongos, otros animales y bacterias.

2 Reproducción celular y en organismos


¿Hay división celular en ellos? Expliquen su respuesta.

• ¿En qué procesos es importante la división celular para ellos?

• ¿Los procesos humanos en los que la división celular es importante se


parecen a los de tu bicho?

Reproducción asexual

Este tipo de reproducción permite que los organismos se multipli-


quen con rapidez, y se caracteriza por la ausencia de fusión de células
especializadas y porque los organismos resultantes son genéticamente
idénticos a su progenitor. Esto se realiza por medio de la división
sucesiva del organismo completo en el caso de organismos unicelu-
lares, o de la división por mitosis de algunas células de su cuerpo. La
mayoría de los organismos que se reproducen asexualmente son uni-
celulares. No obstante, algunos pluricelulares utilizan esta estrategia
para reproducirse en ciertos momentos de su vida. Ya que este tipo de
reproducción está basado en la mitosis, no sólo facilita la multiplica-
ción de organismos, sino que también tiene diversas funciones en el
cuerpo humano, como la cicatrización.

Un grupo de organismos que se reproduce asexualmente son los proca- esto ya


lo sabes
riontes. En Biología I revisaste las características principales de estos orga-
nismos.
Describe brevemente estas características en tu cuaderno.

Existen diferentes formas de reproducción asexual. Una de ellas


es la fisión binaria, que quiere decir que una célula se divide en dos.
Ésta es la forma más sencilla y la llevan a cabo los organismos pro-
cariontes. En general es un proceso muy similar a la mitosis, con la
diferencia de que los procariontes tienen un solo cromosoma y no
se forma un huso mitótico. La célula debe duplicar su cromosoma y
cuando este proceso se completa, cada cromosoma se une a la mem-
brana celular. El siguiente suceso es que la célula duplique sus com-
ponentes, y provoque que crezca. Por tanto, los cromosomas unidos
a la membrana se separan. Ahora la célula sigue aumentando su vo-

45

BIO2-DGB-U1.indd 45 2/21/08 11:39:30 AM


lumen hasta duplicarlo, y se forma un pliegue en la membrana hacia
el interior de la célula (este proceso se conoce como invaginación).
La invaginación de la membrana continúa hasta que las membranas
de ambos lados se fusionan y separan, dividiendo a la célula en dos
Unidad 1 Reproducción y herencia

células hijas idénticas.

punto de
1 pared fijación
celular

membrana
plasmática adn circular

La fisión binaria es una forma de mitosis


evolutivamente menos desarrollada. Los
organismos procariontes se valen de ella para
reproducirse asexualmente.

Ya se ha mencionado que no sólo los organismos unicelulares pue-


den reproducirse asexualmente. Éstas son algunas estrategias asexua-
les de los organismos pluricelulares.
Gemación. Ocurre gracias a la formación de un brote o yema (si-
milar a los brotes de las plantas de donde salen nuevos tallos) en algu-
na parte del cuerpo del organismo que parece una miniatura del pro-
genitor. La yema se alimenta del progenitor hasta que alcanza cierto
tamaño y después se desprende para funcionar como un miembro
independiente. La gemación produce organismos idénticos al pro-
genitor. La realizan hongos como las levaduras y animales como las
anémonas.
Las anémonas, pertenecientes al phylum
Esporulación. Los hongos y algunos protozoarios se reproducen
Cnidaria, se pueden reproducir por gemación. utilizando un tipo de células con una cubierta o cápsula protectora

46

BIO2-DGB-U1.indd 46 2/21/08 11:39:32 AM


y rígida llamadas esporas. Dichas esporas se producen por mitosis y,

2 Reproducción celular y en organismos


cuando han madurado, se liberan al medio. El objetivo es que lleguen
a un lugar con condiciones favorables para que un organismo pueda
vivir. Entonces germinan, es decir, rompen la cubierta y comienzan a
dividirse y a formar un organismo nuevo.
Reproducción vegetativa. Algunas plantas se reproducen de esta
manera cuando las condiciones ambientales son muy estables y fa-
vorables para la planta. Así que
no es necesario gastar energía en
producir flores. Esto ocurre muy
a menudo en selvas tropicales
debido a que la planta, o el ser
humano según sea el caso, puede
enterrar una rama y ésta produce
raíces. Esta forma se llama repro-
ducción por acodos. Otra forma
es que un fragmento de rama
que cayó al suelo comience a
generar raíces y de ahí un nuevo
organismo; se conoce como esta-
cas. Esta estrategia reproductiva
la aprovecha el hombre cuando
El ser humano ha explotado la reproducción
las características de una planta son muy favorables, por ejemplo en vegetativa para obtener grandes plantaciones en
los viñedos, donde se busca que muchas plantas produzcan uvas con las que todas las plantas tienen características
idénticas.
las mismas características de sabor para generar un vino específico.
Fragmentación. Las estrellas de mar, los corales, las medusas, las
lombrices de tierra y algunos gusanos planos tienen la capacidad de
generar un organismo nuevo a partir de un fragmento de su cuerpo.
Por lo general el organismo se divide en dos y cada fragmento rege-
nera la parte que le falta, ambos quedan como organismos completos
e idénticos entre sí.
Partenogénesis. En algunas poblaciones de reptiles, como las la-
gartijas, en las que todos los organismos son hembras, se observa
este tipo de reproducción. Cuando se estudió el fenómeno se dieron
cuenta de que las hembras producían huevos que, al no ser fecun-
dados, duplicaban su material genético y se producía una hembra.
Toma en cuenta que los huevos son óvulos y por tanto tienen sólo la
mitad del material genético de una célula somática. Este tipo de re-
producción no es exclusiva de las lagartijas, también se ha encontra-
do en otros reptiles, en caracoles, en algunos crustáceos, y en insectos
como abejas y pulgones de las rosas. En todos los casos, los óvulos no
fecundados son capaces de activar su desarrollo y formar un nuevo

47

BIO2-DGB-U1.indd 47 2/21/08 11:39:36 AM


individuo, por lo general una hembra. Muchos de estos organismos
alternan la partenogénesis con la reproducción sexual. Esto depende
de si se conservan las condiciones ambientales o si cambian, respec-
tivamente.
Unidad 1 Reproducción y herencia

En conclusión, la mitosis permite que la mayoría de estas estra-


tegias se puedan llevar a cabo. De hecho, la mitosis es un tipo de
reproducción asexual que llevan a cabo todas las células de todos lo
organismos, con la única excepción de las células reproductoras.

Es común encontrar en la Naturaleza organismos


que nacieron de un óvulo no fecundado
mediante un proceso llamado partenogénesis.

Vuelve a leer las diferentes formas de reproducción asexual y elabora


un mapa conceptual en tu cuaderno.
haz
tu bicho
Imagina que tu bicho se reproduce asexualmente.

• ¿Cuál de las estrategias asexuales llevaría a cabo tu bicho?

• Describe cómo sucedería.

• En tu cuaderno, elabora un esquema de este proceso.

48

BIO2-DGB-U1.indd 48 2/21/08 11:39:40 AM


Meiosis

2 Reproducción celular y en organismos


La meiosis es un tipo de división celular especializado para producir
células reproductoras o gametos, que son el óvulo y el espermato-
zoide y presentan características distintas al resto de las células del
cuerpo.

Anteriormente, en este capítulo, revisamos las características que poseen esto ya


lo sabes
las células haploides y las células diploides.
Describe brevemente y con tus palabras estas características.

conceptos

Meiosis es el tipo de división celular que


produce células con una sola copia del
material genético y que comprende dos
divisiones celulares sucesivas.
Esta meiosis la realizan cierto grupo de células destinadas a con-
vertirse en gametos. Estas células están presentes en los tejidos espe-
cializados en la reproducción. En los mamíferos se llaman gónadas,
en particular se les llama testículos, en el caso de los machos, y ova-
rios, en el caso de las hembras. Este proceso involucra dos divisiones
celulares sucesivas y sólo una duplicación del material genético antes
de iniciar.
Una diferencia importante entre la meiosis y la mitosis se encuen-
tra en la primera división. Los pares de cromosomas o cromosomas
homólogos intercambian material genético (adn) cuando ocurre un
suceso conocido como entrecruzamiento. El fenómeno de intercam-
bio de material entre cromosomas homólogos es la recombinación, y La meiosis es el mecanismo de producción de
gracias a ella las células que resultan de la meiosis tienen información los gametos.
genética diferente a la de las células que la originaron. Explicaremos
esto un poco más adelante.
En términos generales, la meiosis abarca una única replicación de
adn seguida de dos divisiones celulares denominadas meiosis i y
meiosis ii.
cromátidas hermanas enzimas de recombinación

49

BIO2-DGB-U1.indd 49 2/21/08 11:39:58 AM


Meiosis i
Profase I
Antes de esta fase hay una interfase prolongada en la que hay una
replicación del adn. Esta primera división celular comprende cua-
tro fases: profase i, metafase i, anafase i y telofase i. En la profase I
Unidad 1 Reproducción y herencia

leptoteno ocurren muchos sucesos importantes y característicos de la meiosis,


por lo que se ha subdividido en cinco etapas: leptoteno, zigoteno,
paquiteno, diploteno y diacinesis.
Profase i En esta fase se lleva a cabo el entrecruzamiento de los
cromosomas y el intercambio de material genético de acuerdo con la
siguiente secuencia.
• Leptoteno (de origen griego, significa filamento delgado) El nom-
zigoteno bre se refiere a cómo se ve la cromatina en este momento de la
división, ya que se condensa en una región de la célula y se acorta
para formar los cromosomas. Éstos se organizan en pares con sus
homólogos. Ya que en la interfase, antes de la meiosis, se duplicó el
material genético. En este punto se pueden observar cuatro cromo-
somas de cada tipo, es decir, dos pares de cromosomas homólogos.
• Zigoteno (del griego zygon, pareja) Su nombre se debe a que los
cromosomas homólogos se alinean, como si se juntaran por parejas.
paquiteno
En ese momento entre los cromosomas se forma una estructura
llamada complejo sinaptonémico, compuesta de diferentes tipos de
proteínas que mantienen unidas a las cuatro copias de cada cromo-
soma, formando tétradas. Este proceso de unión de las copias de
cromosomas se conoce como sinapsis.
• Paquiteno En la figura se observa que los cromosomas son como
una hebra gruesa. Por ello esta fase se llama paquiteno, que signi-
diploteno
fica filamento grueso. Esta fibra gruesa se forma porque los cro-
mosomas se han unido a todo lo largo con intervención del com-
plejo sinaptonémico. Si se observa más de cerca la estructura, luce
como si los cromosomas estuvieran unidos por un cierre. Es justo
ahora, cuando los cromosomas están unidos, que se da el entre-
cruzamiento. En ciertas regiones específicas de cada cromosoma
se da el intercambio de segmentos de adn. Este lugar, donde se
diacinesis unen los cromosomas homólogos para intercambiar material,
se llama quiasma.
• Diploteno Ahora empiezan a separarse los cromosomas y se desin-
tegra el complejo sinaptonémico. Sin embargo, permanecen unidos
en la zona de los quiasmas.
• Diacinesis Después de todo lo ocurrido, la diacinesis permite iden-
tificar los cuatro cromosomas homólogos, aunque se siguen man-
Durante el entrecruzamiento los cromosomas
homólogos se unen en lugares específicos
teniendo unidos por algunos de los quiasmas por haberse reducido
llamados quiasmas e intercambian material. su número.

50

BIO2-DGB-U1.indd 50 2/21/08 11:40:00 AM


Metafase i Los husos mitóticos, aquellos cables o fibras de proteína metafase I

2 Reproducción celular y en organismos


que se extienden desde los polos de la célula, se anclan a los cromo-
somas ya acomodados en medio de la célula y todavía unidos por los
quiasmas. También desaparece el nucleolo y la membrana nuclear. quiasma

Anafase i Las fibras del huso atraen a cada cromosoma y lo separan


completamente de su homólogo. Entonces cada cromosoma migra los cinetocoros
de las cromátidas
hacia extremos opuestos de la célula. hermanas permiten
que se separen
Telofase i Al igual que en la mitosis, en esta etapa las fibras del
huso desaparecen, y en algunas especies se forma la envoltura nuclear.
anafase I
Por lo general, en esta etapa se da la citocinesis.
En el momento de la meiosis I se tienen dos células diploides, pero
cada una con información genética diferente debido al entrecruza-
miento. Comienza entonces una interfase, llamada intercinesis, en la
que no hay duplicación del adn, sino la separación de las cromáti-
das desde el centrómero para que queden libres y migren de manera
independiente.

Meiosis ii metafase II
La meiosis ii, que se asemeja mucho a una mitosis, consta también de
varias etapas: la profase ii, la metafase ii, la anafase ii y la telofase ii.
Profase ii Si se formó una membrana nuclear, desaparece en este
momento y se forman las fibras del huso.
Metafase ii Los cromosomas se alinean en el ecuador celular gra-
las fibras del cinetocoro
cias a su unión con las fibras del huso. de las cromátidas
hermanas apuntan hacia
Anafase ii Las cromátidas hermanas se separan y migran a polos direcciones opuestas
opuestos.
Telofase ii La migración de los cromosomas termina y se forma
la envoltura nuclear a su alrededor. Desaparecen las fibras del huso anafase II

y los cromosomas se desbaratan, por lo que es difícil observarlos, separación súbita de


las cromátidas
la cromatina se ve laxa, es decir, el adn está empaquetado pero no
por completo. Después, las dos células se dividen por diacinesis y se
obtienen cuatro células con la peculiaridad de que cada una posee
una sola copia de cada cromosoma. Por tanto, se dice que las cuatro
células resultantes de la meiosis son células haploides. Recuerda que
cuando una célula se divide por mitosis, el resultado son sólo dos
células, cada una con dos copias de cada cromosoma, es decir, células
diploides.
Las células que conforman el cuerpo de un organismo eucarionte Los cromosomas están unidos por los quiasmas
en la metafase I y se separan los homólogos en
son siempre células diploides, las únicas células haploides que éste la anafase I. En la metafase II cada cromátida
posee son las de los gametos. Cuando un gameto se fusiona con otro se une a un huso en dirección contraria a su
cromátida hermana, y en la anafase II se separan
de su misma especie y de sexo contrario, la célula resultante, llamada completamente y cada célula termina con un
cigoto, tiene otra vez dos copias de cada cromosoma, se dice que juego de cromosomas.

51

BIO2-DGB-U1.indd 51 2/21/08 11:40:02 AM


metafase I
Unidad 1 Reproducción y herencia

anafase I

telofase I

profase II

metafase II

anafase II

telofase II

gametos
haploides
La meiosis es un proceso de división celular de
dos divisiones sucesivas y un entrecruzamiento
de cromosomas que origina cuatro células hijas
con información genética propia y diferente a la
de su progenitora y a la de sus hermanas.

52

BIO2-DGB-U1.indd 52 2/21/08 11:40:04 AM


recupera la diploidía. El cigoto tiene un juego de cromosomas del

2 Reproducción celular y en organismos


padre y otro de la madre; es decir, un juego de cromosomas procede
de un gameto y el otro juego del gameto del sexo opuesto. El cigoto
tiene entonces la capacidad de originar un nuevo organismo gracias
a que efectúa numerosas divisiones por mitosis para formar todas las
células del futuro embrión. Cuando este nuevo organismo produzca
gametos se intercambiará y mezclará la información de ambos padres
durante el entrecruzamiento. El resultado serán gametos con infor-
mación genética mezclada y diferente a la del resto de las células de
este organismo. En este resultado radica la verdadera importancia
de la meiosis: producir variantes de la información genética en los
gametos, es decir, diferentes combinaciones que les otorga informa-
ción genética propia y única a los gametos.

Ahora que conoces los procesos de meiosis y mitosis contesta las


siguientes preguntas.

• ¿Qué tipo de células se dividen por mitosis?

• ¿Qué células se dividen por meiosis?

• ¿Cuántas células hijas quedan después de que una célula se dividió por
mitosis?

• ¿Cuántas células hijas resultan de la división por meiosis?

• Completa el cuadro.

Mitosis Meiosis

¿Qué tipo de células la realizan?

¿Hay duplicación del ADN antes de


iniciar?

¿Cuáles son sus fases?

53

BIO2-DGB-U1.indd 53 2/21/08 11:40:06 AM


Mitosis Meiosis

¿Cuántas divisiones celulares com-


prende?
Unidad 1 Reproducción y herencia

¿Qué características tienen las células


resultantes?

¿Cuál es el evento más destacado que


sucede durante el proceso?

Gametogénesis

Como ya viste, todas las células reproductoras o gametos se originan


por meiosis. Sin embargo, cada tipo de gameto, masculino o femeni-
no, sigue procesos especiales que culminan con una maduración. Pri-
mero hay que entender que desde el desarrollo embrionario existen
ciertas células que son anteriores a los gametos y que se dividen por
mitosis, hasta que señales bioquímicas indican iniciar la meiosis que
producirá gametos. No todas estas células inician la meiosis al mismo
tiempo, sino un grupo a la vez.

54

BIO2-DGB-U1.indd 54 2/21/08 11:40:08 AM


Otra cuestión importante es que, en general, el inicio de la meio-

2 Reproducción celular y en organismos


sis ocurre en el momento en que el organismo alcanza la madurez conceptos
sexual. Sin embargo, en el caso de los mamíferos la meiosis inicia
en momentos diferentes para el sexo masculino y el femenino. En Gametogénesis es el proceso de for-
mación de gametos por medio de la
los machos, las espermatogonias o células precursoras de los esper- meiosis.
matozoides se dividen por meiosis hasta que el individuo alcanza la
Espermatogonias son las células precur-
pubertad o madurez sexual. En las hembras, en cambio, las ovogo- soras de los espermatozoides.
nias, antecesoras de los óvulos, realizan la primera parte de la meiosis
durante el desarrollo embrionario; luego se detienen en la profase I.
La meiosis se reactiva cuando el organismo llega a la pubertad.
El proceso de la gametogénesis forma los gametos; gametogénesis
quiere decir generación de gametos. Existen dos tipos de gametogéne-
sis, la espermatogénesis que origina gametos masculinos, espermato-
zoides, y la ovogénesis que produce gametos femeninos, óvulos. La
diferencia entre ambos procesos está en la función de cada gameto.
En tanto los gametos masculinos suelen tener muy poco citoplasma
para ser lo más pequeños y móviles posible, los femeninos son muy
grandes, acumulan muchos nutrimentos en su gran citoplasma y casi
no se mueven, en realidad esperan a que el espermatozoide se en-
cuentre con ellos.
En todos los organismos los gametos masculinos se producen por
miles y miles. Lo mismo ocurre con la mayoría de las hembras del
reino animal. Sin embargo, la gran excepción son las hembras de rep-
tiles, aves y mamíferos que producen sólo un número determinado
(por lo general reducido) de gametos femeninos. Este hecho, además
de afectar la forma en que se produce cada tipo de gameto, tiene un
efecto en la conducta de cada sexo. Si te fijas, entre los vertebrados
es común que los machos muestren comportamientos de lucha entre
ellos, colores y cantos vistosos, o incluso llevar regalos a las hembras o
construir los nidos; son las hembras quienes parecen elegir al macho
que les conviene para invertir sus pocos óvulos disponibles.

Espermatogénesis
Después de muchas divisiones mitóticas dentro de los testículos, las
espermatogonias se diferencian en espermatocitos primarios. Estas
células inician la meiosis y al término de la meiosis I han formado
dos células diploides llamadas espermatocitos secundarios, que ini-
ciarán la meiosis II y cada uno formará dos células haploides llama-
das espermátidas. Las espermátidas son espermatozoides inmaduros
que sufrirán cambios en su estructura y componentes celulares para
convertirse en espermatozoides activos y listos para nadar en busca
de un óvulo.

55

BIO2-DGB-U1.indd 55 2/21/08 11:40:11 AM


La espermatogénesis es el proceso de formación
de los gametos masculinos o espermatozoides.

espermatogonia
Unidad 1 Reproducción y herencia

espermatocito primario

espermatocito secundario

espermátida espermatozoide

meiosis i meiosis ii maduración

Ovogénesis
Una característica de la ovogénesis es que en los mamíferos inicia
durante el desarrollo embrionario en los ovarios del feto. Un gru-
po de células llamadas ovogonias comienzan a dividirse por mitosis
y producen ovocitos primarios. Los ovocitos primarios empiezan la
meiosis, pero se interrumpe en la metafase I. Antes de que el desarro-
llo embrionario termine, ya no hay ovogonias en los ovarios y sólo
quedan los ovocitos primarios que la hembra tendrá por el resto de su
vida. Todos los ovocitos primarios tendrán el proceso de división de-
tenido antes de completar la primera división meiótica. En las hem-
bras humanas esto ocurre antes de llegar al tercer mes de desarrollo
embrionario. Después del nacimiento, los ovocitos primarios empie-
zan a acumular sustancias nutritivas y por tanto aumentan mucho
su tamaño. Así permanecen hasta que la mujer alcanza la pubertad.
Entonces, mes con mes un ovocito reactiva la meiosis I y genera dos
células diploides.
Detengámonos un poco en este punto. Recuerda que uno de los
objetivos del ovocito es acumular todos los nutrimentos posibles. Por
esta razón las dos células que se producen después de la primera di-
visión meiótica tienen tamaños diferentes. Una de ellas se queda con
casi todo el citoplasma y se llama ovocito secundario, y la otra célula,
el cuerpo polar, prácticamente no tiene citoplasma y por tanto es
mucho más pequeña. Esta célula pequeña tiene las mismas caracte-
rísticas genéticas que el ovocito secundario y también podría quedar
fecundada, pero como no tiene una reserva de nutrimentos suficien-
te, no podría llevar a cabo el desarrollo embrionario. El cuerpo polar
recibe su nombre porque la división de la célula original, el ovocito
primario, ocurre cerca de una orilla o polo. Con ello se garantiza que

56

BIO2-DGB-U1.indd 56 2/21/08 11:40:13 AM


sólo una de las células se quede con la mayor cantidad de citoplasma

2 Reproducción celular y en organismos


y con todos los organelos necesarios para el desarrollo de un nuevo
organismo.
Al terminar la meiosis i, el ovocito secundario inicia la meiosis
ii sin pasar por ninguna interfase. El primer cuerpo polar también
lleva a cabo la meiosis ii y produce dos cuerpos polares más. Así, al
final de la meiosis de las células sexuales femeninas se obtiene un
gameto de gran tamaño, y tres cuerpos polares que se desechan.
Es importante mencionar que la meiosis ii se interrumpe al llegar
a la metafase y sólo se reiniciará cuando el óvulo quede fecundado.
En este momento se forma una célula grande llamada ovátida y otro
cuerpo polar.
La ovogénesis inicia durante el desarrollo
ovocito secundario embrionario y culmina hasta el momento
de la fecundación.
óvulo
ovogonia

cuerpo polar

ovocito primario

cuerpo polar

cuerpo polar

cuerpo polar

meiosis i meiosis ii
(después de la fecundación)

Dibuja en tu cuaderno un esquema donde compares la espermatogé-


nesis con la ovogénesis. Anota los nombres de las células que inician
el proceso.

Reproducción sexual

La reproducción sexual involucra la producción de gametos tanto


masculinos como femeninos por medio de la gametogénesis. Gracias
a la fecundación, estos gametos se encuentran y se fusionan; final-
mente se desarrolla el nuevo organismo. Podríamos definir la repro-
ducción sexual como el tipo de reproducción que involucra la fusión
de dos gametos de dos organismos de la misma especie y de sexo
opuesto.
Para ello es necesario que se encuentren dos organismos de la mis-
ma especie y del sexo opuesto en el momento indicado, para que cada

57

BIO2-DGB-U1.indd 57 2/21/08 11:40:15 AM


uno aporte sus gametos. En las plantas suele ser un problema que se
conceptos soluciona con diferentes estrategias. Una, que fue de las primeras que
se utilizaron, es aprovechar el aire para permitir que los granos de
Fecundación es la fusión del gameto polen, que llevan los gametos masculinos, alcancen las estructuras fe-
Unidad 1 Reproducción y herencia

masculino con el femenino cuyo resul-


tado será la formación de una célula meninas y fecunden los óvulos. Otra estrategia es aprovechar insectos
diploide, llamada cigoto, cuyas divisiones que lleven el polen de una flor a otra.
sucesivas la llevan a formar un nuevo
Algunos animales logran acercar los espermatozoides al óvulo de-
organismo.
positándolos dentro del aparato reproductor femenino. Esta estrate-
gia se llama fecundación interna y la llevan a cabo sólo los mamíferos,
las aves y los reptiles que, como recordarás, son los animales cuyas
hembras producen pocos gametos. Esto tiene muchas ventajas ya
que el macho se asegura de que la hembra que lo eligió aproveche
su semen. Además, en el caso de animales que cuidan a sus crías, el
macho puede estar seguro de que las crías que cuidará son sus hijos.
Otra ventaja es que casi se puede asegurar la fecundación, ya que el
semen se quedará en el aparato reproductor femenino y no se des-
perdiciará.
Otra forma de fecundación en los animales es la externa, en la
que los organismos depositan los óvulos y los espermatozoides en
un lugar cercano para que los fecunden. Algunas especies, como los
corales, liberan espermatozoides y óvulos un día específico del año.

2 reacción acrosomal
Las aves, los mamíferos y los reptiles se valen (inicia la penetración)
de la fecundación interna para incrementar las 1 unión del
posibilidades de fertilización. espermatozoide a la
zona pelúcida

3 penetración a
membrana plasmática del través de la zona
óvulo pelúcida

zona pelúcida

4 Fusión de las
Cualquiera que sea la estrategia de la especie membranas plasmáticas
animal para fecundar un óvulo, el objetivo es el 5 el núcleo del
mismo, que un espermatozoide se fusione con espermatozoide entra el
un óvulo para iniciar el desarrollo de un nuevo citoplasma del óvulo
individuo. Éste es un esquema de los sucesos
cuando un espermatozoide encuentra un óvulo.

58

BIO2-DGB-U1.indd 58 2/21/08 11:40:17 AM


Esto ocasiona que el mar se llene de gametos que en algún momento

2 Reproducción celular y en organismos


se encontrarán y se fecundarán. Otras especies buscan más seguridad
y una vez que se establece la pareja, la hembra deposita los óvulos en
un lugar y sobre ellos el macho descarga el semen; de esta manera se
asegura la fecundación de la mayoría de los óvulos. Otro ejemplo es
el de algunas especies de ranas y sapos, el macho se coloca sobre la
hembra y le da un tipo de abrazo llamado amplexo; esto es una señal
para que la hembra deposite los óvulos al tiempo que el macho los
baña con semen.
Lo más importante de la fecundación es que se fusionan ambos
gametos y el resultado es una célula con dos juegos de cromosomas,
uno de ellos proveniente de la madre y el otro del padre. Estas dos
copias del material genético se volverán a combinar durante la meio-
sis, y las células resultantes llevarán un solo juego de cromosomas con
características combinadas del padre y de la madre.

Aunque ya viste cómo se reproduciría tu bicho de manera asexual, haz


tu bicho
ahora imagina que se reproduce sexualmente.

• Identifica si tu bicho es un macho o una hembra. Describe las característi-


cas que lo identifican con ese sexo.

• Dibuja a tu bicho con sus características sexuales.

• Ahora imagina el sexo opuesto de tu bicho y dibújalo también.

Ventajas de la reproducción sexual y asexual

Si analizamos los dos tipos de reproducción desde el punto de vista


de la velocidad para obtener nuevos organismos seguramente con-
cluiremos que la reproducción asexual es mucho mejor. Este tipo de
reproducción permite obtener muchas generaciones de individuos en
poco tiempo. Si tomamos el ejemplo de las bacterias, que se repro-
ducen por fisión binaria, notamos que pueden tardar tan solo veinte

59

BIO2-DGB-U1.indd 59 2/21/08 11:40:21 AM


minutos en dividirse por lo que en poco tiempo tenderemos varias
generaciones de bacterias. Por lo tanto, si lo que buscamos es rapidez,
la reproducción asexual sale ganando.
Otra ventaja de la reproducción asexual es que se invierte muy
Unidad 1 Reproducción y herencia

poca energía, ya que no es necesario producir gametos, muchos de


los cuales se desperdiciarán y no originarán nuevos organismos. Por
lo tanto es mucho más eficiente que la sexual.
También resulta ventajoso que para reproducirse asexualmente el
organismo no necesite buscar y encontrar a otro individuo de su mis-
ma especie y de sexo opuesto, lo que también ahorra energía.
Con todas estas ventajas que aporta la reproducción asexual re-
sulta difícil imaginar porqué la Naturaleza propició el desarrollo de
la reproducción sexual. Sin embargo, resulta obvio pensar que debe
tener alguna ventaja superior, ya que la mayoría de los organismos la
llevan a cabo, al menos en alguna etapa de su vida. Esta ventaja radica
en la alta probabilidad de originar organismos con características ge-
néticas únicas dentro de su especie, lo que se logra gracias a la recom-
binación de genes que sucede durante la meiosis. Este evento provoca
que cada gameto que se produce lleve cromosomas con pedacitos que
provienen unos de la madre y otros del padre. Imagina que tienes un
mazo de barajas con un estilo rojo en el reverso y otro con un estilo
azul y los revuelves. Luego separas ambos mazos de barajas pero no
te fijas en el estilo del reverso de los mazos sino únicamente en tener
el mazo de cartas completo. Si revisas el reverso de cada mazo verás
que tienes unas cartas con un diseño y otras con el otro. Por lo tanto
tus mazos ahora son diferentes a los originales. Algo similar es lo que
sucede en la recombinación.

El genoma de un gameto se asemeja a un mazo


de cartas completo que tiene dos patrones
diferentes, tiene toda la información necesaria
pero con pequeñas variaciones que lo hacen
único.

60

BIO2-DGB-U1.indd 60 2/21/08 11:40:22 AM


Entonces todos los organismos producto de la reproducción sexual

2 Reproducción celular y en organismos


tienen características individuales, pero ¿para qué sirve esto? La res- conceptos
puesta se basa en el medio. Imagina un viñedo. Como ya hemos vis-
to, las plantas que lo forman son todas idénticas, ya que provienen de Variabilidad genética es la variación en
el material genético de una población
una sola que se fue reproduciendo asexualmente por acodos. Si en la que otorga muchas posibilidades de fe-
zona donde se encuentra el viñedo cambia el clima drásticamente, di- notipo.
gamos que la temperatura promedio desciende unos cuantos grados y
estas plantas no tienen la capacidad para soportar esas temperaturas,
entonces el viñedo entero morirá. Esto no es muy grave en términos
ecológicos, porque aún existirán otras plantas de vid en el planeta
que sobrevivirán y de donde se restaurará este viñedo. Pero ahora
planteemos este problema en una población natural, es muy poco
probable que una población en la que no hay variabilidad genética
sobreviva en caso de un cambio en el medio o incluso si tiene que
migrar y vivir en un lugar diferente. Es necesario entonces que entre
los individuos de una población haya pequeñas diferencias, ya que
esto les permitirá adaptarse a posibles cambios en el medio.
Entonces la reproducción sexual aporta variabilidad en una po-
blación a partir de la recombinación de los cromosomas, lo que re-
sulta de gran importancia en las poblaciones de organismos. Esto se
puede comprobar evaluando una estrategia que realizan las bacterias,
la conjugación, que revisamos el curso pasado. El objetivo de esta
estrategia es precisamente obtener variantes de los genes que ya tie-
nen las bacterias, es la forma en que ellas resuelven el hecho de no
reproducirse sexualmente.
Otro ejemplo lo podemos observar en especies hermafroditas. Un
organismo hermafrodita es aquel que tiene la capacidad de producir
gametos femeninos y masculinos. Ejemplos de estos organismos son
los caracoles, muchas plantas y algunos moluscos. Estos organismos
no suelen autofecundarse, en lugar de esto, buscan otro organismo de
su especie con quien intercambiar gametos y entonces reproducirse.
Imagina toda la energía invertida en producir los gametos como para
Aunque algunas flores produzcan óvulos y polen
desperdiciarla en una autofecundación, la variabilidad se anularía. no suelen autofecundarse.

En tu cuaderno responde las siguientes preguntas:

• ¿Cuántos gametos útiles se producen en total a partir de una célula en la


espermatogénesis? ¿Y en la ovogénesis?
• ¿Cuál es la característica principal de la reproducción sexual?
• Describe la importancia de la fecundación interna y de la externa.
• Menciona y explica la ventaja más importante que para ti tienen los dos
tipos de reproducción, la sexual y la asexual.

61

BIO2-DGB-U1.indd 61 2/21/08 11:40:26 AM


haz
tu bicho
A hora que conoces las ventajas y desventajas de la reproducción asexual y
de la sexual, decide qué tipo de reproducción tendrá tu bicho.

Imagina todo el proceso completo e ilústralo en el siguiente cuadro.


Unidad 1 Reproducción y herencia

• Describe las razones por las que elegiste este tipo de reproducción para
tu bicho.

62

BIO2-DGB-U1.indd 62 2/21/08 11:40:30 AM


3 La herencia
esto ya
En tu cuaderno escribe una reseña de los estudios de Gregor Mendel lo sabes
sobre genética y cómo fue que se interesó en ellos.

3 La herencia
Si lo necesitas, regresa a tu libro del curso anterior de Biología y com-
pleta esa información con una investigación.

Imagina que hay muchos organismos como tu bicho. haz


tu bicho
• ¿Cómo identificarías a los organismos que son hijos o hermanos? ¿Qué
características tomarías en cuenta? Descríbelo.

T odos sabemos de manera más o menos intuitiva lo que es la he-


rencia. Por ejemplo, podemos identificar a los hijos de una pa-
reja gracias a rasgos físicos semejantes. Incluso utilizamos expresiones
como “tienes los ojos de tu abuela”. También lo podemos observar en
los perros, las razas que conocemos en la actualidad son el resultado
de una selección artificial de rasgos que resultaban benéficos para
un propósito en particular, y que se fueron heredando de padres a
hijos sin perderse, hasta la actualidad. ¿Cuáles son las bases de estos
fenómenos?

Herencia mendeliana

Mendel fue el primero en descifrar las bases de la herencia utilizan-


do como modelo la planta de los chícharos e identificando caracte-
rísticas que podía reconocer con facilidad. También acuñó muchos
Tenemos conocimientos empíricos en cuanto a
términos de genética que se utilizan en nuestros días en todos los la herencia y los aplicamos cuando adivinamos
niveles. Antes de entrar en materia revisemos algunos conceptos que el parentesco.

utilizarás en este tema.

63

BIO2-DGB-U1.indd 63 2/21/08 11:40:31 AM


Recuerda que los organismos poseen células diploides y que, por
conceptos tanto, tienen dos juegos de cromosomas. Si recuerdas también que
dentro de los cromosomas están los genes, entonces puedes deducir
Alelo es una de las posibles formas de que hay dos copias de cada gen en cada una de nuestras células. Cada
Unidad 1 Reproducción y herencia

un gen.
gen puede tener diferentes formas, por ejemplo, un gen para el color
Alelo dominante es la forma de un gen de las semillas puede tener las variantes café, negro o gris, aunque
que determina el fenotipo aunque esté
sigue siendo el mismo gen. Cada forma diferente del gen se llama
junto otra forma del gen.
alelo. Cuando un organismo tiene sus dos copias de un gen con el
Alelo recesivo es la forma de un gen que mismo alelo se dice que es homocigoto para ese gen. Si por el contra-
sólo se expresa en el fenotipo cuando
dos copias están en cromosomas ho-
rio tiene alelos diferentes se dice que es heterocigoto.
mólogos. Esto es lo que sucede en un organismo heterocigoto para un gen
específico. Retomemos el color de las semillas, el organismo que
Homocigoto es una célula que tiene el
mismo alelo de un gen en un par de cro- vamos a analizar posee un alelo café y otro negro. ¿De qué color será
mosomas homólogos. la semilla? Digamos que la semilla es negra, esto indica que el alelo
negro es el dominante, es decir, que se podrá observar en el físico
Heterocigoto es la célula que tiene dos
formas diferentes de un gen en un par del organismo siempre, aún cuando esté en la forma heterocigota.
de cromosomas homólogos. Por otro lado, el alelo café será un alelo recesivo ya que cuando
se presenta en un organismo heterocigoto no es posible observarlo,
aunque esté presente en los genes del individuo. Si te das cuenta
estamos considerando las características físicas visibles y las carac-
terísticas genéticas de los organismos. Las características físicas se
conocen con el nombre de fenotipo, y son el resultado de los genes
en las células de un individuo y de la interacción con el ambiente.
Por otro lado, a las características genéticas se les llama genotipo y
es el resultado de los genes que tiene una célula y que provienen de
ambos padres.
Ahora, revisemos los experimentos y conclusiones de Mendel. Tra-
bajó con la planta de chícharos que presenta varias ventajas, entre
ellas que es barata, produce mucha descendencia y se autofecunda.
Esta última ventaja permite que quien trabaje con ella obtenga razas
puras, es decir, organismos cuyos descendientes presentarán sus mis-
mas características. Pero también se puede evitar que se autofecunde
si se cortan los estambres de las flores, donde se produce el polen, y
se pueden fecundar con el polen que se decida. Esto fue lo que hizo
Mendel, las dejaba autofecundarse o las fecundaba según lo que qui-
siera investigar.

haz Elige una característica para tu bicho, digamos el color de la piel o de


tu bicho
los ojos, la estatura, o lo que tú quieras.
Ahora determina dos formas posibles, por ejemplo dos colores dife-
rentes.
Estas formas que se pueden observar en tu bicho son el fenotipo.

64

BIO2-DGB-U1.indd 64 2/21/08 11:40:36 AM


Mariana Martínez Pelayo
Fernando García Hernández

1
Biología 2
1 La evolución biológica de los seres vivos, y su continuidad en una evolución cultural de
los seres humanos hasta lograr dar cuenta de la responsabilidad de sobrevivir y preser-
var su hábitat, son temas de reflexión en Biología 2.

Biología 2
La evolución cultural del ser humano como máxima expresión de los obstáculos
biológicos y sociales que ha enfrentado en sus doce mil años de existencia también es
materia de estudio de la biología. Es la convergencia del esfuerzo mental y físico de
hombres y mujeres que dieron sentido a su propia existencia; es el punto más álgido
del trabajo conjunto con conciencia de sí.
Los autores esperan que el contenido de este libro trascienda los muros escolares, y
que los jóvenes logren hacerlo parte de su concepción de mundo para que participen
con todos los hombres y mujeres que los precedieron, bajo la perspectiva de ser la
máxima expresión de la evolución de la vida en su planeta.

BACHILLERATO

Elaborado según la Reforma curricular


con un enfoque educativo centrado
en el aprendizaje.

Biologia 2 DGB cover.indd 1 2/18/08 1:51:43 PM