Está en la página 1de 375

a

autoridades
)
Rector: Dr. Luis Mara Desimoni
Vicerrector: Comisario Gral. (r) Lic. Carlos Daniel Musso
Decano de la Fac. de Cs. Jurdicas y Sociales: Dr. Horacio Aracama
Secretario Acadmico: Dr. Hugo Mndez.
Secretario Administrativo: Comisario Gral. (r) Angel Juan Antonio Ramrez
(
(
(
(
(
(
(
(
(
(
educacin a distancia
icd
investigacin cientca del delito
Autor: Lic. Juan Carlos Alegretti
Asesora de Diseo didctico: Dra. Claudia Cristina Burgos
Diseo Grco: Mariela Acorinti y Ariel Ballart
Diagramacin: Gabriela del Carmen Garcia
Correctora Jurdica y de Estilo: Dra. Mara Alicia Muract Gola
Directora del Programa Educ. a Distancia: Dra. Mara Evangelina Trebolle
(
(
(
(
(
(
(
(
(
(
t1
) (
(
(
5
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( CARTA AL ALUMNO )
De la misma manera que lo hago en las ctedras presenciales me presento
ante Ustedes. Soy el Licenciado en Criminalstica Juan Carlos ALEGRETTI, a quien
se le ha otorgado el privilegio de dictar una materia tan variada como fascinante:
Investigacin Cientca del Delito. A travs de la presente deseo brindarles la ms
cordial bienvenida a un nuevo ciclo lectivo
El contenido de la materia comprende el conocimiento de una disciplina tc-
nico cientca, la Criminalstica, desde sus tres puntos de accin: la Investigativa, la
Pericial y la Prevencional.
Soy plenamente consciente que el carcter de esta rama del conocimiento hu-
mano dada su rigidez tcnico cientca, escapa a los cnones del resto de las mate-
rias de la carrera que han emprendido. Sin embargo su conocimiento presenta, en la
prctica profesional, tan importante interrelacin y aporta tantos auxilios, que no slo
se hace interesante su profundizacin, sino que lo transforma en imprescindible.
Su desarrollo no tiene como meta el aprendizaje del accionar criminalstico peri-
cial, ya que no es objeto temtico de Abogaca ni sera posible esbozarlo en el escaso
tiempo destinado. Slo pretende brindar una cosmovisin integral de los aportes que
puede brindar esta disciplina, no slo en el cumplimiento de la difcil tarea del ejercicio
del derecho, sino en un sentido mucho ms amplio, ya que sus alcances permiten su
utilizacin en la vida cotidiana domstica.
La Criminalstica aporta sus conocimientos para el cumplimiento de su fundamental
tarea que es la determinacin de la verdad sobre los mecanismos de produccin de los
hechos, sean stos delictivos o no, con el n de que aquel que tenga a su cargo impartir
justicia pueda hacerlo en forma imparcial dando a cada uno lo que le corresponde, ya que
a travs de los testigos mudos o cosas dejadas en el lugar de su concrecin o de aquel-
las con las que se ha materializado y a travs de la objetividad cientca de sus mtodos,
se puede arribar a la tan ansiada verdad que ha sido, es y seguir siendo la tarea ms
dicultosa para la resolucin de los conictos provocados por el hombre.
6
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Invoco la proteccin de Dios para que las partes comprometidas en esta tarea,
Uds. como receptores de la informacin aportada y yo como gua, podamos cumplir
las metas jadas y que con el futuro desempeo de los nuevos profesionales veamos
coronados todos los esfuerzos que a ambas partes nos ha signicado, el empren-
dimiento de una tarea que implica tantos compromisos como satisfacciones por el
deber cumplido.
Los invito a que conozcan una disciplina cientca que, no solo aporta en el desem-
peo profesional as como en el diario vivir, una serie de facilidades para afrontar un mundo
globalizado, cruel, difcil, pero a su vez magnco para ser vivido y disfrutado en toda su
magnitud.
Cordialmente.


Licenciado Juan Carlos ALEGRETTI Licenciado Juan Carlos ALEGRETTI
7
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( CURRICULUM VITAE )
Nombre y Apellido: Juan Carlos ALEGRETTI
Nacionalidad: Argentina
Lugar y fecha de Nacimiento: en Capital Federal, el 20 de Febrero de 1949
Profesin: l Licenciado en Criminalstica U.B.A.
l Comisario (r) Polica Federal Argentina
l Profesor
l Ex Presidente de la Asociacin Criminalstica Argentina (ASCRA)
l Ex Instructor Sumario Administrativo en Procuracin del Tesoro de la
Nacin.
Desde el ao 1998 se ha desempeado como titular de ctedra en diferentes asignaturas en
las facultades de Ciencias Criminalsticas, Ciencias Jurdicas y Sociales y Ciencias de la Seguridad,
todas ellas del Instituto Universitario de la Polica Federal Argentina.
Desde el ao 1981 se ha desempeado como docente en las diferentes escuelas de la
Polica Federal Argentina tales como: Escuela Federal de Polica; Academia Federal Superior; Es-
cuela de Informaciones de la Superintendencia de Interior; Cursos en las divisiones Scopometra
y Balstica de la Superintendencia Cientca y en otros Institutos Privados y Estatales.
l Ao 1976: 10 Curso Especial Antisubversivo en la Divisin C.A.P.E. de la Polica 10 Curso Especial Antisubversivo 10 Curso Especial Antisubversivo
Federal Argentina.
l Ao 1977: Curso Instructor de Tiro en el Departamento Escuela de Tiro de la Super- Curso Instructor de Tiro Curso Instructor de Tiro
intendencia de Instruccin.
l Ao 1980: Curso de Perfeccionamiento para Graduados sobre Criminologa y Psico-
patologa Criminal, dictado por el Ministerio de Bienestar Social, Direccin de Salud
Mental, Centro Arturo Ameghino.
l Ao 1983: a) Curso de Fotografa en el Foto Club Buenos Aires. Curso de Fotografa Curso de Fotografa
b) Curso Investigacin de la Muerte en la Divisin Homicidios Curso Investigacin de la Muerte Curso Investigacin de la Muerte de la
Superintendencia de Investigaciones Criminales.
Cursos realizados
Actividades docentes
8
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
l Aos 1984/85: a) Curso de Grafopsicologa aplicada a Investigaciones en la Escuela en la Escuela Curso de Grafopsicologa aplicada a Investigaciones Curso de Grafopsicologa aplicada a Investigaciones
Nuevas Tcnicas Psicolgicas.
b) Curso de Perfeccionamiento Docente sobre Grafologa Cientca y Curso de Perfeccionamiento Docente sobre Grafologa Cientca y Curso de Perfeccionamiento Docente sobre Grafologa Cientca y
Test Proyectivos en Escuela Nuevas Tcnicas Psicolgicas. Test Proyectivos Test Proyectivos
l Ao 1991: Curso de Perfeccionamiento Docente en la Academia Federal Superior. Curso de Perfeccionamiento Docente Curso de Perfeccionamiento Docente
l Ao 1993: Curso sobre Derecho Procesal Penal, Nuevo Cdigo y Juicio Oral en la Curso sobre Derecho Procesal Penal, Nuevo Cdigo y Juicio Oral Curso sobre Derecho Procesal Penal, Nuevo Cdigo y Juicio Oral
Universidad del Salvador.
l Ao 1994: Curso sobre La Defensa Nacional en el Ao 2000. Temario: Globalismo y Region-
alismo; Economa, Ciencia, Tecnologa y Medio Ambiente; Derecho y Legislacin; Estado y
Defensa, dictado por la Universidad de Buenos Aires, Facultad de Derecho y Ciencias Sociales
y por el Instituto Universitario de Estudios Navales y Martimos de la Armada Argentina.
l Ao 1995: Curso de Postgrado en Capacitacin Docente dictado en el Instituto Uni- Curso de Postgrado en Capacitacin Docente Curso de Postgrado en Capacitacin Docente
versitario de la Polica Federal Argentina.
l Ao 1997: Curso de Capacitacin en Procedimiento Disciplinario dictado por la Escuela del Curso de Capacitacin en Procedimiento Disciplinario Curso de Capacitacin en Procedimiento Disciplinario
Cuerpo de Abogados del Estado de la Procuracin del Tesoro de la Nacin.
l Aos varios: Curso Superior Avanzado de Idioma Ingls, Nivel Conversacin en el Curso Superior Avanzado de Idioma Ingls, Nivel Conversacin Curso Superior Avanzado de Idioma Ingls, Nivel Conversacin
Instituto Universitario de la Polica Federal Argentina.
Desde el ao 1972 hasta la fecha ha participado como disertante, orador, organizador,
moderador, concurrente, asistente, etc. en Seminarios, Congresos, Conferencias y Jornadas de la
especialidad, organizadas por Instituciones Pblicas y Privadas, Organismos de los tres Poderes
Constitucionales y Sociedades Cientcas, tanto en el pas como en el exterior.
ASOCIACION CRIMINALISTICA ARGENTINA (ASCRA): Por eleccin de sus socios, en
Asamblea Electoral fue designado Presidente en el ao 1986 hasta 1997.
FUNDACION VIDA: Es Miembro Asesor de la Fundacin Vida (Resolucin I.G.J. n 1044),
en el programa Prevencin en Drogadependencia y Orientacin del Menor.
Fue representante permanente de la Polica Federal Argentina en Cuestiones Criminalsticas.
Designado Institucionalmente como asesor y conferencista en diversos Organismos e Instituciones,
tales como Ejrcito Argentino, Prefectura Nacional, Registro Nacional de Propiedad del Automotor,
Registro de las Personas, etc.
Seminarios -congresos -conferencias -jornadas
Otras actividades
Otras representaciones
9
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Por disposicin Institucional en 1981 grab en video-caset, con nes de instruccin en Aca-
demias de Personal, Conferencia-Debate sobre diferentes temas penales.
Designado institucionalmente para conferencias y entrevistas periodsticas sobre temas
Criminalsticos, especialmente sobre papel moneda nacional y extranjera. En Televisin: para
Nuevediario, Telenoche, etc.; en Radios: para Rapidsimo, Cordialmente, etc.; en Prensa
Escrita: para Clarn, etc. Adems participacin en programas de Inters General con participacin
de paneles pblicos, como Con Ustedes, conducido por Fernando Bravo.
Publicacin de artculos de carcter Criminalsticos, especialmente sobre autenticidad de
papel moneda nacional y extranjera (pases integrantes del Mercosur, Estados Unidos de Norte
Amrica y Euro) y sobre documentos de identidad en Proteccin & Servicios, Ombudsman
y Baluarte.
Actuacin profesional como perito ocial y/o de parte en actuaciones judiciales y ex-
trajudiciales, para particulares y empresas, en pericias Documentolgicas, Balsticas, Acciden-
tolgicas y de Rastros.
Conferencias grabadas en video-caset
Conferencias en medios de difusin pblica
Publicaciones escritas
Como Perito ocial y de parte
10
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
11
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos generales de la materia
om abogaca a distancia
)
l Dimensionar los conceptos de: Informacin, Conocimiento Global y Conocimiento
Cientco; y la forma de adquisicin de stos: Emprica, Inductiva, Deductiva.
l Clasicar las Ciencias segn su Objeto, Enunciado y Mtodo. Precisar el alcance del Lenguaje
Cientco y los trminos de que puede valerse para sus enunciados.
l Comprender los elementos y las interacciones de todo Proceso Semitico y los niveles que
regulan el lenguaje de signos.
l Conocer los alcances de la disciplina Crininalstica. Su evolucin histrica, orgenes y precur-
sores. Grandes captulos que la comprenden y el alcance de su accionar, para que pueda
ser utilizada por los Abogados en el ejercicio de su profesin.
l Delimitar su actuacin con las de otras disciplinas como la Criminologa y la Medicina Legal,
analizando brevemente el objeto temtico de cada una de ellas.
l Detallar los contenidos, componentes y alcances de un Informe Pericial, a n de comprender
los requisitos legales para actuar como perito, sus diferentes roles, su accionar individual
y conjunto, el anlisis del Objeto Pericial y la importancia de su redaccin; el detalle de los
Elementos Dubitados e Indubitados aportados para estudio; los anlisis, estudios y formali-
dades tcnicas y reglamentarias que diferencian la actuacin del perito con la del testigo y
los tipos de conclusiones a las que se puede arribar.
l Detallar los recaudos legales y prcticos a cumplimentar en el Retrato del lugar del Hecho
o Inspeccin ocular, en la preservacin del lugar, prioridades, documentacin, ubicacin,
levante, conservacin, recaudos legales, transporte y precauciones a tomar con los indicios
o testigos mudos hallados en el lugar.
l Precisar el concepto de Identidad Humana y conocer los principios bsicos que sustentan
los sistemas de Identicacin que, uno en forma directa y varios en formas indirectas, per-
mite a travs de elementos probatorios o de indicios demostrar la presencia de una persona
determinada en esa escena o en esos elementos vinculantes.
l Indicar los conceptos loscos y tericos que permiten la comprobacin de autora
o no, en manuscritos o rmas.
l Introducir al futuro profesional en el conocimiento de las peritaciones y comprobaciones que
pueden realizarse sobre escrituras mecnicas o tipogrcas, realizadas con mquinas de
escribir, impresoras, fotocopiadoras y fax.
12
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
l Conocer las medidas de seguridad documental en papeles, tintas, sistemas de impresin y
generales que se realizan sobre cualquier tipo de soporte, a n de reconocer falsicaciones
y adulteraciones.
l Conocer las medidas de seguridad implementadas en los billetes papel moneda nacional y
sus representativos, en dlares y otros pases donde se utilizan billetes polmeros.
l Conocer las medidas de seguridad en tarjetas de crdito, documentos de identidad, creden-
ciales, chapas patentes, etc., por su signicancia en su accionar profesional.
l Conocer los lineamentos de la intervencin pericial balstica, desde sus divisiones: interior,
exterior y de efectos. Sealar las caractersticas que permiten la identicacin del arma
utilizada a travs el proyectil y la vaina secuestrada, como asimismo el establecimiento de
distancias de disparo, trayectorias, oricios de entrada y salida, etc.
13
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
pa
presentacin de la asignatura
abogaca a distancia
)
La naturaleza determinantemente social del hombre lo precondiciona a vivir en socie-
dad, ya que slo a travs de ella logra crecer y desarrollarse. Esto ha sido omnicomprendido
desde tiempos remotos, donde para enfrentarse a las pulsiones hostiles del medio, a las
inclemencias del tiempo y para satisfacer sus necesidades bsicas de alimento, vivienda y
proteccin, ha debido nuclearse y conformar pueblos, ciudades y pases. As logr, en base
a la observacin y la experimentacin, signicativos avances y una gran evolucin no slo
de la especie sino tambin de su hbitat, aunque el costo ha sido a veces excesivo.
El devenir del tiempo sigue demostrando esa necesidad societaria. La globalizacin
en general y las integraciones internacionales tales como la COMUNIDAD EUROPEA, el
NAFTA y el MERCOSUR, etc. en particular, lo conrman cotidianamente y son ejemplos
orgnicos de esta esencial necesidad humana.
Desde siempre, las relaciones entre los hombres son y seguirn siendo origi-
nadoras de conictos. Cuanto ms heterogneas son las sociedades, ms hiptesis
de conictos presentan. Si bien su gnesis es muy variada, gran parte de los mismos
son provocados por las anmalas relaciones comerciales, donde el endiosamiento
mercantil capitalista cree justicar doctrinas egostas, individuales o grupales que,
para conseguir ventajas, no dudan en recurrir a acciones marginales o criminosas.
La adopcin de oportunas medidas cautelares de prevencin suele paliar estas cir-
cunstancias, pero en muchos casos se debe recurrir a planteamientos judiciales ante
fueros nacionales o internacionales para su dilucidacin.
Desde las primeras conformaciones clnicas o tribales hasta nuestros das, quienes
debieron o deben administrar justicia (jefes de tribus, consejos de ancianos, jueces) han
necesitado, necesitan y necesitarn la determinacin de LA VERDAD, es decir conocer
la realidad de la produccin de los hechos para poder, en forma imparcial, dar a cada uno
lo que le corresponde ya sea castigando o resarciendo. Para lograr la verdad, el hombre
ha utilizado diversos mtodos -cuya revisin histrica ser detallada en la unidad corre-
spondiente- hasta llegar a la Criminalstica, cuya denicin, objeto, alcances y mtodos
sern objeto temtico de esta materia.
Como anticipo diremos que la Criminalstica permite el asesoramiento integral sobre
la conformacin de la prueba material especca para cada caso y frente a cada indicio,
14
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
a los que se han denominado testigos mudos, con la resolucin de los interrogantes
periciales que estos presenten; la valoracin de los aciertos o deciencias de las pruebas
obrantes en las causas; la redaccin de interrogatorios a peritos o testigos con respecto a
dichas pruebas materiales; la valoracin y en su caso la impugnacin de peritaciones no
basadas en comprobaciones tcnicas o cientcas; el contralor de las pruebas cumplidas
y a cumplimentar tanto en hechos judiciales como extrajudiciales, todo ello a travs de las
cinco ramas en que se puede englobar su actividad.
Ofrece un amplio campo contributivo que no todos han logrado advertir, recur-
rindose a ella y a sus peritos slo en acontecimientos extremos o espordicos desap-
rovechando as una asistencia que puede ser determinante y que es aplicable en casi
todos los rdenes de la vida y no solamente en el campo litigioso, sino fundamental-
mente en la faz preventiva, tanto en seguridad documental como en la valorizacin de
actos o procedimientos, debindose recurrir a ella no slo despus de un hecho, sino
antes. Es til tener presente que tanto en SALUD como en SEGURIDAD es mejor y ms
econmico PREVENIR QUE REMEDIAR.
15
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
oa
organizacin de la asignatura
abogaca a distancia
)
La asignatura se encuentra organizada en diferentes unidades. Cada una de ella
nos introduce de manera conceptual y siguiendo un orden sistematizado, a los diferentes
contenidos que en virtud del tiempo asignado para su desarrollo (un cuatrimestre), se consid-
eran de importancia en cuanto a su conocimiento por parte del futuro profesional abogado,
ya que la Criminalstica aporta todo su bagaje tcnico y cientco para el esclarecimiento
del hecho una vez que este ha sido cometido, a travs del hallazgo e interpretacin de los
testigos mudos, y para la adopcin de medidas de seguridad prevencionales que diculten
el accionar avasallante de aquellos que hacen del delito su medio natural de existencia.
LA UNIDAD I: Tiene como objeto introducirnos dentro de un mundo de objetividad
cientca, demarcando la importancia de un lenguaje que puede y debe ser entendido
por conocedores y legos.
LA UNIDAD II: Nos introduce al conocimiento de la Criminalstica, sus alcances y dife-
renciaciones con otras disciplinas relacionadas. Asimismo nos demuestra la rigidez con
que debe expresarse el perito a travs de su informe a n de cumplir su cometido, pun-
tualizando las virtudes y falencias que deben mensurarse para solicitar explicaciones y/o
solicitar su impugnacin.
LA UNIDAD III: Detalla las formas y precauciones a tenerse en cuenta en la realizacin
de la Inspeccin ocular del lugar del hecho a n de encontrar y preservar los indicios.
Detalla las reglas que deben cumplimentarse en su ejecucin fctica y en toda actividad
criminalstica.
LA UNIDAD IV: Nos introduce en la problemtica de la Identidad Humana, dando un
escueto panorama de los diferentes recursos indirectos y directos con que es posible
establecerla.
LA UNIDAD V: Seala los basamentos tcnicos y cientcos que permiten la realizacin
de pericias sobre escrituras mecnicas realizadas con mquinas de escribir, hasta las
realizadas con impresoras de ltima generacin, con fotocopiadoras y fax.
LA UNIDAD VI: Lo hace con relacin a las pericias sobre manuscritos y rmas a n de
establecer paternidad escritural o no.
LA UNIDAD VII: Detalla, dentro de la criminalstica prevencional, las medidas de seguridad
sobre papeles, tintas, sistemas de impresin e impresiones.
16
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
LA UNIDAD VIII: Detalla las medidas de seguridad en documentos y billetes de moneda
nacional y extranjera y sus representantes.
LA UNIDAD IX: Nos introduce al mundo de la balstica desde sus conceptos globales.
Interior, exterior y de efecto.
A su vez cada unidad especca, desarrolla su contenido y sugiere bibliografa a leer.
17
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
oa
orientacin general del aprendizaje
abogaca a distancia
)
Tal como habr comprendido, esta materia es netamente tcnica y se aparta
de los contenidos de las dems materias, donde el objeto de estudio es el derecho
desde las diferentes pticas en que debe ser contemplado.
Sin embargo su interrelacin es cada vez ms estrecha, ya que se convierte en
una importante fuente para la obtencin de las formas y mecanismos de produccin
de los hechos que son analizados en cualquiera de sus diferentes ramas.
Conocer el abanico de posibilidades que ofrece la disciplina Criminalstica en
auxilio del derecho, brinda la posibilidad de su utilizacin para el esclarecimiento de
los hechos, la identicacin de los autores y la conformacin de la prueba material.
A travs de un supercial panorama permite primero conocerla y luego: saber
que es posible recurrir a ella en cualquier momento o etapa de sustentacin de una
causa; entender la importancia de su consulta antes de la redaccin de los interrogantes
periciales; de las funciones que cumplen y cmo, en la prctica, se desenvuelven los
peritos, para poder mensurar adecuadamente en cada caso, la necesidad o no de
recurrir a ellos como expertos de parte o consultores tcnicos; cmo pueden reali-
zarse los pedidos de explicaciones y en su caso qu es lo que se puede impugnar
de sus actuaciones; comprender las bondades que aporta la valoracin del estado
de las causas desde una ptica tcnica: visualizar lo casi ilimitado de su accionar, en
cuanto a posibilidades; etc.
Lo importante de la tarea emprendida es, en denitiva, conocer un poco del
mundo criminalstico porque es realmente til en el ejercicio de la abogaca y no por
la necesidad fctica de cumplimentar con un nmero de materias predeterminado
para obtener un ttulo.
Los temas seguramente le interesarn. Si es as trate de indagar lo ms que pueda
sobre ellos recurriendo a la diferente bibliografa aportada como obligatoria y sugerida.
Estoy seguro que lo que comienza como una obligacin se transformar en una pasin
no slo graticante, sino que le aportar gran utilidad profesional.
18
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Si bien su desarrollo ser desde la ptica criminalstica, el enfoque que debe
drsele es siempre desde el punto de vista prctico, es decir los aportes que pueda
brindar al ejercicio de la profesin y los ataques que puedan ser inferidos desde el
cumplimiento de los diferentes roles que el abogado puede ejercitar, dentro del pro-
ceso litigioso.
La informacin brindada debe ser racionalizada, valorada, en algunos casos
profundizada y luego asimilada como conocimiento. Para ello se hace imprescindible
la constante y fecunda labor intelectual que debe desarrollar el alumno, a travs de la
lectura de los diferentes temarios del manual y de las bibliografas aportadas como
obligatorias y optativas, promoviendo consultas y frecuentes dilogos por cualquier va
con el titular de la ctedra, para visualizar los temas en particular y en conjunto.
Las lecturas obligatorias, los ejercicios de comprensin y los trabajos prcticos
que se deban desarrollar, sern taxativamente detallados en cada unidad temtica,
debindose remitir aquellos que se especiquen, sin que ello impida la remisin de cu-
alquier otro trabajo que por decisin propia se pueda realizar sobre el temario tratado,
como una tarea de autoaprendizaje.
Las evaluaciones tiene como tarea fundamental comprobar el grado de
asimilacin y racionalizacin del amplio temario tratado. No se busca la repeticin
sistemtica de lo visto, sino su aplicacin concreta y de la misma manera en que lo
deber encarar durante el ejercicio de la profesin que se empea en alcanzar.
Ello requiere que se le dedique el tiempo y el esfuerzo necesario (los que de-
pendern de cada alumno en particular), teniendo en cuenta que slo l puede realizar
esa tarea, pero sabiendo que el soporte didctico est siempre a su disposicin y que
no slo puede, sino que debe ser utilizado en forma permanente.
Es el alumno quien tiene la visin de todas las materias que cursa o ha cursado.
La aplicacin de esta disciplina es para todas y cada una de ellas. Trate de interrela-
cionarla; sugiera nuevos emprendimientos; canalice todos sus conocimientos tras el
mismo objetivo: el mejor desempeo de las tareas que pronto deber ejercer. Recuerde
que todo lo que aprenda ser para siempre su mejor patrimonio y que en este nuevo
orden tecnolgico nunca se termina de aprender ni se sabe lo suciente.
19
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
pr
programa
abogaca a distancia
)
Concepto de Conocimiento Global y Conocimiento Cientco. Caracteres del conocimiento
Cientco. Clasicacin de las Ciencias segn su objeto, enunciado y mtodo. Ciencias fcticas
y formales. Lenguaje cientco. Semitica. Proceso semitico. Niveles de anlisis.
Evolucin de los medios de prueba. Criminalstica, orgenes, objeto y precursores Grandes
captulos que la comprenden. Su relacin con otras disciplinas en la conformacin de la prueba
material. Concepto de Medicina y Medicina Legal. Concepto de Criminologa y principales escuelas.
Informe pericial. Partes constitutivas.
Inspeccin Ocular. Importancia, oportunidad y metodologa. Tcnicas en el lugar del hecho.
Hallazgo, levantamiento, conservacin, remisin y recaudos legales sobre rastros y elementos
indiciarios. Diferencia entre prueba testimonial y prueba material. Reglas de Marchessau.
Identidad Humana, concepto y antecedentes. Medios directo e indirectos de establecerla.
Papiloscopa: fundamentos. Dactiloscopa: topografa del dactilograma, tipos fundamentales y no-
menclatura. Puntos caractersticos. Requisitos para establecer identidad dactiloscpica. Huellas,
rastros y manchas, su importancia en la identicacin humana.
Pericias mecanogrcas. Distintos tipos. Mquinas de escribir: tradicionales y electrni-
cas. Impresoras: de impacto, de chorro a tinta y lser. Identicacin de la mquina utilizada.
Pericias sobre fotocopias. Distintos tipos de fotocopiadoras. Proceso de fotocopiado. Fax.
Distintos tipos.
Unidad 2
Unidad 3
Unidad 4
Unidad 5
Unidad 1
20
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Pericias manuscritas. Aprendizaje de la escritura. Esenciales constitutivas de personalidad
grca. Principios scopomtricos sobre elementos dubitados, indubitados y conclusiones. Identi-
cacin de escrituras y rmas. Historia grca. Cuerpos de escritura.
Seguridad documental. Papeles, diferentes clases. Papeles con certicacin de origen, de
emisin controlada y de emisin registrada. Tintas, distintos tipos. Sistemas de impresin: offset,
calcogrco, tipogrco y computacional o electrostticos. Medidas de seguridad documental.
Distintos tipos y usos.
Caractersticas de seguridad en papeles, tintas e impresiones del papel moneda nacional en
todos los valores en circulacin. Caractersticas de seguridad del papel moneda dlares estadoun-
idenses en todos los valores y tipos. Prevencin sobre falsicaciones de billetes. Billetes polmeros.
Pericias Balsticas. Armas propias e impropias. Balstica interior, exterior y de efecto. Con-
cepto de celosidad de un arma. Nociones sobre identicacin de las armas de fuego a travs del
proyectil y/o la vaina secuestrada. Calibres. Distancias de disparo. Determinacin de Impactos.
Trayectorias. Utilizacin de lser para la determinacin de la ubicacin del tirador. Identicacin de
herramientas.
Unidad 6
Unidad 7
Unidad 8
Unidad 9
21
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA ASIGNATURA )
INFORMACIN Y CONOCIMIENTO GLOBAL
CARACTERES DEL CONOCIMIENTO CIENTFICO
CLASIFICACIN DE LAS CIENCIAS
LENGUAJE Y TRMINOS CIENTFICOS
INTRODUCCIN A LA SEMITICA
ELEMENTOS DEL PROCESO SEMITICO
NIVELES SEMITICOS
CONOCIMIENTO
EVOLUCIN DE LOS MEDIOS DE PRUEBA
CONCEPTO, ORGENES Y PRECURSORES
GRANDES CAPTULOS QUE LA COMPRENDEN
APORTES SEGN SU FUNCIN
SU RELACIN CON OTRAS DISCIPLINAS
IMPORTANCIA EN LA CONFORMACIN DE LA
PRUEBA MATERIAL
FORMAS DEL INFORME PERICIAL
RETRATO DEL LUGAR DEL HECHO
RECOLECCIN Y GUARDA DE TESTIGOS MUDOS
REGLAS DE PROCEDIMIENTOS TCNICO
C. INVESTIGATIVA
CRIMINALSTICA
22
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
IDENTIDAD HUMANA
SISTEMAS DE IDENTIFICACIN HUMANA
MEDIOS INDIRECTOS Y DIRECTO
IDENTIFICACIN DE ESCRITURAS MECNICAS
IDENTIFICACIN DE MANUSCRITOS Y FIRMAS
BALSTICA EN GENERAL
C. PERICIAL
MEDIDAS DE SEGURIDAD EN PAPELES
SISTEMAS DE IMPRESIN
TINTAS SEGURIDAD
MEDIDAS DE SEGURIDAD DOCUMENTAL
MEDIDAS EN PAPEL MONEDA NACIONAL
MEDIDAS DE SEGURIDAD EN PAPEL MONEDA
EXTRANJERO
C. PREVENCIONAL
23
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
u1
unidad uno
investigacin cientca del delito
) (
25
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD I
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Concepto de informacin. Su canalizacin a travs de los sentidos.
2. Concepto de conocimiento: global y cientco.
3. Caracteres del conocimiento cientco.
4. Clasicacin de las ciencias segn su: objeto, enunciado y mtodo.
5. Concepto de hiptesis y axiomas.
6. Lenguaje cientco. Trminos lgicos, denidos e indenidos.
7. Concepto de semitica.
8. Componentes del proceso semitico. Su interrelacin.
9. Niveles de anlisis semiticos.
10. Investigacin cientca y tecnologa aplicada.
Mencin sinttica de los contenidos
26
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
27
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n Por ser la Criminalstica una disciplina tcnico cientca, se hace necesario deter-
minar y precisar en forma clara, diferentes conceptos del haber cognoscitivo humano,
diferenciando los alcances y conceptos loscos y tericos de la terminologa que se
utilizar.
n Precisar el alcance de trminos como Informacin, Conocimiento, Conocimiento
Cientco, Lenguaje y Trminos Cientcos, Rigor Cientco, etc., ya que ello le per-
mitir evaluar crticamente el accionar de los peritos quienes, como auxiliares de la justicia,
brindan importantes aportes para la determinacin de la verdad, premisa fundamental a
establecer por aquellos que tengan a su cargo la difcil tarea de impartir justicia o colaborar
con ella.
n Conocer y comprender la diferenciacin existente entre objetos, enunciados y mtodos de
vericacin formales y fcticos, que permiten la utilizacin de distintos procedimientos para
arribar a conclusiones de esas caractersticas.
n Precisar el contenido de Semitica, sus alcances, componentes del proceso semitico y sus
niveles, con el n de lograr la correcta interaccin comunicativa no slo dentro del quehacer
profesional especco, sino en cualquier orden.
n Sealar los benecios del conocimiento cientco aplicado en la investigacin de un
hecho y el uso de la tecnologa derivada del mismo.
28
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
29
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD I )
CONOCIMIENTO
Sentidos: medios de comunicacin.
Informacin: estmulo primario de carcter nito.
Conocimiento: informacin procesada y archivada.
Conocimiento Emprico: de aprendizaje experimental.
Conocimiento Inductivo: pasivo por observacin y repeticin.
Conocimiento Deductivo: intelequia interna y racional.
Conocimiento Cientco: especializado y rigido por normas.
Lenguaje Cientco: funcin informativa de carcter rgido.
Objetos Fcticos o Reales y Formales o Ideales.
Enunciados Relacionando Objetos Concretos o Ideales.
Mtodos Vericales o Racionales o Lgicos.
Verdad Fctica y Formal.
Semitica: Lenguaje de Signos.
Proceso Semitico: Requisito Comunicacional.
Niveles de Comprobacin.
Aplicacin Tecnolgica del Conocimiento.
30
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
31
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
Lea atentamente el primer item del Esquema Conceptual precedente. Analice cada
una de las palabras que lo conforman y teniendo en cuenta el objetivo o los propsitos que
se pretenden alcanzar en esta primera unidad, dena o circunscriba con sus palabras y sin
recurrir a ningn tipo de auxilio externo, el concepto que encierran.
Finalizada esa tarea, repita idnticos procedimientos con los restantes items.
Plasme el resultado de su trabajo en hojas de trabajo de manera que, a medida que se
introduzca en el desarrollo temtico y se vayan tratando los diferentes temas, pueda vericar
el resultado de su anlisis previo raticando aquellos que correspondiera, recticando aquellos
conforme a las diferencias obtenidas, compulsando la bibliografa obligatoria y optativa ofrecida
y sobre todo comunicndose con el tutor a n de discutir todo aquello que no termine de en-
cuadrar y/o que, segn su ptica, merezca anlisis y discusin previa, antes de asimilarlo como
conocimiento.
32
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
33
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD I )
El bagaje de informacin que, a travs de los sentidos, se obtiene en forma
constante -tanto a nivel consciente como subconsciente- es de tal magnitud que el
hombre no ha logrado desarrollar en cantidad y calidad su principal rgano, el cerebro,
de manera tal que la misma se transforme en conocimiento.
Todo el proceso necesario para el almacenaje, resguardo y recuperacin del
conocimiento implica la necesidad de tomar conciencia de que se posee. Siendo
absolutamente sinceros, honestos y modestos, debemos tener perfectamente en claro
que sabemos mucho ms de lo que creemos y que a veces, creemos saber mucho
ms de lo que en realidad conocemos.
Diariamente utilizamos o nos valemos de nuestros conocimientos para solucionar
o enfrentar las pequeas o grandes dicultades de la vida. Cuando frente a una dicultad
podemos deducir las causales que la provocan y los recursos que tenemos a nuestra dis-
posicin para solucionarlas, estamos recurriendo a todo nuestro caudal de conocimientos,
que en forma consciente o no hemos asimilado.
Cabe destacarse que dada la complejidad del tema a tratar, su desarrollo temtico
tiene como n una rpida recorrida por un mundo que, no por cotidiano, puede resultarnos
desconocido, simplemente por no haberse reparado en algunos conceptos bsicos y de
aplicacin corriente. No se intenta hacer un anlisis losco integral, slo pretende situarnos
dentro del espacio donde deberemos movernos para interpretar esta materia; hacernos dife-
renciar y precisar cmo y con qu trabajaremos y la forma en que deberemos expresarnos.
Sin duda, estamos conectados con el exterior y con los dems por medio de nuestros
sentidos. A travs de ellos estamos recibiendo Informacin en forma permanente de todas Informacin Informacin
las circunstancias que nos rodean. Pero tales datos no son sino expresiones primarias
de nuestra capacidad sensorial. Todo este caudal informativo de carcter consciente o de nuestra capacidad sensorial. Todo este caudal informativo de carcter de nuestra capacidad sensorial. Todo este caudal informativo de carcter
subconsciente se pierde si no efecta un complejo proceso neurocognoscitivo.
Introduccin
Conocimiento global y cientco
34
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Una informacin terica (datos metereolgicos) o prctica (sensacin trmica al
nivel de la piel) nos permite saber por ejemplo la temperatura alta o baja de un lugar y
momento dado. Ese dato es suciente para que se adopten los recaudos necesarios
para afrontar tales circunstancias. Una vez adoptados dejar de sernos tiles y no
necesitaremos registrarlo como conocimiento, procediendo a su descarte.
Por el contrario, si esta informacin es procesada por los canales correspon-
dientes, se asimila y se archiva en la memoria como conocimiento. Conocimiento que
formar parte de nuestro haber y que si se ha almacenado correctamente, aun depen-
diendo de diversos factores, estar a nuestra disposicin siempre.
El hombre primitivo reuni una cantidad de conocimientos que le ayudaron a
subsistir en medio de una naturaleza inhspita y an hostil. Relacionndolos entre s por
medio de la memoria, la asociacin de ideas y un cierto grado de intuicin, lleg a tener
un conocimiento emprico o adquirido por sucesivas experiencias y por la conciencia
de sus recuerdos. Posteriormente le sum todos aquellos que pudiera recibir de sus
semejantes y particularmente de sus mayores a travs del aprendizaje.
Todo este caudal de conocimiento, por haberlo recibido en forma pasiva a travs de
la observacin, repeticin o enseanza, recibe el nombre de conocimiento inductivo. Es
decir un tipo de conocimiento que desde afuera nuestro se incorpora en nuestro interior,
sin otra actividad que la de procesar informacin y almacenarla como conocimiento.
Aristteles dej planteado que el mtodo inductivo caracterizaba a las cien-
cias. A travs de minuciosos trabajos cientcos determin que la observacin de
numerosos ejemplos de un mismo tipo permite establecer una generalidad, una
ley abarcativa. Francis Bacon sostuvo que la ciencia proviene de la experiencia, la
observacin sistemtica de la naturaleza, la acumulacin de datos a n de detectar
regularidades, reiteracin ordenada de fenmenos, es decir leyes que rigen lo que al
principio pareca catico.
Pero debemos destacar que hay otro procedimiento para obtener conocimiento
y este lo es a travs del razonamiento, es decir desde nuestro interior y sin esperar
la produccin de fenmenos naturales o el recibimiento de enseanza externa. As
elaboramos informacin, sometindola a la deduccin lgica y racional dentro del
proceso cognoscitivo, este tipo recibe el nombre de conocimiento deductivo. Es un
mtodo que a travs de la lgica, se ocupa de la derivacin de enunciados a partir
de otros enunciados dados.
35
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Sea un tipo u otro, el verdadero valor losco del conocimiento se alcanza,
cuando se adquiere el estado de conciencia de poseerlo y se ubica dentro del mundo
que lo rodea y de los fenmenos naturales que en ese ambiente existen. Cuando llega
el momento en que el hombre tiene conciencia de tales fenmenos naturales, de su
repeticin, de la relacin entre unos y otros, y de que existen ciertas constantes que
se reiteran, nos encontramos sumergidos en el mundo del conocimiento global y tal
vez en los umbrales del conocimiento sistematizado o conocimiento cientco.
A lo largo de la historia de la humanidad, el paso del conocimiento emprico
al conocimiento cientco ha sido paulatino y prolongado y ha recibido en oportuni-
dades grandes impulsos, con sus consiguientes adelantos, debido a la inteligencia de
algunos hombres que han marcado hitos decisivos en el desarrollo de la aprehensin
intelectual.
Cuando los Asirios escriban sobre tablillas de arcilla con escritura cuneiforme
(forma de puntas aguzadas de echas) la posicin de los planetas y de las estrellas
y llegaron a predecir ciertos fenmenos celestes, sin saberlo estaban dando origen o
nacimiento a una ciencia, la Astronoma. Los griegos por su parte son los descubridores
de las ciencias naturales, pues aquellos primitivos sabios helnicos eran verdaderos
lsofos de la naturaleza. Thales de Mileto, Aristteles, Hipcrates, Pitgoras, etc.,
pertenecieron a esa categora de hombres que dieron gran impulso al conocimiento
cientco. Platn y Aristteles quizs fueron los primeros en plantear el problema del
mtodo cientco. Para ellos, el conocimiento basado en los conceptos surgidos de
la observacin de los hechos, reejaba la realidad. Esta posicin dogmtica no es
puesta en duda hasta el siglo XVI con Descartes quien retoma el problema del mtodo
con el n de llegar a evitar el error, instalando la duda metdica.
Actualmente entendemos el conocimiento cientco como un mtodo experi-
mental. El problema del conocimiento no puede estar separado del otro problema
quizs fundamental, el de la verdad, ya que un conocimiento falso no es conocimiento.
Pero se debe recordar que en el campo del conocimiento muchas veces se trabaja
con premisas consideradas verdaderas en un momento y que luego se demuestra que
son falsas. Debe comprenderse que, para cuando esto ocurre, esos conocimientos
ahora falsos, ya han prestado su utilidad y le han permitido dar al hombre un paso
ms en el camino al conocimiento, que como valor absoluto, seguramente seguir
siendo inalcanzable.
36
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Un ejemplo clsico, la teora de la relatividad que provoca objeciones a la teora New-
toniana de las fuerzas gravitacionales. Es clara y veraz la enunciacin de que todo cuerpo
que no se encuentra en movimiento est en un estado de reposo. Pero se hace necesario
para un rigor cientco absoluto establecer el medio donde se encuentra. En un ambiente
determinado un cuerpo esta en reposo con relacin a otro que se encuentra animado
de energa cintica. Pero ambos al ser parte de un sistema que est en movimiento,
(la tierra en sus movimientos de rotacin y translacin y el sistema solar que se mueve
en las galaxias) independientemente de sus estados individuales, se encuentran en
movimiento relativo.
E = m x c
2
donde E es energa =, m es masa y c2 es velocidad de la luz, signica
que una masa diminuta puede convertirse en una cantidad enorme de energa, circun-
stancia que fue probada con la utilizacin de la energa nuclear. En 1915 Einstein con
su teora de la relatividad expuso que la masa distorsiona el espacio tiempo de modo
que los cuerpos se inuyen mutuamente en sus movimientos.
Al establecer que la velocidad de la luz es igual en cualquier direccin, se produce
un gran desconcierto con relacin al ter, ya que la luz debera moverse ms rpido o
ms lento ya sea que vaya en igual o contraria direccin a ste. En 1905 Einstein acept
este hecho negando el ter y demostrando matemticamente que la medicin de espacio,
tiempo y masa en dos sistemas diferentes dependen de sus movimientos relativos, y que
a la velocidad de la luz, la longitud se convierte en cero, el tiempo se detiene totalmente
y la masa se torna innita.
Si bien pretender encasillar un tipo de conocimiento en forma rgida o estructurada
nos esquematizara de manera tal que quedaramos atrapados dentro de nuestra propia
rigidez ya que es imposible acotarlo, podemos en forma conceptual y didctica indicar que
el conocimiento cientco se diferencia o se especializa con respecto al conocimiento
global, cuando se cumplen inexorablemente los siguientes cuatro requisitos o caracter-
sticas que le son propias.
1. Objeto y Objetividad: Aqu se hace necesario diferenciar y conceptuar trminos. Al refer-
irnos a objeto, debemos desdoblar su signicado. Por un lado el Objeto Temtico que
hace referencia a la disciplina o al tema o materia analizada o tratada. Por otro lado reere
al Objeto propiamente dicho o cosa real o abstracta sobre la cual trabajaremos.
Introduccin a las ciencias
37
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Al referirnos a la Objetividad, la estamos diferenciando de la subjetividad, es
decir descartando la intervencin del yo. Decir que la ciencia es objetiva, signica ar-
mar que las conclusiones a las que arriba un trabajador cientco deben ser detalladas
de manera tal que sea posible individualizar el objeto propiamente dicho (dentro del
concepto de igual a si mismo y distinto a los dems); reproducir las condiciones en la
que fue llevada a cabo la investigacin o experiencia; y detallar todas las situaciones
que se hayan producido y que hagan verdaderos sus enunciados. Estos enunciados
deben estar redactados de tal manera que cualquiera pueda tomar idnticos elemen-
tos, reproducir las mismas condiciones utilizadas y realizar los mismos pasos que,
necesariamente, llevarn siempre a los mismos resultados.
Con el n de claricar los enunciados, ejemplicaremos los conceptos grca-
mente: El objeto temtico propuesto es pintar una habitacin de color azul, realizando
el trabajo entre varios. Tomada la decisin, cada uno de los trabajadores traer los
elementos con que cumplir su tarea, debiendo traer tambin la pintura de color azul.
Finalizado el trabajo se habr conseguido seguramente una habitacin recin pintada
y de color azul, aunque todas las paredes sern del mismo color azul?. Seguramente
no, porque habr inuenciado la subjetividad de los adquirentes de la pintura com-
prando el azul acorde a su gusto. Para conseguir un rigor cientco objetivo debera
haberse especicado gama de azul acorde a su longitud de ondas o bien acorde a
un color comercial, marca y partida predeterminada.
Pero hubiera bastado simplemente precisar color para obtener un trabajo igual
y objetivo?. Seguramente la respuesta ser no. Porque tambin habr inuenciado
el resultado las herramientas con que fue realizado: pincel, rodillo, esponja, etc., la
habilidad o empeo puesto en la ejecucin y la cantidad de manos aplicadas. El rigor
cientco debe especicar elementos, forma, calidad y cantidad.
2. Vericabilidad: no se pide que la ciencia sea un conocimiento verdadero, sino que el
conjunto de sus enunciados pueda ser vericado, sabiendo para ello las circunstancias que
lo hacen verdadero o falso. Efectuada la vericacin por parte de la comunidad cientca
en condiciones de practicarla, deja de ser un trabajo cientco para transformase en un
conocimiento cientco.
3. Sistematicidad: Las armaciones de la ciencia no forman un conjunto inconexo de
proposiciones, sino un sistema de enunciados vinculados entre s por relaciones lgicas,
es decir racional, ordenado, fundado y coherente.
38
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Asimismo sus pasos deben realizarse en forma total, en orden racional y lgico
y asegurando el cumplimiento de todos y cada uno de ellos.
4. Mtodo: todas las investigaciones cientcas responden a un plan previo que es el que
dirige el trabajo en el sentido de lo que se quiere encontrar y cmo hacerlo. Ese plan no
es al azar, sino que hay procedimientos predeterminados y estn regidos por pautas.
Las ciencias tienen como nalidad, mediante la explicacin y la prediccin, dar
respuestas a ciertos problemas buscando leyes generales.
El lenguaje a utilizar debe ser cientco: este lenguaje no debe ser expresivo ni
directivo, sino simplemente informativo y carente de vaguedad. Debe trasmitir informacin
a cualquiera que haya sido adiestrado para recibirla. La comunicacin cientca es po-
sible en virtud de la precisin que pretende alcanzar el lenguaje de la ciencia, precisin
que se logra mediante una clara denicin de los trminos que se van a usar y que es
a su vez, condicin para la vericacin de los enunciados. Toda ciencia madura posee,
adems de trminos que hacen referencia a individuos observables con propiedades
observables, otros vocablos que designan individuos y propiedades que se encuentran
ms all de la observacin ms o menos directa (tomo, valencia, gen, ego, masa, campo
magntico, etc.) Es decir son vocablos propios de las teoras cientcas, distintos del
lenguaje comn u ordinario.
As debemos distinguir diversos tipos de trminos. Los trminos que se introducen
por medio de deniciones se denominan trminos denidos. Con stos se designan
situaciones no descriptas o inexistentes hasta al momento. Seleccionado el trmino se
lo dene para precisar su signicado -que no puede estar contenido en otro trmino
conocido- y debe describir una condicin o situacin que ser a partir de all recono-
cida como tal. Por ejemplo: clon o clonacin: una vez denido, explicita el alcance de la
situacin, la que ser reconocida como tal.
Los que conservan su signicado habitual, se llaman trminos lgicos, es decir
son aquellos que su lectura indica un objeto o situacin determinada y conocida que no
requiere ms denicin ni aclaracin, Ej. lpiz, casa, etc. A su vez estn los trminos
indenidos o primitivos que son aquellos que no tienen signicacin estable, que pu-
eden variar y que slo se utilizan en los esquemas de enunciados. Estos deben tambin
tener una categora lgica y se usan como variables de relacin Ej. A = B.
39
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Las ciencias se dividen en Formales y Fcticas y en esta divisin se tiene en cuenta:
a) el objeto de estudio
b) el tipo de enunciados armativos de cada disciplina cientca, y
c) el mtodo por el que se verican o refutan sus enunciados.
Desde el punto de vista del objeto mientras las ciencias fcticas procuran ser
una representacin de lo real, de cosas concretas, las ciencias formales (matemtica,
lgica) no se ocupan de hechos y por lo tanto no dan informacin acerca de la reali-
dad, sino que tratan de entes ideales que slo son construcciones intelectuales que
no existen fuera de la mente de los que especulan acerca de ellos.
Desde el punto de vista de los enunciados, las ciencias fcticas se reeren a
objetos empricos o armaciones acerca de hechos concretos, en tanto que las formales
son meras relaciones entre signos.
Desde el punto de vista del mtodo, las ciencias fcticas son siempre veric-
ables con procedimientos reales, en tanto que las formales, slo es posible establecer
la verdad o falsedad por mtodos puramente lgicos, sin poder recurrir a la prueba
emprica. En las fcticas se necesita recurrir a la experiencia para poder establecer la
falsedad o verdad de sus proposiciones.
Esto nos lleva entonces a dos tipos de verdades, la verdad formal y la verdad
fctica. Una proposicin ser formalmente verdadera cuando sea consecuencia lgica
de otras proposiciones verdaderas. En cambio una proposicin ser fcticamente
verdadera cuando lo armado en ella encuentra conrmacin prctica y emprica.
El mtodo: En las ciencias formales o deductivas las proposiciones se concluyen
en forma deductiva de otras. No pueden ser probadas, pero no porque experimen-
talmente sea dicultoso o distinto, sino porque no es realmente posible. Esto es una
caracterstica especial de algunas proposiciones que las hace improbables, porque si
pudieran probarse todas las proposiciones sera imposible eludir un crculo vicioso o
una regresin al innito.
En estas ciencias se pretende que algunas proposiciones que denominaremos
axiomas sirvan como punto de partida para deducir el resto. Utilizando los trmi-
nos indenidos, denidos y lgicos se construirn esquemas de enunciados. De
Clasicacin de las ciencias
40
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
estos esquemas se eligen algunos como punto de partida, dndolos por ciertos sin
establecer su verdad o falsedad, denominndolos AXIOMAS. Razonando a travs
de ellos se obtienen enunciados que se llaman, por denicin, teoremas. Debemos
tener presente que, en todas las ciencias, slo los axiomas se toman por cierto sin
establecer su verdad.
El mtodo en las ciencias fcticas o ciencias inductivas es siempre vericable.
Esto nos permite armaciones singulares (relacionadas con un solo caso) o universales
(generalizacin a una especie o cosa). Al ser este mtodo siempre vericable, debemos
manejarnos con el concepto de hiptesis: Una HIPTESIS es un enunciado que no tiene
an establecida su verdad o falsedad, pero que se toma como punto de partida para
estudiar sus consecuencias y compararlas con lo que ya est conrmado o refutado.
La hiptesis es entonces un enunciado no vericado que una vez conrmado
dejar de ser hiptesis para ser un enunciado vericado. Los enunciados de las hiptesis
se llaman enunciados directos o bsicos.
Establecidos stos permiten un conjunto de proposiciones en el que es dable
distinguir al menos dos tipos de resultados:
a) uno que habla de un individuo o un conjunto pequeo de individuos, al que podemos
llamar muestra, y de sus propiedades (ejemplo una rata recorre un laberinto y llega a
la comida o al extirpar el pncreas a un perro ste desarrolla diabetes). A estos enun-
ciados, que llamaremos de Nivel I, corresponden a datos o casustica de la actividad
cientca;
b) el otro que habla de una poblacin global (ejemplo todos los animales sin pncreas
desarrollan diabetes) Estos enunciados los llamaremos de Nivel II y se corresponden a
las leyes de la ciencia. Segn el mtodo inductivo el Nivel II se obtiene generalizando,
haciendo vlidos para todos, en todo tiempo y lugar, las observaciones del nivel I, lla-
mado en la jerga losca base emprica o conjunto de hechos en que se sustenta
el edicio de la ciencia.
Para el conocimiento se formula un lenguaje. Este lenguaje es un sistema de
signos formado por determinados elementos bsicos y por reglas que los regulan. La
SEMIOTICA es la disciplina que estudia los signos, la teora general de los signos y
los sistemas de signos. Esto conlleva un Proceso de SEMIOSIS. Este proceso posee
varios trminos denidos:
Concepto de semitica
41
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
SIGNO: todo aquello que reere, signica o representa otra cosa. Es un ideograma o
dibujo representativo. Ej. sonido del timbre, bandera. (Es un Dibujo)
DESIGNADO: aquello referido o designado por el signo. Es decir es el objeto o cosa rep-
resentado por el signo. (Es un Objeto o cosa)
INTRPRETE: el sujeto para el cual el signo signica o representa algo. (Es una Persona)
INTERPRETANTE: la respuesta ofrecida por parte del intrprete o la disposicin a respond-
er de determinada manera por haber captado el signicado del signo. (es una Accin)
CONTEXTO: las circunstancias en que se dan las relaciones. (Es la Armona)
Se puede ensayar una denicin o interpretacin de este proceso diciendo
que el mismo se cumple cuando: El Interprete (una persona) ejecuta el Interpretante
(accin) dentro de su Contexto (en forma correcta o armnica a los nes deseados) al
reconocer al Designado (objeto) a travs de su Signo (ideograma).
Para lograr una comunicacin armnica, se hace necesario que esta disciplina veri-
que el cumplimiento de anlisis indispensables (no nicos ni excluyentes) de tres elementos
propios del proceso semitico.
PODEMOS DISTINGUIR TRES NIVELES:
l SINTAXIS: considera la relacin entre los signos sin tener en cuenta sus signicados
y la relacin con el intrprete. Es decir slo trata las relaciones armnicas entre signos,
para que estos puedan interrelacionarse entre s de manera comprensible, ordenada y
lgica.
l SEMNTICO: considera la relacin de los signos con los designados. Aqu el anlisis
es para que cada signo slo represente a un designado encuadrndolo dentro de un
signicado exclusivo y excluyente.
l PRAGMTICO: estudia la relacin de los signos con los intrpretes.
Niveles de analisis semiticos
42
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
43
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El siguiente esquema nos permite una rpida visualizacin del contenido temtico
completo de esta unidad.
Informacin procesada a travs de nuestro sistema neurovegetativo
Se conserva en la memoria y forma parte de nuestro haber cultural
Requiere conciencia de poseerlo
En forma inductiva
En forma deductiva
Empricamente
Por formacin
sp
)
sntesis parcial
abogaca a distancia
Datos que ingresan a travs de nuestros sentidos
Son de carcter temporal y nos permiten adoptar recaudos
temporales
INFORMACIN
CONOCIMIENTO
SE ADQUIERE
PUEDE SER Global
Cientco
GLOBAL
CIENTFICO
Todo conocimiento adquirido
Requiere de Objeto y Objetividad
Vericabilidad
Sistematizacin
Mtodo
CIENCIA Rama del conocimiento humano especializado. Tantas como ob-
jetos temticos de Conocimiento especializado.
44
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Por su Objeto
Por su Enunciado
Por su Mtodo
SE DIVIDEN
FACTICAS DIVISIN POR FORMALES
Concreto, real, existente en naturaleza
Objeto
Ideal. Existe slo en la mente
Relacin de objetos concretos
Enunciado
Relacin entre signos
Siempre vericable Empricamente
Mtodo
Racional o Lgico


Esquemas dados por ciertos. Permiten enunciar teoremas. AXIOMAS


Estudia y regula los signos, su teora general y los sistemas que
permiten el Lenguaje.
SEMITICA
Enunciados vericables. Pueden dar resultados
Falsos Verdaderos
Signo (ideograma)
Designado (objeto)
Intrprete (persona)
Interpretante (accin)
Contexto (armona)
PROCESO SEMITICO REQUIERE
Sintaxis (relacin signo con signo)
Semntica (relacin signo con designado)
Pragmtico (relacin signo con intrprete)
NIVELES
Individual
Universal
HIPTESIS
Lgicos
Denidos
Indenidos
Informativo. Usa trminos LENGUAJE
45
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
af
actividad nal
abogaca a distancia
)
A modo de ejercicio de autoevaluacin realice las siguientes actividades:
a) Luego de interpretado el contenido temtico desarrollado, de haber ledo y analizado
la bibliografa que se indica como obligatoria, es decir: Introduccin a la Ciencia de
J. A. THOMSON (parte pertinente) y Lgica simblica y Elementos de metodologa
de la Ciencia de Alicia SALAMA, exclusivamente el captulo de Elementos de met-
odologa de la Ciencia de Margarita ROULET, y habiendo analizado con el tutor, de
ser necesario, los contenidos y alcances de los conceptos utilizados en el tratamiento
de la presente unidad, efecte un nuevo desarrollo de todos los items del Esquema
Conceptual, ahora con los nuevos conocimientos asimilados, explicitando con sus
palabras cada uno de ellos.
b) Vuelva a las hojas donde ha plasmado el resultado de su evaluacin previa de todos
los items del Esquema Conceptual y comprelos con el obtenido luego de efectuar lo
dispuesto en a).
46
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
47
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD I )
n THOMSON, J. A.; Introduccin a la Ciencia; Ed. Labor; Barcelona; Ao 1926.
n SALAMA, Alicia; Lgica simblica y Elementos de metodologa de la Ciencia; Ed. El
Ateneo; Bs. As. Ao 1986. Debe leerse con carcter obligatorio slo el captulo Elemen-
tos de metodologa de la Ciencia de Margarita ROULET.
De resultarle interesante los tpicos tratados en la presente unidad y desea profundizar
lo relativo al conocimiento global y cientco, se sugiere la siguiente lectura:
n KLIMOVSKY, Gregorio; Las Desventuras del Conocimiento Cientco; Ed. A-Z; Ao
2001.
Bibliografa obligatoria
u2
unidad dos
investigacin cientca del delito
) (
51
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD II
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Concepto de Hombre Social. Nucleamientos comunitarios. Evolucin de estas comu-
nidades a travs del tiempo.
2. Naturaleza conictiva del hombre. Necesidad de determinar la verdad para la resolucin
de los conictos producidos.
3. Evolucin de los medios de prueba, desde sus orgenes msticos hasta los proced-
imientos ms modernos.
4. Los indicios o testigos mudos, alcances y contenido.
5. Alcances de la Documentologa, de Identidad Humana, de Pericias Qumicas, de Acciden-
tologa y de Balstica.
6. Accionar investigativo, pericial y prevencional. Alcances, obligaciones, recaudos.
7. Conuencias y divergencias con otras disciplinas relacionadas.
8. Los peritos. Distintos tipos acordes a roles desempeados. Habilitaciones. Designa-
ciones. Inhibicin, recusacin, responsabilidades.
9. Diferenciar la actuacin del testigo y la del perito.
10. Delimitar alcances y formas de los interrogantes periciales.
11. Conceptos y requisitos de los elementos Dubitados e Indubitados.
12. Anlisis y comprobaciones profesionales. Presentacin del informe. Alcances y obliga-
ciones.
13. Conceptos tericos temticos periciales y elementos utilizados.
14. Distintos tipos de conclusiones.
15. Pedidos de aclaraciones e impugnaciones periciales.
Mencin sinttica de los contenidos
52
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
53
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n Efectuar un recorrido histrico sobre los distintos procedimientos utilizados por el
hombre en la bsqueda de la verdad acerca de los hechos.
n Denir y comprender el concepto o tarea de la disciplina Criminalstica, sus orgenes,
objetivos, alcances y precursores o mentores.
n Diferenciar por sus objetos temticos los grandes captulos que la conforman, detal-
lando conceptos y precisando trminos relacionados con su quehacer.
n Describir los diferentes enfoques u objetivos que desde su accionar realiza.
n Precisar los alcances de su actuacin y la relacin o interrelacin con otras disciplinas
en la conformacin de la prueba material.
n Diferenciar los conceptos y alcances de Medicina y Medicina Legal.
n Precisar el concepto y alcance de la Criminologa y su diferencia con la Criminalstica.
n Esquematizar didcticamente las principales escuelas criminolgicas a n de com-
prender sus objetos, evolucin e interrelacin con los cdigos penales.
n Analizar el contenido de un informe pericial criminalstico, a n de conocer cada uno
de los elementos detallados en l, sus alcances, lmites y dems circunstancias que
permitan su evaluacin.
54
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
55
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD II )
Naturaleza Social
Medios hostiles y necesidad de congregarse
Dirimir conictos en tribus, clanes, sociedades, pases
Conocer los mecanismos de produccin de los hechos
Impartir justicia
HOMBRE
Causales de produccin
Soluciones pactadas entre las partes
Soluciones por imperio de autoridad competente
CONFLICTOS
Por interpretacin de indicios o testigos mudos
A travs de los Peritos o Intrpretes
Formas de determinacin
VERDAD
Criminalstica
Medicina y Medicina Legal
Criminolgia
Otras
AUXILIARES
56
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
57
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
Lea atentamente la reproduccin del informe pericial que se transcribe a continuacin.
Su lectura le brindar un ejemplo de la forma que un perito eleva el resultado de sus estudios
y comprobaciones y le servir, una vez que desarrolle la presente unidad, como referencia
para una gran parte de su contenido.
58
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
59
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA ACTIVIDAD INTRODUCTORIA )
BUENOS AIRES, da, mes y ao.
Seor Juez
S / D
De mi mayor consideracin.
El que suscribe, Licenciado en Criminalstica Juan Carlos ALEGRETTI, Libro General de
Grados 68, folio 187, nmero 9152, U.B.A, tiene el agrado de elevar a vuestra consideracin el
resultado de los estudios periciales encomendados.
I. OBJETO DEL PRESENTE INFORME
El presente estudio tiene por objeto establecer si el cheque de pago diferido nmero 00000468
perteneciente a la cuenta 10084/0, es autntico. De serlo, si la rma de su librador es autntica y si
presenta algn tipo de adulteracin.
II. ELEMENTOS APORTADOS
Para ello se han aportado los siguientes elementos: como indubitado de cotejo cheque
de pago diferido del Banco XXX nmero 00000466, con domicilio de pago en Lima 1353 Zrate,
Provincia de Buenos Aires, perteneciente a la cuenta corriente en pesos n 10084/0 de Elsa Belatriz
Bobe, con domicilio en Conte 676 de Zrate, por la suma de mil pesos ($ 1.000), de fecha 10 de julio
de 2001 a nombre de la Fundacin Zrate, con rma indubitada en original de Elsa Belatriz Bobe, y
como dubitado, cheque de la misma entidad bancaria, tipo y moneda, n 00000468, perteneciente
a la misma sucursal y cuenta, librado el 6 de marzo de 2001, con fecha de pago el 20 de junio de
2001, por la suma de mil treinta y cinco pesos ($ 1.035) con destinatario Editorial Argentina S.A.
III. ANALISIS Y COMPROBACIONES REALIZADAS
Los estudios dieron comienzo con la utilizacin de elementos pticos y cientcos adecuados
a la experiencia que nos ocupa, tales como lupa binocular estereoscpica de variados aumentos y
luces del espectro visible y ultravioleta acondicionadas desde distintos ngulos de incidencia.
A n de establecer la autenticidad o no del cheque dubitado, se detallan a continuacin
las medidas de seguridad de orden fsico que pueden determinarse en el cheque aportado
como indubitado.
60
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Dicho cartular se encuentra realizado en papel de calidad controlada con las caractersticas
de diseo utilizado por la rma Ciccone Calcogrca S.A. que presenta ligrana repartida donde
puede leerse autochequelux y observarse un dibujo a modo de obelisco. El mismo no presenta
lamentos o confetis de seguridad visibles ni invisibles, pero presenta todas las especicaciones que
para el papel de cheque especica el Banco Central de la Repblica Argentina.
A los efectos de no alterar en forma signicativa dicho cheque, slo se ha comprobado con
respecto a las tintas empleadas para realizar el diseo del fondo de seguridad, su fugitividad con
respecto al agua en el sector del reverso sealado con el nmero 1, donde puede observarse la
destruccin de las tintas provocadas por la reaccin a este agente.
De su observacin macro y microscpica se ha determinado que el mismo presenta tres
sistemas de impresin. El denominado calcogrco (I C) en la guarda en rojo con el nombre y logotipo
del banco; el computacional o lser (I L) para los datos variables, es decir en el nmero del cheque
tanto en dgitos como en letras; en la sucursalizacin y domicilio de pago; en el cdigo de ruta; en
el nmero y datos de la cuenta y del titular; y en el cdigo magntico caracteres siete bastones; y el
offset (O) para el resto de las impresiones.
Adems presenta las siguientes medidas de seguridad: Imagen Latente (I Lte) con el
logotipo del banco en el sector destinado a la rma; Microletras (M) en los renglones destinados
al importe en nmeros y letras, destinatario y rma; Tintas de variacin cromticas (O.V.I) en
la roseta ubicada en el sector derecho debajo de la guarda en rojo; Tintas invisibles protecto-
ras del sector de los importes en nmero y letras y del destinatario; y plaquetas invisibles de
proteccin de color rojo, sobre los datos variables.
Analizado el cheque dubitado n 00000468 presenta las mismas medidas de seguridad en
papel, tintas e impresiones que el detallado precedentemente, por lo que debe ser considerado
como autntico. Ver lmina ilustrativa n 1.
Antes de la determinacin de autenticidad o no de la rma que suscribe el cheque dubitado
y el cotejo de las letras que lo conforman, se hace necesario hacer una breve introduccin acerca
de los fundamentos en que se basan este tipo de peritaciones documentolgicas. Sin duda las
escrituras manuscritas son gestos. Gestos que resultan de un acto volitivo o de un reejo y de-
pende en cuanto a su direccin, extensin y fuerza, de factores antomos-siolgicos (rapidez de
la transmisin del impulso nervioso a travs de los hilos transmisores, fuerza muscular, exibilidad
de las articulaciones, longitud de las palancas seas, etc.) y de factores psquicos (cerebrales o
simpticos). A pesar de la aparente variedad de los casos particulares, el gesto para una misma
persona acusar una constante que lo har siempre reconocible y permitir distinguirlo del gesto
anlogo realizado por otro individuo. As como todo individuo posee una personalidad psquico-
social propia y nica, su escritura manuscrita posee esenciales constitutivas de personalidad
grca subconscientes, espontneas, propias y nicas.
61
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
La identicacin escritural se basa en la concordancia de las particulares caractersticas que
forman la denominada personalidad grca del escribiente, que ste va adquiriendo a travs del
tiempo con el ejercicio de la escritura y que se maniestan subconscientemente en el acto de escri-
bir, escapando al contralor de su autor y dotando a su escritura de particularidades identicatorias
que permiten distinguirlas de otras. Estas caractersticas no son advertidas a simple vista en la que
slo se repara en el aspecto morfolgico, sino que constituyen un cmulo de particularidades que
se interrelacionan de las ms diversas formas, dando origen a la personalidad individual a que nos
hemos referido.
El aprendizaje de la escritura reconoce tres etapas caractersticas cuya duracin y lmites no
pueden ser establecidos con precisin. En la primera etapa se efecta una verdadera actividad de
copia donde se trata de reproducir el modelo del grasmo que se tiene a la vista; en la segunda o mne-
mnica, ya sin el modelo presente, el aprendiz debe recurrir a la memoria para poder recordar como
se hace tal o cual letra y como se relacionan stas para conformar la palabra. En la tercera etapa esta
actividad pscomotriz se realiza subconscientemente y el escritor va incorporando elementos propios
que apartan a sus grasmos de los modelos primitivos, es decir incorpora elementos personales que,
dan a los mismos, individualidad. Estos elementos, tales como los diferentes puntos de ataque y es-
cape, el presionado, la evolucin de los rasgos, la estructuracin alfabtica, los ligados y desligados,
la proporcionalidad, los valores angulares, el silabeo, etc., adquieren diversas formas y se combinan
de distintas maneras y es all donde radica precisamente la identidad escritural, siendo la morfologa
general slo un elemento ms, pero absolutamente insuciente por si mismo.
Como estas esenciales constitutivas son el resultado de una actividad psicomotriz subconsci-
ente, escapan al control y an a la percepcin incluso del mismo autor, manifestndose como automa-
tismos escriturales. Su determinacin implica la necesidad de un profundo anlisis con el auxilio de
instrumental ptico de microscopa e iluminacin adecuada. Lo aqu expresado, se cumple asimismo
con las rmas y posibilita establecer la falsedad de las mismas o su autenticidad, que es lo mismo que
determinar que una persona es la autora de un escrito o de una rma en particular o no lo es.
Por los motivos expuestos, el falsicador no puede reproducir las grafas ni las rmas autnti-
cas con todas sus caractersticas, ya que no posee los parmetros psquicos-motrices del verdadero
autor y adems se encuentra condicionado por los propios y sus esenciales constitutivas, de manera
tal que su reproduccin de las escrituras y/o rmas autnticas, es slo una imitacin realizada con
mayor o menor habilidad, de aquello que es apreciable a simple vista, la morfologa del grasmo
y sus caractersticas estructurales de carcter general. Por lo tanto del anlisis correlativo entre las
caractersticas de las rmas o escrituras autnticas y la de los sospechosos de serlo, es posible
establecer si estas ltimas son autnticas o falsas.
Por todo lo expuesto y siguiendo metodolgica y sistemticamente los principios tcnico
-cientcos que rigen la disciplina Criminalstica es posible determinar o descartar autora de rmas
o manuscritos. Para ello es necesario contar con abundante material indbito, es decir autntico
62
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
y sin cuestionamiento, de rmas o escrituras pertenecientes a quien o quienes se le/s atribuye/n
los escritos, a n de establecer primeramente las esenciales constitutivas de personalidad grca
emergentes de los mismos, para su posterior cotejo con los dbitos.
Idealmente dicho material debe ser anterior, posterior y contemporneo a la fecha del o de
los documento/s dbito/s a n de poder conformar su historia grca, tenindose en cuenta que
al igual que la persona, los gestos escriturales tambin se modican con el tiempo. Dichos escritos
y/o rmas pueden ser obtenidas de documentos pblicos y/o privados. Cuando no sea posible la
obtencin de los mismos, se puede recurrir a la realizacin en presencia del perito, de una plana
escritural extensa realizada por la persona a quien se le atribuye las grafas o rmas.
Confrontada la rma indubitada aportada para estudio de Elsa Belatriz Bobe se ha determinado
que la misma es espontnea, veloz, de orientacin horizontal ascendente, de diagramacin ilegible,
proporcionada en sus rasgos maysculos y minsculos, con intervalos, ejecutada en varios trazados,
sin signos de puntuacin, de conformacin curva, inclinacin de ejes a la derecha, de irradiacin
horizontal, con ataques y remates netos, base de rengln serpenteante y presenta un movimiento
a modo de rbrica y un rasgo iditico muy particular de ida y vuelta en ese trazado horizontal. Ver
lmina ilustrativa n 1.
Analizada la rma dubitada, la misma presenta idntica morfologa, diseo y movimientos
estructurales en ataques, angulaciones y remates, e idnticas esenciales constitutivas de personalidad
grca, por lo que debe ser considerada autntica. Ver lmina ilustrativa n 1.
Confrontados los dgitos y letras del llenado del cheque dubitado con el llenado del cheque
indubitado, se han detectado (en la mayora de las leyendas, con excepcin de las que se detallarn
ms abajo), coincidencias morfocinticas y estructurales en ataques, angulosidades y remates en
la conformacin de letras y dgitos, destacndose las letras d, e, r, o; los nmeros 2, 0 y
el grupo 2000.
Sin embargo se han determinado discoincidencias estructurales, de ataques y de remates
en las siguientes letras dentro del cheque dubitado:
Letra M: las letras capitales de las dos palabras Marzo estn realizadas con cuatro rasgos.
Su ataque comienza a la altura mxima, descendiendo hasta alcanzar la lnea de base del rengln
desde donde asciende separada o casi sobre s mismo, conformando luego de alcanzar su altura
mxima una meseta recta o cncava, para descender nuevamente hasta la lnea de base donde
remata en forma de gancho a la derecha.
La correspondiente a la palabra Mil est realizada en tres rasgos. Su ataque comienza en
la lnea de base, asciende hasta su altura mxima donde conforma una meseta ms angulosa, para
descender hasta la lnea de base rematando a modo de golpe de sable a la izquierda.
Letra i: la correspondiente a la palabra Mil presenta un doble trazado, una marcada in-
clinacin a la derecha y su tilde es a modo de punto, en tanto que en el resto es a modo de guin.
63
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Letra l: todas las indubitadas terminan por encima de la lnea de base, en tanto que la de
la palabra Mil termina muy por debajo de esta.
Antes de establecer las caractersticas fsicas de/l/os elemento/s escritor/es utilizado/s para
el llenado de los cheques, se hace necesario hacer un breve comentario sobre este tipo de estudios.
Los diferentes elementos escritores que pueden ser utilizados para la escritura manual poseen un
gaviln o punta, que conjuntamente con la tinta permiten dicha escritura. Dicho gaviln presenta
caractersticas propias de fabricacin, distintas para una pluma fuente, una birome o una bra, e
incluso diferentes para un mismo tipo, sea en forma o tamao.
Dicho gaviln adems de las caractersticas propias de su fabricacin adquiere con el uso
o mal uso, caractersticas propias por roturas, desgastes, abolladuras, empastes, etc. De presentar
estas circunstancias, los mismos van dotando a los trazos por ellos ejecutados de particularidades
que permiten vincularlos como realizados por un mismo elemento, ya que producen entintados ir-
regulares, faltantes y/o dibujos anmalos.
Adems se debe observar con la utilizacin de luces del espectro visible acondicionadas
desde distintos ngulos de incidencia, la respuesta que presentan las tintas frente a la absor-
cin de la luz. Asimismo, expuestos a la radiacin ultravioleta, se debe vericar la respuesta
uorescente que cada tipo de tinta presenta.
Analizadas las escrituras de todo el cheque dubitado, no se han determinado diferen-
cias que permitan establecer diferente elemento escritor por deciencias en el gaviln o por
respuesta a la luz directa o ultravioleta, entre la palabra Mil y el nmero 10 del importe en
nmeros, con relacin al resto del llenado.
Dicha falta de caractersticas no implica la utilizacin de un mismo elemento escritor, sino
de un elemento o elementos de similares caractersticas de gaviln y tintas. Para la determinacin
denitiva de la utilizacin de igual o distinto elemento escritor y tintas, debera realizarse una pericia
de ndole qumica, la que necesariamente lleva aparejada la toma de muestras de la tinta utilizada y
el consiguiente deterioro del cartular, por lo que se debe autorizar expresamente.
Todo lo expuesto permite inferir que corresponde a una misma mano escritora el llenado completo
del cheque indubitado (con excepcin del destinatario) y el llenado del cheque dubitado, incluido su
destinatario, con excepcin de la palabra Mil, no pudindose determinar expresamente, con relacin a
los dgitos 1 y 0 del importe en nmeros. Ver sealizaciones en lmina ilustrativa n 1.
Las diferencias sealadas con respecto a la palabra Mil del importe en letras permite inferir
una maniobra de adulteracin del cheque que transform su numero original treinta y cinco en
Mil treinta y cinco, no determinndose circunstancia alguna con respecto a los dgitos 1 y 0
del importe en nmeros por falta de elementos. Esta circunstancia fue posible debido al incorrecto
espacio dejado en blanco entre el signo pesos impreso y el importe manuscrito y entre la palabra
pesos y el importe en letras.
64
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
A raz de los anlisis y comprobaciones realizadas, el suscrito se encuentra en condi-
ciones de efectuarles a Uds. las siguientes
IV. CONCLUSIONES
EL CHEQUE DUBITADO NUMERO 00000468 ES AUTENTICO, POR PRESENTAR TO-
DAS LAS MEDIDAS DE SEGURIDAD EN PAPEL, SISTEMAS DE IMPRESIN Y TINTAS DE LOS
CHEQUES DE PAGO DIFERIDO DEL BANCO XXX, REALIZADOS POR CICCONE CALCOGRAFICA
S.A.
LA FIRMA DUBITADA DEL MISMO, SE CORRESPONDE CON EL GESTO GRAFICO DE
ELSA BELATRIZ BOBE POR LO QUE DEBE SER CONSIDERADA AUTENTICA.
LOS DIGITOS Y LETRAS QUE COMPLETAN EL CHEQUE INDUBITADO (CON EXCEPCION
DE LOS DATOS DEL DESTINATARIO) SE CORRESPONDEN CON EL LLENADO DEL CHEQUE
DUBITADO, (INCLUSO LOS DATOS DEL DESTINATARIO), CON EXCLUSION DE LA PALABRA
MIL, NO PUDIENDOSE ABRIR JUICIO DE VALOR CON RESPECTO A LOS DIGITOS 1 Y 0
DEL IMPORTE EN NUMEROS.
LAS DIFERENCIAS SEALADAS CON RESPECTO A LA PALABRA MIL DEL IMPORTE
EN LETRAS PERMITE INFERIR UNA MANIOBRA DE ADULTERACION DEL CHEQUE, QUE
TRANSFORM SU NUMERO ORIGINAL TREINTA Y CINCO EN MIL TREINTA Y CINCO, NO
DETERMINANDOSE CIRCUNSTANCIA ALGUNA CON RESPECTO A LOS DIGITOS 1 Y 0 DEL
IMPORTE EN NUMEROS.
Es cuanto al respecto se puede informar.
Con el presente informe que consta de SEIS (6) fojas y UNA (1) lmina ilustrativa, se
devuelven los elementos aportados para estudio.
Sin otro particular saludo a Uds. con las seguridades de mi mayor estima.
NOTA: Por ser la reproduccin de un informe pericial real, los datos de la entidad bancaria, numeracin del
cheque, de la cuenta y los de su titular han sido modicados para preservar el secreto. Se ha omitido asimismo
la reproduccin de la lmina ilustrativa por idnticas razones. En la presente unidad lo importante es la forma
genrica del informe y no tanto las comprobaciones efectuadas. Debe tenerse en cuenta quees inadmisible
un informe sin la/s ilustracin/es donde se demuestre todo lo sealado en el mismo.
65
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD II )
Como brevemente ya hiciramos referencia en la presentacin de la asignatura,
el hombre, por un arrastre atvico de ciertas facultades, est precondicionado a vivir en
forma societaria. Ello constituye su determinante naturaleza social. Para la gestacin
de un nuevo ser, su crecimiento, desarrollo, salud y perpetuacin, necesita de una
relacin comunitaria.
Esta circunstancia ha sido cabalmente comprendida por el hombre ya que,
desde los tiempos ms remotos, ha debido nuclearse conformando las primeras for-
maciones grupales. As pudieron enfrentar las hostilidades de las diferentes regiones
que ocuparon, las inclemencias del tiempo, protegerse de los ataques de las eras y
de otros hombres y procurar y satisfacer sus necesidades bsicas de alimento y vivi-
enda. Estos grupos dieron lugar a las primeras formaciones clnicas o tribales.
Posteriormente, con el paulatino incremento de las mismas y de sus necesidades, confor-
maron pueblos, ciudades y pases. Sus permanentes y cada vez ms imperiosas necesidades,
su astucia y dedicacin les permiti, sobre base de los conocimientos obtenidos a travs de la
observacin, la experimentacin y la deduccin, signicativos avances y una gran evolucin.
Grandilocuente es la obra humana. Las mejoras en cuanto a la calidad, condicio-
nes y tiempo de vida de la especie, son realmente asombrosas, como lo son tambin los
logros obtenidos con relacin a su hbitat. Sin embargo, ese mismo apetito evolutivo
ha impulsado al hombre a cometer excesos no slo sobre otros hombres, sino en el
planeta donde habita, que a la postre podr signicarle un costo excesivo.
El inexorable transcurso del tiempo ha demostrando fehacientemente esa nece-
sidad societaria. Hoy el hombre comparte un mundo totalmente globalizado, donde lo
que ocurre en algn lugar del planeta, por ms remoto que fuere, tiene profunda inter-
relacin con el resto. La globalizacin es una realidad y tanto las naciones como los
hombres, se siguen nucleando a travs de tratados internacionales como: la COMUNI-
DAD EUROPEA, el NAFTA y el MERCOSUR entre muchos otros. Esto no slo conrma
cotidianamente, la naturaleza social hombre, sino que constituyen verdaderos ejemplos
orgnicos de esa esencial necesidad humana.
Criminalstica
66
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Sin embargo, la naturaleza social del hombre no lo convierte en un ser con conductas
sociales armnicas. Desde siempre las relaciones entre los hombres son y seguirn siendo
causales de conictos. Adems cuanto ms heterogneas sean esas sociedades, en
cuanto a cultura, educacin, niveles econmicos, tradiciones, costumbres, etc., ms
hiptesis de conictos presentarn. La gnesis de los mismos obedecen a causales
muy variadas, sin embargo gran parte de los mismos, son provocados por anmalas
relaciones comerciales, donde el afn mercantilista provoca y cree justicar doctrinas
egostas que, en forma individuales o grupales y con el n de conseguir ventajas, no
dudan en recurrir a acciones marginales o criminosas.
Adoptar oportunas medidas cautelares de prevencin, suelen dicultar o
paliar estas circunstancias pero, en muchos casos, no queda otra alternativa que re-
currir a planteamientos judiciales ante fueros nacionales o internacionales para
su dilucidacin.
Desde aquellas primeras conformaciones clnicas o tribales hasta nuestros das,
quienes debieron o deben administrar justicia (jefes de tribus, consejos de an-
cianos o nuestros actuales jueces) han necesitado, necesitan y necesitarn de una
precondicin para poder expedirse: la determinacin de LA VERDAD, es decir el
conocimiento de la realidad en la produccin de los hechos para poder, en forma
imparcial, dar a cada uno lo que le corresponde, ya sea castigando o resarciendo.
Para lograr la verdad, el hombre ha utilizado diversos mtodos. Sin pretender una
profunda revisin histrica, mencionaremos que, primitivamente, se pensaba que la verdad era
revelada por la Providencia o Dedo de Dios, que a travs de las ordalas o del duelo
judiciario intervena para exculpar o demostrar la culpabilidad de los sospechados.
Este procedimiento consista en someter a aquel/los involucrado/s en un conicto
que deba dilucidarse, a determinadas pruebas fsicas. De resultar airoso en ellas era con-
siderado inocente o veraz, en caso contrario era culpable o falaz.
Entre otras pruebas por ejemplo, para la determinacin de quien deca la verdad en hechos
de importancia, se les haca colocar a aquellos cuyas versiones diferan, su puo sobre el fuego. El
que lograba mantenerlo por mayor tiempo era el veraz, ya que por intervencin divina o del dedo
de Dios, lograba soportar el dolor y de esa manera demostrar la veracidad de sus dichos.
Huelga decir que este medio les permita a todos aquellos ms hbiles o con mayor
estado fsico, resistir las duras pruebas a las que eran sometidos, pero en modo alguno ase-
67
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
guraba la determinacin de la verdad de los hechos. Este procedimiento por ilgico que pueda
parecernos, fue utilizado por el hombre, en algunas sociedades, hasta hace unos 400 aos.
Otro mtodo para obtener la verdad es la Confesin, es decir el reconocimiento
de un hecho y de sus circunstancias por aquel que lo ha cometido. Es tan claro en
teora esta forma de obtener la verdad, que fue reconocida y denominada por mucho
tiempo como la reina de las pruebas. Esto en realidad sera as, ya que si aqul que
a sabiendas que recibira un castigo por su conducta reconoce la autora del hecho,
qu mayor certeza de estar frente a la verdad se podra obtener?
Sin embargo, no siempre quien conesa es el verdadero autor de un hecho.
La anormal necesidad de algunas mentes enfermizas de recibir castigo, an por algo
que no han cometido (en muchos casos como reparacin por otros hechos no cuestio-
nados, por los que consideran que deberan ser castigados y a sabiendas que nunca
lo sern) o por la anmala necesidad de notoriedad, de revaloracin de personalidad,
o por conveniencia pecuniaria, amiguismo, etc., hace que la sola confesin no sea el
camino vlido para la determinacin de la verdad.
Asimismo, la historia nos ha demostrado que para llegar a una confesin, el hom-
bre se ha valido muchas veces de mtodos brbaros y crueles como la tortura, (recordar
la inquisicin o santas cruzadas). Frente a tales procedimientos -donde se consideraba
que el n justicaba los medios- y para escapar de esas circunstancias, muchos ino-
centes no slo se han reconocido culpables de hechos no cometidos, sino que una vez
aceptado ello, para eludir nuevas torturas aportaban nombres de familiares y conocidos
como cmplices o auxiliadores de los mismos, arrastrando as a otros inocentes.
Ningn Juez en la actualidad, dara por probado un hecho slo por los dichos del
inculpado, necesitar obviamente de otros elementos probatorios para su dictamen nal. La
confesin sin embargo ser un medio de prueba ms acorde a las disposiciones del Cdigo
de forma en materia Penal para la Capital Federal, cuando la misma se realice en presencia
del Juez, del Secretario, el Ministerio Fiscal y del Abogado defensor (art. 295 CPPN). Pero
debemos recordar que por precepto constitucional nadie est obligado a declarar contra
s mismo, estando raticado dicho derecho en el artculo 296 del mismo cuerpo legal.
Si este no es el camino, qu mtodo podemos utilizar para la determinacin de la
verdad?. Surge entonces el Testimonio, o dichos de un tercero ajeno a los hechos, es
decir de aquellos que por no tener inters personal en el resultado del proceso slo
relatan lo que saben, lo que han percibido a travs de los sentidos.
68
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Desestimando por su obviedad a los testigos falsos, se debe tener en cuenta que un
testigo relata los hechos acorde como estos impresionaron sus sentidos. Con qu alcances
conoce el hecho? cunto sabe de l?, desde dnde lo vio?, cmo lo impresion?, qu
recuerdos o vinculaciones con otros vividos por l o por familiares o amigos le traen?; qu
capacidad de almacenar los detalles propios del hecho posee?; qu posibilidad de abstrac-
cin posee sobre los dichos, comentarios, observaciones, noticias y dems circunstancias
percibidas sobre los mismos?; qu capacidad posee de recordar y relatar los hechos sin
aditamentos o adiciones involuntarias de pequeos detalles que pueden ser fundamentales
para determinar los mecanismos de produccin de un hecho? qu grado de capacidad,
memoria, atencin, forma de expresin, imaginacin, etc. etc., posee?.
De la respuesta a estos y otros muchos interrogantes depender el grado de exac-
titud o veracidad de su declaracin. Si a esto le sumamos la posibilidad de la actuacin de
testigos falaces, se pone en evidencia la fragilidad de este medio como garante de la obten-
cin de la verdad de un hecho. Guardando, empero, las formalidades que el citado cdigo
de forma taxativamente impone en el Captulo IV Testigos, donde seala los deberes,
capacidades, prohibiciones, facultades de abstencin, compulsin, citacin, formas y las
responsabilidades y medidas a tomar ante falso testimonio, su actuacin sigue revistiendo
suma importancia, aunque no sea garanta de verdad por las causales sealadas.
Queda claro que tanto la confesin como el testimonio son verdaderos auxiliares de
la justicia, pero ellos no son por s, garanta de la verdad. Por ello se ha debido recurrir a
las cosas, a los elementos que se encuentran en la escena del hecho. Estos son verdade-
ros testigos mudos que por carecer de sensibilidad no se impresionan, no mienten ni se
modican, aportando la verdad en forma objetiva.
Surge as la Prueba Indiciaria tambin llamada de los testigos mudos. Testigos
que necesitan de intrpretes especializados para que expresen lo que saben, por lo que
se debe recurrir a la Criminalstica y a sus peritos, que aportan todos los conocimientos
tcnicos y cientcos que permiten el esclarecimiento del hecho. La actuacin cientca
est contemplada en el citado cdigo entre otros, en el artculo 184 inciso 2 y 4.
Deniremos a la CRIMINALSTICA como una disciplina tcnico cientca
interdisciplinaria cuyo objeto es establecer la identidad de las personas o cosas;
el estado en que estas se encuentran; las causas y medios que provocaron sus
anomalas; las personas o cosas con ellas relacionadas; sus interrelaciones con otros
hechos; y que permite encontrar y asegurar las pruebas. Es decir busca determinar
la existencia de un hecho ilegtimo o irregular, individualizar a su autor o autores
69
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
y conformar la prueba material que asegure el castigo y resarcimiento. Todo ello
a travs de la determinacin del Dnde?, Cmo?, Cundo? y Quin? de un
hecho, sea ste delictivo o no.
Para ello se vale de los objetos, cosas o modicaciones de las que debieron
estar, que quedan o son parte de ese hecho y de los intrpretes criminalsticos o
peritos que tienen como funcin interpretarlos, sacar de ellos conclusiones, utilizando
los medios tcnicos y/o cientcos a su alcance.
El juez de instruccin austraco Hans Gross, tras 20 aos de silenciosa y fecunda
labor, en 1892 publica su Handbuch fr Untersunchungsrichter als System der Kriminalistik
o Manual del Juez de Instruccin como Sistema de Criminalstica, utilizando por primera
vez esta denominacin para designar al conocimiento especco y a todas las tareas tc-
nicas y cientcas destinadas a conformar la prueba material del delito.
Sin embargo, antes de adoptar en forma denitiva este nombre ha sido denominada
de manera muy diversa. Debe tenerse en cuenta que sus alcances estn directamente rela-
cionados con los hechos delictivos y que su aplicacin en forma emprica proviene de las
fuerzas policiales como auxiliares de la justicia. De all el origen de esas denominaciones:
Polica Cientca, Tcnica Policial, Ciencia de la Polica Judicial, Arte de la Polica Judicial,
Polica Judicial Cientca.
Con relacin a sus precursores, se hace muy difcil precisar desde cundo y quines
han iniciado esta tarea y adems se corre el riesgo de omitir mencionar a alguien. Empero en
lo relacionado a la difcil tarea de la identicacin del hombre, no podemos dejar de mencio-
nar a Malpighi, Fer, Testud, Forgeot, Faulds, Herschell, Bertilln, Galton, Vucetich, Henry,
Fortunato, Farina, Preller, Urquijo, Saucedo, Rosset y Lago, de quienes nos ocuparemos
en la unidad correspondiente.
En cuanto a la aplicacin de las tcnicas y fundamentalmente en la difusin de las
mismas debemos mencionar adems de Gross, a Lacassagne, Nicforo, Sdermann y
OConnell y Locard.
En el orden nacional no slo por haber sido los iniciadores, sino por la dedicacin,
esfuerzo, capacidad, abnegacin y total desinters econmico puesto de maniesto en el
cumplimiento de su labor, logrando dentro de la Polica Federal Argentina la formacin de
dependencias especializadas, la invencin y donacin de patentes de aparatos tcnicos
cientcos que se han difundido por el mundo entero, como el scopmetro, el fotocom-
parador, la clave de identicacin mecanogrca, etc., que permiti durante muchos aos
70
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
colocar a la institucin a la que pertenecan en un puesto de privilegio, al ser reconocida
internacionalmente como la mejor polica del mundo. Cabe mencionar entre muchos otros
a Roberto Albarracn, Enrique Pisano, Roberto Capello, Ernesto Belaunde, Julio Fortunato,
Pedro Lago, Servando Saucedo y al insigne maestro y hombre ejemplar Ricardo Rosset
de quien tuve el honor de ser discpulo, alumno y permtaseme el atrevimiento, amigo. A
todos ellos vayan mi permanente gratitud y reconocimiento, conjuntamente con la de todos
aquellos que con humildad, nos dedicamos al cumplimiento de tareas Criminalsticas.
A ttulo de referencia se hace constar que la Facultad de Derecho y Ciencias Socia-
les por expediente n630.729/66, propone al Rector de la Universidad de Buenos Aires
la creacin de las Licenciaturas en Criminologa y en Criminalstica dentro del Instituto de
Derecho Penal y Criminologa de dicha facultad. Que en uso de las atribuciones confe-
ridas por el artculo 1de la resolucin ministerial n106/66, con fecha 19 de diciembre
de 1967 el Rector crea ambas licenciaturas, aprobando las condiciones de admisibilidad
para su ingreso, los planes de estudios, condiciones y correlatividades a cumplimentar
para la obtencin de los ttulos. A partir de all, otras universidades en todo el pas han
proseguido con la tarea de formar especialistas en Criminalstica.
La Criminalstica permite un asesoramiento integral sobre la conformacin de la
prueba material especca para cada caso y frente a cada indicio, con la resolucin de los
interrogantes periciales que estos presenten; la valoracin de los aciertos o deciencias
de las pruebas obrantes en las causas; la redaccin de interrogatorios a peritos o testigos
con respecto a dichas pruebas materiales; la valoracin y en su caso la impugnacin de
peritaciones no basadas en comprobaciones tcnicas o cientcas; el contralor de las
pruebas cumplidas y a cumplimentar tanto en hechos judiciales como extrajudiciales y en
los siguientes tpicos:
Pericias documentolgicas: tambin llamadas documentoscpicas, scopomtricas o
caligrcas, donde se cuestiona la autenticidad de rmas y manuscritos; de sus autores;
de abusos de rmas en blanco; superposiciones y rdenes de prelacin de escrituras
(antigedades relativas); determinacin de falsicaciones y adulteraciones en documentos
en general; sobre fotocopias y determinacin de la fotocopiadora utilizada; testamentos
olgrafos; escritos mecanogrcos, determinacin de mquinas de escribir, agregados
y tiempos de ejecucin; impresoras de todo tipo; autenticidad de papel moneda nacional
y extranjero, ttulos y otros valores; sellos, lacres, timbres y marcas; adulteraciones por
borrado, lavado qumico, enmiendas, agregado, testados, etc.; sistemas de impresin y
asesoramiento integral sobre seguridad documental.
71
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Se hace necesario aqu hacer una breve referencia sobre las diferentes denomina-
ciones de este tipo de peritaciones. Por no existir profesionales especcos a nes del siglo
XIX y primera mitad del siglo XX, que pudieran realizar pericias sobre escrituras manuscritas
o rmas, se recurri a los nicos idneos que sobre escrituras haba entonces, es decir a
los calgrafos. Si bien su tarea era la de hacer buena letra en el llenado de los documentos,
es decir una tarea netamente artstica, sus ejecuciones requeran anlisis pormenorizados
de las diferentes conformaciones y estilos, lo que conllevaba a profundos estudios sobre el
arte de la escritura. Esto los transformaba en los ms conocedores de esa materia.
Posteriormente, dada la necesidad de profesionalizacin de la tarea pericial, se divide la
carrera en dos ramas de estudios, una artstica y una pericial, abarcando entonces lo referente
al asesoramiento sobre todo tipo de escrituras. Si se recurre a los calgrafos para este tipo
de peritaciones, es lgico llamar a sus informes pericias caligrcas. Dada la antigedad
de su uso, tambin es lgico pensar siempre en primer instancia en esta denominacin.
Antes que los jueces comenzaran a requerir cooperaciones periciales sobre estos
estudios a la Polica Federal Argentina, como auxiliar de la justicia, gracias a las inquietudes y
visin de futuro de sus funcionarios, se crean laboratorios con preparacin tcnico-cientca,
que luego fueron perfeccionando y ampliando el mbito de competencia, denominndoselo
Gabinete Scopomtrico, palabra que posee raz latina Skopein que signica examinar,
estudiar, y metra por las tareas de mensura que implica. Adems necesit formar a su
personal en esta actividad, por lo que se dictaron cursos especcos. Si la ocina policial
se denominaba de esa manera, los cursos formaban tcnicos scopmetros, las pericias
lgicamente, se denominaron scopomtricas.
Como muchas de ellas requieren estudios y comprobaciones de orden qumico, se
hizo comn requerir pericias caligrcas, scopomtricas y qumicas cuando se necesitaba
del auxilio de esta disciplina tcnica. Por ser ambas denominaciones especcas de activi-
dades locales, que obviamente no poseen reconocimiento internacional, el nombre genrico
adecuado para todas las pericias relacionadas con todo tipo de documentos, que estudian
y analizan sus soportes, sus tintas, los sistemas de impresin utilizados, las medidas de
seguridad incorporadas, el detalle de las falsicaciones y adulteraciones de todo tipo, es
la de documentologa.
Balsticas: Sobre este captulo, en razn de haber en el programa una unidad que desar-
rolla esta temtica, slo diremos que se ocupa del estudio de las armas, sus municiones,
alcances y direccin de sus proyectiles y los efectos que producen. Para el cumplimiento
de su tarea, se divide en
72
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Balstica Interior: donde se estudia y analiza las caractersticas de las armas, sus piezas, las
interrelaciones de stas que permiten su funcionamiento y aptitudes para el disparo, las de
sus municiones, la identicacin de proyectiles y vainas y los mecanismos de produccin
del disparo hasta que el proyectil abandona la boca del can.
Balstica Exterior: que se ocupa de las trayectorias, distancias de disparo, posicin del tirador,
y las afectaciones que sufre el proyectil por la gravedad, aire y factores climticos. Y la
Balstica de Efecto: que estudia los daos de los impactos, rebotes, etc,
Pericias accidentolgicas: se ocupa de este tipo de hechos dividindose en dos grandes
grupos: la Accidentologa General que se ocupa de cadas al vaco, causales y mecanismos
de produccin de accidentes caseros, laborales, etc.; y la Accidentologa Vial: referida a
los accidentes automovilsticos, estudiando campos visuales de conductores; distancia
de frenado; velocidades; secuencias de impactos y desplazamientos; roles de embistente
o embestidos, desarrollo y causas del siniestro; etc.
Se hace constar que si bien la denicin de accidente es todo hecho casual,
obra de la fatalidad y sin imputacin a terceras personas, el captulo criminalstico que
se dedica a esta temtica se denomina as, ya que si el hecho no lo es, se procura la
determinacin de sus mecanismos de produccin, de las personas involucradas en
ellos y la conformacin de la prueba.
Dentro de la accidentologa se hace necesaria la determinacin de todas las circun-
stancias que afectan a los elementos del llamado tringulo accidentolgico
El estudio del hombre se ocupa de todos aquellos que de una manera u otra
han intervenido en la produccin del hecho. Comprende a/l/os conductor/es y a la/s
vctima/s. Con relacin a los conductores se debe determinar y comprobar sus estados
Hombre
Terreno Mquina
73
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
psquicos y fsicos anteriores y posteriores pero inmediatos al momento del accidente,
sus identidades y si han cumplido con las exigencias necesarias para poder conducir
vehculos: capacidad, estado, idoneidad, habilitacin, vigencias de las mismas, segu-
ros, uso de anteojos, etc. Asimismo determinar el grado de atencin (uso de celulares,
etc.), ngulos de visin, roles desempeados, prioridades, etc.
Similares determinaciones, con las especicidades que cada caso requiera, debe
cumplimentarse con otros tipos de hechos accidentales tanto del hogar como del trabajo.
La funcin, con respecto al hombre, es la de determinar todo aquello que permita a quien
deba juzgar el hecho, comprobar la existencia o no de imprudencia, negligencia, impericia
en su arte o profesin o inobservancia de los reglamentos o de los deberes de su cargo
(acorde a lo taxativamente dispuesto en el artculo 84 del Cdigo Penal).
Con relacin a las vctimas, sus estados fsicos y la urgente necesidad de atencin
mdica, sus identidades, estados psquicos y fsicos anteriores al hecho, formas de partici-
pacin, lugares que ocupaban antes del hecho, vnculos con los imputados, etc. Asimismo
la determinacin de testigos presenciales del hecho y los necesarios de actuacin para las
determinaciones, comprobaciones y/o secuestros.
Con relacin a las Mquinas, se deben determinar el estado de las piezas que
las componen, sus armonas para el funcionamiento y sus condiciones generales
antes del hecho. Asimismo si se cumplen las disposiciones legales y de habilitacin
que autoricen su uso y funcionamiento y todos los daos sufridos con motivo del
accidente.
En lo referente al Terreno, deben efectuarse las comprobaciones desde dos
pticas diferentes: uno con relacin al estado de la pista o calles donde se produjo
el hecho, tendiente a determinar no slo su composicin, sino su estado con respecto
a baches, trabajos en realizacin, disminucin de trochas, obstculos que diculten
la visin (por ejemplo, carteles, puestos de diarios, vehculos mal estacionados, etc.)
iluminacin, seales de trnsito, prioridades de paso, etc.; o en otros tipos de ac-
cidente conexiones elctricas, medidas de seguridad implementadas, cumplimiento
de normas, etc.
La otra ptica estar dada por los factores climticos que inciden sobre las
causales de produccin de accidentes, tales como: luminosidad natural, sol enceg-
uecedor, lluvia, nieve, hielo, neblina, inundaciones, estticas, humedad, etc.
74
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Identidad Humana: Por ser un temario tratado en una unidad de esta materia,
slo mencionaremos que permite establecer las identidades fsica, biolgica y psquica
de una persona, utilizando para ello todos los aportes que la ciencia y la tcnica of-
rece, que en la prctica, permite identicar en forma directa o indirecta al hombre,
conformando prueba o indicios que posteriormente debern ser evaluados por quien
tenga que impartir justicia.
Qumicas: a travs de estudios, anlisis y comprobaciones de este carcter
sobre tintas, papeles, plvoras, pinturas, manchas en general, etc.
El profesional universitario (perito), especializado en uno o varios temas tc-
nicos cientcos, una vez realizados los estudios y comprobaciones correspondientes
acorde a los interrogantes planteados, en forma metodolgica y sistemtica presentar
su resultado en un detallado informe que debe contener y valorar lo siguiente:
Fechado: Debe tenerse en cuenta que el fechado encierra adems del da, mes y ao, el
lugar en que se realiza el informe, ya que eso implica jurisdicciones judiciales y por ende
el uso de las normas de forma correspondientes.
Autoridad requirente: En caso de ser presentado ante un juez, debe precisar su compe-
tencia ya que ello requiere el cumplimiento de formas especiales. En materia penal segn
el artculo 263 del CPPN, El dictamen pericial podr expedirse por informe escrito o hac-
erse constar en acta .... En materia civil y comercial acorde al artculo 472 del CPCCN
El perito presentar su dictamen por escrito, con copias para las partes... debiendo los
consultores cumplir con los mismos requisitos.
Idoneidad del Perito: Para ambos cdigos de forma se requiere ttulo habilitante en caso
de que la profesin estuviera reglamentada. En caso contrario o cuando no hubiere peritos
diplomados, se podr designar cualquier persona con conocimientos en la materia (artculos
254 CPPN y 464 CPCCN). Asimismo los peritos deben inscribirse en las Cmaras de los
diferentes fueros, a n de ser incorporados en el listado que anualmente se confecciona y
de donde sern seleccionados por sorteo para intervenir en las diferentes causas.
Rol del perito: Acorde a lo dispuesto en ambas normas, el juez podr ordenar pericias
cuando, para conocer o apreciar algn hecho o circunstancia, se requieran conocimien-
tos especiales en alguna ciencia, arte o tcnica. (artculos 253 CPPN y 457 CPCCN). En
virtud de las diferencias que ambos cdigos presentan en cuanto:
a) la cantidad de peritos y las denominaciones que reciben acorde su rol; y
b) la forma de realizar los estudios y de las personas que pueden participar en ellos, se
detallar por separado cada circunstancia, comparando cada disposicin.
75
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
a) Cantidad y denominacin: En materia penal el perito designado por el juez tendr el Cantidad y denominacin: En materia penal Cantidad y denominacin: En materia penal rol de
perito de ocio si ha sido sorteado del listado confeccionado por las Cmaras, y el rol
de perito ocial si pertenece a alguna reparticin en la cual perciba sueldo por su tarea
como perito. Acorde al artculo 258 del CPPN, El juez designar de ocio a un perito salvo
que considere indispensable que sean ms.... Deber adems noticar de esta resolu- que considere indispensable que sean ms.... que considere indispensable que sean ms....
cin, bajo pena de nulidad, al ministerio scal, a la parte querellante y a los defensores
antes de que se inicien las operaciones periciales. En caso de suma urgencia o que la
indagacin sea extremadamente simple, se les noticar de su realizacin y que pueden
hacer examinar los resultados o pedir su reproduccin, de ser posible, por otro perito.
Las partes podrn proponer otros, a su costa, dentro de los tres das, los que actu-
arn como peritos de parte. (artculo 259).
En materia civil y comercial el juez podr designar perito nico de ocio, salvo ley
especial, en procesos de declaracin de incapacidad y de inhabilitacin o por nulidad de
testamento. En estos dos ltimos supuestos debern o podrn (respectivamente), nombrar
de ocio a tres peritos. Adems cada parte tiene la facultad de designar a un perito que
cumplir su funcin como consultor tcnico (artculo 458 CPCCN).
b) Forma: En materia penal Los peritos practicarn unidos el examen, deliberarn en
sesin secreta, a la que slo podr asistir el juez, y si estuvieren de acuerdo redactarn su
informe en comn. En caso contrario, harn por separado sus respectivos dictmenes....
artculo 262 del CPPN. Por el artculo 260 del mismo cuerpo, es facultad del juez la de
dirigir la pericia y jar los plazos en que debe expedirse el perito.
En la prctica una vez aceptados los cargos, el juez hace entrega de los elementos
a peritar al que cumple el rol de perito ocial o de ocio. Este debe citar a los restantes peri-
tos para iniciar en forma conjunta los estudios. Obtenidas las evaluaciones de los estudios
realizados por cada perito, se sesiona en forma secreta. De estar de acuerdo se suscribe
un nico informe. De surgir diferencias las mismas pueden ser parciales o totales.
De ser parciales, se deja expresamente detallada las concordancias y se sealan
las diferencias suscribiendo todos el informe, debiendo aquel que est en discordancia
efectuar un informe individual sobre las mismas, que puede ser presentado al perito ocial
para elevacin en forma conjunta, o bien lo puede presentar directamente en el juzgado.
De ser totales, se deja de ello expresa constancia en el informe del perito ocial o
de ocio, que debe ser igualmente rmado por todos como prueba de la realizacin
76
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
de los trabajos en forma conjunta y de las diferencias surgidas, debiendo aquel que
est en discordancia actuar de la manera ya sealada.
En materia civil y comercial la pericia estar En materia civil y comercial En materia civil y comercial a cargo nicamente del perito des-
ignado por el juez o sea el de ocio u ocial. Los consultores tcnicos, las partes
y sus letrados podrn presenciar las operaciones tcnicas que se realicen y formular
las observaciones que consideraren pertinentes (artculo 471 del CPCCN).
El perito presentar su informe con copia para las partes y los consultores
tcnicos podrn presentar por separado sus respectivos informes con iguales
requisitos y plazos, (artculo 472).
Con el n de completar el espectro referente a los peritos se consigna que tienen
Incapacidad o Incompatibilidad: los incapaces, los que deban o puedan abstenerse
de declarar como testigos, los eliminados del registro por sancin, los condenados o
inhabilitados (artculo 255 del CPPN).
Asimismo son causales de excusacin y recusacin para los peritos, las mis-
mas establecidas para los jueces (artculos 256 del CPPN y 466 del CPCCN). Con
respecto a la obligatoriedad del cargo, en materia penal, el designado tendr el deber
de aceptar y desempear elmente el cargo, salvo grave impedimento. Si no acudiere
a la citacin o no presentare su informe, incurrir en las mismas responsabilidades
sealadas para los testigos por los artculos 154 y 247 del CPPN.
En tanto que en materia civil y comercial se dan dos circunstancias distintas:
a) de no aceptar el cargo una vez propuesto o no concurriere dentro del plazo jado, se
nombrar a otro en su reemplazo y la Cmara determinar el plazo durante el cual
quedar excluido de la lista (artculo 469 CPCCN);
b) el que habiendo aceptado el cargo renunciare sin motivo atendible o no presentara su
informe, ser removido de su cargo y el juez lo condenar a pagar los gastos por daos
y perjuicios, perdiendo el derecho de cobrar los honorarios por las tareas realizadas
(artculo 470).
Objeto de la peritacin: se transcribirn los interrogantes periciales o dudas
planteadas por quien solicite la pericia, sobre los elementos indiciarios hallados du-
rante la investigacin. Debe tenerse en cuenta que no se puede responder a otros
interrogantes que los taxativamente planteados, -ya que hacerlo puede invalidar todo
el trabajo a pedido de alguna de las partes-, salvo que expresamente lo habilitaran a
77
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
extenderse en su participacin a cualquier otro dato de inters que pueda aportar
luz sobre los hechos investigados.
Tampoco puede dejar de tratar ningn interrogante, debiendo concluir con
algunas de las tres posibilidades que se detallarn oportunamente. Se hace expresa
mencin de que en el cumplimiento taxativo de lo ordenado por el juez, debe mensu-
rarse el no inducir a error con la respuesta dada. De ser as no slo puede sino que
debe efectuar las extensiones correspondientes.
A modo de ejemplo se detalla un caso concreto. El interrogante pericial pretende deter-
minar las adulteraciones que puede presentar un documento. Del estudio realizado surge que
el documento remitido para pericia no presenta ningn tipo de adulteraciones, pero es falso.
Contestar simplemente que no presenta adulteraciones, llevara al magistrado a considerarlo
sin irregularidades, lo que sera inducirlo a error por omisin de detalles. En esos casos la
opcin es indicar simplemente la falsedad o requerir ampliacin de los puntos a peritar.
Debe tenerse en cuenta que si bien es el juez quien ordena en denitiva, segn la
necesidad planteada en cada causa, los puntos de pericia, las partes pueden requerir
el cumplimiento de todas aquellas peritaciones que puedan aportar apoyo a sus dichos.
En la prctica el juez desestima aquellos que considera improcedentes, ordenando slo
los interrogantes que considere oportunos, sea a propuesta propia o de las partes.
Ello debe llevar a la reexin a quienes soliciten los interrogantes o hagan un interro-
gante mnibus, ya que una vez ordenados, los peritos deben contestarlos a todos, les resulten
favorables o no a los intereses de las partes, aunque stas sean quienes los han solicitado.
Elementos aportados: es el detalle de los elementos cuestionados o dbitos
cuya verdad se trata de establecer y de los elementos incuestionables o indbitos
que se aportan para confrontacin. Ambos elementos deben cumplir con los siguien-
tes requisitos:
Elementos dubitados: stos necesariamente deben aportarse en original por las siguientes
razones:
a) una copia fotogrca, fotosttica o efectuada por cualquier medio es el el reejo de
la verdad, salvo intervencin culposa o dolosa de quien la efectu, ya que es muy
simple producir modicaciones a travs de algn medio tcnico y
b) debe efectuarse siempre sobre el soporte, los estudios necesarios para determinar
si sobre l se han producido maniobras adulterativas por borrado, raspado, lavado,
78
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
cortado, etc., circunstancia que no sera posible sobre una reproduccin, donde
slo se podra estudiar el soporte de la copia.
Elementos indubitados: idealmente estos elementos deben ser anteriores, posteriores y
contemporneos a la fecha del documento dbito a n de poder confeccionar una historia
cronolgica acerca de las caractersticas y condiciones generales, con sus evoluciones
e involuciones a travs del tiempo, de/l/os elemento/s a cotejar.
Estos elementos deben provenir de documentos pblicos y privados, estos
ltimos de fecha cierta, que no tengan relacin con el juicio, es decir, que aseguren
las caractersticas normales de los mismos, fuera de toda afectacin.
Cabe destacar que es imperioso que el profesional abogado que requiera o que est
interesado en la produccin de esta prueba, aporte estos documentos o indique los organis-
mos pblicos o privados donde pueden encontrarse, a n de que el perito, portando el cor-
respondiente ocio judicial, pueda concurrir a los lugares especicados para su examen.
En caso de no existir documentos de estas caractersticas, se puede tomar cuerpos
supletorios, los que en principio son inidneos, debiendo recurrirse a ellos slo en caso
de extrema necesidad y siempre que se cumplan determinados requisitos. Estos, entre
otros, son: que se realicen con similares elementos escritores manuales o mecnicos,
con similares calidades de tintas, situaciones, caractersticas y muy especialmente en
presencia del perito, que debe implementar segn cada caso, las tcnicas de toma
correspondiente.
Debe tenerse en cuenta que en la realizacin de los mismos debe vencerse segn los
casos, el nerviosismo natural de toda persona que no siendo responsable de un ilcito, se ve
comprometido en actos procesales que pueden afectarlo, o las maniobras tendientes a eludir
las particularidades individualizadoras cuando el actor sea responsable, adoptando las formas
adecuadas que deben ser seleccionadas en el momento, acorde las caractersticas que se
vayan produciendo.
Fundamentos, anlisis, estudios y comprobaciones realizados: Este es el apartado
fundamental de todo estudio pericial ya que es donde se detallan, en forma metdica y
sistemtica, todos y cada uno de los pasos realizados por los peritos. Estos son los que
les permitirn a la postre, arribar a las conclusiones correspondientes. Si bien cada uno
de los pasos detallados precedentemente posee la importancia que de su lectura e inter-
pretacin se desprende, todos ellos son de caractersticas formales, siendo el presente
el que permite y sostiene con elementos objetivos, las opiniones subjetivas nales.
79
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Aqu se detallar todo el instrumental ptico-cientco utilizado para efectuar
los estudios, como as tambin las luces, longitudes de ondas, ngulos de inciden-
cia, ltros tonales, etc., y dems circunstancias que hacen a las condiciones en que
fueron realizados. Se consignar adems los fundamentos tcnicos, cientcos o
loscos sobre los que se basa la peritacin a realizar, como as tambin el detalle
de todos los estudios fsicos y qumicos realizados.
Sistemticamente segn los casos, se deben efectuar exmenes extrnsecos
o generalizados de todos los detalles de forma y de caractersticas globales, y
exmenes intrnsecos o pormenorizados de todas aquellas caractersticas cuya
observacin y estudio requiere del uso de aparatos de microscopa. El orden natural,
que puede variar segn los casos, es realizar los estudios primero sobre los elementos
indubitados a n de lograr el conocimiento de stos, luego igual procedimiento sobre
los dubitados y, posteriormente, efectuar comparacin o confronte a n de determinar
coincidencias o discoincidencias que permitan efectuar las evaluaciones.
Realizada la descripcin de las operaciones o estudios y asentados en detalle los hal-
lazgos producidos, se deber sealizar los mismos en lminas mediante procedimientos
fotogrcos, fotostticos o por escaneado a n de que, en forma ilustrativa, puedan
ser observados, comprendidos y reconocidos, tanto por conocedores del tema como
por legos.
Debe tener en cuenta el futuro profesional, que las observaciones, pedidos de ex-
plicaciones o impugnaciones que se realizan o pueden realizarse sobre un estudio pericial,
van a estar referidos a este apartado del informe, que es donde el perito puede demostrar
su idoneidad, capacidad, conocimientos, metodologa y tcnicas.
Todo trabajo realizado con rigor cientco debe cumplimentar las caractersticas
que distinguen al conocimiento global del cientco, es decir debe superar los pasos
de objetividad (objeto), sistematicidad y mtodo a los que nos hemos referido en la
primera unidad, a n de que dicho trabajo est en condiciones de ser vericado.
De haberse cumplimentado correctamente tanto los trabajos o estudios realizados
como la descripcin de los mismos, no importa la cantidad de peritos que intervengan,
todos debern haber observado objetivamente lo mismo, ya que la aplicacin de
los mismos elementos (aparatos de microscopa y luces) sobre un mismo objeto (el-
ementos dubitados e indubitados), en iguales condiciones (de aplicacin y tiempo)
va a producir, inexorablemente las mismas situaciones.
80
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
La evaluacin de los resultados obtenidos y su valoracin cualicuantitativa podr
ser diferente para cada perito en particular, ya que esa apreciacin es de carcter
subjetivo, por no ser una disciplina de las denominadas exactas como las matemti-
cas.
A n de una mayor comprensin de lo explicado se incluye el siguiente ejemplo: un
paciente enfermo concurre a consulta y es atendido por dos mdicos en forma simultnea.
Ambos, objetivamente, van a observar y mensurar idnticos sntomas sobre ese
paciente. La valoracin de los sntomas ser de carcter subjetivo y, dentro de los
lmites de la sana lgica, se podr arribar a diagnsticos distintos.
Conclusiones: efectuada entonces esa valoracin cualicuantitativa los peritos podrn arribar
a sus conclusiones, las que en forma genrica pueden ser de tres tipos, acorde al siguiente
detalle:
a) CONCLUSIN POSITIVA, esto es la contestacin categrica de los interrogantes plant-
eados, entendindose por ello que las dudas expuestas en la causa y que motivaran el
asesoramiento requerido por el juez, han sido denitivamente resueltas, tanto sea que,
por ejemplo, se haya determinado la participacin de una persona en unos escritos
o rma o que se haya comprobado su no participacin.
b) CONCLUSION NO POSITIVA: es aquella en que por no haberse contado con los
elementos de cotejo en cantidad y calidad necesaria, no ha podido concluirse en
forma positiva, debindose dejar perfectamente aclarado que de conseguirse los mis-
mos, se deber efectuar un nuevo estudio pericial, y
c) CONCLUSION IMPOSIBLE: que se da en aquellos casos en que a la fecha no ex-
isten fundamentos tcnicos y/o cientcos que permitan contestar los interrogantes
planteados. A diferencia del caso anterior, ac no depende de la obtencin de nuevos
elementos indubitables para cotejo, sino de la determinacin de procedimientos de
base tcnicas que permitan su resolucin. Otras de las causales, es que el elemento
dubitado no reuna las condiciones necesarias para el desarrollo de los estudios.
Efectuado el presente detalle, se hace necesario indicar que un desarrollo no acorde
a ese esquema, en modo alguno indica que el informe o los estudios y comprobaciones
realizadas no sean correctos. All se han cumplimentado todos los pasos que corresponde
a un desarrollo completo de la tarea pericial. Su conocimiento le permitir al profesional
abogado, mensurar las caractersticas generales del contenido de un informe, sirvindole
de base para evaluar futuros informes en las causas en las que intervenga.
Se hace necesario asimismo destacar la gran diferencia que existe entre la tarea
del perito y la del testigo. El testigo debe relatar los hechos acorde a lo captado a
81
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
travs de sus sentidos; si el perito tuviera como funcin hacer hablar a los testigos
mudos y luego contar lo que estos le dicen, no estara cumpliendo su funcin de
perito sino la de testigo, ya que estara relatando los hechos captados a travs de sus
sentidos como si esos testigos mudos se los hubieran manifestado.
La tarea del perito tiene un principio bsico pero fundamental, que es propio de su
funcin. Este principio lo obliga a no armar nada que no pueda demostrar. Esto indica
que su tarea es puntualizar o sealar lo que esos indicios revelan, en forma objetiva.
Luego de la descripcin y sealizacin en lminas ilustrativas de todo lo hallado, s
podr efectuar las evaluaciones, que le permitirn alcanzar sus conclusiones.
Acorde al rigor cientco demostrado en su informe, a la claridad de sus dichos en el
uso de un lenguaje informativo, el detalle de los fundamentos tericos cientcos y loscos
que para cada tipo de pericia debe consignar, la descripcin y sealizacin efectuada sobre
lo hallado en los testigos mudos relacionados con esos fundamentos, la base que sustente
sus conclusiones y las demostraciones efectuadas, se le podr solicitar al perito actuante las
explicaciones necesarias que sirvan para esclarecer o sostener sus conclusiones, y
en caso de falta de rigor cientco o sustento, se podr impugnar la pericia.
El juez, o las partes a travs de ste, podrn solicitar que el perito efecte las explica-
ciones necesarias sobre todas aquellas cuestiones que no hayan sido detalladas con precisin
en el informe, o de las condiciones, situaciones o evaluaciones que hubiere efectuado y no
hubieren quedado sucientemente claras. Asimismo sobre extralimitaciones realizadas, ya sea
por haber contestado ms de lo requerido o menos. Estas explicaciones segn lo determine
el juez, podrn efectuarse por escrito o en forma verbal, pudiendo estar presentes las partes,
peritos o consultores tcnicos.
Cuando las explicaciones formuladas, el informe o los estudios realizados no tuvi-
eran sustento tcnico cientco o se determinaren falencias graves de forma y/o fondo, el
juez, o las partes a travs de ste, podrn pedir la impugnacin de la pericia en forma total
o parcial. Esta impugnacin, de ser acordada, trae aparejada la anulacin de la pericia en
todo o en parte y la necesidad de una nueva peritacin.
Si bien en materia penal no est expresamente dispuesto en el Captulo V Peritos,
del Ttulo III, Libro II del Cdigo Procesal Penal de la Nacin esta circunstancia, no slo est
avalado por la jurisprudencia y la sana crtica, sino por la lgica y el raciocinio.
En materia civil y comercial en el Libro II, Ttulo II, Captulo V, seccin 6ta. Prueba de Peritos, En materia civil y comercial En materia civil y comercial
del Cdigo Procesal Civil y Comercial de la Nacin, en el artculo 473 taxativamente seala que
82
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
...De ocio o a instancia de cualquiera de ellas (se reere a las partes) el juez podr ordenar que
el perito d las explicaciones que se consideren convenientes, en audiencia o por escrito.....
El mismo artculo expresa que si el acto se cumpliera en audiencia y los consultores
tcnicos estuvieren presentes, con autorizacin del juez, podrn observar lo que fuere perti-
nente; si no comparecieren esa facultad podr ser ejercida por los letrados. Si las explicacio-
nes debieran presentarse por escrito, las observaciones a las dadas por el perito podrn ser
formuladas por los consultores tcnicos o, en su defecto, por las partes... Asimismo indica
que Cuando el juez lo estimare necesario podr disponer que se practique otra pericia o que que
se perfeccione o ample la anterior, por el mismo perito u otro de su eleccin....
Ese mismo artculo expresa ... La falta de impugnaciones o pedidos de explicaciones
u observaciones a las explicaciones que diere el perito, no es bice para que la ecacia proba-
toria del dictamen pueda ser cuestionada por los letrados.... El artculo 477 expresa La fuerza
probatoria del dictamen pericial ser estimada por el juez teniendo en cuenta la competencia
del perito, los principios cientcos o tcnicos en que se funda, la concordancia de su aplicacin
con las reglas de la sana crtica, las observaciones formuladas por los consultores tcnicos o
los letrados, ..... y los dems elementos de conviccin que la causa ofrezca.
CRIMINALSTICA: teniendo en cuenta su funcin, esta disciplina utiliza tres tipos de mtodos
bien diferenciados uno de otros. El primero es el investigativo es decir, todos los aportes
que la criminalstica puede brindar en la escena donde se ha cometido un hecho tendientes
a encontrar, sealizar, levantar, proteger, conservar y asegurar legalmente los elementos
que inexorablemente quedan, de los que nos ocuparemos ms adelante al desarrollar el
retrato del lugar del hecho.
Otro es el mtodo pericial, donde los peritos a travs de todas los procedimien-
tos tcnicos y cientcos hacen hablar a esos testigos mudos y donde a travs de las
demostraciones efectuadas en sus informes permiten, que aun los legos, visualicen
y comprueben esos dichos.
Por ltimo, el mtodo preventivo. Debe tenerse en cuenta que si es posible
llegar a la verdad sobre un hecho luego de que este ha sido producido, por contrario
imperio tambin es posible adoptar los recaudos preventivos necesarios antes de su
produccin. Esto ha permitido adoptar, entre muchas otras, las medidas de seguridad
documentales que actualmente se utilizan en todos los documentos y en papeles
monedas nacionales y extranjeros y en valores cursables que los representan, temas
que analizaremos en las unidades correspondientes.
83
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Por todo ello, la Criminalstica ofrece un amplio campo contributivo que no todos
han logrado advertir, recurrindose a ella y a sus peritos slo en acontecimientos extremos
o espordicos, desaprovechando as una asistencia que puede ser determinante y que es
aplicable en casi todos los rdenes de la vida, no slo en el campo litigioso, sino tambin
en la faz preventiva, tanto en seguridad documental como en la valorizacin de actos o
procedimientos, debindose recurrir a ella no slo despus de un hecho, sino antes.
Actualmente, a diferencia de hace unos aos atrs, no se discute que ambas
disciplinas cientcas, la Criminalstica y la Medicina Legal, son autnomas y tienen
sus propios fundamentos e incumbencias ya que, si bien muchas tareas pueden ser
conjuntas, cada una se realiza dentro de su campo de accin y que, an estando
ntimamente ligadas, ninguna puede reemplazar a la otra.
Denida ya la Criminalstica, resta ahora denir a la Medicina y a la Medicina
Legal para comprender mejor sus interrelaciones y sus diferencias:
Entendemos por Medicina (del latn mederi, curar, cuidar) a la ciencia cuyo objeto
es el estudio de las enfermedades, de su tratamiento y de su prevencin. Es decir su
tarea es la de curar el cuerpo y la salud. Acorde a sus diferentes especialidades se
las puede clasicar en: medicina interna o clnica mdica que estudia las enferme-
dades y sus tratamientos medicamentosos; la medicina quirrgica encargada del
tratamiento cruento de las afecciones; la medicina preventiva o de normas higinicas
y de medidas prolcticas para prevenir las enfermedades; la medicina veterinaria
encargada del tratamiento y curacin de las enfermedades de los animales.
La medicina legal trata los problemas biolgicos y mdico-quirrgicos en rel-
acin con las ciencias jurdicas y sociales. Es decir su tarea no es la de curar sino la
de informar, requiriendo para ello de un funcionario pblico para extender certicados
de peritaje o informes forenses.
La medicina legal utiliza diferentes ramas de la medicina y de la antropologa. As
presta una fundamental tarea en la resolucin de los innumerables casos concretos donde
el conocimiento mdico se torna indispensable, que deben ser dilucidados en los tribunales
de justicia y sin cuya intervencin no podran ser resueltos. Acorde a sus funciones se la
puede subdividir en medicina jurdica y medicina forense.
La Criminalistica y la medicina legal
84
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
La jurdica contribuye en todos aquellos casos en que se necesitan conocimientos
mdicos y biolgicos para la formulacin, interpretacin y aplicacin de disposiciones jurdicas.
La forense trata de resolver aquellas cuestiones concretas que se presentan ante los estrados
judiciales y administrativos. En los siglos XVIII y XIX la medicina legal comienza a diferenciarse
como una ciencia autnoma, transformndose en un verdadero auxiliar de la justicia.
Al igual que la medicina legal, la criminalstica es un importante auxiliar de la justicia,
pero como puede apreciarse a travs de sus deniciones y de las tareas que cada una de
ellas cumplen, sus diferencias y autonoma quedan perfectamente aclaradas. En casos
especiales como en balstica, es posible tanto para un criminalstico como para un mdico
legista determinar sobre oricios de entrada y salida, distancias de disparo, calibres utilizados,
etc. Pero obviamente sobre balstica interior y exterior, el mdico legista no podr intervenir,
como as tampoco corresponde la intervencin del, experto criminalstico en la valoracin
de los daos corporales, trayectorias internas y mecanismos de la muerte. Ambos pueden
trabajar en forma independiente o concomitante sin invadir tareas ajenas, pero valorando
circunstancias en forma conjunta como por ejemplo en casos de suicidio, ahorcamientos,
muertes violentas, etc. donde cada uno, en su especialidad, puede relacionar elementos
del lugar del hecho y que, como testigos mudos revelan para quien conoce su lenguaje,
una cantidad de pistas posibles de conducirnos al esclarecimiento de los hechos, tambin
de las personas con este relacionadas.
La Criminologa estudia al hombre como ser potencialmente capaz de cometer
delitos y las conductas humanas que deben ser tipicadas como tales. A diferencia de
la Criminalstica que determina el cmo, el cundo, el dnde y el quin? del hecho
delictuoso, la Criminologa estudia el por qu.?
A los nes de una introduccin didctica al mundo criminolgico y a la criminologa
en s (que es una prxima materia de estudio), diremos que la humanidad en toda su exis-
tencia y hasta un tiempo relativamente cercano, slo haba considerado como materia de
anlisis criminolgico, el estudio de las conductas que deban ser reputadas delictivas.
As la Escuela Clsica del Derecho Penal consideraba que slo se deba eval-
uar esas conductas antisociales para reputarlas como delitos, considerando a stos
como entes jurdicos. Para la concrecin de los hechos tipicados como tales, deba
intervenir el libre albedro, es decir la capacidad humana de decidir la ejecucin o no
del mismo. Si en forma libre se decida cometer un delito, la pena deba establecerse
como responsabilidad moral y deba ser adems proporcional al dao cometido. Pe-
Criminalstica y criminologa
85
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
nas stas que eran aplicadas en forma ja una vez establecida la ejecucin fctica y
racional del hecho. Consideraba a los enfermos mentales como inimputables por no
poder elegir libremente.
Establecido el autor material del hecho mediante las formalidades judiciales
correspondientes a cada poca y lugar, se aplicaban las penas previstas y se cumplan
las sanciones correspondientes.
Los delitos por no ser universales ni eternos, varan acorde a culturas, lugares y
tiempo. Las conductas tipicadas como delito en un pas determinado hoy, puede no
serlo maana, o puede no serlo en un pas limtrofe. Por eso se hace necesario estudiar las
conductas referidas a cada sociedad y a cada tiempo, evaluar los grados de peligrosidad
de esas conductas y sancionarlas segn corresponda, debindose estar en permanente
estado de alerta a las necesidades siempre dinmicas de cada lugar y poca. Tipicadas
las mismas cualquiera que fuere que las realizara, deba ser sancionado.
No es sino hasta pasada la mitad del siglo XIX, donde comienza la verdadera revo-
lucin en esta disciplina. En efecto, el mdico forense italiano Don Cesare Lombroso en su
libro El hombre delincuente, expresa que haba determinado anomalas congnitas de
morfologa estructural orgnica en los criminales cuyas necropsias haba realizado. Esto le
permiti elaborar su teora, sustentada en todo su accionar como mdico patlogo en la
Morgue Judicial de Roma, donde colige que estas anomalas seran las causales que los
condicionaron o predeterminaron a cometer delitos.
Dedujo as que el hombre no elega ser delincuente, sino que fuerzas atvicas pro-
vocaban anomalas orgnicas en determinadas personas y estas se vean compelidas a
cometer delitos, an sin su voluntad. Esta teora caus profundo efecto en el mundo crimi-
nolgico, ya que deba considerarse la concrecin de un hecho como resultado de fuerzas
exgenas al hombre predeterminismo- y no como producto de su voluntad. Esto los
transformaba de victimarios en vctimas.
Posteriores determinaciones establecieron por un lado que, algunas personas sin
esos estigmas orgnicos, haban tenido sin embargo una larga trayectoria delictiva y por otro,
que otras personas presentando algunas de esas anomalas, no haban cometido jams un
delito. Esto que probaba lo errneo de la teora lombrosiana y como lgica consecuencia
su refutacin, ocasion como efecto contrario, una verdadera revolucin criminolgica.
Junto con Garfalo y Ferri crearon una nueva cosmovisin del mundo delictivo naciendo la
Escuela Positiva. Negaron el libre albedro y consideraron como factor de causalidad
86
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
al determinismo atvico o paso atrs en la evolucin del hombre. La pena ya no era
una responsabilidad moral del delincuente, sino una medida cautelar contra su pelig-
rosidad. Adems no deba ser una pena ja, sino que esta debera jarse teniendo en
cuenta las particularidades de cada delincuente, segn su grado de peligro.
La Criminologa moderna, sin perjuicio de las distintas clasicaciones delincuenciales,
teniendo en cuenta los factores psquicos, sociales, culturales, etc. del hombre, engloba en
la Escuela Eclctica Pragmtica los tres parmetros a tener en cuenta: las conductas
que previamente deben ser tipicadas como delito, el hombre que las realiza valorando
su libre albedro y las causales endgenas que intervienen en la formacin de su per-
sonalidad; a las victimas que la padecen para interpretar su rol y de all valorar el rol
del delincuente y por ltimo las penas con un amplio margen de mnimos y mximos
para que su aplicacin sea tema de estudio y valoracin del magistrado en cada caso.
Como se comprender esta escuela no hace otra cosa que tomar conceptos de las
otras dos y en forma prctica o pragmtica vincula ambos conceptos.
Los cdigos penales de la mayora de los pases del mundo, incluyendo la Argentina,
adoptan la postura de esta escuela, valorando el libre albedro y las circunstancias especiales
de cada hombre delincuente y vctima, sin perder de vista la permanente y dinmica nece-
sidad de evaluar las conductas humanas, tipicar las atpicas y las antisociales y legislarlas
como antijurdicas o delitos, con penas que cumplan funciones de reparacin de daos sin
perder de vista la evaluacin del grado de peligrosidad individual.
En el cumplimiento de cualquiera de sus funciones y en todos los captulos temti-
cos detallados, la Criminalstica encuentra permanente y fecunda interrelacin con otras
disciplinas tcnicas y cientcas que aportan o pueden aportar auxilio en el cumplimiento
de las tareas que le son propias.
As recurre a las artes grcas para la determinacin de medidas de seguridad
documentales y en papeles monedas. A la ingeniera y arquitectura en casos espe-
ciales de incendios, explosiones y determinaciones de peligrosidad; al dibujo tcnico
en la confeccin de croquis, planos e identicacin de personas; a la fotografa
tanto de lugares, de multitudes o a travs de microscopios o aparatologa tcnica; a
la computacin para la comprobacin automtica de identidad humana; a la fsica
para el uso de luces, sus longitudes de ondas, frecuencias, mediciones; etc.
La Criminalstica y otras ciencias
87
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
sf
sntesis nal
abogaca a distancia
)
Por naturaleza: eminentemente social
Por conducta: socialmente conictivo
Por derechos: amparados por ley
Por obligaciones: requiere correctivos
Para autoridad: jurisdiccin y competencia
Para juzgar: conocer la verdad
Para imparcialidad: dar a cada uno lo que le corresponda
Para justicia: aplicacin de la ley
La providencia o el juicio de las Ordalas
La Confesin o Reina de las pruebas
El testimonio
La prueba indiciaria o testigos mudos
Determinacin del hecho, sea delictivo o no
Determinacin del autor o autores
Conformacin de la prueba material
Responde al: Cmo, cundo, dnde y quin?
HOMBRE
REQUISITOS JUZGADOR
EVOLUCIN MEDIOS DE PRUEBA
CRIMINALISTICA
CAPITULOS
Documentolgico, tambin llamado caligrco o scopomtrico
Balstico: estudia balstica interior, exterior y de efectos
Identidad Humana: sistemas de identicacin directo e indirectos
Accidentologa: general, del hogar, laboral y vial
Qumicas: aplicacin de este orden de tcnicas
88
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Fechado. Importancia para las jurisdicciones
Autoridad requirente: segn competencia
Presentacin perito, habilitacin y rol desempeado
Objeto de la peritacin: reproduccin de interrogantes
Elementos ofrecidos: dubitados e indubitados
Operaciones, estudios y comprobaciones realizadas
Conclusiones periciales
Pedidos de explicaciones e impugnaciones
Investigativa: aporte de la tcnica cientca en el lugar del hecho
Pericial: interrogatorio de los testigos mudos por parte de los peritos
Prevencional: aportes tcnicos cientcos para dicultar fraudes
Con la Medicina y Medicina Legal
Con la Criminologa
Con otras: ingeniera, fsica, arquitectura, fotografa, dibujo, etc.
Habilitacin e indoneidad
Diferentes roles acordes a designaciones y funciones
Excusaciones y recusaciones. Inhabilitaciones
Responsabilidades
Diferencia con los testigos
FUNCIONES
DIFERENCIAS
PERITOS
INFORME PERICIAL
89
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD II )
n ALBARRACIN, Roberto; Manual de Criminalstica; Editorial Policial; Bs. As. 1971.
n GUZMAN, Carlos; Manual de Criminalstica; Ed. La Rocca; Bs. As. 1997.
n BONILLA, Carlos; La pericia en la Investigacin; Ed. Universidad. Bs. As. 1996.
n Revistas Mundo Policial; Editorial Policial.
n DEL PICCHIA, Jos; Tratado de Documentoscopa; Ed. La Rocca. Bs. As. 1993.
Bibliografa obligatoria
Bibliografa optativa
u3
unidad tres
investigacin cientca del delito
) (
93
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD III
( INVESTIGACIN CIENTFICA DEL DELITO )
1. La Inspeccin Ocular. Importancia de no alterar el lugar donde se han producido los
hechos.
2. Estudio de los diferentes mtodos que pueden implementarse para asegurar su correcta eje-
cucin.
3. Tcnicas de ejecucin para asegurar el lugar, determinar testigos que puedan aportar
datos y elaborar una hiptesis de produccin de los hechos.
4. Prioridades en la intervencin. Registro fotogrco o por otros medios para congelar
la escena.
5. Bsqueda, revelado, sealizacin y registro de los rastros hallados.
6. Formas de levante, conservacin y traslado de testigos mudos.
7. Reglas de precisin, integridad y mtodo enunciadas por Marchessau.
8. Planos de Kenyers. Formas de cumplimentarlos para transformar la prueba testimonial
en prueba material.
9. Evaluacin de los trabajos oportunamente realizados para sostener o desvirtuar la prueba
producida a partir de la inspeccin ocular.
10. Concepto absoluto y relativo de los indicios.
Mencin sinttica de los contenidos
94
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
95
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n A travs del concepto de El Retrato del Lugar del Hecho, tomar conciencia que el
mismo permite tanto al Juez, como al Ministerio Fiscal y a los abogados de las partes,
conocer el lugar donde se produjeron los hechos
n Comprendido esto, valorar la importancia de la realizacin de una Inspeccin Ocular
hecha en tiempo y forma, y por qu debe ser considerada como un hecho nico e ir-
reproducible.
n Introducirnos en la metodologa que se debe implementar en su realizacin, para que
su resultado alcance rigor tcnico y cientco.
n Al precisarse la importancia del cumplimiento sistemtico de cada uno de sus pasos,
se pone al descubierto los errores que su inobservancia puede ocasionar y que en
denitiva, redundan en la posibilidad cierta del esclarecimiento de los hechos.
n Comprender por qu cada una de las partes intervinientes en la misma deben ocupar,
para no alterar o desvirtuar su cometido, un orden de prioridad que debe ser respetado
en toda ejecucin.
n Conocer, para poder evaluarlas, las diferentes tcnicas a implementarse segn los
lugares donde se practique la inspeccin ocular ya que, acorde a sus caractersticas,
deben utilizarse una u otras.
n Conocer qu y cules son las formas de bsqueda de los testigos mudos, cmo pueden
encontrarse y qu aptitud se debe adoptar en cada caso para su sealizacin, su registro y
las formas para su levante, para evitar anomalas que puedan hacerles perder su valor.
n Detallar las normas que imponen su realizacin, a n de poder vericar el cumplimiento
de las formas que la ley establece.
n Entender que, una vez hallados esos rastros, deben tomarse ciertos recaudos que
hacen a su conservacin, remisin y entrega, para que no pierdan su efectividad.
n Diferenciar los conceptos de prueba testimonial y material, como as tambin los con-
ceptos de prueba e indicio.
n Comprobar las exactitudes o falencias de los procedimientos cumplimentados, para
poder valorar dentro de las reglas de un sano razonamiento, a este importante medio
investigativo.
96
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
97
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD III )
Oportunidad para su realizacin
Actuacin irreproducible
Disposiciones legales a cumplimentar
Adopcin de mtodo acorde a circunstancias
Asistencia urgente a las vctimas
Aseguracin del lugar para evitar contaminacin
Interrogatorio e identicacin testigos
Inspeccin previa para elaboracin de hiptesis
Registro fotogrco o flmico
Participacin ordenada y sistemtica de peritos
Forma en que se pueden hallar los rastros o testigos mudos
Sealizacin y registro una vez revelados
Levante acorde a estados y a recaudos legales
Proteccin, embalaje, aseguracin, conservacin y traslado
Entrega al tribunal o a peritos
Reglas de procedimiento
INSPECCIN OCULAR
98
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
99
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Como actividad inicial de esta unidad y para comenzar a familiarizarse con los temas que
se tratarn, lea y analice el siguiente texto tomado del Manual de Criminalstica de Roberto ALBAR-
RACIN de la Editorial Policial, donde se detallan los pormenores de una inspeccin ocular. Si bien
el texto relata un hecho de hace varias dcadas atrs, sigue teniendo total vigencia.
actividad introductoria
ai
abogaca a distancia
)
Concluida la lectura, efecte un breve comentario sobre los aciertos que se destacan del
accionar el funcionario interventor y mensure los errores que podra haber cometido. Acorde a sus
conocimientos actuales, evale la situacin y la forma de encarar la causa, colocndose tanto en el
rol de abogado de la querella, como en el de la defensa.
100
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
101
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD III )
El Retrato del lugar del Hecho o Inspeccin Ocular debe encuadrarse dentro del
accionar investigativo de la Criminalstica, ya que su intervencin es requerida luego de
haber ocurrido un hecho delictuoso o de apariencia delictuosa. Tomado conocimiento del
mismo por parte de la autoridad correspondiente, sta debe abocarse sin demora alguna
a efectivizar todas las diligencias necesarias para su averiguacin.
En la casi totalidad de los hechos, es el funcionario policial el primero en arribar al
lugar donde ste se ha producido, tomando conocimiento de las circunstancias que lo
rodean, determinando el tipo de accin penal -acorde a lo dispuesto en el artculo 71
del Cdigo Penal- y de corresponder su participacin, debe abocarse a lo dispuesto
en el artculo 184 inciso 2del Cdigo de Procedimientos en Materia Penal, es decir
a cuidar y conservar los rastros materiales y a preservar de modicaciones el lugar
hasta que lo disponga la autoridad judicial competente.
En la prctica, el arribo o la disposicin fctica de la autoridad judicial en el lugar
de los hechos slo se efectiviza en muy contadas ocasiones, por lo que la ley le conere
como atribuciones dentro del mismo artculo en su inciso 4, ante el peligro de que cualquier
demora comprometa el xito de la investigacin, la facultad de hacer constar el estado de
las personas, de las cosas y de los lugares, mediante inspecciones, planos, fotografas,
exmenes tcnicos y dems operaciones que aconseje la Polica Cientca.
Esta norma surge de la experiencia y del conocimiento, ya que cuando se comete
un hecho, quedan en el lugar un conjunto de rastros, huellas, objetos, seales y manchas
de diversas naturaleza que a prima facie pueden orientar la investigacin y que posterior-
mente pueden transformase en las evidencias o las pruebas, que permitan la determinacin
fehaciente del hecho y la individualizacin de sus autores.
Las diligencias practicadas por la autoridad competente y que tienen como nali-
dad la bsqueda, proteccin, levantamiento, conservacin, vinculacin y posterior envo a
los laboratorios periciales para su evaluacin, de los indicios o huellas que quedaran en el
lugar del hecho, es lo que se denomina Inspeccin Ocular, que por sus caractersticas Inspeccin Ocular Inspeccin Ocular
y resultados toma tambin el nombre de Retrato del Lugar del Hecho.
Retrato del lugar del hecho
102
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Como se viera en la unidad anterior, la bsqueda de la verdad de un hecho debe
hacerse a travs de elementos objetivos, donde la subjetividad no pueda alterarla, ni an en
forma involuntaria. La inspeccin ocular tiene como objeto entonces, analizar las circunstan-
cias de un hecho en procura de esos testigos mudos. Para que su resultado aporte
los mltiples benecios que de ella se desprende, es de vital importancia efectuarla
en forma metdica y sistemtica, cumpliendo las normas de forma que cada jurisdic-
cin imponga.
A n de precisar con exactitud los trminos utilizados, se aclara que se denomina
lugar de los hechos, al espacio de forma y extensin variable donde se concret
el mismo, sus actos preparatorios y/o posteriores. En los mismos, por muy prolija
que haya sido la intervencin de su autor o autores, siempre quedarn rastros de su
produccin y de sus interventores. El minucioso estudio de esos lugares, contribuir
a conformar la prueba indiciaria y con ella el probable de la verdad.
Por las circunstancias descriptas debe ser realizada con atencin, esmero, minucio-
sidad e imparcialidad. Es tanta y tan diversa la gama de elementos que pueden constituir
evidencia, que requiere de personal altamente capacitado para su realizacin y de una
alta rigurosidad tcnica en su ejecucin. Debe tenerse en cuenta que es un acto nico
e irreproducible, ya que el mismo accionar de los investigadores y la bsqueda y
recoleccin de rastros, modica en forma inexorable ese lugar.
Es entonces, una fuente informativa de los mecanismos de produccin y ejecucin
de un hecho. Los datos aportados, sin embargo, deben ser descifrados y al igual que las
piezas de un rompecabezas, deben ser interpretados y vinculados correctamente.
Como se comprender, la correcta ejecucin de estas diligencias es fundamental
para los resultados a obtenerse. Adems cuanto ms rpido se haga, mejores sern sus
logros. Empero son varias las causales que inciden sobre los mismos. En algunos casos,
la ansiedad por determinar la magnitud de su infortunio hace que la vctima manosee el
lugar, remueva u ordene lo alterado. En otros, los curiosos o familiares que se acercan al
lugar, sacan el arma para evitar que pueda ser tomada por los nios o limpian la sangre
u otras manchas antes que stas daen muebles o alfombras.
Todos deberamos tomar conciencia de que ese lugar no puede ser alterado hasta
que no se realicen sobre l, todas las diligencias tcnicas y cientcas que permitan el es-
clarecimiento el hecho.
103
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Cada hecho en particular debe ser considerado como una entidad nica, ya
que las circunstancias, personas o cosas involucradas en l, los sern. Sin embargo
la correcta realizacin de una inspeccin ocular, requiere cumplir metodolgica y
sistemticamente todos y cada uno de los pasos necesarios en el orden o secuencia
correspondiente. An debindose tener en cuenta cada caso en particular, el proced-
imiento adecuado recomienda el cumplimiento de los siguientes requisitos:
l Comprobar la necesidad de asistencia a las personas involucradas. Esto es prioritario.
Como es lgico, prestar el urgente auxilio a quien lo requiera se torna primordial, an a costa
de la prdida de rastros o huellas fundamentales para el esclarecimiento del hecho.
Todas las personas involucradas en un hecho que presenten lesiones de cu-
alquier tipo deben ser urgentemente examinadas, tratadas o en su caso trasladadas
a nosocomios o lugares adecuados. Bajo ningn pretexto, por grave o riesgoso que
esto pueda resultar para el buen desarrollo de la causa, puede posponerse esta asis-
tencia. Esta regla o premisa es incuestionable.
En los casos en que dicha asistencia no deba cumplimentarse, por ms grave
que sea el hecho, por ejemplo un homicidio donde ya no hay nada que se pueda
hacer para ayudar a la vctima, la regla o premisa es que no se puede alterar o
mover nada, hasta que no se hayan realizado todas las cooperaciones tcnicas
o cientcas posibles.
l Asegurar el lugar por cualquier medio que fuera. Esto implica que no accedan al
lugar del hecho y a sus zonas de inuencias personas que, an con afn de ayudar, lo
contaminan, destruyendo involuntariamente rastros fundamentales o provocando otros
ajenos al hecho, con la consiguiente prdida de tiempo y esfuerzo que conllevan su
anlisis, estudios y descartes.
La tcnica ms simple es la de cercar con cintas, cuerdas, hilos, personas, etc. el
lugar, debindose tener en cuenta que no se debe proteger slo el lugar exacto donde se
encuentra el cadver por ejemplo, sino tambin las zonas perimetrales y adyacentes.
Cuando ocurre un hecho grave y se da cuenta a la autoridad policial, la dependencia
que desplaza mviles autoriza adems de los que poseen competencia por lugar, a otros
que estando en las cercanas puedan brindar ayuda o intervenir en el hecho urgente. Esto
en la prctica hace que en muchos casos se renan varios funcionarios policiales prestos
a intervenir, auxiliar y participar activamente en hacer cesar el hecho, proteger y auxiliar a
las vctimas y proceder a la detencin de los autores.
104
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
De estar an los autores en el lugar o ante la necesidad de auxiliar a las vctimas, su
accionar resulta altamente ecaz, resultando invalorable su presteza y abnegacin. Lgica-
mente la determinacin de estas circunstancias slo es posible apreciarlas al llegar al lugar
e intervenir y luego de adoptadas las medidas adecuadas.
En los casos en que se determina que no es necesaria su participacin y/o luego
de su participacin necesaria, se pone en evidencia las partes negativas de este ac-
cionar, que no slo no puede repararse en ese caso particular, sino que seguramente
volver a ocurrir en circunstancias anlogas.
La presencia de muchas personas en el lugar donde se ha producido el hecho, trae
aparejado que sus desplazamientos borren, oculten, anulen o destruyan rastros o huellas
que a la postre hubieran podido resultar fundamentales en el esclarecimiento del mismo.
Adems as como los autores sin querer dejaron sus rastros, ese personal desplazndose,
dejar de igual manera otros totalmente desvinculados con el hecho.
La prdida de aquellos y el hallazgo, recoleccin y estudio de stos, ocasionan ver-
daderas circunstancias negativas que inciden en el resultado nal de la investigacin. Sin
embargo, como se comprender, esto es inevitable y no puede remediarse. Por ello se hace
indispensable que todo lo que s pueda evitarse, deba ser cumplido rigurosamente.
Volviendo al ejemplo del rompecabezas, se puede ampliar el concepto del tema
tratado. Consideremos al hecho resuelto como un rompecabezas completo y armado. El
mismo puede estar compuesto de muchas piezas que ocuparn un determinado lugar y que
encastrarn adecuadamente con las otras. La falta de unas pocas piezas no nos impedir
determinar su dibujo completo, pudindose apreciar cabalmente su forma, extensin y
caractersticas. Idnticas circunstancias ocurren con un hecho determinado.
Cuando se adquiere este pasatiempo en un negocio, por muchas que sean las pie-
zas que lo componen, tenemos la certeza de que todas les pertenecen y que nuestra tarea
slo ser ubicarles su posicin y encastrarlas con las restantes. En un hecho se recogen
en el lugar todos los rastros, huellas y manchas que se detecten, sin saber si pertenecen
al mismo o no. Es decir no estn sealizadas cules son atinentes y cules no. El buscar la
posicin de una pieza es tarea no fcil, pero es an ms difcil si esa pieza no corresponde
a ese juego. Esto resulta cuando lo analizado es un rastro o huella dejado por algunas de
las personas que pasaron por el lugar, pero que no participaron del hecho.
Otra circunstancia negativa es la prdida de rastros o huellas. Algunas piezas del
entretenimiento mencionado pueden resultar imprescindibles como guas de otras. Su falta
puede ser determinante en su armado nal. Esto puede ocurrir si se destruye o pierde un
rastro por el accionar de personas no vinculadas con el hecho.
105
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El armado del hecho necesita sin duda, que no se pierda ninguna pieza fundamental
ni se agreguen otras que nos induzcan a error. Ello requiere proteger el lugar utilizando
para ello el procedimiento o la tcnica ms fcil, rpida y ecaz.
l Interrogar e identicar a todas las personas que se hallaren en el lugar o en sus
adyacencias, mientras an tengan frescos los detalles y antes de que puedan alejarse.
Esta necesidad est receptada por el cdigo de forma en materia penal en su artculo
184 inciso 3. Dicho artculo, adems, otorga la facultad de no permitrseles, en caso
de necesidad, que se alejen del lugar o que se comuniquen entre s, debindose dar
cuenta inmediata al juez.
Las personas que se encuentran en las inmediaciones o cercanas del lugar del
hecho pueden haber captado a travs de sus sentidos, alguna circunstancia que, por si
sola, no permita dilucidar nada, pero que en conjunto con otras puede llegar a aportar datos
valiosos.
Detectar e identicar a stas oportunamente resulta imprescindible, ya que es sabido
que luego de haber satisfecho sus a veces morbosas necesidades de curiosidad, estas
personas se alejan del lugar porque no desean verse envueltas en todas las incomodidades
que implica la actuacin como testigo.
Por otra parte no debe descartarse que entre las mismas se encuentren el o los
autores, cmplices o auxiliadores que no tuvieron oportunidad de alejarse, o los partcipes
por ejemplo de unas lesiones u homicidio en ria. De all la necesidad de retenerlos an por
medio de la fuerza pblica, siendo asimismo oportuna la reforma dispuesta por Ley 25.434
que agrega que no se deben comunicar entre s.
l Asegurar con registros fotogrcos, flmicos o por cualquier otro medio tecnolgico
la escena completa, a n de registrarla dedignamente antes de que sea alterada y
para que en la causa quede debidamente documentada. Se debe tener en cuenta que
la autoridad judicial probablemente slo conocer el lugar a travs de este medio, al
igual que el ministerio scal y los letrados de las partes.
Esta circunstancia, adems de ser obligatoria por ley inciso 4 del artculo 184 del
cdigo citado, aporta un sin nmero de utilidades. El congelar en forma permanente y por
documentacin dedigna el lugar y las condiciones en que se encontraba al arribo de la
autoridad, permite en caso de alguna alteracin involuntaria de parte de esa escena, que
se pueda volver a reconstituir en forma exacta.
106
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Adems, conjuntamente con otras cooperaciones como ser croquis, planos, etc.
conforma un verdadero retrato del lugar de los hechos que permite a todos aquellos que de
una manera u otra deban participar en la causa, tener un acabado conocimiento de como
era ste y cules eran las condiciones que presentaban luego del hecho.
Una importante tarea criminalstica es el estudio y valoracin de las causas desde
ese punto de vista, aportando perspectivas diferentes y extrayendo informacin que pueden
hacer cambiar el rumbo o la estrategia profesional por parte de los abogados de las partes,
ya que aporta una visin especca al atar cabos que por s solos no indican nada, pero que
aunados y con la amplia visin tcnica cientca del profesional actuante, logran resulta-
dos sorprendentes. Lgicamente la evaluacin se efecta solamente a travs de todas las
circunstancias reunidas en la causa, donde la documentacin fotogrca de la inspeccin
ocular se torna imprescindible.
l Aqul que tenga a cargo la diligencia debe realizar una inspeccin del lugar sin alterar
nada, con el n de poder elaborar una hiptesis de cmo pudo producirse el hecho,
por dnde entraron, se desplazaron y salieron el autor o autores, y dnde pueden en-
contrarse rastros o huellas acorde a cada caso en particular.
Ac debe tenerse absolutamente claro que la inspeccin debe ser dirigida por una sola
persona, aunque sean varias las participantes. La autoridad judicial o aqul que la representa
es la que debe dirigirla. Para ello y luego de una rpida apreciacin del lugar y sin provocar
ningn tipo de alteraciones, deber reconstruir los posibles movimientos de los participantes
del hecho, deduciendo las cosas que pudieron ser utilizadas, movidas, tocadas o dejadas por
ellos. Todos esos datos le permitirn elaborar una hiptesis, pero sin dejar de valorar tambin
todos los restantes elementos o rastros aunque no concuerden con ella, ya que ellos podran
hacerla variar y vericarla como falsa, haciendo necesaria la elaboracin de una nueva.
Acorde cada hecho en particular, esta primera apreciacin le indicar por un
procedimiento deductivo, el orden de prelacin en la que debern intervenir los distintos
tcnicos o profesionales.
l Acorde a esa determinacin, deber disponerse el ingreso de los diferentes profesio-
nales o tcnicos especcos; mdico legista, personal de rastros, de balstica, qumicos,
planista, etc. Su participacin obedece la realizacin de tareas fundamentales que
deben ser cumplimentadas en el lugar. Debe cumplirse en cada etapa con las formas
dispuestas por la ley. El artculo 138 del Cdigo Procesal Penal de la Nacin, estipula
que para dar fe de los actos realizados se labrar acta, debiendo estar asistidos, el juez
107
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
por el secretario y los funcionarios policiales por dos testigos ajenos a la Reparticin,
en este tipo de diligencia.
Se hace necesario hacer aqu algunas consideraciones con respecto a la intervencin
de los distintos profesionales que deban participar del acto. La intervencin en el lugar del
mdico legista, por ejemplo, adems lgicamente de certicar el deceso de la vctima, es
la de apreciar desde el punto de vista mdico legal, todas las circunstancias que rodean al
hecho para establecer si es compatible con las heridas o daos corporales que presenta.
Debe tenerse en cuenta que el o los autores de un hecho poseen informacin
cierta y saber que an involuntariamente y a pesar de los mltiples cuidados que pueda
tener, donde se comete un hecho quedan, inexorablemente, rastros o vestigios de l. Por
eso no es infrecuente que una vez cometido el mismo traslade la escena a otro lugar en
procura de dejar los menos posibles.
El mdico legista, la mayora de las veces trabajando en condiciones adversas en cuanto
a luminosidad, comodidad y posibilidades ciertas de poder practicar un examen meticuloso,
debe justipreciar todas las circunstancias exteriores que le permitan apreciar por la posicin
de los cuerpos, de las cosas y de las armas empleadas, si puede tratarse de un homicidio o
de un suicidio. De considerar la primer posibilidad, si se ha cometido en ese lugar, valorando
adems cantidad de humores humanos, temperatura del cuerpo, heridas mortales, etc.
Todo ello no puede ser realizado fuera de ese mbito, por lo que se hace imprescindible
su participacin en el lugar. En la morgue judicial, ya cubiertas todas las necesidades profesio-
nales, emitir un informe sobre las causas y mecanismos de la muerte y nuevamente deber
justipreciar con los datos obtenidos en la inspeccin in situ, si resultan compatibles.
Con respecto al personal tcnico de rastros, adems de vericar los lugares indicados
por el interventor acorde a su hiptesis, deber indagar en todos aquellos que su experiencia
le aconseje, en procura de todos aquellos rastros o huellas que en forma directa o indirectas
permitan el esclarecimiento del hecho.
El relevamiento fotogrco y topogrco, como as tambin el del personal tcnico
balstico o accidentolgico segn los casos, deben cumplimentar idnticos requisitos.
Todas sus actuaciones debern ser volcadas en un acta, guardando las formalidades que
taxativamente establece el Cdigo Procesal Penal de la Nacin en el Libro I, Captulo IV,
Ttulo V, Actos Procesales.
108
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
l Encontrado cada uno de los rastros, huellas, manchas, etc., antes de ser removidos,
deben sealizarse, identicndoselos en el orden en que van siendo hallados a travs
de nmeros correlativos.
Esta simple premisa permite en todo momento tener perfectamente identicado a cada
testigo mudo, su procedencia, ubicacin, estado y dems circunstancias particulares. Asimismo,
en los casos en que se efecte la reconstruccin del hecho, vericar las posibilidades fcticas
de su concrecin segn la forma relatada por las partes y/o documentadas en la causa.
La forma de realizacin es tan simple, prctica y fcil que no ofrece ninguna dicultad,
porque no requiere de elementos sosticados ni de complicada ejecucin. Una simple hoja
y un elemento escritor comn, son sucientes.
Para precisar el signicado de los trminos utilizados o que se pueden utilizar,
se hace necesario efectuar las siguientes consideraciones acerca de los mismos:
Informaciones: son todos los datos obtenidos en forma investigativa y proveniente de
rumores, informes, exmenes, etc. Pueden procurarse a travs de personas u objetos, o
por medio de interrogatorios, entrevistas, anlisis, cooperaciones o vigilancias en general.
Es tarea del investigador evaluarlas y descartar errores o mentiras. Pueden obtenerse
altos valores investigativos, an a travs de pequeos fragmentos o detalles.
Evidencias: son todos aquellos medios que permiten que un hecho pueda ser aceptado
o rechazado. Pueden provenir de testimonios, objetos, documentos, antecedentes, etc. y
demuestran, aclaran o conrman hechos. Pueden ser directas: establecimiento o existencia
de hechos a travs de los sentidos; circunstanciales: establecimiento por medios indirectos
a travs de otras personas; o reales: a travs de objetos que hablan por s mismos. Deben
cumplir con las reglas de pertinencia: relacin directa con el caso; de validez: es decir ser
adecuada, suciente, conable; y de competencia: fsica, psquica, legal, cientca, etc.
Rastros: son todas las seales impresas o vestigios dejados por el paso de una persona
o que quedan de una cosa. Es decir todos los elementos dejados en forma consciente o
subconsciente por los actores de un hecho.
Manchas: trazas o marcas dejadas por algo. Se diferencian o se destacan de la supercie
que las contienen, por su color, su olor, aspecto y forma.
Huellas: improntas dejadas por diversas causas ante el apoyo de partes del cuerpo hu-
mano o de las cosas, sobre otras supercies aptas para recibirlas.
Indicios: acciones o seales que dan a conocer lo oculto. Con relacin a nuestro estudio
y tal como los vemos podemos decir que son los dichos de los testigos mudos. Estos
109
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
tienen dos valores opuestos. Uno de carcter absoluto y otro de carcter relativo. El ab-
soluto permite excluir a todo aquello que no est debidamente relacionado. Por ejemplo
de encontrarse rastros de sangre de determinado grupo, factor y caractersticas genera-
les, excluye a todos los involucrados que no se ajusten a esas caractersticas. El relativo:
indica posibilidad pero no certeza. Siguiendo el mismo ejemplo, los que se ajusten a esas
caractersticas son posibles, pero no se puede armar categricamente.
Pueden ser anteriores, concomitantes o posteriores al hecho. Su validez depende de la
sana crtica de aqul que tenga la responsabilidad de juzgar. Acorde a la evaluacin en cantidad
y calidad de todos ellos, podrn dar por probada o no una participacin o un hecho.
Pruebas: Conclusiones o resultados de los exmenes de las evidencias. Permiten la com-
probacin de algo. Ajustndose a las consideraciones analizadas en unidades anteriores,
pueden provenir de la Confesin, del Testimonio y de aportes Tcnicos y Cientcos a
travs de la prueba indiciaria.
l A continuacin deben ser constatados por todos los interventores y fotograados
en el lugar, dejndose expresa constancia en el acta labrada.
Aqu es importante destacar que todos y cada uno de los participantes en el acto
deben observar estos hallazgos, su documentacin y descripcin en el acta, quedando de
esta manera denitivamente situados, no siendo necesario luego recurrir a la memoria indi-
vidual de los mismos, que pueden llegar a proporcionar datos errados o variados. Adems
el interventor confeccionar un croquis a mano alzada, que deber ser suscripto por
cada uno de los intervinientes en el acto, consignando ubicacin de cada rastro o
huella hallada, perfectamente individualizados con sus nmeros.
El cumplimiento taxativo con respecto al croquis realizado por el interventor, sin la
necesidad de efectuar las mensuras y las escalas mtricas requeridas en el procedimiento
topogrco, efectuado sobre cualquier papel y acorde a las habilidades individuales y pro-
pias, pero en presencia y con la rma de todos los intervinientes en el acta donde se precisa
la ubicacin y situacin de todas las evidencias halladas, constituye prueba material por
ser objetiva y no encontrarse supeditada a la capacidad intelectual, de retencin de
datos, de redaccin o descripcin subjetiva por parte de los testigos de actuacin.
l Se debe confeccionar plano a travs del personal especializado, quien deber mensu-
rar y dibujar en escala todas las dependencias, consignando todas las circunstancias
halladas.
110
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Este tipo de relevamiento topogrco s es realizado por personal idneo con todas
las mensuras, escalas y formas dispuestas para un trabajo tcnico especializado. Los datos
que debe tomar el personal en el lugar, sern oportunamente transferidos a dibujos, con-
signndose en ellos nuevamente todos los datos del croquis, pero a diferencia de aqul,
este ser rmado slo por su ejecutante y tomado como prueba testimonial.
l Se proceder luego al levantado de cada uno de los rastros, adoptndose en cada caso
las tcnicas que sean ms apropiadas, acorde al tipo hallado, su estado y forma.
Acorde al rastro hallado o a su estado, se deber adoptar los procedimientos o las
tcnicas que aseguren de la manera ms simple su recoleccin y guarda. En virtud de la
extensa variedad de rastros o huellas que pueden ser hallados en el lugar de los hechos,
slo se darn algunos ejemplos, los que sin embargo darn la orientacin necesaria sobre
las formas de su realizacin.
Los testigos mudos dejados en la escena del hecho pueden ser hallados en alguna
de las formas que se detallan a continuacin: visibles, latentes y moldeados o plsticos.
Visibles: son todos aquellos rastros, manchas o huellas que pueden ser apreciadas a simple
vista. Es decir que no requiere de ningn procedimiento especco para su observacin. Las
causales de produccin se deben a diversos motivos, como ser: por la accin de sustancias
colorantes de origen orgnico, inorgnico o sinttico. Se detectan por diferencias de color
o contraste con respecto a las supercies que las contienen.
Latentes: son aquellos que no se perciben a simple vista. Para poder observarlos hace falta
que sean revelados, utilizando para ello diferentes longitudes de ondas lumnicas aplicadas
desde diferentes ngulos o reactivos de ndole fsico, qumico u orgnico.
Estos rastros se encuentran en el lugar, pero en razn de no poder observarse a
simple vista requieren de la intervencin de personal especializado que los detecte y rev-
ele. Dentro de la extensa variedad de este tipo de rastros, el ms comn de todos es el
dejado por los dibujos papilares ubicados en los pulpejos de la tercer falange de los dgitos
de la mano, conocidos como impresiones digitales. En la unidad correspondiente se
efectuarn los detalles de formacin de estos dibujos. Baste por ahora entender que
tanto en esa falange de los dgitos de la mano, como en las palmas y en las plantas
de los pies se encuentran en forma caprichosa, una serie de dibujos formados por
las crestas y los surcos papilares.
Esas crestas poseen los poros de exudacin de las glndulas sudorporas que
segregan los humores por ellas producidos y que mantienen la supercie de las manos
111
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
permanentemente hmedas. Esa humedad a modo de entinte, permite los estampes de
esos dibujos como los producidos por un elemento sellador. Dado su aspecto transparente
e incoloro, ese estampe no es apreciable a simple vista cuando quedan depositados en
aquellas supercies aptas para su contencin.
Estos rastros pasan desapercibidos para todas aquellas personas no acostumbradas
a su bsqueda. Para revelarlos, acorde a la supercie que los contenga, se utilizan diversos
procedimientos. El ms prctico es el de la utilizacin de longitudes de ondas lumnicas
tanto del espectro visible como ultravioleta.
Al respecto debemos recordar algunas consideraciones con respecto a la luz. Los
ojos son sensibles a ella y nos permiten ver objetos y cosas a travs de las formas,
colores y movimientos. Su descomposicin en longitudes de ondas permite uti-
lizarla para diferentes nes y propsitos. Los Rayos X: poseen longitudes de onda
muy pequeas; Ultravioleta: entre 40 y 4000 angstroms; Visible: es decir captada por
el ojo humano, va desde el azul hasta el rojo; e Infrarroja: corresponde a las mayores
longitudes de onda. La luz blanca posee todas estas longitudes de onda. Su descom-
posicin a travs de un prisma muestra el espectro completo.
Al incidir sobre un objeto, la luz nos marca su contorno permitindonos ver la forma
del mismo. Adems ese objeto absorbe la totalidad de las longitudes de onda reejando
slo las correspondientes a su color. Ejemplo: un objeto de color azul recibe la totalidad
de las longitudes de onda de la luz blanca. Las absorbe a todas, reejando solamente las
correspondientes a su color. Acorde a esto, un objeto blanco recibe todas las longitudes
de ondas y reeja la totalidad de estas ya que as se forma ese color. Un objeto negro por
el contrario absorbe la totalidad de las longitudes de ondas y no reeja o emite ninguna,
ya que ese color est dado por la ausencia de reejo.
Algunos elementos poseen la propiedad de ser fluorescentes. Esto signica que ex-
puestos a determinadas longitudes de ondas, las correspondientes al espectro ultravioleta
por ejemplo- absorben esas longitudes y emiten bajo esas condiciones luminosidades que
le son propias. Esto determina que algunos elementos que no pueden ser visualizados con
luz blanca, s lo sean bajo esas longitudes de ondas, por su propiedad uorescente.
Adems la luz blanca puede ser utilizada de diferentes manerasacorde sus ngulos
de incidencia. En forma Directa: la luz incide de pleno sobre el objeto, demarcando
su forma y permitindole reejar su color. Por Transparencia: el objeto a examinar
debe ser colocado entre una fuente lumnica y nuestros ojos. La luz al pasar a travs
de l, nos permite comprobar esta cualidad. Forma Tangencial o rasante: utilizando
112
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
cualquiera de los ngulos que se forman entre un haz de luz dirigido al objeto en
forma oblicua y otro en forma horizontal. Acorde como la luz incida sobre ese objeto
se podrn apreciar diferentes circunstancias.
Una de las formas de revelar rastros latentes es la utilizacin de diferentes longi-
tudes de ondas lumnicas, especialmente del espectro ultravioleta y/o con luz blanca en
forma tangencial o rasante. Esto es prctico cuando se trata de rastros en supercies
limpias, lisas y pulidas.
Otro procedimiento es mediante la utilizacin de reactivos fsicos denominados
polvos adhesivos. Estos son polvos muy namente tamizados -para eliminar la
posibilidad de formacin de grumos- y que poseen la propiedad de ser adherentes.
Acorde a las supercies donde sern aplicados y para lograr un mayor contraste pu-
eden ser: blancos, negros, de aluminio, rojos, uorescentes, magnticos, etc.
Tambin pueden utilizarse reactivos de orden qumico. Estos son utilizados sobre
soportes de papel, cartn, madera, etc. y especialmente sobre rastros viejos. Entre los
ms utilizados podemos mencionar la ninidrina o nynhidrina, el nitrato de plata, el yodo
metaloideo y vapores de yodo, solucin de leucomalaquita en ter y otros.
Entre los ms modernos se puede destacar la utilizacin del rayo lser que
permite su utilizacin sobre una amplia gama de supercies aunque estas hayan es-
tado expuestas a temperaturas extremadamente calientes o fras e incluso en aquellas
que han sido mojadas en agua. El equipo que se utiliza posee un rayo lser de in
argn, que revela las huellas en color amarillo o naranja, permitiendo su observacin
en forma directa y su fotograado o proyeccin por circuito cerrado de televisin.
Otra ventaja que presenta es que no altera o afecta ni la supercie ni a la impresin,
por lo que adems pueden utilizarse luego otros procedimientos.
Recientemente en Londres, se ha experimentado con una bacteria orgnica. Es-
tudios realizados sobre diferentes microorganismos, permiti determinar una bacteria
que prolifera en los componentes presentes en una huella, es decir la exudacin de
las glndulas ya mencionadas. Esos microbios actan sobre esos humores revelando
las crestas papilares. La especie bacteriana obtenida fue denominada acinetobacter
calcoaceticus que es mezclada con un gel fundido. Este se derrama sobre la huella y
se espera hasta que cuaje. Durante la incubacin se forman en el gel unas colonias de
bacterias que coinciden con las crestas papilares, tornndolas visibles y permitiendo
su identicacin.
113
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Plsticas o moldeadas: son rastros visibles hallados sobre supercies blandas como ser:
plastilina, masilla, resina, jabn, chocolate, etc. Estas son producidas por el estampe por
presin de las crestas papilares sobre uno de esos soportes. Debe tenerse especialmente
en cuenta, que el estampe de las impresiones se produce por la diferencia existente entre
crestas y surcos, siendo las primeras las que deprimen las supercies blandas. Como es
lgico suponer lo que son altos relieve en las impresiones, pasarn a ser depresiones o
bajorrelieves en estas huellas. Se hace necesario hacer un contratipo o positivo.
Como surge de lo descrito en todas las posibilidades de encontrar rastros, es de
vital importancia tener en cuenta las distintas supercies donde stos pueden encontrarse.
Las ideales son supercies lisas y pulidas tales como vidrio, espejos, maderas lustradas,
frmicas, papeles de diferentes naturaleza, etc. Por ese motivo en una inspeccin ocular
debe prestarse especial atencin a las mismas, especialmente en puertas, marcos, ventanas,
llaves de luz, mesas, vasos, etc. Pero como se ha visto, es posible encontrarlas en cualquier
lugar, por lo que los exmenes deben contemplar todas las posibilidades.
Acorde a sus portabilidades estas supercies pueden ser Mviles: es decir las
transportables o fciles de mover. Ejemplo: armas, botellas, trozos de vidrio, etc.
Tambin pueden ser Fijas: son aquellas que no pueden ser transportadas ya sea por
su volumen, peso o por ser parte de un inmueble.
De encontrarse, por ejemplo, una mancha se deben efectuar las siguientes
preguntas y consideraciones: de qu es esa mancha?. En caso de pensarse que
es sangre qu nos puede indicar con relacin a su forma y tamao?; es humana
o animal?. es de la vctima o del victimario? de qu parte del cuerpo proviene?
qu caractersticas presenta?. En el lugar slo es posible realizar reacciones de
orientacin. Para stas se utilizan diferentes compuestos qumicos que al reaccio-
nar provocan coloraciones especcas. De no obtenerse el resultado esperado no se
trata de lo sospechado. De obtenerse, signica que es posible pero para su determi-
nacin, se debern efectuar las reacciones de certeza. Estas ltimas se hacen en
los laboratorios criminalsticos correspondientes, luego de haberse procedido a su
levantado y remisin.
Dentro de los ensayos o reacciones de certeza, que en forma especca certi-
can la presencia o no de sangre en una mancha, acorde a su comprobacin pueden
describirse cuatro tipos diferentes:
a) mtodos microscpicos;
b) mtodos microcristalogrcos;
114
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
c) mtodos cromatogrcos y
d) mtodos microespectroscpicos.
l Dentro de los microscopicos, se observan por medio de microscopios los elementos
gurados de la sangre, es decir los glbulos rojos o eritrocitos y/o los blancos o leu-
cocitos. Dentro de los microscristalogrcos idntica observacin pero de los cristales
obtenidos por la accin de ciertos reactivos. Los mtodos ms utilizados son los de
Teichmann y el de Takayama.
l Con el mtodo cromatogrco se utilizan sembrados sobre papel o placa delgada para
uso cromatogrco y con el mtodo microespectroscpico se observa el espectro de
absorcin de la oxihemoglobina, mensurndose sus longitudes de onda.
l Siguiendo el orden mencionado primeramente, debe examinarse la mancha en cuanto
a su forma, ya que una gota de sangre podr tomar diferentes aspectos tanto en sus
bordes como en su tamao. El anlisis de estos datos nos permitir por ejemplo esta-
blecer altura de cada, si al momento de la misma la persona se hallaba en movimiento
o en reposo, en que direccin y con qu rapidez se desplazaba, etc.
Vase a continuacin el ejemplo grco de lo detallado. Todas las imgenes
fueron tomadas del Manual de Criminalstica, Tomo II, de los autores GOBBI, PADULA.
PALACIOS y otros de la Editorial Policial y corresponden a gotas de sangre cadas sobre
una supercie plana. Debajo de cada una de ellas se consigna la altura de produccin.
Ntese tamaos y bordes.
50 cm. Entre 50 y 100 cm. Entre 100 y 150 cm. Superior a 150 cm.
115
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Cuando una gota de sangre cae en ngulo recto, la imagen resultante es siempre
casi circular. Su imagen va tornndose cada vez ms ovoidal a medida que el ngulo de
impacto decrece. Si este es muy pequeo y se desprende una pequea gota, sta tomar
la forma de un signo de exclamacin. Obsrvese en la gura siguiente el aspecto de gotas
de sangre cadas sobre una supercie con un ngulo de impacto inferior a 90.
En hechos de sangre, esta puede estar a simple vista sobre el cuerpo o ropas de
la vctima, en pisos, paredes, alfombras, etc., siendo fcilmente detectada. Pero tambin
puede darse que se encuentre enmascarada por un empapelado, en paredes oscuras,
en telas de tapizados, en cerramientos, puertas, bordes inferiores de los muebles, sifones
de lavatorios, en bolsillos, piel, uas, plantas de pies, cabellos, etc. Debe extremarse la
bsqueda en todos los lugares, sean estos lgicos o no.
Tenindose en cuenta el tipo de herida que presenta la vctima, con la cooperacin
del mdico legista se debe determinar si la cantidad es la que corresponde al tipo de lesin,
ya que pudo haberse limpiado el lugar o bien pudo haber sido cometido en otro sitio y
luego trasladado, debiendo adoptarse en cada caso, los procedimientos de bsqueda
correspondientes.
l Acorde a su estado la mancha puede estar en grandes o pequeas cantidades, fresca,
coagulada, semi seca o seca. Para su levante se debern adoptar diferentes tcnicas. Si
est fresca se recoge en tubos de ensayo o frascos limpios, utilizando de ser necesario,
cucharas o pipetas para su recoleccin. Si est coagulada debe diluirse con solucin si-
olgica, se la mezcla suavemente, se la levanta en tubos y se la conserva con hielo. Tam-
bin es posible hacerla absorber con papel o tela. Si est semi seca se la puede solubilizar
con agua destilada y recoger con papel de ltro o secante. Dejar secar al aire para evitar
putrefaccin y luego tapar. Si est seca se puede raspar la supercie y recoger sobre papel
blanco. Si la supercie contenedora es mvil se puede secuestrar y remitir al laboratorio,
al igual que en los casos en que se puede recortar en lugar donde sta se encuentra.
116
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
l Todas estas muestras deben ser rotuladas e identicadas, procedindose adems acorde
a disposiciones legales, no debindose mezclar las recogidas en diferentes lugares ya que
pueden pertenecer a diferentes tipos y se pueden contaminar. Deben tomarse muestras
de la vctima para cotejo posterior. No cumplir con esta simple diligencia puede ocasionar
la necesidad de posteriores exhumaciones con los consiguientes trastornos y dicultades
que trae aparejada dicha diligencia, especialmente para sus familiares o deudos.
l Ya en los laboratorios periciales se efectan algunas de las reacciones de certeza ya
mencionadas a n de establecer si es efectivamente sangre. Luego se debe determinar si
es humana o de animales y de que parte del cuerpo proviene. A ttulo ilustrativo se hace
constar que se puede determinar si la sangre es de una hemorragia nasal por ejemplo,
al encontrarse restos de mucosidades; de origen menstrual por clulas de la mucosa
uterina que contengan; producto de una violacin por la presencia de pelos pbicos o
semen, etc.
Adems es posible determinar grupo y factor sanguneo, enfermedades, uso de
alcohol o drogas, y entre otros y acorde a las caractersticas del caso, el genomio o cdigo
gentico contenido en los cuarenta y seis cromosomas del ncleo de una cdula, esencial-
mente constituidos por cido desoxirribonucleico o ADN.
l De tener que levantarse un arma por ejemplo, se debe tener en cuenta que la misma
puede contener impresiones digitales, por lo que hay que prestar atencin a su manipuleo.
Tambin debe tenerse en cuenta que para su identicacin a travs de los proyectiles
disparados, es importante conservar el estado del nima o interior de su can. Nunca
debe ser levantada introduciendo algn elemento por ste, ya que puede modicarlo. La
forma correcta es tomarlo con un lpiz o elemento similar, a travs del arco de guarda-
monte que protege la cola del disparador, ms comnmente conocido como gatillo.
l De tener que secuestrarse un proyectil, depender donde ste se halle localizado. Si se
encuentra en una persona viva ser el mdico que determine los riesgos de su extraccin o
no. Si no se lo extrae puede ser til la obtencin de una placa radiogrca a n de efectu-
arse las consideraciones que puedan hacerse a travs de este mtodo. Si se extrae ser el
mdico cirujano, acorde a posibilidades, que buscar las formas de poder asirlo con pinzas
desde su ojiva y culote. De no poder hacerlo sin riesgos para la vctima, deber extraerlo
como pueda, an a costa de daar la zona til que impida su posterior identicacin.
De hallarse sobre un cadver el mdico debe asegurar su extraccin sin alterarlo.
De hallarse sobre un objeto mvil debe ser secuestrado y si lo est en una madera o pared,
debe horadarse la zona aledaa para que ste se desprenda, evitando lgicamente su cada
al suelo que podra modicarlo o daarlo.
117
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
l Una vez levantado debe ser asegurado para evitar su sustitucin. La forma ms prctica,
efectiva y fcil es la envolver el rastro hallado y hacer rmar sobre el envoltorio a todos
los participantes, asegurando dicho embalaje con cintas adhesivas transparentes.
No importa la forma o tamao que posea el rastro que se est levantando y secuest-
rando. En su gran mayora es susceptible de ser envuelto, aunque para ello deba recur-
rirse previamente a la utilizacin de otro recurso. Debe prestarse especial atencin a
la forma en que se realiza este tipo de medida, ya que su incorrecta ejecucin puede
ocasionar daos irreparables en el testigo mudo hallado.
An los rastros lquidos se pueden envolver luego de ser envasados en tubos o
frascos. Si se trata de un rastro en un vaso, envolverlo signicara que el papel o la bolsa
borre o altere la impresin contenida en l, por lo que previamente debe ser asegurado en
una caja jndoselo para que no se mueva dentro de ella y, posteriormente, embalarla.
Efectuado esto, debe asegurarse el contenido del embalaje a travs de la rma de
todos los intervinientes en el acta. Esas rmas aseguran que es se y no otro el elemento
secuestrado. Para asegurar adems las rmas deben protegerse stas por medio de
cintas adhesivas transparentes, ya que una vez jadas su remocin es detectable por
los rastros que dejan sobre las bras del papel o los daos producidos sobre ellas.
l Tambin se hace necesario vericar la forma de embalaje y conservacin. Cada rastro
o huella, sus condiciones y estados deben ser mensurados individualmente y se debe
adoptar la forma ms adecuada acorde a esas circunstancias.
Como ya quedara claro, cada rastro debe ser embalado en forma individual para no
contaminar a uno con otro. Pero debe tenerse en cuenta que si se coloca por ejemplo, un
pauelo embebido con sangre fresca en una bolsa de nylon y esta queda durante determi-
nado lapso de tiempo cerrada, inevitablemente esa sangre se degradar provocando hon-
gos y dems oras o faunas, que terminarn destruyndola. Iguales inconvenientes traera
aparejado el secuestro de una fruta o porcin de queso con el rastro de una dentada.
l El traslado de los elementos secuestrados debe hacerse de manera tal que no pueda
daarse o modicarse su contenido.
No guardar los recaudos necesarios para el transporte y traslado de los rastros se-
cuestrados, puede hacer que estos se daen o modiquen. Por ejemplo, si se rompiera el
vaso que contiene la impresin digital, o se perdiera uno de los tubos contenedores de las
118
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
muestras de sangre u otros elementos, o el proyectil tan celosamente resguardado fuera
apretado o presionado por un pie o puerta, por nombrar slo algunos.
l La conservacin debe efectuarse acorde a las necesidades o condiciones de cada
rastro o huella secuestrado.
Cada tipo de testigo mudo, acorde a su composicin y estado genrico requerir
ciertas formas de conservacin, hasta que pueda ser examinado. Por ejemplo las muestras
de sangre requerirn para su conservacin que se guarde manteniendo una cadena de fro
para evitar su putrefaccin. Si el rastro de una pisada hubiera sido levantado con yeso, debe
cuidarse que no se rompa o parta.
l Deben ser entregados a la autoridad judicial correspondiente o a los peritos o labo-
ratorios periciales ordenados por aquellos en tiempo y forma.
Debe asegurase que todos los testigos mudos recogidos en el lugar lleguen al destino
correspondiente no slo en forma adecuada, sino tambin en el tiempo correspondiente.
Demorar la remisin de un rastro antes de su peritacin o despus de efectuada si hubiera
quedado pendiente de remisin, puede ocasionar su prdida por extravo o por falta de con-
tralor del juzgado o de las partes. Esto, lamentablemente, no es tan infrecuente como a prima
facie pareciera.
Como corolario, es necesario tener una cabal comprensin de que todos los pasos
detallados y otros que acorde a los casos puedan darse, hacen que la realizacin de la in-
speccin ocular deba ser efectuada con suma meticulosidad, minuciosidad e imparcialidad.
Al ser tantos los pasos a seguir, se debe asegurar que todos sean realizados correctamente,
ya que el error en uno slo de ellos, trae aparejado la anulacin de los dems. De qu sirve
ser meticuloso en la inspeccin para el hallazgo de rastros, si stos no quedan documentados
de donde son tomados?. De haber hecho esto, si al levantarlo lo daamos o contaminamos,
o no le damos la forma legal, o no lo protegemos y puede ser sustituido, perdido, daado o
llegan en mal estado a su estudio?
Para el buen logro de esta diligencia, la misma debe ser realizada por un grupo de
trabajo compuesto por un ocial licenciado en criminalstica, un subocial especializado en
esa disciplina, un tcnico en rastros, un fotgrafo, un planista y acorde al tipo de hecho, un
mdico legista o un tcnico en balstica o en accidentologa.
119
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Los rastros o testigos mudos ms comunes hallados en el lugar de los hechos son:
l Huellas dactilares o palmares,
l De pisadas con pie calzado, con medias y excepcionalmente descalzo.
l Rastros de uidos corporales como ser sangre, semen, saliva, orina, etc.
l Rastros de componentes orgnicos: pelos, piel, uas, etc.
l Rastros de accesiones utilizados por el hombre: bras, colillas, fsforos, etc.
l Armas de fuego, proyectiles o vainas.
l Rastros de deagracin de plvora y explosivos.
l Rastros de bebidas, alimentos, drogas, medicamentos, vidrios, etc.
l Rastros de ropas o elementos personales.
l Rastros de efraccin
l Otros.
Todos los conocimientos tericos y prcticos aportados por carreras, cursos y la
experiencia propia y ajena, hacen que aquellos profesionales que deban cumplir estas
tareas se encuentren cada vez ms preparados para ejercerla. Sus resultados obviamente
dependern de la habilidad, sagacidad, paciencia y meticulosidad del interventor. Sin em-
bargo el cumplimiento de la forma metdica y sistemtica de las tareas a cumplimentar,
con las consiguientes variaciones propias de cada caso, lugar y ejecutante, ha demostrado
ser el mejor camino para la optimizacin de los resultados.
Por las caractersticas del hecho y las riquezas de elementos, se ha tomado como
caso ejemplicativo de una intervencin profesional, un caso de homicidio. El personal
interventor debe tener permanentemente chequeado los elementos bsicos que debe
contener el equipo para el cumplimiento de tan importante funcin. Idealmente son
aconsejables los siguientes elementos: Lupa, tijera, linterna, cuaderno de notas, nmeros
sealizadores, marcadores, lpices, tizas, guantes de goma, sobres de embalaje, tintas
adhesivas de diferentes tamao, pinzas varias, elementos de mensura tales como reglas,
metros, calibres, brjulas, rayo lser, etc., herramientas varias como ser llaves, destor-
nilladores, cortadores, esptulas, polvos adhesivos, plumones, hilos, plastilina, bolsas
plsticas, etiquetas, lacres, rotuladores, frascos o tubos de vidrios, etc.
Arribado al lugar se debe interiorizar de las diferentes alternativas del hecho a travs
de todas las personas que se encontraran all, efectuando una observacin de carcter
genrico sin alterar la escena. Si la vctima est inmvil se debe comprobar si requiere aux-
ilio inmediato. De no ser necesario se trazar el plan de accin a seguir. Se comenzar la
bsqueda de rastros sin tocar nada, efectundose las anotaciones que correspondieran.
120
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Posteriormente se tomarn las fotografas o se registrar la escena por cualquier
medio tcnico, haciendo constar en forma panormica todas las dependencias de modo
general y el lugar de los hechos en particular.
El personal de rastros, bajo la direccin del interventor, proceder a la bsqueda,
revelamiento y sealizacin de los testigos mudos, sin proceder a su levantado o modicacin.
Se proceder a su fotograado en el orden cronolgico de su hallazgo y acorde a la numer-
acin asignada en la sealizacin de los mismos, emplendose las luces, ltros y equipos
adecuados. Es conveniente proceder a la mensura de las ubicaciones o de los objetos de
pequeo tamao, a travs de la colocacin de reglas graduadas que deben ser registradas
fotogrcamente junto con los objetos. Seguidamente, y acorde a las normas dispuestas
en el cdigo de forma, se debe proceder a su levantado para el envo a los laboratorios de
criminalstica correspondientes, labrndose acta de estilo y croquis a mano alzada.
El croquis a mano alzada realizado por el interventor al cual ya nos reriramos, debe
hacerse en forma inmediata en el lugar y en presencia de todos los intervinientes en el acto,
debindose corroborar todos y cada uno de los rastros hallados e indicando sus ubicaciones.
El mismo se puede realizar sobre cualquier tipo de papel y con cualquier elemento escritor.
Idealmente debera efectuarse de alguna de las dos maneras siguientes:
Croquis en cruz: toma este nombre por la forma que adquiere, similar a ese smbolo reli-
gioso. Dicho croquis debe trazarse desarrollando un cuadrado central que estar repre-
sentando al piso de la habitacin donde se realiza la Inspeccin Ocular. Arriba, abajo, a
la derecha y a la izquierda de ste, deben confeccionarse otros cuadrados similares que
representarn las paredes de la habitacin. Sobre cada uno de ellos se efectuarn las
sealizaciones, indicando las distancias correspondientes de los rastros hallados.
En el exterior de un edicio es relativamente sencillo sin contar con una brjula, ubicar
los puntos cardinales para indicar las posiciones de los elementos que se pretende describir.
No siempre ocurre lo mismo estando en el interior de la habitacin de un inmueble, mxime
si el mismo no tiene conexin directa con el exterior. De estar absolutamente seguro, debe
utilizarse para demarcacin de orientaciones esos puntos, dibujando la rosa de los vientos.
De no estarlo se debe describir las orientaciones, tomando como puntos de referencias
elementos jos de esa habitacin, por ejemplo una puerta o una ventana.
Croquis en Cruz Larga: las caractersticas de este croquis son similares a las descriptas
precedentemente. Slo que debe agregarse un nuevo cuadrado inmediatamente por de-
bajo del cuadrado que representa una de las paredes, ubicado debajo del que representa
al piso de la habitacin. Como se deduce, el nombre es por la gura formada y se utiliza
121
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
en los casos en que es necesario efectuar detalles o marcaciones de rastros en el techo
de la habitacin. La realizacin de ambos croquis no ofrece dicultad prctica, aportando
reales benecios demarcatorios, que permiten a los participantes comprobar en el lugar
fehacientemente los mismos, y recordarlos nuevamente cuando sean interrogados ms
adelante, con la sola visualizacin de stos.
El mdico legista realizar el examen exhaustivo del cadver y de las circunstancias
que lo rodean. Luego se confeccionar el plano del lugar por el personal tcnico espe-
cializado, quien mensurar tamaos llevndolos a escala y detallando la posicin de los
elementos acorde a la rosa de los vientos.
Antes de nalizar la tarea se debe efectuar una nueva inspeccin integral para com-
probar la ejecucin total de las actividades. Se deben realizar, asimismo, inspecciones de
las adyacencias en busca de elementos relacionados.
Se dispondr, luego el traslado del cadver y de todo lo secuestrado, la clausura o
entrega del lugar, acorde lo dispuesto por la autoridad judicial.
Este tipo de inspecciones debe realizarse siempre desde lo general a lo particular, es
decir indicando los alrededores del lugar de los hechos, donde se determinar la presencia
o no de elementos vinculados, ya sean provenientes de actos anteriores o de preparacin,
o bien posteriores con motivo de la fuga o de ocultamiento de indicios. Se hace necesario
detallar ubicacin geogrca, indicando calle, nmero, piso, departamento, etc.
En el interior del inmueble donde hubiera ocurrido el hecho, se debe iniciar la
inspeccin tambin desde lo general a lo particular, detallando e inspeccionando todas
las dependencias del mismo en busca de idnticos indicios. Para el nal se dejara como
ltimo paso el registro del lugar exacto de la produccin de los hechos, a los efectos
de realizarlo con la meticulosidad debida.
Cualquier procedimiento utilizado que permita el riguroso examen y la completa real-
izacin de esta diligencia, debe ser considerado como correcto. Empero se detallar a con-
tinuacin lo que se ha denominado el plano de abatimiento de Kenyers, que no es otra cosa
que una serie de ingeniosos, simples y completos mtodos de realizacin sistemtica.
Mtodo del Espiral: debe tomarse como centro de este mtodo el preciso lugar de los
hechos o el lugar donde se encuentra, por ejemplo, el cadver. Teniendo en cuenta este
punto central, el investigador proceder a la inspeccin de toda la habitacin en el sentido
de las agujas el reloj y en forma centrpeta, es decir desde afuera hacia adentro, regis-
trando toda el rea. Este mtodo asegura el reconocimiento de toda zona, permitiendo
una exploracin total y la posibilidad de sealizar y recolectar indicios.
122
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Mtodo de las Coordenadas: tomando como centro el cadver o lugar especco de
concrecin de un hecho, se traza una coordenada referencial marcando el norte y el sur.
Desde ella se trazan coordenadas hacia los rastros hallados. Esto permite no solamente
detallar las exactas posiciones de cada uno de estos elementos, sino tambin las distan-
cias que lo separan del cadver y de los otros elementos.
Mtodo del Damero: o del tablero de ajedrez. Este est especialmente diseado para
espacios muy grandes. Cualquiera sea la forma y extensin del lugar a inspeccionar, se
procede a cuadricularlo en forma planimtrica, rotulando numricamente o con letras
cada uno de los espacios resultantes.
Este mtodo puede ser aplicado tanto en lugares abiertos como en cerrados. Es
preciso, simple, objetivo y de fcil interpretacin. Permite explorar en forma sistemtica,
grandes reas y obtener registros panormicos de la misma. Localiza, relaciona y mensura los
diferentes elementos hallados, permitiendo vinculaciones. En grandes extensiones permite
dividir tareas, asegurando la vericacin ordenada y ecaz de todos los casilleros. Tambin
es posible mensurar la tarea realizada y la por realizar. Es perfectamente adaptable a cu-
alquier terreno, forma y extensin. Es posible adoptar para la divisin, la forma geomtrica
ms adecuada acorde a la topografa del terreno a inspeccionar. Es posible tambin una
rpida diagramacin grca o dibujo sobre papel cuadriculado, donde se pueden realizar
todas las anotaciones necesarias.
Todos y cada uno de estos mtodos pueden ser utilizados en forma armnica y
conjunta. Por ejemplo en cada uno de los casilleros se puede utilizar el mtodo de las co-
ordenadas o el del espiral. Eso asegura la minuciosidad dentro de cada espacio.
Si bien el riguroso cumplimiento de objetividad cientca, encierra el contenido de
los conceptos que a modo de reglas de procedimiento detallara Marchessau, su
conocimiento y/o recordatorio fortalece lo analizado durante la presente unidad. Por
ser mencionadas en la casi totalidad de la bibliografa al respecto y ser parte del
presente programa de estudio, se efectuar un breve comentario sobre las mismas.
Estas reglas, tres en total, estn representadas por simples trminos que encierran
en s mismos, todo un bagaje de practicidad y empirismo.
Una de ellas, es la regla o principio de Precisin: Los objetos deben llamarse por su
nombre, los colores han de indicarse con arreglo a las clasicaciones aceptadas corriente-
mente, las distancias han de medirse con exactitud y las direcciones han de indicarse con
auxilio de los puntos cardinales.
123
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Como se observa la misma hace referencia al cuidado que debe tenerse en el detalle
o descripcin de los elementos que deben mencionarse en las actas realizadas para dar fe de
los actos de secuestro o realizados por los interventores. Las descripciones deben contener
las apreciaciones que cualquier persona, sea del nivel intelectual o poseyere los conocimientos
que fueran, sin incorporar detalles que no aportan sino circunstancias subjetivas que pueden
no ser compartidas por todos. La descripcin de un elemento puede ser fcilmente efectuada
a travs de su tipo, marca, modelo, nmero de identicacin y estado. Esto no crea, en la
prctica, ninguna dicultad. Sin embargo hay otros elementos cuya descripcin requiere el
detalle de sus formas o caractersticas. En estos casos debe tenerse especial cuidado en no
describir sino lo observable a simple vista por todos, sin hacer comparaciones que puedan
requerir de conocimientos especializados. Conocimiento que puede no ser compartidos por
todos los interventores y que ocasionan interpretaciones individuales.
Principio o regla de Integridad: Las descripciones deben ser completas, sin omitir
detalles aunque, aparentemente, carezcan de importancia. Debe ser el en cuanto revele
la marcha misma de la intervencin desde la llegada del instructor y en el orden en que la
inspeccin ocular fue desarrollndose.
Quien efecte una inspeccin ocular debe compenetrarse en esa tarea, actuando
minuciosa e imparcialmente. Minuciosamente porque no debe subestimar ni dejar de
analizar nada que se encuentra en la escena del hecho, aunque en apariencia sea insig-
nicante o que no coincida con la hiptesis o primera apreciacin sobre los mecanismos
de produccin de los hechos. Por ser un hecho de caractersticas irrepetibles debe tenerse
presente que es la nica oportunidad de recolectar todo aquello que pueda, en denitiva,
aportar luz para el esclarecimiento del hecho.
Imparcial porque no debe despreciar o rechazar por s o por terceros, nada que
pueda estar relacionado. La premisa es que, si se sabe con lgica razonabilidad que un
elemento tiene relacin directa con el hecho, debe considerarlo, vincularlo y secuestrarlo. Si
tiene dudas sobre su vinculacin, debe actuar de idntica manera. De comprobarse luego
su desvinculacin se podr desechar. Pero, lgicamente, no ser posible luego su estudio
si no ha sido considerado o levantado oportunamente.
Principio o regla del Mtodo: consiste en realizar la inspeccin en forma ordenada,
pasando de lo general a lo particular, de la impresin de conjunto a la descripcin minuciosa
de las caractersticas de cada objeto.
Trabajar con mtodo impone saber desde donde se comienza la tarea, cul es el
objetivo propuesto y con qu elementos, cosas, lugares o personas se va a trabajar. Se
requiere la preorganizacin y determinacin de los pasos a seguir. El azar no puede ser
124
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
considerado en el mtodo, aunque ste se pueda inltrar ocasionando benecios o com-
plicaciones. La aplicacin prctica a este tipo de tareas, es saber que en esa escena del
hecho, lugar del cual se parte, se intenta llegar al objetivo, que es la determinacin del hecho
y de sus autores. Los elementos o testigos mudos que permitirn tal tarea, se encuentran
en el lugar. Slo hay que saber encontrarlos, interrogarlos y vincularlos. Para ello desde una
ptica pluralizada, se debe ir acotando paso a paso, hasta los ms pequeos detalles.
Todo lo explicado en la presente unidad, es slo un puado de las muchas cosas
que sobre este acto o diligencia judicial, de signicativa importancia en la dilucidacin
del caso investigado, pueden decirse o detallarse. La nalidad de su conocimiento es
observar su cumplimiento en las diferentes diligencias de las actuaciones sumariales o
instructorias de la causa, poder valorarlas y criticarlas fcticamente cuando no hayan sido
realizadas con rigurosidad tcnica y cientca, o saber como actuar en caso de participar
como letrado, scal, secretario o magistrado.
Nunca, por mucho que pueda decirse de esta materia, se lograr un desarrollo
completo de esta temtica. Tampoco es la nalidad ni la pretensin de esta ctedra. Es
siempre recomendable, empero, profundizarla a travs de lecturas anes y desde la ptica
de diferentes autores que, a travs de sus conocimientos y experiencias, podrn aportar
datos de real vala.
125
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
sp
)
sntesis parcial
abogaca a distancia
Tarea de la Criminalstica Investigativa
Aportes tcnicos cientcos para la recoleccin de testigos mudos
Hecho irreproducible e inmediato
Practicida por autoridad judicial o funcionario policial
Regulada por el Cdigo de forma
De lo general a lo particular. Distintos mtodos de ejecucin
Arribo al lugar y asistencia a las vctimas
Asegurar el lugar y sus adyacencias para evitar contaminacin
Interrogar a testigos. Asegurar no alejamiento e incomunicacin
Inspeccin sin modicaciones para elaboracin de hiptesis
Fe por acta de los actos a realizar, acorde a disposiciones legales
Documentacin fotogrca panormica o por otros medios
Acceso de personal profesional o tcnico en orden cronolgico
Deteccin y sealizacin de rastros y huellas
Documentacin fotogrca y topogrca de los mismos
Relevamiento topogrco del lugar
Levantamiento, proteccin, embalaje, rotulacin y aseguramiento de rastros
Secuestro, traslado y entrega de testigos mudos hallados en el lugar
Cumplimiento de las disposiciones nales del procedimiento escrito
Entrega o clausura del lugar
INSPECCIN OCULAR
Precisin
Integridad
Mtodo
REGLAS DE MARCHESSAU
126
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Mtodo del Espiral
Mtodo de las Coordenadas
Mtodo del Damero o tablero de ajedrez
Luces y sus diferentes longitudes de ondas
Luces y sus ngulos de incidencia
Reactivos de orden fsico
Reactivos de orden qumico
Nuevos mtodos de levantamiento
Personal especializado necesario
Equipo auxiliar necesario
PLANO DE KENYERS
AUXILIARES
TIPOS DE RASTROS Visibles
Latentes
Plsticos o moldeados
DIFERENCIAR
Informacin
Evidencia
Rastro
Mancha
Huellas
Indicios
Prueba
127
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD III )
n ALBARRACIN, Roberto; Manual de Criminalstica; Editorial Policial; Bs. As. 1971.
n GUZMAN, Carlos; Manual de Criminalstica; Ed. La Rocca; Bs. As. 1997.
n GOBBI, Eduardo y otros; Tratado de Criminalstica; Ed. Policial; Bs. As. 1983.
n Revistas de Polica y Criminalstica; Editorial Policial.
NOTA: los textos obligatorios se encuentran para consulta o prstamo, en la biblioteca del Instituto Universitario
de la Polica Federal Argentina.
Bibliografa obligatoria
u4
unidad cuatro
investigacin cientca del delito
) (
131
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD IV
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Uso vulgar y cientco del trmino Identidad. Su origen y alcances.
2. Formas de reconocimiento humano desde las primeras conformaciones clnicas o
tribales hasta nuestros das.
3. Conceptos de Antropologa y Antropometra. Formas de Identidad Humana.
4. Las aplicaciones de la fotografa, dibujo tcnico, computacin y otros mtodos para el
establecimiento de la Identidad.
5. La necesidad histrica de identicar a los delincuentes. Los benecios de la Identi-
cacin dual -para delincuentes y honestos-.
6. Diferentes rastros y manchas que pueden conducirnos a la Identidad.
7. Estudio referencial de la piel humana y las particulares conformaciones que producen
las papilas drmicas y su sistematizacin papiloscpica.
8. Sus principales precursores hasta llegar a VUCETICH y HENRY.
9. Impresiones papilares naturales y articiales.
10. Fundamentos tcnicos y cientcos que sostienen la Papiloscopa.
11. La Papiloscopa y sus alcances. Dactiloscopa, Palametoscopa y Pelmatoscopa.
12. Descripcin de los tipos fundamentales dactiloscpicos puros e impuros descriptos
por Juan VUCETICH. Sus conformaciones, partes componentes y topografa de un
dactilograma.
13. Clasicacin de un archivo decadactilar. Claves y posibilidades.
14. Identidad Dactiloscpica. Puntos caractersticos y requisitos.
15. Nociones de Palametoscopa y Pelmatoscopa.
Mencin sinttica de los contenidos
132
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
133
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n Comprender los alcances y las necesidades humanas y legales de determinar la Iden-
tidad del Hombre.
n Precisar el concepto riguroso que posee el trmino Identidad, tanto en su aplicacin
humana como para las cosas.
n Hacer un rpido recorrido sobre la evolucin del nombre, los apellidos y los efectos
jurdicos que estos presentan.
nConocer de que medios se ha valido el hombre para obtener un sistema de identicacin
que permitiera lograr con absoluta precisin, dicha identidad.
n Comprender el concepto de medios indirectos y directo para determinar Identidad.
n Efectuar una cosmovisin sobre los diferentes medios indirectos, a n de poder evaluar
la cantidad de pequeos rastros que pueden llevarnos a travs de indicios, al estab-
lecimiento de la identidad del o los autores del hecho.
nDiferenciar los antiguos y ver la manera en que los nuevos medios tecnolgicos coadyu-
van a lograrla. Adems conocer la aplicacin y usos de estos avances.
n Introducirnos en el fascinante mundo del nico medio que a la fecha, permite lograr la
Identidad Humana.
n Conocer los orgenes de la Papiloscopa, sus pilares sostenedores y sus alcances.
n Obtener una supercial pero completa visin del Sistema Dactiloscpico Argentino
creado por Juan VUCETICH.
n Efectuar una supercial visin de las caractersticas identicativas que aporta la Palam-
etoscopa y la Pelmatoscopa.
n Referenciar su aplicacin en el mundo y los aportes que la computacin brinda para
lograr mayor rapidez y efectividad en su uso.
n Conocer las diferentes aplicaciones biomtricas actuales y sus mltiples aplicaciones,
tanto dentro del orden judicial como privado.
134
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
135
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD IV )
Concepto y diferenciacin con semejanza
Conocimiento de los integrantes de clanes y tribus
Necesidad de reconocimiento en grandes conglomeraciones humanas
Necesidad primaria de identicar a los delicuentes
Diferentes procedimientos utilizados con ese n
Identicacin dual de honestos y delincuentes por la Papiloscopa
Precursores
Otros medios de Identicacin Humana
Orgenes, antecedentes y alcances
Conformacin de la piel humana
Fundamentos o pilares sostenedores
Ramas que la componen
Tipos fundamentales, descripcin y reconocimiento
Topografa de un dactilograma. Su importancia
Partes componentes
Clasicacin decadactilar. Claves y posibilidades
Puntos caractersticos. Descripcin y conformaciones
Requisitos para establecer Identidad Dactiloscpica
DACTILOSCOPA
IDENTIDAD
PAPILOSCOPA
136
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
137
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
Lea atentamente el siguiente texto que como Introduccin fuera includo en un trabajo
monogrco por alumnos de este Instituto Universitario. Luego de ello y acorde a sus conocimientos
actuales indique que entiende por Persona (humana y jurdica), identidad, semejanza e identicacin.
Qu signica el nombre civil y qu el antropolgico? Cuntos Sistemas de Identicacin Humana
conoce? En qu consisten?
138
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
139
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD IV )
El Derecho como ciencia que estudia y regula las acciones del hombre en sociedad,
del hombre con el hombre y del hombre con las cosas, necesita para hacer efectiva su
tarea determinar en forma fehaciente la Identidad Humana, como condicin sine qua
non para que stos puedan adquirir derechos y obligaciones.
Para el logro de este Derecho a la Identidad se ha debido transitar un largo
camino. Hoy este derecho est asegurado y cada vez son ms las tcnicas que de
maneras directa o indirectas permiten establecerlo.
Sin embargo, para una total comprensin, se hace necesario precisar que algunos
conceptos o vocablos pueden alcanzar extensiones o signicados distintos en su uso
vulgar y en el uso tcnico o cientco. Segn el diccionario podemos denir a
Igualdad: Como la semejanza o correspondencia de una cosa con otra. Relacin
de equivalencia entre dos cantidades o funciones.
Identidad: Igualdad o alto grado de semejanza.
Idntico: Igual o muy parecido.
Semejanza: Como el conjunto de caractersticas que hacen que una persona o cosa
se parezca a otra. Parecido.
El anlisis de todas estas deniciones permiten inferir que dichos trminos pu-
eden ser utilizados como sinnimos. En el uso cotidiano o vulgar, esto es as. Cuando
nos referimos a dos vehculos de la misma marca, modelo, color y estado; o a un juego
de platos o copas, no resulta incorrecto decir que todos son iguales. Empero en forma
cientca, ambos conceptos encierran signicados diferentes. Dos gotas de agua de la
misma extensin, tamao, peso, contenido, etc., sern semejantes pero nunca podrn
ser iguales porque ocupan diferentes lugares en el espacio.
Dentro de este concepto denimos entonces a:
Identidad: Del latn Identitas y sta de Idem: como igualdad o calidad de idntico.
Conjunto de circunstancias que distingue a una persona de otras. O caractersticas
Identidad humana
140
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
y condiciones que distinguen a personas y cosas de otras de la misma naturaleza.
O cualidad de todo ser de ser igual a si mismo y distinto a los dems, quod est
est y quod non est non est.
Identidad Humana: Encierra cuatro componentes:
a) Cualidad de una persona de ser igual a s misma;
b) de ser distinta a los dems;
c) en todo tiempo; y
d) en todo lugar. Slo se puede ser igual a s mismo.
En las primeras conformaciones humanas tribales o clnicas, todos los integran-
tes se conocan entre s, siendo de esa manera fcil el reconocimiento indubitable
de una persona. A su vez, estas comunidades se diferenciaban y reconocan una de
otras por su vestimenta, adornos, pinturas, tatuajes, etc., estando unidas por lazos
de sangre, por sus dioses, sus totems clnicos, etc.
Antes que los hombres se comunicaran con el lenguaje hablado, lo hacan a travs
de gestos o a travs de sonidos guturales. Al evolucionar y utilizar la palabra como medio
de comunicacin, necesitaron implementar para referirse y distinguirse uno de otros, lo que
actualmente conocemos como nombre. stos primeramente fueron tomados de la
naturaleza, de los animales o fueron creados intelectualmente. En la edad media el
Papa Gregorio VII incorpora como nombres, los provenientes del santoral cristiano.
A medida que el nmero de integrantes de una comunidad creca, se hizo necesario
para poder distinguirse, incorporar nuevos datos referenciales. Estos datos conformaron
lo que hoy denominamos apellido cuyos orgenes ms comunes parten de carac-
tersticas de aspecto fsico (Cano, Delgado, Rubio); del lugar de origen o residencia
(del Valle, Montaa, Ros); de la profesin (Escudero, Herrero, Pastor); por signicado
(del hebreo Eva = vida, David = amado, Raquel = dulce), (orientales Abd = servidor
de: Abd-Allah = servidor de Dios); por derivacin del nombre del padre (griegos:
Aquiles de Peleo = Aquiles Pelades); o por defectos (Platn de platys = ancho de
espaldas siendo su nombre real Arstocles), etc.
Los espaoles por derivados del padre (hijo de Martn, deriv en Martinizi, Martinete,
Martnez; de Sancho en Snchez, Snchiz, Saenz, Sanz, Saez, Siz. Otros por agregacin
del trmino hijo al nal; (en Inglaterra y Suecia son, Adamson; en Alemania, shon, en
Dinamarca sen; en Escocia lo antepusieron: Mc; en Irlanda anteponan la preposicin
Of, que luego sustituyeron por la O con apstrofe, resultando por ejemplo: O Donnell.
141
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Los vascos por armado de datos echea casa, garay mayor = Echegaray = Casa
mayor; u orma tapia = Ormaechea = casa con tapia. A partir del siglo XI se acoplan de-
nominaciones seoriales por feudos o solares, Pedro Prez de Flores, etc.
Todo ello pasa a formar lo que hoy conocemos como el nombre civil de una per-
sona, que es una individual de orden jurdica pero no fsica. Esto equivale a decir
que reconoce jurdicamente los derechos a quin lo ostenta, pero hay adems que
establecer cul es la persona fsica que puede hacerlo por derecho propio.
Antiguamente, cuando algn integrante de esas comunidades cometa hechos por
lo que deba ser sancionado, su reconocimiento a travs del nombre civil era suciente.
Las penas podan ser leves o severas, siendo la ms grave el destierro. Aquellos que suf-
ran esta pena deban retirarse para siempre de la comunidad, por lo que emigraban hacia
otras. Si eran conictivos por naturaleza, en las nuevas comunidades muy pronto incurran
en conductas que motivaban nuevos destierros. La repeticin de estas conductas y las
graves dicultades que esto traa aparejado, hizo que fuera extremadamente difcil que
las comunidades aceptaran extranjeros, dicultndose as las migraciones naturales por
razones de salud o climticas, por parte de aquellos que no eran expulsados, por lo que se
hizo necesario distinguir uno de otros.
Obviamente las personas honestas eran las que necesitaban de alguna manera
comprobar quienes eran para poder as demostrar su honestidad. Los delincuentes por
su lado, utilizaban el simple recurso de cambiar su nombre civil y de esta manera eludan
sus antecedentes u obligaciones. Como la comprobacin de la honestidad es mucho ms
dicultosa y menos necesaria socialmente (no as individualmente), desde antao surgi
como un grave problema a resolver la identicacin del delincuente, para evitar su
incorporacin a las comunidades y para que no pueda eludir sus responsabilidades,
utilizando para ese n diferentes, brbaros y hasta salvajes procedimientos.
Para mencionar algunos, cabe citar que en la India y por aplicacin de las leyes de
Man se les provocaban marcas visibles que provocaban rechazos y abandonos. Adems
y segn el tipo de delito, le aplicaban mutilaciones de pies o manos y hasta la castracin. En
Grecia y Roma le efectuaban marcaciones con hierros candentes en la frente, manos, etc. y
eran considerados estigmticos. En Francia y Cuba el corte de orejas, marcas tales como V
(voleurs, ladrones), Gal (de Galere, condenado a la pena de galeras) o parana inyectada en
fro debajo de la piel para detectarla por medio del tacto. En Rusia cortes en la nariz, marcas,
etc. En Inglaterra las letras BC de (bad character) y Bentham creador de la teora Utilistarista -
donde el n justica los medios-, propuso grabaciones del nombre con tatuajes indelebles.
142
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Los tatuajes fueron muy utilizados para este n, pero tambin para distinguir tribus
o clanes, cofradas, organizaciones, profesiones (como por ejemplo las prostitutas), etc.
Con el descubrimiento de la fotografa se crey que el problema estaba por n
resuelto, ya que registrando a los delincuentes por este medio, stos ya no podran
eludir sus identidades ni sus responsabilidades. Sin embargo no tardaron en aparecer
los inconvenientes que este medio produca. Primero los cambios sonmicos normales
producidos por el paso del tiempo, o por simples modicaciones de estilos: cabellos
largos o cortos, uso de barbas o bigotes, etc. Afortunadamente no existan en esa fe-
cha los recursos actuales, donde el cambio de color del cabello es slo una nimiedad,
cuando tambin es posible el cambio de color de los ojos y hasta de la piel.
Otros inconvenientes eran las semejanzas de los rasgos sonmicos entre individuos;
las caractersticas coincidentes entre personas de razas negra o amarilla; y la gran cantidad
de fotografas a comparar con cada uno de los sospechados.
En la permanente bsqueda de mtodos que permitieran una ecaz labor y la solu-
cin de los inconvenientes que presentaba el uso de la fotografa, Alfonso Bertilln aplic
los conocimientos de la Ciencia Antropolgica, (que estudia al hombre fsica y moralmente
a travs de la biologa, de los tipos fsicos, genes, etnias, piel, formas fsicas, pigmenta-
ciones, etc) y a travs de las Ciencias Sociales (que estudia las costumbres, creencias,
organizaciones de vida, etc.), logrando desarrollar una nueva disciplina, la Antropometra
o Sistema Antropomtrico o Bertillonaje.
Este mtodo tena por objeto la toma de medidas fsicas del cuerpo (talla) en
posicin de parado, sentado y con los brazos extendidos. Mensuraba sobre la cabeza:
su longitud, ancho, dimetro bicigomtico y la oreja derecha y adems los miembros
superiores e inferiores. Tom como base, tres principios fundamentales:
a) jeza sea casi absoluta despus de los 20 aos;
b) la diversidad de las dimensiones del sistema seo entre individuos; y
c) la relativa facilidad y precisin en la toma de las medidas siguiendo algunos par-
metros especicados.
Efectuadas estas mediciones se confeccionaba una cha, a la cual se adosaba la
fotografa. Ante la tarea de identicacin de un delincuente, deba vericarse las chas y las
fotografas, solamente de aquellos cuyas medidas se correspondieran. Esto disminua consider-
ablemente la cantidad de fotografas que deban compararse. A pesar de los muchos defectos
que su prctica puso en evidencia, fundamentalmente por la aplicacin slo parcial que poda
143
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
efectuarse (no a menores, no a mujeres), por errores de medicin; por cambios en la estructura
sea hasta los 25 aos, por enfermedades, por vejez, etc. fue adoptado por muchos pases
del mundo, quienes luego de la abolicin paulatina pero constante, de los anteriores mtodos
vejatorios y brbaros, no contaban con otro sistema que los auxiliara en esta tarea.
Fue el mismo Bertilln que, ante las falencias de su sistema, crea a modo de comple-
mento el Retrato Hablado (portrait parl) o expresin oral de las caractersticas sonmi-
cas humanas. En ste, se detallan los siguientes elementos: Filiacin Civil: donde se
consignan todos los datos personales: nombre y apellido, sexo, raza, nacionalidad,
ocupacin, edad, estatura, peso, si sabe leer y escribir. Filiacin cromtica: colores
del cutis, cabellos, barba, ojos, cejas, etc. y Filiacin morfolgica: descripcin de sus
rasgos sonmicos tales como: formas de ojos, cabellos, insercin frontal, cejas, nariz,
barba, bigote, cara, mentn, boca, labios, cuello, orejas, frente, etc.; Seas particulares:
cicatrices, verrugas, caractersticas en dientes, tatuajes, marcas de nacimiento, viru-
ela, pecas, etc.; Peculiaridades: tics, andar, pasos, anteojos, bastn, tartamudez, etc.;
Indumentaria: sombrero, zapatos, estilos, pulcritud, etc.; Joyas: tipo, clase, donde las
usa, cantidad, etc.; Lugares: donde vive, viva, frecuenta o trabaja, de amigos, parientes,
etc.; Enfermedades: crnicas, temporales; Hbitos: bebedor, fumador, adicto al juego,
deportes, recreo, baile; Desplazamientos: en automvil, bicicleta, moto, camina,; etc.
Estos mtodos, a pesar del signicativo avance brindado, (tener presente que ac-
tualmente el fotogrco y el retrato hablado siguen siendo utilizados en identidad humana)
estaban condenados a ser prontamente suplantados por el Sistema Dactiloscpico, que
sistematizado primero por Vucetich y poco despus por Henry, son los que actualmente
brindan absoluta y precisa exactitud como Sistema de Identicacin. Sobre la Papiloscopa
en general y la Dactiloscopa en particular, nos volveremos a referir en la presente unidad.
Efectuado un rpido y cronolgico recorrido sobre los Sistemas de Identicacin
Humana, se hace necesario antes de la profundizacin de alguno de ellos, efectuar algunas
precisiones sobre la problemtica identicativa.
Establecer en forma indubitable la identidad de las personas, mantenindola desde
el momento de su nacimiento y hasta ms all de su muerte, les permiten adquirir derechos
y obligaciones. Estas responsabilidades pueden ser de carcter civil (herencias, sufragio,
contrataciones, etc.) o criminal (libertad, pecuniaria, etc.) y en todos los casos es necesario
su determinacin, ya que es posible ejercer derechos y obligaciones si se acredita que les
corresponden, asegurando as al honrado su determinacin y al delincuente la acreditacin
de autoras y reincidencias, evitando que pueda ocultarla o variarla.
144
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
El hombre siempre ha sido igual a s mismo, distinto a los dems, en todo tiempo y lugar.
El meollo de la cuestin fue lograr determinar fehacientemente estas circunstancias. Es decir
el lograr un Sistema de Identicacin que permitiera acreditar estas circunstancias.
En sus orgenes, la determinacin de la identidad fue emprica, es decir se basaba
en el conocimiento y el reconocimiento de la identidad de una persona. Esto trajo
aparejado como inevitable consecuencia, el error humano involuntario o voluntario.
Haba que reconocer a la persona a pesar del tiempo y los cambios producidos. Se haca
necesario una determinacin fehaciente a travs de un juicio. No slo haba que deter-
minar mediante juicio la responsabilidad de autora de un hecho, sino que en la captura
o recaptura de una persona haba que probar por igual medio, que sta era la persona
buscada. As hubo muchos tristemente clebres casos de suplantacin de identidades,
algunas de ellas por error o equivocacin y otras por maldad, conveniencia o fraude.
El hombre posee tres tipos de identidades. La identidad fsica: dada por las
caractersticas y particularidades de transmisin gentica que se exteriorizan en la
morfologa o constitucin del hombre; la identidad psquica: constituida principal-
mente por las vivencias y afectaciones personales, que conforman con intervencin
del ego, del yo y del ello, particularidades propias y nicas; y la identidad biogrca:
correspondiente a los datos de nacimiento, madre, padre, lugar, fecha, sexo, etc.
Para poder lograr el establecimiento de la identidad, hay en la actualidad una
gama muy variada de posibilidades. En forma genrica podemos distinguirlas en
procedimientos de carcter indirectos y/o directo. Este ltimo est dado por la
Papiloscopa que como se indicara, ser tema a tratar en esta unidad. Los primeros
estn constituidos por una serie de elementos y de sistemas, que en forma muy su-
percial (dada su amplitud y complejidad) trataremos de desarrollar.
Lograr la identidad en forma directa, signica que la identidad est lograda por s y
en forma indubitable. Es decir es prueba absoluta. Hacerlo en forma indirecta es hacerlo
a travs de indicios. Los indicios tienen dos caractersticas, una absoluta y otra relativa.
Son absolutos cuando permiten comprobar en forma fehaciente una circunstancia, que
en lo referente a identidad es siempre un descarte por discoincidencias. Esto equivale
a decir que no es la persona buscada. Por su carcter relativo, permite vincular como
posible a una persona, pero no da certeza de identidad ya que otra u otras personas
pueden presentar similares caractersticas identicativas. La evaluacin en cantidad y
calidad de los indicios encontrados, permitir a quien tenga la responsabilidad de juzgar
a travs de la sana crtica, darle validez probatoria o desechar los mismos.
145
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Son varios los elementos y mtodos que permiten por medios indirectos, establecer
la presencia y/o la participacin o no de una persona en un lugar o en un hecho. Muchos de
ellos son antiguos y han tenido escasa o nula utilizacin. Otros ms modernos y tcnicos, se
han convertido en verdaderos auxiliares de la justicia. Mencionaremos, entre estos ltimos,
los ms destacados o importantes. Debe tenerse en cuenta que la reforma constitucional
de 1994 ha establecido como garanta por ella amparada, el Habeas Data o derecho de
privacidad de los datos personales. Esto signica que para la obtencin de elementos de
comparacin indubitados, que permitan la evaluacin y dictamen sobre los rastros o testigos
mudos vinculados con el hecho, se deben guardar las formas legales correspondientes, es
decir la voluntaria prestacin ante la autoridad judicial correspondiente o de corresponder,
la orden por ella emanada.
Identicacin Odontolgica: la denticin es un conjunto de fenmenos que
contribuyen a la formacin, salida y crecimiento de los dientes. Presenta normalmente
dos etapas: una primaria a partir del quinto mes de vida y una secundaria a partir de
los cinco aos. La dentadura permanente de un adulto es de 32 dientes dispuestos
en cuatro hemiarcadas, conformadas por dos incisivos, un canino, dos premolares y
tres molares. Estos se representan esquemticamente por una frmula grca llamada
frmula dentaria.
Durante el proceso de denticin se pueden producir anomalas en cuanto a la cantidad
de dientes. Se llaman suplementarios o supernumerarios a los dientes que exceden la canti-
dad ya referida y se denomina oligodoncia a la falta de uno o ms dientes. Tambin pueden
ocurrir anomalas de formas como ser: dientes incluidos, radiculares, marcados, etc.
En la frmula dentaria contenidas en chas de cartulinas de 20 x 16 cm., en su
anverso se consignan los datos personales y el odontograma o dibujo de la frmula
dentaria, sealizndose sobre sta con color rojo los tratamientos anteriores, sean
stos arreglos, faltantes, prtesis, anomalas, etc. Con azul los trabajos a realizar, ob-
turaciones, material, tratamientos, radiografas, encas, sarro, prtesis, presupuesto,
forma de pago. En el reverso fechas de trabajos, de pagos, de ausencias.
La comparacin de los detalles de las chas con las dentaduras analizadas, permite
identicaciones. Entre sus principales defectos se detallan: las deciencias por llenado,
traslados de lugares de profesionales o pacientes, fallecimientos del odontlogo, etc. Se ha
propuesto que en los arreglos se incorpore antes de la amalgama, una chapa identicatoria.
En caso de ser necesario por medio de una radiografa se identica el vstago. Debe tenerse
en cuenta empero, que por ser una prtesis la misma puede ser removida o transferida.
146
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Reconocimiento a travs de la Voz Humana: la voz es un fenmeno neurosi-
olgico, fsico, acstico, fonolgico y lingstico que permite la comunicacin por len-
guaje oral. Su reconocimiento permite la identicacin de una persona. Como primer
antecedente positivo podemos mencionar que en la Biblia, Gnesis 27, 1-22, se seala
el reconocimiento por parte de Isaac en su lecho de muerte (pese a los esfuerzos
realizados por su esposa Rebeca, al adherirle vello en el brazo de Jacob tal como lo
posea Esau, su hermano mayor) de la voz de su hijo segundo, que intentaba recibir
los derechos del primognito. Como antecedente negativo en 1935 el caso Lindberg
c/ Haupmann en los Estados Unidos de Norte Amrica, donde se condena a muerte
por secuestro al imputado, luego de ser reconocida su voz a travs del telfono, de-
terminndose luego de su ejecucin su no responsabilidad en el hecho.
Podemos decir que la voz es un conjunto de sonidos modulados en la laringe por las
cuerdas vocales y nalmente emitidos por la cavidad oral. Las teoras actuales concuerdan
que se produce por mecanismos localizados en las vas respiratorias inferiores y superiores,
estando comprendida la primera por los pulmones -que actan como fuelles lanzadores de
aire-, los bronquios, la trquea y la porcin inferior de la laringe hasta las cuerdas vocales.
Los msculos aritenoideos regulan la tensin de las cuerdas vocales. El aire al pasar por
la glotis -porcin superior de la faringe-, produce una vibracin sonora que acta sobre la
voz. El sonido es modicado por las vas superiores, conformadas por la parte superior de la
faringe por encima de las cuerdas vocales, la faringe, la boca (lengua, paladar y labios) y las
vas nasales, conformando una verdadera caja de resonancia que le da sus caractersticas.
Esta ltima va es normalmente afectada por el polvo, el humo, el alcohol, la humedad, etc.
causando disfonas o afasias.
En el cerebro se producen dos fenmenos: recibida una impresin, se produce la
traduccin en sonidos articulados de las ideas que fueron suscitadas por la impresin
recibida. La voz se forma por la variacin posicional de los labios, de la mandbula, la
lengua y el velo del paladar produciendo formantes espectrales, provocando la nariz
y la faringe alteraciones en la resonancia.
Son causales de variacin entre las personas las diferencias: anatmicas y siolgi-
cas; de aprendizaje del habla; de tiempo; de condiciones fsicas, psquicas y anatmicas;
de maneras de emisin; de idioma, de acento; de frecuencias; por simulacin, etc.
Su reconocimiento pericial es por medios aurales y espectrogrcos. Efectuadas
las depuraciones de las cintas que contienen los registros, se resguardan y se toma la
testigo en las condiciones ms similares posibles. Los profesionales involucrados en los
147
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
estudios efectan reconocimiento aural por medio de escuche, retencin en memoria,
reconocimientos y evaluacin. Determinan ritmo, entonacin, inexin, modismos, recep-
cin, defectos y pronunciacin. Luego por medio de registros espectrogrcos con equipos
de seal digital, se obtienen espectrogramas o representaciones grcas tridimensionales
que representan la relacin entre los componentes frecuenciales, de amplitud, tiempo y
armnicas. Sobre el grco se determina ubicacin, evolucin temporal y frecuencia de
formantes, ancho de bandas, amplitudes relativas y frecuencia gltica. La evaluacin de
los reconocimientos espectrales y aurales permiten arribar a las conclusiones.
En nuestro pas desde hace unos aos, este tipo de estudio es realizado por la Polica
Federal Argentina a travs de la divisin Scopometra de la Superintendencia de Polica
Cientca, por medio de un equipo de profesionales conformado adems de personal tcnico
auxiliar, por un ingeniero en sonido y por fonoaudilogos, que han debido cumplimentar
con los requisitos regulados por el Subcomit de Identicacin y Anlisis Acsticos de la
Voz (VIAAS) de la Asociacin Internacional de Identicacin (IAI).
Identicacin por la Huella Gentica: Genomio es el nombre con que a veces se
denomina al cdigo gentico que cada uno de nosotros posee. Salvo algunas excepciones
(como el caso del hemate), cada clula en su regin nuclear, contiene este cdigo con
todas las informaciones indispensables para que nuestro organismo se desarrolle. Para
ello, son necesarios cuarenta y seis cromosomas esencialmente constituidos por cido
Desoxirribonucleico o ADN. Este est compuesto por cuatro bases, Citosina, Timina,
Guanina y Adenina representadas por las letras C, T, G y A que al agruparse en una larga
cinta, conforma el cromosoma.
Dada la forma que adoptan estas estructuras de doble cadena helicoidal (recordar
que helicoide es el giro alrededor de un cilindro, mientras que espiral es el giro envolviendo
un cono) reciben el nombre de doble hlice, enrollndose una alrededor de la otra. As
dados sus tamaos slo pueden unirse la Adenina con la Timina o viceversa y/o la Cito-
sina con la Guanina o viceversa. Las primeras lo hacen a travs de un doble puente de
hidrgeno y las segundas por un triple puente de hidrgeno. Estas cadenas no son iguales
sino complementarias una de otras. El ordenamiento sucesivo en secuencias de bases en
la molcula de ADN, es propio y constante en cada especie.
148
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
El apareamiento especco de estas cadenas le permiten que al separarse,
sirva de molde para la formacin de una cadena acompaante similar. Esto se llama
propiedad de autoduplicacin y es lo que permite identicar las secuencias o
disposicin de las letras CTGA y por consiguiente leer el propio cdigo gentico. A
travs de tcnicas se ha concebido un medio para determinar donde aparecen ciertas
secuencias especcas. En un cdigo gentico de una longitud de aproximadamente
tres mil millones de bases, es posible determinar secuencias especcas o combi-
naciones de esas letras en una longitud de 15 a 20 bases. Estas secuencias pueden
repetirse varios miles de veces.
Las secuencias en tndem formadas (repeticin de n veces de la secuencia
CTGA, es decir que si n es igual a tres, la secuencia ser CTGA-CTGA-CTGA) per-
miten secuencias de 2, 3, 4, 5 veces. Los diferentes valores tomados por n, es decir
el nmero de veces que se repite una misma secuencia, permite la identicacin por
el ADN. Obsrvese la conformacin de una secuencia.
Obsrvese en la gura precedente la formacin de las cadenas y las bases descriptas.
149
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
AGCTAGCT
AGCTAGCTAGCT
AGCTAGCTAGCTAGCT
AGCTAGCTAGCTAGCTAGCT
AGCTAGCTAGCTAGCTAGCTAGCT
AGCTAGCTAGCTAGCTAGCTAGCTAGCT
Obviamente los elementos repetitivos que se analizan son ms complejos que la simple
secuencia mencionada como un ejemplo extremadamente simplicado y slo para dar una
idea de la amplitud de diferenciacin entre individuos. Una unidad que normalmente tiene una
longitud de 15 a 20 bases puede repetirse en tndem entre 200 y 1400 veces. Esto representa
que si en un juego podemos elegir entre 10 y 20 nmeros sobre un total de 200 a 1400, la
probabilidad de elegir todos los mismos nmeros que otra persona son pocas. Con respecto
al ADN esta circunstancia es as salvo en los gemelos, cuyo patrimonio gentico es idntico.
Identicacin fsicaa travs del Olor: ste es captado a travs de uno de los sentidos
humanos y es la sensacin que se produce en la mucosa olfatoria por la accin estimula-
toria de las terminaciones nerviosas de los nervios olfatorios a nivel de la mucosa nasal.
Algunas sustancias emiten partculas muy pequeas que al estimular la mucosa nasal,
provoca una reaccin qumica y sta estimula el impulso nervioso o sea la sensacin del
olor. La especializacin de este sentido permite que los tcnicos en olores reconozcan
en un ambiente cargado de centenares de perfumes, uno de ellos y sus mezclas.
A travs del olor se pueden identicar a personas vivas o muertas, explosivos, estupefa-
cientes, sustancias orgnicas, tumores cancerosos, etc. En la identicacin humana la tcnica
indica recoger los olores dejados por el autor y jarlos de manera durable. Teniendo en cuenta
que el olor es una microhuella que el cuerpo exuda y que se deposita en el suelo, en las cosas
tocadas, usadas, etc., es posible su identicacin a travs de la espectrografa de masa.
Ante la premisa de que no hay dos hombres con olores idnticos y que la transpiracin
dispersa moles de olor, se requiere la capacidad y el adiestramiento necesario para su deter-
minacin. El hombre si bien es macrmato, es decir que tiene poco olfato, puede lograr una
especializacin. El perro es por naturaleza micrmato (mucho olfato) y es normalmente adiestrado
para este tipo de reconocimiento, siendo necesario desarrollar un reejo condicionado.
Los olores pueden recogerse o jarse en paos libres de olores, que se colocan por
espacio de 25 minutos sobre objetos sostenidos por una persona por espacio de 10 minutos.
Con pinzas para evitar contaminaciones, se lo dobla hacia adentro y se los conserva en fra-
scos cerrados y rotulados pudiendo durar varios aos. La tcnica implica hacer oler al perro
150
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
adiestrado, libre de todo estmulo que pueda distraerlo, el testigo mudo recogido en el lugar del
hecho. Luego se debe colocar entre cinco frascos distanciados a un metro cada uno, cuatro
olores no relacionados y el sospechado. Olfateados por el animal, se acostar frente al frasco
identicado. Se debe repetir la operacin cambiando de lugar los frascos y con otros animales.
El margen de error es de aproximadamente 2%.
El olor se presenta en forma de materia y permanece durante horas, das, semanas
y ms. La rama tecnolgica que se encarga del estudio y determinacin de los olores se
denomina Olfatrnica. El mtodo de determinacin es a travs de un cromatgrafo
que separa bases gaseosas y lquidas y de su medicin se obtiene, lo que se ha dado
en llamar, rmas olfatrnicas.
Introducidos los vapores de la muestra a analizar en el cromatgrafo de fase gaseosa,
este es arrastrado por la corriente de gas inerte que en forma lenta y continua se le hace
pasar. Del otro extremo del tubo un indicador ultrasensible controla la salida del elemento.
Se efectan cromatogramas que luego son comparados.
Otras tcnicas ms recientes han permitido la invencin de un detector de olores por
sensores elctricos que luego son comparados por medio de computadoras. Todo esto
permite relacionar o descartar sospechosos, relacionar lugares con autor, etc.
Identicacin por Reconstrucciones sonmicas: consiste en el dictado del
rostro de los autores por parte de las vctimas a travs de bocetos, o de modicacio-
nes sobre fotografas para actualizar cambios o reconstrucciones de rostros daados
o tapados por terceros, o sobre cadveres, etc. Varias son las formas de aplicacin,
mencionaremos entre ellas:
El Identi-kit: consiste en ms de quinientas transparencias con los diversos rasgos que componen el
rostro. Acorde a los datos suministrados se hacen incidir rasgos sobre gua de contorno del rostro,
la que posee aberturas para sujecin. Su principal inconveniente es la apariencia robotizada que
se obtiene.
El Foto-t: son dibujos tcnicos sobre la conguracin del rostro en lo que hace a su forma, dis-
posiciones pilosas, nacimientos de pelo, forma de cejas, bigotes, barbas, etc. Asimismo forma
de ojos, orejas, boca, labios, mentn, frente, nariz, cicatrices, lunares, verrugas, etc. Se efecta
de frente y perl.
La aplicacin de programas computacionales que incluyen software que permiten
efectuar modicaciones sobre las imgenes logradas, ha aportado un gran auxilio a esta
forma de reconocimiento humano. Entre ellos se destacan el secon y el faces.
151
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Otros medios de identicacin pueden brindarlos por ejemplo: los puntos de sutura
quirrgica, los tatuajes, proyectiles retenidos en el cuerpo, marcapasos con marca y nu-
meracin registrada en historia clnica, prtesis de todo tipo: ortopdicas, odontolgicas,
plsticas, estticas, etc., marcas de ropa y de lavandera, etc.
Dentro de la amplia gama de rastros o testigos mudos que se pueden recoger en el
lugar de los hechos luego de realizada la inspeccin ocular, se describirn algunos pocos y se
har referencia a otros, que en forma indirecta permiten la identicacin de una persona.
Rastros de pisadas: pueden ser dejados de tres maneras diferentes. Por pie
calzado, pie con medias o pie desnudo que pueden dejarse en diversos tipos de su-
percie. En las duras, lisas y pulidas pueden dejarse visibles o latentes. Los primeros
por estar mojados o embarrados o bien por estar coloreados con sangre, pintura, harina,
sustancias grasas, talco, etc. Los segundos deben ser revelados utilizando para ello
los procedimientos ms adecuados a cada caso en particular. En supercies blandas
pueden quedar por ejemplo sobre tierra hmeda, barro, arena, nieve, etc. y luego de su
fotograado se la puede levantar acorde al tipo de supercie, utilizando diversos proced-
imientos, obtenindose as un moldeado con yeso de rpido fraguado del tipo Pars.
El rastro de pisada dejado por un pie desnudo, por ser parte de la papiloscopa se
detallar ms adelante. Con relacin al pie calzado es posible obtener, a partir del rastro de-
jado, una serie de datos importantes. Tipo de calzado utilizado: zapatos con suelas y tacos
de goma o de cuero o mixto, deportivos con suelas de goma, otros con suelas de plstico,
de soga, etc. Posible marca del calzado: dado por el diseo o dibujo de la suela, esto espe-
cialmente en los calzados deportivos. Tamao del pie: a travs de la mensura de la huella.
Anomalas: que se evidencien en el andar. Desgastes desparejos: acorde a su composicin,
los tacos y las suelas presentan desgastes anormales por incorrecto apoyo de los pies, fric-
ciones desparejas, problemas en columna, peso, modismos ambulatorios, etc. El sexo: dado
por el tipo de calzado o por la forma de apoyo en casos de disimulo. El retrato del paso: nos
puede dar talla por la distancia entre dos pisadas, forma y direccin de la punta del pie al
andar, si hubo ms de una persona, si hubo lucha, etc.
Obtenido el moldeado o la reproduccin fotogrca, se debe tener en cuenta que los
mismos son el negativo de las suelas y por lo tanto no pueden ser cotejados directamente con
el calzado sospechado. Para dicho cotejo previamente debe obtenerse molde o fotograado
de las pisadas dejadas por el sospechoso con ese calzado y en similar tipo de supercie
que el dubitado. En concreto siempre debe compararse molde con molde o fotografa con
fotografa, obtenindose luego otras reproducciones donde se sealarn las coincidencias
o discoincidencias.
152
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Huellas de pie con medias: si bien el tramado de la media utilizada puede quedar estam-
pado en estos rastros y a travs de ellos es posible establecer tipo, roturas, zurcidos,
etc., no es mucho lo que en realidad estos datos puedan indicar. S resulta importante
los datos que aportan en cuanto a la forma de implantacin del pie. Recordemos que por
anomalas en su conformacin o en la columna o por apoyo, un pie puede ser normal,
talo o en exin, plano, etc. Esto puede visualizarse en este tipo de rastro, al igual que
las formas, separacin, tamao, posicin y apoyo de los dedos.
Huellas de mordida: este tipo de huella dejada sobre supercies blandas tales como
manzanas, dulces slidos, quesos, chocolates, etc. o en piel humana, pueden darnos
adems del tamao y forma de la boca, la cantidad de piezas dentarias, sus posiciones
e interrelaciones, estados, defectos, etc., y en algunos casos obtener restos de saliva.
Acorde a cada supercie, cantidad y tiempo transcurrido se puede obtener directamente
o por medio de lavado por hisopado. Su presencia puede darnos una serie de datos que
se describirn a continuacin. Al igual que en otros, es necesario obtener su moldeado
utilizando para ello diversos productos de uso odontolgico para tomas de moldes de
prtesis.
Huella de saliva: adems de los restos que puedan ser arrastrados por ellas desde la cavi-
dad bucal, todos los pertenecientes a su composicin, es decir tipos de sales minerales
o sustancias orgnicas como la mucina, urea y albmina, como as tambin sus enzimas:
la amilasa y la lisozima. La saliva tiene acciones digestivas, lubricantes y secretoras. A
travs de la saliva, de ser secretora la persona, es posible la determinacin de sangre, la
ingesta de alcohol o drogas, etc.
Huella de uidos seminales: se denomina semen o esperma al producto secretado por
el aparato genital masculino despus de alcanzada la madurez sexual. Encontrada una
mancha o extrada por hisopado es posible determinar si es semen, si es de origen hu-
mano o animal, la determinacin del grupo sanguneo, si tiene mezcla con otros materiales
biolgicos como ser orina, materia fecal, saliva y tambin el uso de alcohol o drogas. Esto
permite determinar acciones que pueden ser constitutivas de delitos.
Pelos: este simple y frgil rastro es prcticamente indestructible permaneciendo ad-
herido en cadveres enterrados durante mucho tiempo, conservando informacin sobre
venenos, edad, sexo, raza, teidos, enfermedades y a veces hasta la profesin. Se hace
necesario, como con otros rastros, obtener siempre muestras de la o las vctimas para
futuros descartes. Podemos decir que los pelos son lamentos conicados desarrollados
en la epidermis o capa externa de la piel, que presentan entre 0.05 y 0,6 mm de espesor
y largo variado.
153
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Los mismos se encuentran en casi toda la extensin del cuerpo y presentan
folculo piloso, papila pilosa, raz, tallo y glndulas sebceas, sufriendo diferentes
cambios en el transcurso de la vida.
Su morfologa est compuesta por tres planos, siendo stos de afuera hacia adentro:
la cutcula o escamas, la corteza y la mdula. La cutcula est formada por escamas compu-
estas por clulas queratizadas superpuestas y dirigidas hacia la punta del pelo que pueden
presentarse de diferentes maneras. A ttulo ilustrativo puede observarse en la gura siguiente
tomada del Manual de Criminalstica de la Editorial Policial, representaciones esquemticas
de la misma donde pueden apreciarse sus diferentes conformaciones.
Su estudio, luego de la aplicacin de la tcnica ms adecuada segn el caso,
es por observacin microscpica. Se debe determinar el ndice escamoso o cantidad
de escamas por una unidad de longitud tomada en forma arbitraria. Esto permite
efectuar comparaciones. Si bien no presentan demasiadas variaciones en este ndice
entre varias personas, su valor reside en el descarte del origen del cabello estudiado.
Obsrvese en las vistas tomadas del mismo manual, las diferencias que presentan a
un mismo aumento, los pelos de distintas especies:
154
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
La corteza formada por clulas corticales en forma de agujas, es la responsable de la coloracin
del pelo. La distribucin y color de estos grnulos pigmentados aportan importantes puntos de
comparacin entre cabellos.
La mdula o canal central del cabello presenta, segn las especies, diferentes tamaos, siendo
variable entre individuos y an entre pelos de un mismo individuo. Adems no todos los pelos
presentan mdula. Se mensura su dimetro total y el dimetro medular. Obsrvese en la gura
siguiente, diferentes tipos de mdulas.
Raticando las apreciaciones mencionadas al comenzar con este tema, desde el
punto de vista criminalstico el pelo permite determinar: si es humano o no; lugar del cuerpo
de donde proviene; si ha sido arrancado, cado, cortado, roto; edad, raza y sexo; color si es
original o teido; si es de un ser vivo o muerto; profesin a travs de los residuos hallados;
traumatologa; determinar: venenos; distancia del disparo; grupo sanguneo; enfermedades;
y enzimas, a travs de estudios serolgicos y trazas de elementos orgnicos metlicos.
Macrofotograa x 400 - cuticula de cabello humano Macrofotograa x 400 - cuticula de cabello humano
FIGURA N 1
FIGURA N 5
Macrofotograa x 400 - cuticula simple - pelo de murcielago Macrofotograa x 400 - cuticula simple - pelo de murcielago
Macrofotograa x 400 - cuticula crenada - pelo de zorrino Macrofotograa x 400 - cuticula crenada - pelo de zorrino
155
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Se mencionan otros rastros que pueden hallarse en una inspeccin ocular y que pueden
estudiarse criminalsticamente: pus, materia fecal, meconio (primera defecacin del beb), calos-
tro (primera leche materna), lquido amnitico, orina, sudor, piel, etc. Adems formas de uas, de
manos, de asentaderas, de ropas, de hollado del lecho, de animales, de labios, de efracciones
con distintas herramientas (que ser detallado en la unidad referida a balstica), etc.
Por ltimo y a modo referencial, se efectuarn algunas consideraciones con relacin
a los rastros dejados por vehculos. Los rastros dejados en diferentes tipos de hechos por
el vehculo utilizado para llegar o huir del lugar del hecho o en los casos que ahora han
pasado a ser bastantes frecuentes, de embiste y fuga, la determinacin de este tipo de
rastro puede aportar elementos invalorables. El moldeado y levante, acorde a la supercie
donde se encuentra, es similar a lo detallado para el rastro de pisadas.
El estudio de estas huellas nos puede permitir, a travs del dibujo dejado, establecer la
marca, modelo, tamao, etc. del tipo de neumtico utilizado. A travs de ello, las marcas de
vehculos que pueden utilizarlas. Si adems se obtiene el rastro de ambas ruedas delanteras
o traseras o de todas, es posible establecer el tamao de la trocha y luego determinar los
vehculos que tengan igual correspondencia. Los rastros de pintura determinados en roces,
hebillas, etc. pueden aportar datos de la marca, modelo y llegado el caso a comparaciones
directas con el vehculo sospechado.
Como se comprender, los rastros provenientes de la inspeccin ocular obtenidos
siguiendo las formalidades detalladas en la unidad anterior, permiten de forma variada,
obtener indicios que, en forma absoluta permitirn descartar a un sospechoso y en forma
relativa vincular a otros. Todos los indicios encontrados y peritados sern evaluados en
cantidad y calidad a travs de la sana crtica, por aqul que tenga la responsabilidad de
juzgar, pudiendo considerar luego de ello si se encuentra sucientemente probada o no,
la presencia de una persona en el lugar de ocurrencia de los hechos. Por todo ello, son
considerados medios indirectos de establecer la identidad de una persona.
El mtodo ms conable, que permite obtener la identidad de una persona en
forma absoluta, directa, indubitable y conformante de prueba de la presencia de una
persona en el lugar, es la Papiloscopa. Dada su importancia, se efectuar una breve
pero completa descripcin de sus principales caractersticas, a n de brindar un pan-
orama de los basamentos tcnicos y cientcos que hacen de este, el nico medio de
identicacin directa.
Es a travs de la Papiloscopa y con cualquiera de sus tres ramas tcnicas Dactiloscopa,
Palametoscopa y Pelmatoscopa, que es posible asegurar la identidad fsica de una persona,
156
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
mediante el sello natural antropolgico nico, invariable y perenne que lo distingue de cualquier
otra persona, dado por las caprichosas conformaciones del tejido epidrmico de los pulpejos
de la tercer falange de los dgitos, de las palmas de las manos y de las plantas de los pies.
Ese conjunto de particularidades o pequeos detalles antomonaturales de origen
congnito, aseguran la determinacin categrica e indubitable de la identidad fsica personal
y el derecho a la identidad de todas las personas, desde su nacimiento, durante toda su
vida y an hasta despus de su muerte. Estos relieves papilares son rigurosamente indi-
viduales, no se transmiten por herencia biolgica, no se repiten diseos entre ascendientes
y descendientes y constituyen una singular variedad creadora de la Naturaleza.
Dentro de los primeros estudios y principales precursores de este tema y
siguiendo los dichos del doctor Edmond Locard, pueden distinguirse tres perodos;
a) el prehistrico,
b) el perodo emprico y
c) el perodo cientco. Dentro del primero debe mencionarse que en las cuevas de Auri-
gnac y de Altamira o Gargas entre otras, se encontraron un tipo de arte muy particular
con representaciones humanas-animales y de motivos decorativos variados, entre los
que se destacan representaciones de la mano humana con pinturas en rojo y negro o
humedecidas con xido de hierro.
Asimismo cabe destacarse el hallazgo en cermicas japonesas prehistricas cubiertas
de moldeaduras papilares, o los rastros hallados sobre tejas romas o en los moldes de yeso
pertenecientes a escultores romanos, o sobre ladrillos asirios de la dinasta de Sargn, e
incluso en Amrica sobre ladrillos de adobe sin cocer encontrados en los cerros funerarios
de Mxico. Tambin la reproduccin grabada sobre piedra de los dibujos papilares de los
dedos y de las palmas de las manos encontradas en Kejimkoojik de Gavr-Inis. Estos rastros
papilares incitaron a Faulds y Galton entre otros, a iniciarse en el estudio de estos dibujos,
en procura de lograr la identidad antropomtrica humana.
Dentro del perodo emprico cabe destacarse que dentro de las Leyes Domsti-
cas de China, el marido para poder divorciarse, deba redactar de su puo y letra una
carta con alguno de los siete motivos que autorizaban al divorcio (desobediencia lial,
esterilidad, relajacin de costumbres, celos, lepra, habladura y robo). En caso de no sa-
ber escribir deba contener su impresin digital, la que era considerada como su rma.
Tambin era utilizada la impresin de los dedos o de las manos en las noticaciones de
las sentencias judiciales; en los contratos de venta de las esposas y de las hijas, donde
adems de la mano derecha deban imprimir la planta del pie derecho.
157
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Acorde a la creencia oriental estas impresiones de dedos, manos o pies no tenan el
concepto de identicacin personal, sino un origen mstico, al incorporar algo de su personalidad,
de su ser. Otro dato interesante es que los quiromnticos chinos a partir del siglo XVIII haban
distinguido en los dedos de la mano dos tipos de conformaciones o dibujos dactilares -que de-
nominaron lo y ki- que se corresponden con los tipos: verticilo y presilla respectivamente.
Dentro del perodo cientco no es fcil delimitar fechas ni hombres a quienes atribursele
semejante prioridad o descubrimiento. Esto fue probablemente la resultante del concurso de
centenares o millares de hombres e inteligencias y como en casi todas las grandes creaciones,
estas suelen ser annimas.
Nadie ha descubierto el fuego, ni el remo, ni la vela, ni el molino. No han sido Coln ni
Vespucio quienes descubrieron el nuevo mundo, sino innumerables e ignotos esquimales o
groenlandeses que haban ya arraigado y fundado una civilizacin para esa fecha. Una cosa
se hace cuando todos la piensan. Aquellos a quienes se les atribuye, no han hecho ms que
concretar ideas otantes.
Le corresponde al mdico anatomista italiano Marcelo Malpighi (1628-94) la pri-
maca del estudio de los dibujos papilares. Si bien su estudio fue desde un punto de
vista netamente siolgico, fue el primero es describir las rugas de los dedos y los poros
u oricios sudorparos que ms tarde inspirara a Locard su mtodo poroscpico.
Este mdico italiano hizo un profundo estudio de las diferentes capas de la piel humana,
habiendo descubierto la capa germinativa que lleva su nombre. Fue adems inspirador de otros
anatomistas que continuaron su obra, debiendo destacarse entre otros a Christian HINTZE.
Se puede considerar a Marcelo Malpighi como el abuelo de la dactiloscopa, ya que
todos coinciden que el verdadero padre de esta ciencia fue Juan Evangelista Pujkinje. Este
lsofo y mdico checo nacido en 1787, en su obra De examine physiologique organi
visus et sitematis cutanei efectu una descripcin y clasicacin de los dibujos digitales
y un admirable ordenamiento de las crestas, logrando clasicar nueve categoras.
Por su parte el administrador en jefe de Bengala, Sr. William Herschel desde 1858
haca utilizar en forma prctica las impresiones digitales en la autenticacin de contratos.
Su utilizacin no era con nes de identicacin, ya que no parece que hubiera tenido
idea de que una impresin fuera absolutamente individual, sino ms bien con un sentido
mstico aprovechando la idea de que los hindes al igual que los chinos atribuan a una
huella corporal una obligatoriedad mucho ms fuerte que a la de una rma. Posterior-
mente implement este mtodo tambin con los presos, para el servicio de pensiones y
en el registro de defunciones.
158
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
El mdico escocs Dr. Henry Faulds que se desempeaba en el hospital de
Tsukiji en Tokio, haba observado las numerosas impresiones papilares en cermicas
prehistricas, teniendo la idea de compararla con las impresiones de los japoneses
actuales. Descubri diversas conformaciones que hoy conocemos como puntos car-
actersticos, efectuando estudios etnolgicos y de herencia de los dibujos papilares,
haciendo asimismo comparaciones con la morfologa de otros mamferos.
Es mrito de Faulds, la descripcin de una tcnica que utiliza una placa de estao
y tinta para obtener impresiones y efectuar comparaciones. Describi dos casos en la que
haba empleado la tcnica dactiloscpica, una en la que haba identicado una impresin
dejada sobre un vaso y otra en la que determin no correspondencia de identidad. Acon-
sej utilizar las impresiones en las fotografas de los criminales, determinando asimismo
que las impresiones eran inmutables.
Sir Francis Galton nacido en 1822 en Duddleston y doctorado en medicina,
comenz en 1886 sus estudios sobre la identicacin por las crestas papilares. En 1890
detall un mtodo que le permita la bsqueda de una impresin dentro de una gran
coleccin. Fue l, que mediante sus pacientes investigaciones estableci y determin
la existencia de los tres pilares fundamentales de la papiloscopa, pilares sobre los que
descansa la bondad, seguridad e infalibilidad del sistema. Estos son la inmutabilidad,
la perennidad y la variedad. Adems efectu la comprobacin matemtica de que no
se presentar, salvo despus de una astronmica cantidad de aos, una impresin
exactamente igual a otra.
Pero fue Juan VUCETICH que naciera el 20 de julio de 1858 en la ciudad de
Lesina de la antigua Dalmacia, radicado en la Argentina en 1882, quien trabajando en
el Departamento Central de la Polica de la Ciudad de La Plata, denitivamente logr
un sistema de identicacin humana que en forma directa e indubitable, asegura el
tan preciado derecho a la identidad.
Recibida la orden de abocarse al estudio de establecer un servicio de identi-
cacin antropomtrica y luego de leer un ejemplar de la Revue Scientique donde se
publicaban los estudios de Galton, advierte que en las impresiones digitales se hallaba la
nica solucin integral a la problemtica de la identicacin humana. En 1891 luego de
prolongadas jornadas de estudio exhaustivo, crea un sistema que bautiz como icnofa-
langometra describiendo 101 tipos de dibujos dactilares, tomndose el 1de septiembre
de ese ao por primera vez en el mundo las impresiones digitales de los 10 dedos a 23
procesados. Las chas as obtenidas fueron luego clasicadas y archivadas.
159
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Muy pronto un hecho delictuoso iba a conrmar las previsiones de Vucetich. En junio
de 1892 Francisca Rojas denunciaba ante las autoridades policiales de Necochea el asesinato
de sus dos hijos, acusando como autor del hecho a un vecino suyo. Realizada la correspondi-
ente inspeccin ocular se observ en la puerta de la nca impresiones digitales estampadas
con sangre. Cotejadas esas impresiones con las del vecino y las de la madre de las vctimas,
permitieron establecer que el vecino era completamente ajeno al hecho y que las huellas con
sangre eran de Francisca Rojas, determinndose as la autora de sta en el doble licidio.
El permanente trabajo sobre su sistema buscando empeosamente mejorarlo, le
permite durante el transcurso del ao 1896 reducir aquellos 101 tipos originales a los 4
tipos fundamentales actuales, cuyo conjunto dio lugar a la creacin del Sistema Dac-
tiloscpico Argentino. Este sistema por sus bondades fue rpidamente difundido por
todo el mundo.
Por ltimo debemos mencionar a Sir Edward Richard Henry, colega y sucesor de
Herschel en Bengala, quien perfectamente al corriente de la cuestin de las impresiones
digitales, al regresar a Europa en 1899 haba elaborado un sistema dactiloscpico propio.
En 1900 publica la primera edicin de su libro Clasication and uses of nger print donde
describe su mtodo, que es utilizado actualmente en los pases de habla sajona.
Antes de comenzar con la descripcin del sistema dactiloscpico, se hace necesario
efectuar algunas consideraciones sobre la piel humana. Esta reviste la totalidad del cuerpo
siendo el tejido de mayor supercie y peso. Es el rgano de proteccin sensorial, tctil,
trmico, del dolor y de transmisin nerviosa. Se encuentra formada por tres capas prin-
cipales, una interna denominada endodermis, una intermedia profunda denominada
dermis que cumple una funcin conectiva de sostn y una exterior o epiteliar compu-
esta por clulas renovables denominada epidermis. Para nuestro estudio slo interesan
estas dos ltimas.
La Epidermis o capa supercial presenta una capa crnea exterior con clulas aplanadas La Epidermis La Epidermis
nucleares, otra capa o estrato lcido con clulas traslcidas alargadas, una tercera capa granu-
losa, seguida por otra capa espinosa o de Malpighi con clulas que aumentan de volumen y
se unen a otras, y una quinta capa basal o germinativa con clulas irregulares cilndricas. Se
une a la dermis por la membrana basal que regula el intercambio metablico. En esta capa,
denominada vtrea, se encuentran unas eminencias cnicas denominadas papilas drmicas.
La Dermis o capa profunda llamada tambin Corin, le da a la piel elasticidad, resistencia La Dermis La Dermis
y sensibilidad. Presenta una capa vascular y brosa con clulas conectivas y nerviosas. La
dermis papilar tiene crestas vasculares y nerviosas con corpsculos tctiles. La media pre-
senta vasos sanguneos y glndulas sudorparas. La profunda posee clulas adiposas con
msculos pilosos y bolsas serosas.
160
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Separando ambas capas se encuentra un sustrato traslcido denominado capa vtrea,
donde las papilas drmicas (unas eminencias circulares) se disponen de a pares -formando hil-
eras de extensin y direccin variable- que se maniestan en la epidermis como altos relieves,
denominados crestas papilares. Las ausencias de ellas conforman a ese nivel, depresiones
o bajos relieves, denominados surcos interpapilares. Esta particular disposicin se encuentra
en los tejidos epidrmicos de los pulpejos de los dgitos, en la cara anterior de las manos y en
las plantas de los pies.
Tienen como funcin el levantar el conducto de las glndulas sudorparas, lo que per-
mite mantener hmedas las manos. Esto le otorga la funcin de aprehensin de los objetos lisos
y redondos. Posee adems la funcin tctil, conteniendo los corpsculos de Meissner.
A los efectos de precisar los alcances de cada trmino se especican los siguientes:
Dibujo Papilar: guras conformadas por altos relieves (crestas) y bajo relieves (surcos) en la
epidermis de los pulpejos de la tercer falange de los dgitos, en las palmas de las manos y
en las plantas de los pies, que permiten la identicacin humana.
Crestas Papilares: Unin de dos hileras de papilas drmicas con direccin determinada, que
forman cordones y distintas guras.
Surco Papilar: espacio en bajo relieve que separa las crestas en forma longitudinal.
Impresin Papilar: resultado de estampar sobre un papel o fondo adecuado, los dibujos
papilares de los dgitos, palmas y plantas.
Rastro Papilar: marca visible que se deja sobre supercies adecuadas, es decir lisas y puli-
mentadas, producto de la humedad secretada por los poros de las glndulas sudorparas.
Como ya se ha hecho referencia, todo el sistema papiloscpico descansa sobre sus
pilares fundamentales que son los tres elementos que le dan base cientca al sistema:
a) inmutabilidad,
b) perennidad y
c) variedad.
Inmutabilidad: los dibujos formados por las crestas y surcos papilares permanecen inalter-
ables durante todo el transcurso de nuestra vida. No son modicados por causas voluntarias
ni involuntarias.
Las lesiones que puedan sufrirse en cualquiera de las regiones donde estos dibujos se
conforman, acorde su grado de afectacin podrn: a) si la lesin slo afecta la epidermis,
una vez sanada la misma las crestas se reproducirn de idntica manera conservando
161
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
su dibujo original y sin dejar ningn tipo de seal; b) si la lesin daa la capa profunda
o dermis, en los lugares afectados y luego de sanada la misma quedar una cicatriz,
reconstituyndose todas las crestas no perjudicadas y conformando el mismo dibujo.
La diferencia ser a partir de esa lesin, la presencia en forma permanente de una im-
pronta o cicatriz que pasar a ser un nuevo elemento de identicacin.
De esto se desprende que las alteraciones que puedan sufrir los rastros papilares son de
carcter temporal, reconstituyndose los dibujos originales, salvo en las zonas de cicatrices.
Perennidad: Estos dibujos se conforman entre el cuarto y el sexto mes de vida intrauterina,
o sea desde antes de nuestro nacimiento y perduran hasta ms all de la muerte, es decir
hasta que sobrevenga la putrefaccin o disgregacin cadavrica.
Variedad: No existen dos impresiones dactilares que posean el mismo dibujo papilar. Esto es
tan as que no presentan dibujos iguales ni los ascendientes ni descendientes directos, ni los
hermanos gemelos, ni an entre dos dedos de una misma persona. Cada uno de nuestros
dedos, palmas o plantas poseen dibujos con caractersticas de nicos e irrepetibles.
Un clculo proyectivo matemtico indica que no es probable la repeticin de un
dibujo sino en una cifra superior a los sesenta mil millones (60.000.000.000) de personas.
Los estudios preliminares al sistema y su uso en forma mundial despus de ms de cien
aos, han fortalecido todos y cada uno de los pilares descriptos.
Todas las consideraciones efectuadas hasta el momento, son de aplicacin a todo
el Sistema Papiloscpico. Sin embargo la sistematizacin de cada una de las tres ramas
tcnicas que lo componen (Dactiloscopa, Palametoscopa y Pelmatoscopa) ha requerido
tratamientos individuales.
Se efectuar, a continuacin, la descripcin de los principales elementos de
cada uno de ellos, dndose preferente atencin a la Dactiloscopa.
Dactiloscopa: ciencia que permite la identicacin fsica indubitable categrica y fehaciente,
de una persona, por medio de los dibujos formados por las crestas y surcos papilares situa-
dos en los pulpejos de la tercer falange de los dgitos de las manos. Para su estudio se hace
necesario distinguir dos conformaciones fundamentales: a) Deltas, b) Asa Central.
Delta: Es la gura formada por la conuencia o convergencia de dos o tres sistemas
de lneas o espacios que se miran por su convexidad o concavidad, conformando
una gura similar a la letra griega Delta y de all su nombre- ubicados a la derecha o
izquierda de los dactilogramas. Pueden ser a) negros o b) blancos. (sus deniciones
quedan igual) quedan igual)
162
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
El delta negro est conformado por crestas, las que al entintarse para la toma de
la impresin, provocan lneas de color negro.
El delta blanco se forma cuando en la conuencia de los tres sistemas se forma un
espacio triangular blanco, conformado por los surcos papiloscpicos.
Asa Central: es la lnea ms central del dactilograma que asciende, forma cspide
y desciende en la misma direccin de su inicio y conservando cierto paralelismo,
sin importar la extensin de sus ramas.
Se adjuntan ilustraciones sobre los distintos tipos de deltas descriptos y sobre
la conformacin de un asa central, tomadas del Manual Prctico de Papiloscopa de
Alberto Perez de la Editorial Policial.
Se denomina Dactilograma Natural al que se observa directamente en los pulpejos
de la tercer falange de los dgitos de las manos. A su vez se denomina Dactilograma Ar-
ticial, al que se obtiene sobre papel por entintado y que se conoce vulgarmente como
impresin digital.
El Sistema Dactiloscpico Argentino ideado por Juan Vucetich tiene en cuenta, para
la determinacin de los cuatro Tipos Fundamentales en que ha dividido la totalidad de los
dibujos que pueden presentar la epidermis en el pulpejo de los dgitos de las manos, la
presencia o ausencia de deltas. Es decir es un sistema eminentemente dltico.
163
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El sistema requiere la determinacin, encuadramiento y clasicacin de las dactilogramas
de los diez dgitos de las manos de una persona, debiendo para ello tomarse la impresin de los
mismos en la cha decadactilar por l creada. Para el cumplimiento de las normas de clasicacin
en los dactilogramas articiales, se debe determinar la presencia o ausencia de deltas.
Esto da lugar a dos posibilidades:
a) Ausencia de Deltas o
b) Presencia de Deltas. En este ltimo caso deben considerarse, a su vez, dos circunstancias:
a) Cantidad de Deltas y
b) Posicin con respecto del observador. Acorde a esto se conforman los cuatro
grupos patrones o tipos fundamentales del sistema: arco, presilla interna, presilla
externa y verticilo.
ARCO: Se denomina as al tipo fundamental que se encuadra dentro de la siguiente denicin:
Es todo dactilograma carente de conformacin dltica. Puede presentarse en forma Pura
e Impura.
Se denomina Arco Puro, Llano o Simple a todo dactilograma carente de delta que presenta sus
lneas o crestas papilares en forma transversal, algo curvas y paralelas entre s.
Se denomina Arco Impuro a todos aquellos Arcos no comprendidos dentro de la denicin de
Puro. En estos dactilogramas las lneas o crestas papilares se presentan conformando dibujos
variados. Estas pueden adoptar algunas de las siguientes guras: Piramidal Alto, Piramidal
Bajo, con Inclinacin de Lneas a la Derecha, con Inclinacin de Lneas a la Izquierda, Piniforme,
Angular o Quebrado, o Pseudos Deltas, etc.
PRESILLA INTERNA: se denomina as al tipo fundamental que responde a la siguiente
denicin: Es todo dactilograma que presenta uno, dos o ms deltas a la derecha del
observador. Pueden presentarse, asimismo, en forma Pura o Impura.
Se denomina Presilla Interna Pura a todo dactilograma que presenta un solo delta a la derecha
del observador y las lneas o crestas papilares que conforman la regin nuclear, entran y salen
por el lado opuesto, conformando un asa central de recorrido normal.
Se denomina Presilla Interna Impura a todos los tipos de Presilla Interna que no se encuadren
dentro de la denicin de Pura. Pueden presentarse dos posibilidades diferentes:
a) todos aquellos dactilogramas que tengan dos o ms deltas a la derecha del observador.
Ejemplo: Bideltos, Trideltos y
b) todos aquellos dactilogramas que, an presentando un solo delta a la derecha del ob-
servador, las lneas que conforman su regin nuclear tengan irregularidades en su recor-
rido. Ejemplo: las lneas o crestas centrales pueden presentarse: Volcadas, Intervenidas
Parcialmente, Intervenidas Totalmente, Combinadas Arco ms Presilla.
164
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
PRESILLA EXTERNA VERTICILO
PRESILLA EXTERNA: se denomina as al tipo fundamental que responde a la siguiente
denicin: Es todo dactilograma que presenta uno, dos o ms deltas a la izquierda del
observador. Pueden presentarse en forma Pura e Impura, respondiendo a las mismas
caractersticas ya descriptas para la Presilla Interna. Ofrece como nico pero fundamental
cambio, que los deltas deben estar ubicados a la izquierda del observador.
VERTICILO: se denomina as al tipo fundamental que responde a la siguiente denicin: Es
todo dactilograma que presenta dos o ms deltas al menos dos opuestos. Hay, tambien
forma Pura e Impura.
Se denomina Verticilo Puro a todo dactilograma que presenta dos deltas opuestos y enfrentados.
Se denomina Verticilo Impuro a todo Verticilo que no se encuadra dentro de la denicin
de Puro. Pueden presentarse de dos maneras:
a) aquellos dactilogramas que posean dos deltas opuestos pero no enfrentados y
b) aquellos dactilogramas que posean ms de dos deltas, con al menos, dos opuestos.
Ejemplo: Tridelto, Tetradelto.
Descritos los cuatro tipos fundamentales o patrones, obsrvese en las ilustraciones que
se adjuntan a continuacin, las caractersticas de cada uno de ellos en su presentacin Pura.
ARCO PRESILLA INTERNA
165
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Para hacer ms fcil la clasicacin de los cuatro tipos fundamentales en los diez
dgitos de las manos (lo que permite encontrar la cha buscada en un chero conteniendo
por ejemplo, cien millones de chas), se los ha distinguido con el uso de letras y nmeros.
Las letras corresponden a las maysculas de las iniciales de cada tipo, es decir A, I,
E y V y se utilizan para clasicar los dgitos pulgares. Los nmeros corresponden a la
correlacin de su ordenacin fundamental que es la misma en los que fueron descriptos,
es decir 1 para el Arco, 2 para la Presilla Interna, 3 para la Presilla Externa y 4 para
el Verticilo y se aplican en los restantes dgitos de ambas manos.
De presentar algunos de los dgitos una cicatriz de carcter permanente que im-
pida determinar el tipo fundamental se lo clasicar con una letra X. De presentar
ausencia de algn dgito por amputacin se lo clasicar con la letra O.
Con la utilizacin de esta clasicacin que utiliza letras y nmeros, es posible ob-
tener la frmula correspondiente a los diez dgitos de las manos, que ha sido denominada
Individual Dactiloscpica. Dependiendo cuales sean los tipos fundamentales que posea
una persona en cada uno de sus dgitos, las frmulas a obtenerse, tenindose en cuenta
que resultan de elevar 4 (cantidad de tipos), a la dcima (10 dgitos), da la cantidad de
1.048.576 posibilidades o combinaciones.
De poseer una persona en sus diez dgitos el tipo fundamental Arco, su individual
dactiloscpica ser A 1111 A 1111, la que deber leerse A once - once, A once - once. De
tener en sus diez dgitos el tipo fundamental Verticilo, su individual dactiloscpica ser V
4444 V 4444 que deber leerse V cuarenta y cuatro cuarenta y cuatro, V cuarenta y cuatro
cuarenta y cuatro. La progresin comenzada con la primera individual y terminada con la
otra, es la que posibilita la cantidad detallada. A modo de ejemplo se consignar una se-
cuencia de cmo se obtiene esta progresin, con permuta de los cuatro dgitos (excluido
el pulgar) para observar su forma y luego otra con permuta del pulgar.
Permuta comenzando con dedo meique de la mano izquierda
166
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Permuta comenzando con el dedo pulgar de la mano izquierda. Ver nmeros 10 y 11
Obtenida la frmula de la Individual Dactiloscpica de una persona, se separa del
chero las chas correspondientes a la misma -descartndose las dems- y dentro de
ellas se establece a quin le corresponde a travs de las caractersticas que determinan la
Identidad Dactiloscpica de una persona, que se detallarn ms adelante. En la prctica
no se repiten con idntica frecuencia todas las frmulas, siendo algunas muy comunes,
otras presentan unas pocas chas y otras aun no se han presentado. En realidad slo se
han presentado un diez por ciento de las posibilidades.
Para el cotejo de impresiones dactilares, se hace necesario determinar su topo-
grafa Con excepcin de los adlticos o sea los Arcos, se distinguen en los otros tipos
fundamentales, tres regiones, grupos o sistemas perfectamente delimitados, conformados
por la distribucin de las crestas papilares las que, acorde a su ubicacin, han recibido las
siguientes denominaciones:
A) SISTEMA BASILAR: conformado por las crestas papilares transversales o ligeramente
oblicuas que en forma continua o empalmada van desde un limbo lateral al otro, desde la
lnea directriz inferior del delta hasta el pliegue de la tercera y segunda falange del dedo.
B) SISTEMA MARGINAL: constituidas por crestas largas y continuadas que comenzando
en la directriz superior del delta, en forma paralela con las crestas basilares, luego se
separan subiendo y describiendo curvas acentuadas para terminar descendiendo por
el lado opuesto del dactilograma, perdindose en el limbo. Las mismas conforman el
margen del dactilograma y de all su denominacin.
C) SISTEMA NUCLEAR: conformado por las crestas que se ubican en la regin central
delimitada por las directrices inferiores y superiores. Dichas crestas se disponen de
formas muy variadas en cuanto a su direccin, extensin y dibujo y constituye una
regin muy importante y rica para la identicacin dactiloscpica.
167
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Obsrvese en la gura siguiente, el detalle de las tres zonas o sistemas de-
scriptos para el tipo fundamental Presillas tomado como ejemplo.
Para lograr la Identidad Dactiloscpica, una vez clasicado el dactilograma, se hace
necesario la determinacin de lo que se ha dado en llamar Puntos Caractersticos.
Puntos Caractersticos: Estos estn conformados por crestas papilares que,
en su evolucin, presentan una diversidad de diseos o dibujos, que sirven como el-
ementos de comparacin y referencia en las operaciones de identicacin humana.
Encontrados los mismos y cumpliendo ciertos requisitos que sern detallados opor-
tunamente, se puede establecer en forma categrica, fehaciente e indubitable la identidad
fsica de una persona, a travs de la comparacin o confronte de los dactilogramas dbitos
en indbitos.
Dentro de las diferentes conformaciones que pueden adoptar las crestas papilares
que forman los dibujos dactilares, se han distinguido ocho tipos de puntos caractersticos,
a saber:
1) PUNTO: es la mnima expresin de una cresta y se corresponde con la impresin de un
poro, debindose encontrar aislado es decir que no puede ser la continuacin de una lnea
interrumpida.
2) ISLOTE: porcin de una cresta mayor que el punto, debiendo cumplirse las mismas
condiciones descriptas para el punto. Su tamao lo constituye la impresin de dos a
cinco poros.
3) CORTADA: cresta aislada o suelta, es decir, sin solucin de continuidad que empieza y ter-
mina dentro del dactilograma. Debe cumplir igual requisito que para el punto y el islote.
168
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
4) ENCIERRO: cresta que durante su recorrido se abre y se vuelve a cerrar, conformando
un espacio interior. Este espacio interno puede presentarse intervenido o limpio.
5) HORQUILLA: cresta que en un momento de su recorrido vuelve en la misma direccin,
formando una curva. Puede o no, presentar apndice o cola.
6) BIFURCACIN: cresta de la cual se desprende otra, conformando ngulo.
7) EXTREMO O TERMINACIN DE LINEA: Est conformada por una cresta que, co-
menzando en el interior del dactilograma, se pierde en el limbo.
8) EMPALME: son dos crestas contiguas que se encuentran unidas por una tercera.
Obsrvese en la siguiente gura la demarcacin de los ocho puntos caractersticos descritos para su
visualizacin
Los requisitos que deben cumplir los dactilogramas dbito e indbito comparados
para establecer Identidad Dactiloscpica, dentro del cotejo o confronte papiloscpico,
debern ajustarse a las siguientes normas:
1) IDONEIDAD: los dactologramas a comparar deben cumplir con las condiciones de: a)
nitidez y b) integridad.
Nitidez: se deben visualizar perfectamente diferenciados en ambos dactilogramas, las lneas
de los blancos, es decir deben estar bien contrastadas las representaciones de las crestas
(lneas) y de los surcos (blancos)
Integridad: requiere que ambos posean campo suciente (rea completa) para obtener
una apreciacin integral de la regin a las que pertenecen.
2) SIMILITUD: esta norma se reere no solamente a que deben pertenecer a un mismo tipo
patrn o fundamental, sino que adems guarden parecido o semejanza en la estructura
morfolgica del dactilograma.
169
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
3) CANTIDAD SUFICIENTE DE PUNTOS CARACTERSTICOS: la cantidad de puntos
requeridos para una identicacin categrica depende del tipo de cha a cotejar, segn
el siguiente detalle: a) en una cha decadactilar (con impresin de los diez dedos), entre
nueve (9) y doce (12) puntos y b) en una cha monodactilar (impresin de un solo dedo),
entre doce (12) y quince (15) puntos caractersticos.
4) CALIDAD DE LOS PUNTOS CARACTERSTICOS: determinada una cantidad suciente
de puntos caractersticos, los mismos deben reunir adems los siguientes requisitos
de calidad: a) exacta coincidencia de ubicacin; b) exacta coincidencia de situacin y
c) exacta coincidencia de direccin.
Exacta coincidencia de ubicacin: se reere que los puntos encontrados deben estar ubica-
dos en idntica regin del dactilograma, es decir en la regin Basilar, Marginal o Nuclear.
Exacta coincidencia de situacin: los puntos caractersticos deben estar situados a
igual distancia. La misma se establece mediante el trazado de una recta imaginaria y
por el contaje de todas las lneas por ellas atravesadas.
Exacta coincidencia de direccin: la direccin esta dada por la orientacin que posean
los puntos caractersticos o algunas de sus ramas. Por ejemplo una horquilla posee su
apndice ubicado de izquierda a derecha y de abajo hacia arriba.
Estos requisitos determinan que los puntos caractersticos sean CONCURRENTES.
Esta determinacin permite arribar a una conclusin categrica, fehaciente e indubitable de
identidad dactiloscpica, determinando as la identidad fsica de las personas.
Obsrvese a continuacin un confronte entre dos impresiones, una dubitada y otra indubitada.
Determinados entre 9 y 12 puntos caractersticos que cumplan con los requisitos
detallados, se establece en forma absoluta e indiscutible la identidad dactiloscpica de una
persona, de partirse de una cha decadactilar. Si fuera sobre una cha monodactilar (es
decir de un solo dedo) la cantidad requerida se sita entre 12 y 15 puntos caractersticos.
170
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Este sistema permite identicar a una persona, confrontando las impresiones hal-
ladas en el lugar del hecho, con las de la cha correspondiente extrada del chero luego
de determinada su frmula; o bien a travs del confronte de una impresin dubitada y otra
tomada al sospechoso; entre dos impresiones dactiloscpicas, etc. Tener identicada a la
poblacin por este sistema, permite identicar cadveres, personas extraviadas o demen-
tes, accidentados, etc.
En virtud de que las bases y los principios tcnicos y cientcos son los mismos que
para la Dactiloscopa, slo se efectuar una breve descripcin de la identicacin humana
a travs de los sistemas Palametoscpico y Pelmatoscpico.
El palametograma o conjunto anatmico de crestas papilares que presentan
las palmas de la mano, ha sido dividido por los autores del sistema D.Julio Fortunato
y D. Roberto Albarracn -quienes tomaron como base el del Dr. Gilbert Palmer Pond-
en seis regiones, cuatro regiones interdigitales, una regin tenar y otra hipotenar.
A los efectos de la visualizacin de cada una de estas regiones, se reproduce una
impresin palmar donde se han demarcado las mismas:
171
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
I. PRIMERA REGION INTERDIGITAL: ubicada en el espacio comprendido entre el dedo
ndice y el medio.
II. SEGUNDA REGION INTERDIGITAL: es el espacio comprendido entre el dedo medio
y el anular.
III. TERCER REGION INTERDIGITAL: es el espacio comprendido entre el dedo anular y
el meique.
IV. REGION HIPOTENAR: es el espacio que comprende la eminencia ubicada en el borde
interno de la palma. Dicha eminencia se encuentra formada por los tres msculos motores
del dedo meique.
V. REGION TENAR: es el espacio que comprende la eminencia ubicada en la base del
dedo pulgar, formada por los msculos motores cortos.
VI. CUARTA REGION INTERDIGITAL: es el espacio comprendido entre el dedo pulgar
y el ndice.
Se han determinado seis tipos fundamentales o patrones. Cuatro de ellos reciben
idntica denominacin que los descriptos por Juan VUCETICH para la Dactiloscopa,
aunque no presentan idnticas conformaciones y dos son propios de las palmas.
As el Arco puede presentarse llano, con inclinacin a la izquierda, inclinacin a la
derecha, piramidal, trpode o de delta central, etc. Las Presillas son tpicas formaciones de
asas que pueden o no presentar deltas. Si las ramas de su asa se dirigen hacia el centro
de la mano, se denominan Presillas Internas. Si las ramas del asa se dirigen hacia fuera de
la palma, se denominan Presillas Externas. Los Verticilos son aquellas conformaciones de
crestas que se agrupan en ncleos, cuyo inicio o centro puede ser espiralado, concntrico
u ovoidal, sinuoso, o ganchoso. El Dendrtico o Enramada est constituido por una cresta
central comn a todas (tronco) de la cual se desprenden otras a modo de ramas. El Mosaico
es el diseo conformado por crestas que, al disponerse transversalmente a las que siguen
la direccin general del dibujo, se entrecortan y conforman dameros o enrejados.
Para la identicacin Palametoscpica, se deben establecer entre 12 y 15 puntos car-
actersticos que renan las mismas condiciones que las descriptas para la Dactiloscopa.
Con relacin a la identicacin Pelmatoscpica o conjunto anatmico de crestas
papilares que presentan las plantas de los pies, deben cumplimentarse similares proced-
imientos y requisitos que los mencionados para la Dactiloscopa y la Palametoscopa es
decir que se deben determinar suciente calidad y cantidad de puntos caractersticos.
172
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Por su valor histrico se mencionan dos sistemas creados para este n: a) Sistema
PRELLER que comprende una clasicacin Monoznica y Diez Tipos fundamentales o b)
Sistema URQUIJO que comprende una clasicacin de Cuatro Zonas y Cinco Tipos Fun-
damentales. La identicacin pelmatoscpica se realiza luego de determinarse entre 12 a
15 puntos caractersticos que cumplan idnticos requisitos que para la Dactiloscopa.
Desde la dcada del 70 pases como Alemania, Estados Unidos, Francia y Japn comen-
zaron a desarrollar Sistemas Automticos de Identicacin de Impresiones Digitales, que por sus
iniciales en ingls reciben el nombre de A.F.I.S (A (( utomatic Fingerprint Identication System).
Estos sistemas proceden a la captura de datos, es decir a la toma de los diseos
papilares provenientes de chas decadactilares, monodactilares o de un dactilograma natu-
ral, codicndolo en lenguaje binario, para proceder luego a su registro archivndolos en
pxeles. Posteriormente a travs de un proceso automtico de comparacin, procede a la
identicacin papiloscpica. Todo proceso, cualquiera sea el resultado, debe ser vericado
por un operador humano para minimizar errores.
Estos sistemas que aportan las ventajas de la aplicacin de la informtica a la compleja
actividad papiloscpica, contribuyen con la deteccin acelerada de personas ya registra-
das en la base de datos, por identicacin y vericacin biomtrica, frustrando cambios
de identidad e ingreso de duplicaciones. Actualmente son utilizados por la mayora de las
fuerzas policiales del mundo.
Sin la idea de sustituir a la papiloscopa como sistema de identicacin, sino por el
contrario con la idea de vericar toda aplicacin tecnolgica, tcnica o cientca que permita
asegurar la identidad humana y pueda ser utilizada como elementos de prevencin o de
investigacin, estudios recientes desarrollados en pases lderes, permiten armar que el
organismo humano ofrece un nmero importante de caractersticas variadas, inmutables y
perennes, que pueden ser utilizadas para ese n. Estas caractersticas pueden encerrarse
dentro del concepto de Biometra.
La papiloscopa, la identicacin gentica por A.D.N, por el olor; por la voz humana,
por las rugas palatinas, por datos odontolgicos, etc. conforman sistemas de identicacin
biomtrica modernos. La utilizacin de la informtica permite la lectura de datos a travs de
lectores biomtricos o escneres, su registro, comparacin e identicacin.
Sin que pretendamos incluir una lista taxativa de posibilidades, se detallan algu-
nas aplicaciones biomtricas que, debido a su popularizacin, resultan hoy accesibles.
Identicacin dactiloscpica para accesos a lugares fsicos reservados (ocinas, hogares,
173
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
clubes, etc.) o para regular accesos informticos a travs del uso de mouse o ratn con
escner dactiloscpico. Identicacin por la Geometra o Tridimensin del rostro; por el
color y diseo del iris; geometra y dimensin de orejas, manos y pies; Morfologa, tem-
peratura, presin arterial, y ritmo cardaco corporal; etc.
El camino por realizar en el campo de la identicacin humana, especialmente para
la aplicacin criminal, es todava largo y espinoso, pero es mucho lo que se ha avanzado.
Lgicamente el desarrollo de esta unidad no ha pretendido un detalle pormenorizado de
esta temtica, sino un breve recorrido por su historia y sus principales avances, para que
le sirvan de base de aplicacin al futuro profesional abogado.
174
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
175
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
gl
glosario
abogaca a distancia
)
Se detallan a continuacin el signicado de las palabras:
BINARIO: Cdigo numrico utilizado por todos los ordenadores en el que los nmeros
estn representados con slo dos cifras, el 0 y el 1.
MOLES: Plural de mol o mole, abreviatura de molcula y representa la masa de una sus-
tancia equivalente al peso molecular de la misma tomado en gramos. En un mol siempre
hay la misma cantidad de molculas, sea cual fuere la sustancia.
PIXELES: Plural de pixel y ste a su vez representa el elemento base ms pequeo de
una imagen digital. Proviene de la contraccin de Picture Element o elemento de
imagen.
176
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
177
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD IV )
n ALBARRACIN, Roberto; Manual de Criminalstica; Editorial Policial; Bs. As. 1971.
n GUZMAN, Carlos; Manual de Criminalstica; Ed. La Rocca; Bs. As. 1997.
n ROSSET, Ricardo y LAGO Pedro; El A B C DEL DACTILOSCOPO; Ed. Policial. Bs.
As. 1984.
n Revistas de Polica y Criminalstica; Editorial Policial.
NOTA: Los textos obligatorios se encuentran para consulta o prstamo en la Biblioteca del Instituto
Universitario de la Polica Federal Argentina.
Bibliografa obligatoria
u5
unidad cinco
investigacin cientca del delito
) (
181
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD V
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Distintos tipos de Pericias Mecanogrcas.
2. Pasos metodolgicos y sistemticos para determinar Marca y Modelo de la mquina
de escribir utilizada.
3. Idem para la Identicacin de la mquina con la que se realiz determinado escrito.
4. Determinacin del Fechado de un escrito mecanogrco.
5. Determinacin del Dactilgrafo.
6. Pasos metodolgicos y sistemticos para determinar Tiempos de Ejecucin Mecanogrca.
7. Detalle de las mquinas de escribir convencionales o a canasta porta tipos.
8. Evolucin de las mquinas de escribir y los diferentes tipos de mquinas elctricas.
9. Primeras Impresoras. Utilizacin del sistema de computacin.
10. Evolucin de las impresoras hasta las de ltima generacin.
11. Impresoras Lser.
12. Partes principales y funcionamiento de una mquina fotocopiadora analgica.
13. Partes y funcionamiento de una fotocopiadora Lser.
14. Pericias y determinaciones de fraudes sobre fotocopias.
15. Partes principales y funcionamiento de un fax.
16. Distintos tipos de papeles que pueden utilizarse.
17. Precauciones a implementar acorde al papel y sistema de impresin utilizados por un fax.
Mencin sinttica de los contenidos
182
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
183
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n Distinguir los dos tipos de escrituras posibles que puede realizar el hombre. Manuales
y Mecnicas.
n Tomar conocimiento acerca de los orgenes de la escritura mecnica.
n Introducirnos en la historia y creacin de las mquinas de escribir.
n Conocer los principales elementos constitutivos de una mquina de escribir.
n Su evolucin en el tiempo desde las mquinas de escribir convencionales o a canasta
porta tipos, hasta las impresoras de ltima generacin.
n Los diferentes tipos de pericias mecanogrcas posibles, que permiten contestar los
interrogantes que, en las causas judiciales, se puedan presentar.
n Conocer las ventajas que la tecnologa aporta constantemente para mejorar la escritura
mecnica y los inconvenientes que plantea en el cumplimiento de la labor pericial.
n Conocer los principios tcnicos, principales componentes y funcionamiento interno de
una fotocopiadora.
nComparar los procesos de produccin de una fotocopia, partiendo de una fotocopiadora
analgica o de una digital.
n Ver las diferentes maniobras adulterativas que pueden realizarse con la utilizacin de
una mquina fotocopiadora y las pericias que se pueden cumplimentar.
n Conocer los principios tcnicos, componentes principales y funcionamiento interno de
un fax.
n Tomar conocimiento de los diferentes tipos de papel que se pueden utilizar en un fax,
acorde a su sistema de impresin y los recaudos que deben tomarse frente a cada
uno de ellos.
184
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
185
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD V )
Determinacin de la marca y modelo
Identicacin de la mquina empleada
Determinacin del dactilgrafo
Determinacin de tiempos de ejecucin
Determinacin de la fecha del texto
Diseos de tipos (fabricantes)
Paso mecnico (medicin - plantillas)
Paso proporcional (unidad bsica)
Examen intrnseco. Determinar frmula
Descarte por diseo de tipos y mediciones
Base: personalidad de origen y adquiridas
Examen extrnseco:
a) Determinar paso
b) Determinar diseo letras nmeros y signos
Examen intrnseco:
a) Determinar desalneos, defectos
b) Fisuras, roturas, empastes, etc.
MQUINA
Examen extrnseco: determinar paso y diseo
Examen intrnseco: determinar principios
De Horizontalidad
De Verticalidad
T/EJECUCIN
Historia grca. Requisitos de elementos
Comprobacin de caractersticas
FECHADO
PERICIAS POSIBLES
MARCA Y MODELO
186
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Mquinas canasta porta tipos
Elctricas a bocha
Electrnicas a margarita
Impresoras Cadena
Matriz de punto
Trmicas
A burbujas
A cabezal piezoelctrico
Cambio de fase
Lser
Distintas clases: analgicas y lser
Principales partes componentes
Funcionamiento y produccin del proceso
Distintos tipos de fraudes
Pericias posibles
FOTOCOPIADORAS
Principales componentes y funcionamiento
Tipos de papeles que utiliza
Sistemas de impresin
FAX
EVOLUCIN
187
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
188
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Antes de comenzar con el desarrollo temtico de esta unidad y ledo el recorte periodstico
del diario Clarn del 11 de agosto de 1999 que se adjunta, realice las siguientes tareas:
Analice si la computadora y sus mltiples aplicaciones para la produccin o confeccin de
documentos en general, tanto pblicos como privados, traer ventajas o desventajas. Detalle si
considera que las mismas aportarn ms benecios a la justicia o a los falsicadores y/o adultera-
dores y justique sus consideraciones.
Adems del uso comn o tradicional de una computadora, cree que se ha extendido
el mismo a otros asuntos de la vida diaria que pueden ocasionar conictos, capaces de re-
querir intervencin judicial?
Frente a una respuesta armativa, piense cuidadosamente tomndose el tiempo nec-
esario para una reexin profesional y describa cuntos y cules pueden ser?
Registre el resultado del presente anlisis para una posterior evaluacin personal. La
misma debe ser realizada luego de asimilado el contenido temtico de la unidad que se desar-
rollar a continuacin.
189
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD V )
No hay duda que los pasos que el hombre ha dado para mejorar su calidad de
vida han sido muchos, variados y signicativos. Los realizados especcamente para
documentar a travs del tiempo su palabra, han logrado un estadio superior, aunque
los mismos no slo no se han detenido sino que, peridicamente, aparecen nuevos
recursos que hacen ms fcil el camino y mejoran los resultados.
Desde las primera impresiones religiosas, clnicas o decorativas en las cavernas,
pasando por los grabados de hazaas o actos heroicos en roca o monumentos, hasta
llegar a los pintados o estampados de sellos sobre papiros, pergaminos o papel,
utilizando imgenes, dibujos, jeroglcos o ideogramas o las escrituras en todos los
alfabetos por l creados, ha recorrido un largo y fructuoso camino.
Primero estas escrituras eran realizadas en forma manual, es decir ejecutadas
con las manos. Pero para poder realizarlas, ha debido crear supercies aptas para el
registro deseado, sea trabajando las que la naturaleza le ofreca, sea utilizando diversos
recursos de origen vegetal o animal o bien creando tcnicas que le permitiesen llegar al
n buscado.
Asimismo ha debido crear elementos escritores acordes a cada supercie
(punzones, formones, pinceles, lapiceros, etc.) y pinturas, tintas o elementos col-
oreados que permitieran visualizar las ideas plasmadas.
Slo por destacar un procedimiento que ha perdurado en el tiempo, se har una breve
referencia a los sellos o troqueles tallados sobre metales o piedras comunes o preciosas.
Estos eran utilizados para marcar documentos u objetos con la seal certicadora de
propiedad u origen. As los anillos con el rostro, nombre o escudos reales, provocaban
estampes que garantizaban la procedencia de los mensajes y rdenes escritas.
Estos grabados en sobre o bajorrelieves, dejaban impresin o impronta en lacres o
arcillas, y tambin servan para asegurar el cierre de vasijas, cajas, sacas y fardos. 3.200
aos antes de Cristo se utilizaban en la Mesopotamia sellos tallados sobre hueso o piedra
que, con diversos dibujos estampaban a modo de friso, repetitivas imgenes por rodado
sobre arcilla hmeda.
Escrituras mecnicas
190
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Su uso se extendi a travs del tiempo y su empleo fue muy popular no slo entre
gobernantes y funcionarios, sino tambin entre pequeos terratenientes. Se han hallado
sellos reales, religiosos, municipales, comerciales y de linaje. Con el aumento de la alfabet-
izacin, aument tambin la preferencia por el uso de una rma personal.
Cabe recordar que en un primer momento, el acceso al aprendizaje por ser
oneroso, no estaba al alcance de todos. Baste destacar que cada libro era copiado
a mano, desde su ttulo hasta el texto y las ilustraciones, por monjes o especialistas
que dedicaban meses o aos de sus vidas a esta tarea. Como se deduce fcilmente,
no era pues faena sencilla ni econmica.
La aparicin de la imprenta facilit la impresin mecnica. Con ese nombre se
distingue a los diferentes procesos que permiten la reproduccin de palabras, imgenes
o dibujos sobre una variada gama de supercies, tales como papel, tejido, metal, te-
las y otros materiales. La reproduccin idntica de un original en forma mecnica ha
recibido tambin el nombre de Artes Grcas, utilizndose actualmente, adems de
la tradicional impresin en relieve, los procesos fotomecnicos y qumicos.
Los primeros registros de escritura mecnica aparecen en China poco antes
del ao 200 despus de Cristo. Los mismos eran obtenidos por estampe de letras e
imgenes talladas en relieve sobre madera. Escritos sagrados chinos que contienen
ms de 130.000 pginas, fueron realizados en el siglo X utilizando una tcnica de tipos
mviles muy similar al sistema actual. La requisitoria o necesidad de contar con entre
dos mil y cuarenta mil caracteres diferentes en el idioma chino, hizo que stos no
consideraran prctica esta tcnica, abandonando un invento a todas luces genial.
Ciertos historiadores holandeses y franceses aducen que la imprenta en oc-
cidente exista en el valle del ro Rhin, cien aos antes de Gutenberg y que sus fun-
damentos haban sido desarrollados y utilizados por artesanos textiles europeos para
estampar tejidos. La tcnica utilizada en la fundicin de tipos fue de precisin tal, que
stos se mantenan unidos a los extremos del soporte por simple presin. Su principal
defecto era que cualquier tipo que se colocara una fraccin de milmetros sobre los
dems, ocasionaba omisin o defecto en la impresin de las letras lindantes.
Empero, la calidad de los libros impresos por el natural de Maguncia (Alemania) de
nombre Johann Gutenberg, considerado tradicionalmente como el inventor de la imprenta
en occidente en el ao 1450, especialmente entre ellos el conocido como La Biblia de
Gutenberg, es de tal maestra que no admite comparacin alguna con los libros de la
poca, sean stos precedentes o no.
191
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Los libros por l editados fueron de aceptacin inmediata, sustituyendo a los incu-
nables o manuscritos. Esto permiti la difusin y el abaratamiento de los libros y que, en un
corto perodo se imprimieran ms de seis mil obras diferentes. Adems rpidamente,
se diseminaron por toda Europa una gran cantidad de imprentas.
Las primeras maquinarias transferan la tinta desde las planchas de impresin o
moldes, por presin de los tipos sobre un papel generalmente humedecido, con ayuda
de una supercie mvil o platina. Estas impresiones eran lentas (doscientos cincuenta
impresiones por hora) y slo impriman una cara del papel. Posteriormente el sistema de
tornillo fue sustituido por palancas; que al principio se accionaban manualmente , ms
tarde pas al uso del vapor y luego de otras mejoras se lleg a las rotativas alimentadas
por bobinas, que permitan una impresin de dieciocho mil peridicos por hora.
La idea de escribir utilizando una mquina nace a nes del siglo XVII, pero es el
ingeniero ingls Henry Mills quin, en el ao 1714, patenta la idea de una mquina
para imprimir letras en forma progresiva de manera similar a la manual, que po-
dra ser de gran utilidad en establecimientos pblicos o privados.
Se requiri casi cien aos para que la idea se llevara efectivamente a la prctica. Es en
1808 cuando Pellegrino Turri en Italia, crea una mquina de escribir para la hija ciega del
conde de Fantoni. La idea era que sta pudiera escribir su correspondencia y se distrajera
con ella. No hay registros de cmo estaba construida ni como era su funcionamiento.
Diferentes ensayos crearon mquinas rudimentarias, ingeniosas y notables que
con variados resultados en cuanto a la efectividad de su uso, fueron los que permitieron
llegar a la mquina de escribir convencional que nace en 1872 en Estados Unidos,
de la mano de seis ingenieros que lograron la pionera Rmington 1 que slo poda
escribir en letras maysculas.
La evolucin de la Rmington y los modelos que esos seis ingenieros, en forma
individual comenzaron a fabricar, dieron al mundo una nueva forma de escribir que,
con los adelantos que la tecnologa brinda da a da, ha llegado a nuestros das y est
en condiciones de seguir perdurando en el tiempo.
Toda mquina de escribir, adems de los accesorios que brindan ms y mayores servi-
cios facilitando la escritura mecnica, estn compuestas por cuatro rganos fundamentales:
a) un elemento impulsor;
b) un elemento impresor;
c) un elemento entintador y
d) un elemento de movimiento.
192
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
El elemento impulsor est constituido por las teclas sobre la que actan nuestros
dedos. Al presionarlas se hace avanzar la palanca portatipos que constituye el elemento
impresor. Este est compuesto por una barra o palanca as denominada, porque en el
extremo opuesto a la tecla tiene encastrado y soldado un tipo o dibujo en relieve que rep-
resenta a uno de los caracteres numricos, alfabticos o de puntuacin contenidos en un
idioma. Cada una de estas barras pueden contener uno o ms caracteres, generalmente un
nmero y un signo de puntuacin, o dos signos, o una letra en mayscula y minscula.
Al avanzar dicha palanca luego de ejercida presin sobre la tecla, el tipo arrastra al el-
emento entintador, constituido generalmente por una cinta que puede ser de papel, tela,
plstico, etc. embebida con una tinta especial, que permite el estampe del contorno del
tipo seleccionado sobre el papel. Al mismo tiempo que se realiza la impresin del carcter
deseado, se mueve la barra espaciadora, poniendo en funcionamiento el elemento de
movimiento que, por medio de una varilla, hace girar una palanca, la que acta sobre un
trinquete que hace girar a dos ruedas, corriendo la cremallera dentada que desplaza al
carro un intervalo igual que el asignado a los tipos. A este desplazamiento se lo denomina
Paso o Escape
Las palancas portatipos estn dispuestas a modo de abanico abierto, es decir
convergiendo en un punto y estando separadas por el otro, resultando todas reunidas
pero independientes. As conforman lo que se ha dado en llamar canasta portatipos,
que es el nombre genrico de las mquinas de escribir convencionales. Cualquiera sea la
posicin de una barra dentro de ese abanico desplegado, cuando es accionada a travs
de la tecla correspondiente va a golpear, luego de pasar por la abertura correspondiente
del ring o anillo, en un mismo punto, que es el espacio destinado en el papel para la
impresin de ese carcter. De all es que surge la necesidad de que el papel, una vez
que ha recibido la impresin de un carcter, se desplace hacia la izquierda, para que las
letras se estampen correlativamente a la derecha.
El mecanismo que sostiene y desplaza al papel recibe el nombre de carro, compuesto
esencialmente por uno o dos rodillos, generalmente de caucho, asentado sobre rieles que
le permiten su movimiento. Como se desprende de todo el procedimiento detallado, la
impresin se produce por el impacto del tipo sobre la cinta y ambos sobre el papel. Este
impacto o golpe, deja adems de la tinta proveniente de la cinta, una depresin o inden-
tacin sobre el papel, que se exterioriza como un surco. Estas impresiones denominadas
por impacto, producen por el permanente golpeteo de los tipos, caractersticas sobre los
mismos que se exteriorizan como abolladuras, roturas, suras, aplanamientos, etc. que son
las caractersticas que permiten la identicacin de la mquina utilizada. Al describirse las
diferentes mquinas de escribir e impresoras, se detallar si su impresin es por impacto
o no, debindose considerar que las de impacto son siempre identicables.
193
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Las mquinas de escribir han sufrido constantes avances permitiendo ser
usadas tambin para msica, por ciegos, para matemticas, para escribir a distancia
(teletipos), para estenografa, etc. Adems han evolucionado, desde las mquinas de
escribir tradicionales o a canasta portatipos, pasando por las elctricas, electrnicas
y los diferentes tipos de impresoras, las que sern detalladas en la presente unidad.
Su uso se ha extendido a todos los pases y su costo le ha permitido entrar a casi todas
las casas. Los aportes brindados son indiscutibles y altamente satisfactorios. Pero como ha
sucedido y suceder siempre, con ste y con todos los avances que el hombre logre, alguien
utilizar sus bondades para efectuar maniobras dolosas o daosas, que pueden llegar a con-
stituir delito.
Su utilizacin con nes ilcitos ha requerido que en algunas causas judiciales se
debiera recurrir a peritos, para efectuar diversas determinaciones sobre escritos me-
canogrcos. Esto ha provocado a profesionales en la materia a desarrollar tcnicas,
las que permiten contestar cinco tipos de interrogantes periciales que abarcan una gran
cantidad de hechos. Se expondr cada uno de ellos, partiendo por orden cronolgico
por las mquinas de escribir convencionales. Luego de detallar las caractersticas de las
mquinas elctricas y de las impresoras, se puntualizar sobre cada una, de corresponder,
las diferencias que pudieran darse por las caractersticas distintivas de unas y otras.
Las pericias posibles son:
a) determinacin de la marca y modelo de la mquina de escribir utilizada;
b) determinacin de la mquina de escribir utilizada;
c) determinacin de la fecha del texto mecanogrco;
d) determinacin del dactilgrafo; y
e) determinacin de tiempos de ejecucin mecanogrca.
A continuacin se desarrollar cada uno de estos temas.
Determinacin de la marca y modelo de la mquina utilizada: Consumado un delito
por medio de un escrito mecanogrco, como por ejemplo una amenaza o una
extorsin, los investigadores si no han logrado rastros papilares u otros caminos
que le permitan llegar al o los autores del hecho, tienen como otra alternativa el
hallar la mquina con la que se realiz el escrito mecanogrco para, a travs de
ella, intentar llegar a su autor. Para orientar la bsqueda, se hace necesario deter-
minar las posibles mquinas con las que se pudo realizar, con el n de no gastar
esfuerzos en otras que, por sus caractersticas, no pudieron haber intervenido.
194
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Partiendo entonces de un nico escrito dubitado se deben cumplimentar diver-
sos pasos metodolgicos y sistemticos para la determinacin deseada, a saber:
a) determinacin del Paso o escape;
b) comprobacin de la clave acorde el tipo de diseo;
c) determinacin de la frmula;
d) bsqueda de chas y descarte por diseo; y
e) descarte por mensura.
Se denomina Paso o Escape Mecnico, al espacio constante en que se desplaza
el carro de la mquina de escribir, cada vez que es accionada una tecla que produce
movimiento, salvo el tabulador que lo hace en forma mltiple.
Se aclara que produce movimiento porque hay teclas como la del acento y diresis que
no lo producen. Este espacio o desplazamiento se mide en milmetros. Para su determinacin se
efecta un clculo matemtico o se utilizan plantillas milimetradas. Los pasos mecnicos de las
mquinas ms usadas en nuestro pas son: 2,00 mm; 2,10 mm; 2,12 mm; 2,17 mm; 2,20 mm; 2,23
mm; 2,54 mm; 2,60 mm y 2,82 mm.
Se denomina Tipo de Diseo a la diferente conformacin o dibujo que presentan los carac-
teres (alfanumricos y signos) asignados a una mquina de escribir. Estos diseos consti-
tuyen estilos y pueden ser de conformacin redonda, curva, cuadrada, con o sin serif, etc.
recibiendo nombres identicativos propios como ser: pica, courier, arial, script, elite, etc. En
sus comienzos, cada fabricante de mquinas de escribir confeccionaba sus tipos, eligiendo
un estilo que lo identicaba. Es decir que reconociendo el tipo de diseo era posible deter-
minar la marca de la mquina. Al popularizarse y requerir el mercado una mayor produccin
de mquinas, aparecieron empresas que eran ms armadoras que fabricantes, que si bien
les daban marca y modelo propio, compraban y utilizaban muchos componentes creados
para otras marcas, lo que motiv que diferentes marcas poseyeran similares caractersticas.
De cualquier manera reconocer el tipo de diseo vincula al escrito con ciertas mquinas y
descarta a otras. Ntese a continuacin distintos tipos de diseos:
A B C
ARIAL
A B C
COURIER
A B C
LUCIDA SANS

SYMBOL
A B C
TAHOMA
A B C
ABADI
195
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Determinacin de la clave y frmula: se hace necesario destacar aqu a dos tcnicos periciales
pertenecientes a la Polica Federal Argentina, los seores Ricardo ROSSET y Roberto CAPELLO,
quienes para el cumplimiento de este paso, en forma pionera crearon una clave local que fue
ampliamente reconocida por INTERPOL. Esa clave fue luego reemplazada por otra Internacional
creada por ese organismo, que consta de los siguientes elementos:
1) comprobacin del barral transversal de la letra t minscula. Si es asimtrico, es
decir que no es cortado en su mitad, se le asigna el nmero 1, en caso contrario (si
es simtrico), se le asigna el 2.
2) comprobacin de la morfologa o diseo de ciertos nmeros (2 al 6 y el 9). Si son con
bucles le corresponde la letra a; si son cbicos o abiertos le corresponde la letra b,
ambas en minscula.
3) comprobacin del barral transversal de la letra f minscula. De ser asimtrico se
le asigna el nmero 1, de ser simtrico el 2.
4) comprobacin de las gramas o barrales centrales de la letra M mayscula. Si
alcanzan la lnea de base de la letra le corresponde la letra A, si no la alcanzan le
corresponde la letra B, ambas maysculas.
Determinada la clave se establece la frmula junto con el paso. As por ejemplo podra
resultar la siguiente frmula: 2,23 1 a 2 B. De no haber en el escrito dubitado alguna de las
letras de la clave, se la conforma cubriendo con una X el espacio correspondiente, debindose
luego considerar las frmulas con las dos posibilidades en ese rubro.
Bsqueda de chas y descarte por diseo: Debe extraerse del archivo de marcas y modelos de
mquinas de escribir distribuido por INTERPOL, todas las chas correspondientes a la frmula
determinada, las que generalmente son muchas. Las mismas adems de contener la marca,
modelo, origen, fabricante, lugar y ao de aparicin, tipo de caracteres y la frmula, reproducen el
teclado y un texto en maysculas y minsculas y la altura de una grama de algunos caracteres.
A continuacin se descartan chas por comparacin o confronte de diseos de los restan-
tes caracteres alfanumricos y signos no incluidos en la clave, separando aquellas que se
correspondan. Este descarte habr reducido sensiblemente la cantidad de chas posibles.
Descarte por mensura: Se debe medir en el escrito dubitado la altura de las gramas de
las letras indicadas en las chas posibles, descartndose todas aquellas chas que
no coincidan en mensura. Las restantes, son todas las marcas y modelos de mquinas
de escribir con las que se pudo realizar el escrito dubitado. La bsqueda de la mquina
incriminada se har exclusivamente dentro de las marcas y modelos posibles, lo que
excluye a la gran mayora, simplicando notoriamente la labor investigativa.
196
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Determinacin de la mquina de escribir utilizada: Ac se trata de establecer la m-
quina nica- con la que se realiz el escrito, con prescindencia de cualquier otra
correspondiente a su misma marca, modelo y/o caractersticas. El interrogante puede
plantearse de maneras diferentes: (*) entre un escrito dubitado y una o varias mqui-
nas de escribir o entre los escritos indubitados con ellas realizados; o (**) entre dos
escritos dubitados determinar si fueron confeccionados por una misma mquina.
De contarse con las mquinas de escribir, se hace necesario confeccionar un cuerpo de
escritura. Este debe contener los datos completos de la mquina con la cual se lo confec-
ciona, es decir detallar marca, modelo y numeracin. Luego se debe reproducir dos veces el
teclado completo, tanto en maysculas como en minsculas y por ltimo se copia el texto
dubitado u otro texto, para comprobar como se interrelacionan los caracteres entre s.
Los pasos y comprobaciones a efectuar en todos los casos son los siguientes:
a) determinacin de paso;
b) determinacin de diseo tipogrco;
c) anlisis intrnseco tendiente a determinar las caractersticas de fabricacin y de uso o mal
uso que determinan la personalidad de una mquina de escribir, debindose comprobar
dos circunstancias:
1) desalneos;
2) defectos en los tipos.
Determinacin de paso: Debe realizarse igual procedimiento y comprobacin que para el tipo de
pericia ya descrito. El resultado ser un paso expresado en milmetros. De no corresponder el mismo
paso entre los escritos dubitado e indubitados (*) o entre los dubitados entre s (**), se determina
que no pudieron haber sido confeccionados por una misma mquina. De corresponderse se deben
cumplimentar los restantes pasos.
Determinacin de diseo tipogrco: Se debe vericar la correspondencia de los diseos tipogr-
cos entre los escritos estudiados. De no corresponder o de corresponderse, se debe adoptar igual
procedimiento que en la determinacin del paso.
Anlisis intrnseco: Se deben establecer las caractersticas de fabricacin y/o de uso o mal uso,
que determinan la personalidad de una mquina de escribir. Si bien los tipos y dems compo-
nentes de una mquina se fabrican en serie, stos en forma individual requieren pulidos o trata-
mientos especiales. Las mquinas de una misma marca y modelo se fabrican tambin en serie,
pero su armado se efecta en forma manual e individual, determinando pequeas diferencias
no sustanciales. Por ello y al sumar ambas circunstancias, todas las mquinas recin fabricadas
y puestas a la venta, poseen ya pequeas diferencias que hacen a su personalidad.
197
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El uso o mal uso de las mismas, determina adems, el incremento de esas caractersticas
de fabricacin, provocando:
a) desalineos: dados por los diferentes mecanismos, resortes, tornillos, engranajes,
cremalleras, dientes, vstagos, etc., es decir por los componentes o piezas de la
mquina que sufren por diferentes causas, tales como: incorrecto traslado al ser
tomadas por el carro, golpes en las barras portatipos, falta de limpieza, excesiva o
incorrecta limpieza, etc., daos o deciencias que se trasmiten en forma de desali-
neos de los tipos, provocando impresiones hacia arriba y abajo, hacia la derecha e
izquierda, e inclinaciones hacia la izquierda o la derecha; y
b) defectos de tipos: ocasionados por golpeteos anmalos por presin simultanea de
teclas, que provocan daos en los tipos tales como roturas, suras, abolladuras y
empastes que se trasmiten a sus impresiones. Estas caractersticas sumadas a las de
fabricacin, conforman la personalidad distintiva de una mquina de escribir.
A travs de un profundo examen microscpico se logran comprobar estas dos
circunstancias las que, evaluadas en cantidad y calidad, permiten establecer si dos es-
critos mecanogrcos fueron confeccionados por una misma mquina de escribir.
Determinacin de la fecha del texto mecanogrco: muchos interrogantes periciales
requieren establecer la fecha real en que fue confeccionado un escrito mecanogrco,
es decir determinar si realmente fue realizado en la fecha que presenta el documento
dubitado. Esto requiere efectuar algunas consideraciones acerca de las tintas.
Las tintas en general (de las que nos ocuparemos en otra unidad) utilizadas en los
distintos tipos de elementos escritores (plumas, lapiceras, bolgrafos, bras, cintas de m-
quinas, etc.) no evolucionan con el tiempo, es decir no cambian desde el momento en
que son depositadas sobre el papel. Esto no permite determinar por procedimientos
tcnicos o cientcos, la fecha cierta en que fue confeccionado un documento, sea
este manuscrito, mecanogrco o realizado por cualquier sistema de impresin.
Frente al interrogante planteado en este tipo de pericias, se pueden efectuar distintos
procedimientos indirectos que orientan sobre la fecha de produccin de un documento. Uno es
de orden qumico y se realiza mediante los anlisis y las comprobaciones correspondientes sobre
los componentes de las tintas, el papel y del elemento escritor con que fuera confeccionado
el documento dubitado. Establecido esto, se establece la fecha de aparicin en el mercado de
esos productos. Si son anteriores al fechado del documento, no se puede comprobar circun-
stancia alguna. De ser posteriores al mismo se establece, por imposibilidad fctica de utilizar
un producto que an no se haba producido, la falsa datacin del mismo.
198
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Otro procedimiento para escritos mecanogrcos es de orden fsico y se deben
cumplimentar los siguientes pasos metodolgicos y sistemticos:
a) obtener historia grca de la mquina utilizada,
b) determinar caractersticas de personalidad de la mquina por perodos de tiempo y
c) confrontar las caractersticas del dubitado con las de la historia grca.
Historia grca de la mquina utilizada: Para ello se deben suministrar escritos indubitados
realizados por la mquina con que se confeccionara el documento dubitado, debiendo ser
aquellos, anteriores, posteriores y contemporneos a ste. Esto signica por ejem-
plo, que si el documento sobre el que se requiere establecer el fechado est datado
en marzo de 1998, se deberan obtener indubitados de varios meses de los aos 1996,
1997, 1998, 1999 y 2000.
Caractersticas de personalidad de la mquina por perodos de tiempo: Sobre cada uno de esos
escritos indubitados se deben determinar las caractersticas de personalidad de la mquina,
detectando desalineos y defectos en los tipos. Al hacerlo por perodos de tiempo se podr
determinar la aparicin en fecha aproximada, de nuevas caractersticas de personalidad, sean
stas producto de reparaciones o de deciencias de uso.
Confronte de las caractersticas del dubitado con las de la historia grca: resta ahora
establecer si las caractersticas de personalidad del escrito dubitado se corresponden
con las que posea la mquina en los escritos indubitados cercanos a marzo de 1998 o
no. Si las caractersticas encontradas corresponden a otro perodo, se determinar la
falsedad del datado y se podr establecer la fecha aproximada de su confeccin.
Determinacin del dactilgrafo: en los escritos mecanogrcos annimos, o con-
tinuando el ejemplo detallado que motivara la determinacin de la marca y modelo
de la mquina de escribir utilizada para la realizacin de un texto, donde primero se
determinaron las mquinas posibles, luego dentro de ellas se identic la mquina
utilizada, si ahora individualizamos al dactilgrafo, la investigacin estara completa y
con ptimos resultados.
Sin embargo este interrogante es de difcil solucin, requiriendo para su estableci-
miento contar con un texto lo sucientemente amplio, que contenga sucientes caracter-
sticas identicatorias. Se deben determinar dos circunstancias:
a) presionado y
b) caractersticas de forma.
Presionado: se debe analizar la uniformidad o no de la intensidad de la impresin de los tipos o
de sus indentaciones (surco dejado por la presin del tipo al golpear sobre el papel). Esto estar
199
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
dado por la correcta o incorrecta digitacin sobre el teclado, en concordancia con la posicin de
las manos, fuerza y manejo de los dedos, velocidad, etc. Se debe tener en cuenta que, acorde
a donde se encuentren ubicadas en el teclado, no en todas las teclas, ni con todos los dedos,
se ejerce una presin o golpeteo constante. Esa presin ser diferenciada para cada carcter,
pero constante entre ellos si son realizados por un dactilgrafo acostumbrado, aunque pueden
existir variaciones por diversos factores, tales como nerviosismo, apuro, enfermedades, estados
de nimo, temperaturas extremas, etc.
Caractersticas de forma: Ac se debe tener en cuenta el estilo o forma de efectuar un
escrito, tomndose en consideracin los siguientes elementos: mrgenes superiores, infe-
riores, izquierdos y derechos; utilizacin de sangra, si sta es ja o personal; espaciados;
terminacin de prrafos con punto o punto y guin; terminacin de rengln compensando
o no los espacios libres; forma de utilizacin de los signos de puntuacin; estilo o manera
de efectuar una composicin escritural; el manejo o conocimiento del idioma en cuanto a
estructuracin de frases, modismos, faltas de ortografa, sintaxis, etc.
Es necesario contar con abundante material de confronte realizado en distintas fechas,
sobre textos largos y ajenos a la investigacin. Es, empero, un tema muy complejo que de-
pende de diversos factores, siendo muy pocos los casos en que se puede lograr la identi-
cacin y menos an los casos de categricas armaciones. Tener en cuenta que, lo que
hace a la forma, puede ser imitado por alguien que quiera incriminar a otra persona.
Determinacin de tiempos de ejecucin mecanogrca: un escrito mecanogrco
estar realizado en un solo tiempo de ejecucin, si fue confeccionado en su totali-
dad sin retirar el papel de la mquina o sin haber liberado la palanca sujeta
papel, no importando cuanto tiempo cronolgico haya transcurrido. Si se sac el
papel de la mquina o se liber la palanca, aunque el texto se contine en forma
inmediata, habr ms de un tiempo de ejecucin mecanogrca. Esta determi-
nacin es importante para establecer si hubo agregados en un documento.
No es infrecuente que luego de haber suscripto de comn acuerdo un documento
confeccionado en forma mecanogrca, una de las partes en forma fraudulenta, contando
para ello con la mquina de escribir utilizada, agregue a ese escrito alguna constancia
que de algn modo modica el tenor o las condiciones del mismo. De haber utilizado otra
mquina, la maniobra quedara fcilmente evidenciada, pero al usar la misma mquina, se
requiere una pericia para determinar cuantos tiempos de ejecucin presenta ese escrito. De
presentar uno, no queda duda alguna de su legitimidad si las rmas estn puestas despus
del texto ya que indica que, una vez nalizado, las partes que lo suscriben estuvieron de
acuerdo con el texto.
200
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
De haber ms de un tiempo de ejecucin, no necesariamente implica una maniobra
fraudulenta, pero deber justicarse las causas en forma rme, si se presentan posiciones
encontradas. Debe tenerse en cuenta que no encierra fraude alguno que una vez ledo
un documento, despus de haberlo retirado de la mquina y de comn acuerdo entre las
partes se decida agregar algo, colocndose para ello la hoja nuevamente en la mquina de
escribir. De ocurrir esto, debera dejarse constancia en el documento para evitar posteriores
argumentos de alguna de las partes.
Pero ante la posibilidad de un fraude por agregado en un texto mecanogrco, es
posible determinar si todo el escrito fue realizado en un solo acto o no? La respuesta es s.
Deben para ello cumplimentarse los siguientes pasos metodolgicos y sistemticos:
a) determinacin del paso;
b) determinacin de diseo y
c) vericacin del cumplimiento de los principios de Horizontalidad y Verticalidad.
Determinacin del paso: esta vericacin se efecta para determinar la intervencin o no de ms
de una mquina en la confeccin del texto y para establecer que plantilla milimtrica se debe
utilizar para la experiencia. Recordar que de tratarse de una mquina de escribir convencional, de
establecerse ms de un paso se estara determinando ms de una mquina y lgicamente ms de
un tiempo de ejecucin mecanogrca. Con respecto a la plantilla, determinado el paso se utilizar
la correspondiente al mismo para las comprobaciones a efectuar.
Determinacin de diseo: Al igual que con el paso, en una mquina de escribir convencional
si encontramos ms de un modelo de diseo tipogrco se estar estableciendo el empleo de
ms de una mquina y por ende ms de un tiempo de ejecucin.
Vericacin del cumplimiento de los principios de Horizontalidad y Verticalidad: Determinada la
presencia de una nica mquina de escribir en la confeccin de todo el escrito mecanogrco
dubitado, se debe establecer ahora el cumplimiento de estos dos principios para establecer si se
ha realizado en un solo tiempo de ejecucin.
Principio de Horizontalidad: para su determinacin deben tomarse dos letras iguales de un mismo
rengln, ubicadas lo ms equidistante posible una de otra, es decir una prxima al margen izquierdo
y otra al derecho. Lo ideal sera tomar una letra que tenga una grama (trazo o rasgo de una letra)
horizontal, como por ejemplo el barral de la letra t o los de una i o z.
La plantilla milimtrica correspondiente al paso de la mquina utilizada, posee dibujada
en toda su supercie nas lneas verticales separadas entre s por una distancia igual al valor
del paso. Por ejemplo, para un paso mecnico de 2,54 mm, cada lnea estar separada de la
siguiente por ese valor milimtrico. Adems posee tres o cuatro lneas horizontales distribuidas
201
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
en forma equidistante entre s, denominadas lneas de fe. Haciendo coincidir una de esas
lneas de fe en el centro de la grama horizontal de las dos letras iguales y equidistantes
seleccionadas (esto debe hacerse con la utilizacin de lupa, para que la coincidencia
entre una y otra sea exacta) y las lneas verticales que encierren o enmarquen a todas las
letras de ese rengln, se efecta la comprobacin de este principio.
De cumplirse el mismo, todas las letras iguales a las tomadas como referenciales
que se encuentren en el mismo rengln, deben tener exacta coincidencia con la lnea de fe
que aquellas. Adems tenemos una visin general de coincidencia, al quedar las restantes
letras del escrito perfectamente enmarcadas por las lneas verticales.
Principio de Verticalidad: para su determinacin deben cumplimentarse similares pasos que para
el principio de horizontalidad, slo que las letras iguales tomadas como referenciales deben estar
ubicadas en forma equidistante y en igual columna, entre el primer rengln y el ltimo del escrito o
entre dos renglones lo ms separados posibles. En este caso lo ideal sera tomar letras que conten-
gan una grama vertical, como por ejemplo las letras l , i , d , etc. De cumplirse dicho principio
todas las letras iguales cortadas por la lnea de fe deben coincidir en forma exacta.
Para establecer si todo un escrito fue realizado en un solo tiempo de ejecucin
deben cumplirse ambos principios. De no cumplirse uno de ellos, quedar establecida la
presencia de ms de un tiempo de ejecucin mecanogrca. Estas comprobaciones, al
igual que las detalladas para cada tipo de peritaciones posibles, deben ser sealizadas en
lminas adjuntas al informe pericial, pudiendo obtenerse las mismas por fotografa, fotocopia
o escaneado.
Analizados los diferentes tipos de pericias mecanogrcas que pueden realizarse,
faltara detallar la evolucin que han sufrido las mquinas de escribir con el transcurso del
tiempo, indicando las ventajas de su uso y los inconvenientes o modicaciones en los pasos
a seguir para las comprobaciones periciales.
En orden cronolgico podemos distinguir los siguientes tipos:
a) mquinas de escribir elctricas;
b) mquinas de escribir a esferas o Selectric;
c) mquinas de escribir electrnicas;
d) impresora computacional a cadena;
e) impresora a matriz de punto;
f) impresoras trmicas;
202
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
g) impresoras a burbujas;
h) impresoras con cabezal piezoelctrico;
i) impresoras por cambio de fase; e
j) impresoras lser.
Mquinas de escribir elctricas: Aparecen en el mercado en la dcada del 40, pero en
nuestro pas empiezan a ser vendidas en los 60, comercializndose primero las IBM y luego
las Olivetti y las Underwood, aunque son muchas las marcas que las fabricaron, como ser
Japy, Olympia, Rmington, Friden y Hermes. Sus impresiones son por impacto.
Estas mquinas contienen los cuatro elementos fundamentales de toda mquina de es-
cribir ya descriptos en las convencionales, ms todos aquellos componentes que hacen a su uso
y servicios. Adems de ser elctricas, lo que aportaba benecios en lo que hace a comodidad y
velocidad de la escritura, permiten mucha mayor calidad escritural, en algunos casos muy similar
a impresos por tipos de imprenta, debido a que acorde al cuerpo del carcter (letra, nmero o
signo de puntuacin) a imprimir, ste ocupa un espacio predeterminado pero diferentes unos a
otros. Las letras de menor cuerpo, es decir las ms angostas (l, i, t, etc.), ocupan un especio
menor que las medianas (e, n, o etc.) y que las de mayor cuerpo o anchas (m, w etc.).
Lgicamente esta circunstancia trae aparejado que el paso o escape no puede ser
mecnico o constante, ya que el desplazamiento debe ser acorde al cuerpo del carcter
impreso. Este tipo de mquinas tiene paso proporcional, pudindoselo denir como;
Paso Proporcional es el espacio proporcional en que se desplaza el carro de
la mquina cada vez que se acciona una tecla que produce movimiento simple.
Para su medicin se toma en cuenta la unidad bsica que es el menor espacio
que recorre el carro, correspondindole acorde al ancho de cada carcter 2, 3, 4 o 5
unidades bsicas.
A modo de ejemplo y slo para mencionar algunas de las mquinas ms utilizadas, se
detalla que las marca Olivetti poseen unidad bsica de 0,8 mm, en tanto que las IBM pueden
presentar tres medidas diferentes segn sus modelos, a saber: 1/32 pulgadas (0,793 mm);
1/36 pulgadas (0,705 mm) y 1/45 pulgadas (0,564 mm).
Con relacin al diseo o morfologa de sus caracteres cada marca y modelo pre-
sentan diseos exclusivos o compartidos por otros modelos. Algunas marcas, como por
ejemplo IBM ha dotado a algunos de sus modelos con caractersticas distintivas para su
203
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
fcil determinacin. A modo referencial se menciona que es posible determinar que se trata
de una mquina marca IBM, modelo Executive tipo Directory, si su paso proporcional es de
1/32 pulgadas, y las letras h, n y u poseen 4 unidades bsicas, ya que ninguna otra
mquina de IBM posee esa mensura en esas letras.
Con relacin a los tipos de pericias mecanogrcas posibles, que ya fueran detal-
lados para las mquinas de escribir convencionales, se mencionarn las caractersticas
diferenciales con respecto a este tipo de mquinas. Como se comprender del siguiente
anlisis, las diferencias con aquellas estn dadas, justamente, por las diferentes caractersti-
cas que presentan estas nuevas generaciones de mquinas, pero las comprobaciones
son todas similares.
Marca y modelo: adems de su posible identicacin a travs de los caracteres dife-
renciales mencionados ut-supra, se deben cumplimentar los pasos metodolgicos y
sistemticos detallados para las mquinas convencionales, es decir: determinacin del
paso, que en este caso ser proporcional; de diseo; determinacin de clave y luego
conformacin de frmula; bsqueda en el chero de mquinas de paso proporcional y
descarte por diseo y por mensura.
Determinacin de la Mquina: al igual que para el tipo anterior, se deben cumplimentar
los pasos metodolgicos y sistemticos vistos para las convencionales: paso; diseo y
caractersticas de desalineo y de defectos de tipos. Slo debe aclararse con respecto a
estos ltimos que, debido al ancho y sombreado que presentan, la bsqueda de abol-
laduras, suras, empastes, roturas, etc. y de desplazamientos, se torna ms dicultosa,
debindose agregar adems que generalmente son en cantidad, menores en nmero que
en las convencionales. Dadas estas circunstancias, es posible una identicacin positiva
an hallndose menor nmero de caractersticas.
Determinacin del fechado: rigen las mismas consideraciones que para las convencionales.
Determinacin del Dactilgrafo: este tipo de pericia a partir de estas mquinas y en las que se
detallarn posteriormente, queda reducido a la determinacin de la forma o estilo de escritura,
ya que el presionado no depende del dactilgrafo sino del impulso elctrico de la mquina por
lo que, lo ya dicultoso se torna casi imposible, no tratndose este tema en lo sucesivo.
Tiempos de ejecucin: debe establecerse paso, diseo y los principios de horizontalidad y
verticalidad. Todo conlleva igual procedimiento que en las convencionales, slo que en el
principio de verticalidad, las letras equidistantes entre dos renglones alejados del escrito, no
deben estar en igual columna, sino a igual cantidad de unidades bsicas, ya que no
depender de la cantidad de letras desde el margen, sino del cuerpo de stas o lo que
es lo mismo, de la cantidad de unidades bsicas.
204
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Mquinas de escribir a esfera o Selectric: A mediados de 1961 aparece en el mercado un nuevo
tipo de mquinas de escribir carente de barras portatipos, en las que el carro permanece jo y
es un elemento monoimpresor el que se desplaza de izquierda a derecha a lo largo de aqul.
Ese elemento es de plstico niquelado y est conformado por una esfera achatada en sus polos,
sobre las que estn moldeados en relieve la totalidad de los caracteres tipogrcos, dispuestos
en cuatro hileras paralelas de veintids letras, nmeros o signos cada una (en otros modelos
y/o marcas esta disposicin y nmero son variables). Sus impresiones son por impacto.
Accionada una tecla, es el elemento monoimpresor el que girar hacia derecha o izquierda
y el que se inclinar de manera tal que el carcter seleccionado enfrente el rodillo, hacindolo
luego caer sobre la cinta y el papel, produciendo el estampe. El desplazamiento de este elemento
acorde al tipo de paso que posea la mquina, ser constante o proporcional. Esta nueva car-
acterstica obliga a una ampliacin de la denicin de paso para que, en forma genrica, pueda
abarcar a la totalidad de las mquinas de escribir, sean antiguas o modernas. El mismo quedara
entonces denido as:
Paso es el espacio constante o proporcional en que se desplaza el carro o el
elemento monoimpresor, cada vez que es accionada una tecla que produce mov-
imiento simple.
Algunas de estas mquinas pueden poseer dos o tres pasos diferentes, como por
ejemplo la IBM 82 que posee dos pasos mecnicos, uno de 2,54 mm y otro de 2,12 mm,
pudindose optar por uno u otro, accionando una palanca. Adems el elemento monoim-
presor resulta fcilmente removible de su encastre, por el simple accionamiento de la palanca
liberadora del retn. Esto da la posibilidad de cambiarlo cuando se deteriora o rompe, o
simplemente cuando se desea cambiar de estilo o tamao de letras.
Con relacin a los diseos de los tipos, inicialmente se fabricaron en tres modelos,
uno tipo pica y tres tipo elite, pero estos no eran puros como en las mquinas convencio-
nales, lo que permite su fcil identicacin. De lo expuesto surge que es posible identicar
la marca y el modelo de la mquina utilizada siguiendo los pasos ya indicados, aunque para
este tipo de mquinas es ms conveniente tener los catlogos correspondientes a ellas.
La identicacin de la mquina presenta como principal dicultad, que la posibilidad de
intercambio de los elementos monoimpesores entre mquinas del mismo modelo y marca y a
veces entre mquinas de distinto modelo, trae aparejado que deban mensurarse por separado lo
que son defectos propios de la mquina y los que pertenecen al elemento impresor o esfera.
205
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Sern por ejemplo defectos propios de la mquina, entre otros, los siguientes: la
impresin de caracteres torcidos (por estar torcido el sostn de la esfera); impresiones
desparejas (por inadecuada complementacin de rodillo y esfera); paso o escape no
ajustado a valores establecidos (por deciencias en pin y cremallera); desplazamientos
laterales de los caracteres (por desgaste de la cua que regula la rotacin de la esfera);
desplazamientos verticales de caracteres (por deterioro del retn); defectuoso espacia-
miento de los renglones (por desequilibrio de tamao de rodillo, aunque tambin puede
deberse a causas circunstanciales, como ser la realizacin de varias copias simultneas
con uso de papeles carbnicos); etc.
Son defectos propios del elemento monoimpresor, entre otros, los siguientes: las
roturas, suras, abolladuras y empastes de los caracteres (por idnticas causales que las
ya detalladas); desplazamientos laterales de los caracteres (por desgaste de los dientes
que permiten su rotacin); desplazamientos verticales de caracteres (por deterioro de las
muescas de ajuste); etc. Se hace constar que estos desplazamientos laterales o verticales
se producen slo en los caracteres cuyos dientes o muescas tienen defectos, en tanto
que si son desplazamientos producidos por defecto de la mquina se producen en todos
por presentar defectos el retn o cua que inciden sobre todos.
Para el resto de los diferentes tipos de pericias mecanogrcas, rigen las consideraciones
ya vertidas, siendo posibles sus realizaciones y determinaciones.
Mquinas de escribir electrnicas: las primeras mquinas de este tipo reemplazaron la es-
fera monoimpresora por un disco o margarita, constituido por una rueda plana de engarce
central, que se encuentra dividida en forma de ptalos o rayos, conteniendo en los extre-
mos externos de cada uno de ellos la totalidad de los caracteres. Seleccionado un carcter
la rueda gira en su bsqueda por el camino ms corto. Sus impresiones son por impacto.
Estas mquinas poseen diversos pasos, lo que permite obtener mayor o menor can-
tidad de caracteres por pulgadas o lo que es lo mismo mayor o menor tamao de letras. Ello
se logra moviendo la palanca selectora y cambiando el elemento impresor. Algunos modelos
poseen cartuchos electrnicos que contienen diversos estilos de tipos, lo que permite distintos
tipos de impresiones y uso simultneo de dos estilos. Entre las principales mquinas de estas
caractersticas se destacan dentro de las IBM, los modelos 3 y 5 y Selectric Sistema 2000 y
dentro de las Olivetti las series ET 121, 221, y TES 401.
Posteriormente aparecieron las mquinas de escribir con fuentes electrnicas IBM QUIET
(Quietwriter y Quietwriter 7 Typewriter), que contienen un chip de memoria que les permite
alojar todos los caracteres estndar de la mayora de los discos o margaritas, en diferentes
idiomas y con smbolos de aplicacin especial. Una sola fuente puede contener igual cantidad
de caracteres que 20 discos.
206
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Impresin a esfera o bocha Impresin a disco o margarita
Algunas mquinas electrnicas estn equipadas con memoria interna capaz de
almacenar desde un par de lneas de texto hasta ms de 40.000 caracteres y pantallas de
cristal lquido que permite visualizar el texto antes de su impresin y hacer por ejemplo,
copias de una misma carta para diferentes remitentes. Son hbridos entre las mquinas de
escribir elctricas y los ordenadores. No ofrecen particularidades que impidan la realizacin
de los diferentes tipos de pericias mecanogrcas.
En la dcada de los 80 aparecieron y se popularizaron los procesadores de textos o com-
putadoras que, por medio de un software, se posibilita el manejo de los mismos, insertando, bor-
rando, cortando, moviendo, modicando tipos y tamao de letras, diseando formatos, etc.
En estas computadoras, los textos que se confeccionan o modican a travs del
teclado o del ratn o mouse, pueden ser visualizados en una pantalla o monitor y pueden man-
tenerse en una memora virtual o conservarse en distintos tipos de discos archivadores.
Para su volcado al papel, requieren de una impresora conectada a ella a travs de
un puerto de conexin. Estas, con relacin a las mquinas de escribir, presentan tres de
los cuatros elementos fundamentales para lograr su cometido.
El que no poseen es el elemento impulsor como parte integrante de ella. Dicho elemento
conserva todas las tareas que hasta la fecha tena que realizar y otras nuevas, pero ahora lo
realiza en forma independiente, encontrndose en conexin con el ordenador y no con la impre-
sora. El resto de los elementos, el impresor, el entintador y el de movimiento, con las variantes
propias para cada tipo y modelo que se detallarn en cada caso, conservan su misin.
Las primera impresoras utilizaron el sistema de impresin por impacto a travs de
esfera impresora o disco o margarita. Para ella, en cuanto a los tipos de pericias posibles,
se ratican las mismas consideraciones que para las mquinas de escribir. Obsrvese en
las guras siguientes, los detalles y caractersticas de estos dos sistemas de impresin.
207
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Impresora de cadena: presentan los caracteres o tipos en relieve moldeados sobre eslabo-
nes metlicos ordenados en forma sucesiva, montados sobre una cinta sin n que es ac-
cionada por mecanismos de arrastre. La impresin se produce por impacto al ser disparado
electromagnticamente el martillo, cuando el carcter seleccionado pasa frente a l. Es una
impresin al vuelo y de altsima velocidad, al empujarse el papel sobre la cinta y el tipo.
A lo largo de dicha cadena los caracteres se repiten varias veces, teniendo en cuenta la
frecuencia de uso de los mismos segn el idioma, desplazndose por medio de su mecanismo
de arrastre hacia el carcter seleccionado ms prximo. La posibilidad de la identicacin de
la mquina y de su elemento impresor es positivo. La ventaja de este tipo de impresoras es su
velocidad y la desventaja es la tendencia de la cinta a romperse con el uso. Ver en la ilustracin
siguiente la forma y caractersticas del elemento impresor en este tipo de impresoras.
Impresora a matriz de punto: Estas impresoras revolucionan denitivamente esta forma
de impresin mecnica, ya que no poseen ms tipos jos representando a los car-
acteres alfanumricos y a los smbolos. Estos ahora, son formados por agujas que al
ser disparadas por electroimanes imprimen puntos. La sumatoria de estos conforman el
carcter o dibujo. Su cabezal de impresin posee dispuestas en forma vertical entre 8
y 48 agujas, segn el modelo y sus circuitos internos controlan el disparo de las agujas
o alambres, mientras que su cabezal se desplaza frente a la platina dibujando los carac-
teres por medio de puntos. Las impresiones las realiza tanto hacia la izquierda como a la
derecha, es decir que imprime mientras se desplaza en ambas direcciones.
La calidad de las impresiones depende de la cantidad de agujas con las que han
sido dotadas. Obviamente si tenemos en cuenta que una recta es una sucesin de puntos,
a mayor cantidad de agujas puntos, mejor ser la calidad de sus impresiones.
Impresora a cadena
208
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Poseen adems un controlador de calidad, pudindolo hacer en modo normal o
draft o en calidad tipo carta near letter quality. En esta ltima calidad la impresora imprime
dos veces cada lnea, desplazando medio alambre en sentido horizontal y vertical durante
la segunda pasada, de modo que al haber el doble de puntos impresos, su calidad mejora
semejndose a una buena mquina de escribir.
Por medio de selectores es posible elegir distingos tamaos de letras, de espaciados, se
pueden denir caracteres especiales y hacer grcos. Algunos modelos permiten impresiones
a color. Obsrvese en las guras siguientes, las caractersticas de estas impresoras.


Cuando a travs del CPU recibe la orden de imprimir un carcter, la impresora selec-
ciona cuales son las agujas que deben ser disparadas, poniendo en funcionamiento a los
electroimanes correspondientes.
Al incidir sobre la cinta y el papel, dibujan una sucesin de pequeos puntos que le
dan su caracterstico aspecto, conformando una buena aproximacin del carcter deseado
o de un grco. Al dibujar en cada caso a travs de puntos la orden recibida, permite la
realizacin de cualquier tipo de carcter incorporado a su memoria, el que puede ser de-
terminado a travs de un panel selector.
Ncleo o cabezal de impresin Detalle de las agujas y frente del ca-
209
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
En la gura siguiente puede apreciarse la conformacin de un carcter por la im-
presin sucesiva de puntos:
Impresoras ms avanzadas de este tipo (las de 48 agujas), pueden alcanzar en la real-
izacin de grcos, calidades resolutivas de 360 x 360 dpi (dot per inch o puntos por pulgada)
al poseer cuatro lneas con doce agujas, las que poseen un dimetro de 0,14 mm. Otras han
sido dotadas con cuatro cabezales de impresin que se reparten el trabajo a realizar, logrando
mayor velocidad. Todos estos tipos de impresoras posibilitan identicaciones positivas.
Impresoras trmicas: Estas impresoras son muy parecidas en cuanto a funcionamiento
a las de matriz de punto, ya que realizan sus impresiones a travs una serie de agujas,
las que mediante una sucesin de puntos conforman el carcter alfanumrico, smbolo o
grco seleccionado sobre un papel termosensibilizado, el que puede ser de dos tipos,
de base blanca o negra, los que sern descriptos oportunamente.
Estas agujas se encuentran dispuestas verticalmente en el cabezal que se desplaza
horizontalmente igual que en las matriciales, pero ahora son activadas y calentadas elec-
trnicamente y van quemando ennegreciendo el papel, dejando marcados puntos pequeos,
densos, ntidos y sin difusin. Al igual que en aquellas, comenzaron con poca cantidad de
agujas, las que se fueron incrementando hasta las 48 nales que le coneren a sus impresio-
nes gran resolucin. Cabe, para este tipo de impresoras, idnticas consideraciones periciales
que para las anteriores.
El papel que requieren, como ya se ha especicado, debe ser termosensible. Dentro de la
gran variedad que se ofrece en el mercado, estos pueden ser de dos tipos: a) de base negra o b)
de base blanca. Los de base negra son papeles oscuros recubiertos por una sustancia de
color blanco o plateado, la que se volatiliza fcilmente al incidir sobre ellas temperaturas
relativamente bajas, como las que alcanzan las agujas de las impresoras de cabezal trmico.
Los de base blanca son papeles comunes que estn recubiertos por una sustancia qumi-
camente tratada, la que se torna oscura cuando las agujas calientes inciden sobre ella.
210
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Impresoras por Inyeccin de tinta: este tipo de impresoras tiene, al igual que las descriptas,
un cabezal impresor, pero en lugar de agujas poseen inyectores de tinta, que en nmero
de 48 o 64 alcanzan resoluciones de hasta 360 dpi. Estas toberas que no entran en
contacto con el papel, eyectan tinta cuando su cabezal se desplaza frente a la platina,
dibujando as los caracteres. Se distinguen tres tipos de tecnologas:
a) a burbujas;
b) con cabezal piezoelctrico y
c) por cambio de fase.
A burbuja: Estas impresoras poseen boquillas que en su extremo, alojan a un elemento
trmico que calienta la tinta contenida en su interior, la que al hervir, producen burbujas
de tinta que al crecer y a travs del inyector, es disparada sobre el papel.
Cabezal Piezoelctrico: este tipo de impresora es muy utilizado dado su bajo
costo. El sistema es similar al anterior, slo que al nal de cada inyector posee un
elemento piezoelctrico que bombea la tinta al recibir el impulso o seal elctrica,
funcionando a modo de una canilla que abre y cierra el paso de un uido. Obsrvese
en la gura siguiente, las caractersticas de este tipo de impresoras.
Cambio de fase: Estas impresoras utilizan tintas slidas que al ser calentadas a 140
grados por un calefactor, se licuan y son eyectadas por los inyectores del cabezal.
Una vez que la tinta es depositada sobre el papel, unos rodillos trabajando en fro la
secan, jndola. El resultado es una impresin con colores densos y vivos, propio
de las tintas slidas. Todas estas impresoras pueden ser identicadas, rigiendo las
mismas consideraciones ya vertidas.
211
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Las impresoras lser sern descriptas al desarrollarse el tema de las foto-
copiadoras lser color, por lo que queda pendiente su tratamiento.
Antes de describir como se realiza el proceso de fotocopiado, se hace necesario
efectuar algunos recordatorios y consideraciones bsicas sobre fsica.
Un tomo est compuesto por tres tipos de elementos, poseedores de cargas
elctricas diferentes:
a) Neutrn (de carga neutra);
b) Protn (de carga positiva) y
c) Electrn (de carga negativa). Estos pueden ser aislados y tomados como fuentes
especcas, permitiendo conformar campos electrostticos.
Campos electrostticos: Colocados en forma cercana un protn y un electrn,
estos se atraern por tener cargas elctricas opuestas, desplazndose las lneas de
fuerza desde el protn hacia el electrn. Cuanto ms cerca estn estos dos elementos
o cuanto mayor sea el nmero de los mismos, mayor ser la atraccin. El rea donde
se maniestan estas lneas de fuerzas se llama campo electrosttico.
La intensidad del campo electrosttico depende entonces de dos factores:
a) nmero de electrones y de protones y
b) distancia entre s. El manejo de la cantidad de unos y otros dentro de una molcula
permite obtener materiales conductores, aislantes o semiconductores.
Conductores: son aquellos materiales cuyas molculas poseen electrones relativamente
libres desplazndose dentro de ellas.
Aislantes: son aquellos cuyas molculas tienen pocos electrones libres o bien stos no
pueden desplazarse dentro de ellas.
Semiconductores: son aquellos donde las molculas tienden a ser aislantes en su estado
natural, pero se convierten en conductores al recibir fuentes externas de energa.
Por ejemplo un semiconductor puede ser semiconductor semiconductor fotoconductor si se comporta como fotoconductor fotoconductor
aislante en la oscuridad, pero como conductor en presencia de la luz.
En una fotocopiadora analgica el fotoconductor est constituido por un cilindro de
aluminio revestido con Cadmio o Selenio, ya que stos tienen la propiedad de ser fotoconduc-
tores, circunstancia que es utilizada para captar la imagen. Dentro del ejemplo a considerarse
en esta exposicin, este cilindro estar inicamente cargado en positivo, es decir ms protones
que electrones.
212
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Cargar electrostticamente un objeto signica agregarle o quitarle electrones, as lo
hacemos negativo o positivo respectivamente. La molcula en desequilibrio se llama in,
conformando aires positivos (ms protones que electrones) o negativos (ms electrones).
Dentro de una mquina fotocopiadora analgica, los encargados de aportar electrones, de
atraerlos, neutralizarlos y dirigirlos son el Corotrn y la Corona.
Son varios los elementos, adems de los descriptos, los que intervienen para lograr
que una imagen sea reejada sobre el fotorreceptor. Estos son:
a) Cristal documentativo;
b) Lmparas de exposicin;
c) La lente y
d) La ranura de exposicin. Veremos cada uno de ellos.
Cristal documentativo: este puede ser curvo o plano y tiene como misin sostener el
objeto a fotocopiar sin doblez o comba, ayudando a su registro sin reas decientes. La
cara del documento a reproducir debe contactar con el mismo.
Lmparas de exposicin: estas lmparas tienen como tarea enviar la imagen reejada al
resto del sistema ptico. Se hace necesario recordar aqu que un objeto negro al recibir
las longitudes de ondas correspondientes a la luz blanca las absorbe en su totalidad, no
reejando ninguna. As, al incidir las luces de estas lmparas sobre el texto sostenido por
el cristal, su luz ser reejada en todas las reas que se encuentran en blanco. Aquellas
que posean ilustraciones o texto absorbern la luz, no produciendo reexin alguna.
Lente: La luz de esta manera reejada se desplaza en todas direcciones. Al pasar por
la lente contina su ruta ptica pero en forma invertida. Para obtener reproducciones
a igual tamao, la distancia entre el objeto y la lente debe ser igual que entre sta y el
fotorreceptor. Para evitar mquinas de gran tamao, se compensan estas distancias por
medio de espejos con supercies reectoras en su cara anterior.
Tanto la lente como los espejos deben ser de calidad, curvatura y estado adecuado,
para evitar aberraciones pticas o distorsiones en las reproducciones.
Ranura de exposicin: sta debe estar ubicada entre el ltimo espejo y el fotorreceptor y
cumple tres funciones: limita el rea de incidencia sobre el fotorreceptor; regula el tiempo
de exposicin y evita o reduce la luz parsita. Ver en la gura siguiente el diagrama de
ujo de estos elementos.
213
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Aunque el procedimiento que realiza la mquina es un poco ms complejo, basta con
entender su sntesis. Cuando la luz pasa por la ranura de exposicin, a travs de la capa de
captacin, llega al fotorreceptor de selenio o cadmio. Este, que se encuentra cargado posi-
tivamente, es neutralizado por los electrones liberados por la luz reejada correspondiente
a toda la zona del papel sin imagen. Todo ese sector queda entonces con carga neutra,
mientras que en los sectores con imgenes, donde no hubo reexin de luz por haber sido
absorbidas por stas, contina cargado en forma positiva conservando protones.
En resumen se ha formado una imagen latente negativa del original entre las cargas
neutras correspondientes a las zonas del papel y las cargas positivas de las zonas con imgenes,
sean estas de textos, diagramas o dibujos. Resta ahora revelar dicha imagen con tner, que
es un polvo de carbn (negro de humo) namente tamizado mezclado con resina y cargado
negativamente.
La unidad de revelado aplica el revelador a travs de un cepillo magntico o hacindolo
caer en cascada sobre el fotorreceptor. Por poseer el tner carga negativa, es atrado
en todas las reas donde la imagen latente posee carga positiva, revelando o dibu-
jando todas las constancias escritas en el documento original, formando una imagen
residual.
El paso siguiente es transferir esa imagen. El papel es separado por medio de un
dedo despegador o por un golpe de aire y es llevado a travs de un sistema de transporte
de vaco, hacia el rea de fusin. El corotrn de polarizacin positiva efecta una accin de
pretransferencia, al reducir el campo elctrico del fotorreceptor que mantenan unidas a l
las partculas de tner. Justo antes de que el papel entre en contacto con el fotorreceptor,
el corotrn positivo satura sus bras con iones positivos, efectundose la transferencia.
214
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Para adherir en forma permanente al papel la imagen transferida, que por ahora slo
se encuentra retenida por el campo electrosttico (in positivo del papel con el in negativo
del tner), se debe fusionar el mismo. Para ello y acorde al tipo de mquina fotocopiadora, se
utilizan cinco sistemas:
a) por presin;
b) por horneado;
c) por irradiacin;
d) por horneado e irradiacin y
e) por calor y presin.
Por presin: esta fusin la realizan dos rodillos de presin, uno de los cuales suministra
calor y el otro efecta presin, jando el tner al papel.
Por horneado: utiliza un sistema de calefaccin convectiva, de similar manera a como se
cocinan los alimentos en un horno. Colocado el papel en la cmara caliente, al alcanzar el
tner su punto ndice de cristalizacin, se une en forma permanente a las bras del papel.
Por irradiacin: se usa para ello lmparas de cuarzo que elevan por irradiacin, es decir
como una estufa, la temperatura del tner hasta su punto ndice de cristalizacin.
Por horneado e irradiacin: se utiliza para ello una varilla de cuarzo y un cojn calefac-
tor que realizan una funcin combinada.
Por calor y presin: efecta una combinacin de calor por cualquiera de los sistemas
mencionados (irradiacin u horneado) y de presin por rodillos.
Por ltimo la mquina efecta una limpieza del fotorreceptor removiendo el tner re-
sidual a travs de cepillado, frotado o por medio de una cuchilla raspadora de caucho. Luego
se lo carga electrostticamente dejndolo en condiciones para una nueva operacin.
Se enumeran a continuacin, algunas de las pericias o determinaciones y por con-
siguiente causas que se investigan que pueden efectuarse sobre fotocopias: Identicacin de la
mquina fotocopiadora utilizada; determinacin de adulteraciones por armado y composicin
de fotocopias; determinacin de procedencia de una copia y, dependiendo de varios factores,
es tambin posible la identicacin de marca y modelo de la mquina de escribir; determi-
nacin de la mquina; determinacin de tiempos de ejecucin mecanogrca; identicacin
de rmas y manuscritos; identicacin de sellos o estampados; lectura de testados; etc.
Las mquinas fotocopiadoras digitales o lser no reproducen por reexin de objetos
determinados, sino a travs del dibujo realizado por un rayo lser modulado y programado en la
memoria de una computadora. Cabe destacar que la palabra lser signica: Light Amplication
(by) Stimulated Emision (of) Radiation, lo que signica amplicacin de luz por emisin
estimulada de radiacin.
215
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Estas fotocopiadoras poseen dos unidades separadas pero complementarias, un
lector o explorador o escner, que lee el original y lo descompone en pequeos puntos de-
nominados pxeles, convirtindolos en informacin elctrica binaria y una impresora que luego
de recibida la seal del lector, reconstruye el original y produce la copia deseada. Adems
por diversos circuitos electrnicos pueden, una vez recibida la imagen, variar el porcentaje
de reproduccin; invertir polaridades de la imagen; centrar la copia; erradicar o editar zonas;
deformar la imagen; enmarcar, subrayar, cambiar de color, iluminar, etc. diferentes partes de
la informacin que ser luego reproducida por la impresora, sin modicar el original.
La informacin recibida del lector, con variaciones o no, viaja a travs de un cable de
interconexin hacia la impresora, donde se modula un haz de rayos lser que acorde con
la informacin binaria recibida, lo enciende y apaga, descargando puntualmente el cilindro
e impresionando por barrido, el cilindro fotorreceptor sensible.
Dicho haz lumnico es enviado por medio de un espejo octogonal que gira con-
stantemente, teniendo como misin dirigirlo para que realice un barrido de lneas sobre
el objetivo. ste es un tambor fotorreceptor sensible cargado positivamente, que al reci-
bir luz se neutraliza formando la imagen latente de manera similar a las fotocopiadoras
analgicas ya descriptas. Las unidades de impresin, transferencia y jacin, revelan la
imagen en el tambor y luego la transeren al papel, jndolo. Algunas de estas mqui-
nas alcanzan hasta 1200 dpi de resolucin. Vase en las guras siguientes sus partes
constitutivas, donde se aprecia las formas de su funcionamiento.


Los cilindros de estas mquinas son convencionales y el color y la densidad del original
son obtenidos por medio del principio de separacin y de informacin de los tres colores
primarios, es decir el cyan, el amarillo y el magenta, siendo el negro opcional como un cuarto
color o por conformacin con la sumatoria de los dems. Al reconstruirse la imagen en el
cilindro, el color es transferido al papel uno detrs del otro. La superposicin y complemen-
tacin en las cantidades correspondientes, dan la totalidad de los colores y tonalidades.
Elementos lector e impresor Modulacin y transferencia de la imagen
216
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Estas fotocopiadoras estn diseadas para reproducir sobre cualquier tipo de
soporte, sean stos papeles comunes, especiales, satinados, fotogrcos, radiogrcos,
de diferentes espesores, plsticos, transparencias, etc., logrando excelente calidad en
su nitidez y colores, tanto en tonos como en semitonos.
Debido a la alta temperatura que alcanza en la fusin de la resina del tner, en el orden
de los trescientos grados centgrados, no admiten copias doble faz, ya que el hacerlo provoca
corrimientos del tner primario. Lo que s permite es acrecentar los tonos y con ello la carga de
tner en determinados sectores, lo que provoca sobrerrelieves similares al sistema calcogrco.
Esta circunstancia es aprovechada por los falsicadores que las utilizan para realizar billetes
de moneda nacional y extranjera. En otra unidad de este manual se abundar sobre el funcio-
namiento de este tipo de impresin y por ende del reconocimiento de estas falsicaciones.
Lo ms importante en estas fotocopiadoras es que permiten sin alterar el original y
sin retirarlo de la mquina, mejorar fondos, iluminar, agregar o sustraer colores en forma total
o parcial. Esto permite obtener copias distintas del original, pudindoselas utilizar en forma
fraudulenta, ya que mediante una simple desviacin de cables pueden ser operadas en el
lugar o a distancia. Esto debe ser debidamente tenido en cuenta para evitar ser sorprendidos
en la buena fe y para poder interpretar los dichos de algn patrocinado, cuando relate las
circunstancias en que fueron realizados los documentos afectados a una causa.
Se hace expresa mencin, que el tema pendiente de la impresora lser ha que-
dado detallado en el funcionamiento de la fotocopiadora lser, las que como se reitera,
poseen dos componentes independientes pero relacionados, uno lector o escner y
otro impresor. Ese elemento impresor no es otra cosa que una impresora lser incor-
porada a la mquina por lo que huelgan ms detalles al respecto.
Para completar el tema de escrituras mecnicas, se hace necesario hacer una breve
referencia a otro elemento que por su utilidad, bondades y precio ha pasado a ser un in-
strumento comn y de utilizacin popular y diaria, el fax.
Su uso, que primeramente consisti en la transmisin de imgenes periodsticas,
se difundi dentro del mundo empresarial en las dcadas del 70 y del 80 pasando a ser
hoy una tecnologa de uso normal en muchos hogares gracias a su facilidad de uso,
costos, velocidades y practicidad, ya que muchas tramitaciones que antes requeran
actuaciones personales, se hacen ahora por este medio, como por ejemplo denuncias
de siniestros a compaas aseguradoras, comunicaciones entre empresas o entre su-
cursales, etc., resultando un medio vlido y considerado como documento.
217
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Para cumplir con su cometido requiere de un equipo emisor, que es el encargado de
traducir el contenido de un documento a impulsos elctricos de lenguaje binario, los que son
captados por un equipo sincronizado de recepcin que decodica esos impulsos y reproduce
la copia del documento original.
Esta circunstancia se logra mediante motores simultneos de frecuencia comn o
mediante una serie de impulsos sincrnicos que el equipo transmisor emite, controlando o
sincronizando la velocidad del equipo receptor. No importa la diferencia de posibilidades o cali-
dades entre uno y otro, el transmisor regula al receptor adaptando posibilidades y velocidades
a valores que puedan asumir ambos.
El equipo emisor est dotado de una parte lectora conformada por un cilindro giratorio
que enrolla el original a transmitir y a medida que ste gira, un rayo de luz emitido por una fuente
proyectora barre por sectores la totalidad del documento. Cuando el rayo ilumina una zona con
caracteres o dibujos, es decir oscura, es absorbido por stos. Cuando ilumina una zona clara,
sin contenido, la luz se reeja y es captada por una clula fotoelctrica que genera un impulso
de corriente elctrica. Si ilumina una zona gris la reexin captada por la clula fotoelctrica
es proporcional a la claridad de sus tonos y por ende es tambin proporcional el impulso de
corriente elctrica generado.
La seal de este impulso de corriente elctrica captada por la clula, conforma una
imagen en negativo del original que luego se amplica en un dispositivo de conexin, modu-
lando una onda portadora o produciendo una transmisin a travs de pulsos telefnicos.
El equipo receptor posee un cilindro anlogo que gira en sincronismo con el transmisor,
desplazndose a igual velocidad que el haz de luz de intensidad variable, acorde a claros,
semitonos y oscuros que inciden sobre l, recomponiendo y reproduciendo la imagen en el
papel sensibilizado que es ennegrecido acorde a la intensidad de luz recibida.
Este papel sensibilizado puede ser al igual que en las impresoras trmicas ya analizadas,
de base blanca o base negra recubiertas por una sustancia voltil. En algunos equipos la repro-
duccin o copia es realizada por sistema lser, utilizando tner al igual que las fotocopiadoras o
impresoras de este tipo, poseyendo un sistema similar de transmisin y recepcin de imgenes
que aquellas.
Otras mquinas que poseen similares tecnologas son utilizadas para funciones automti-
cas de cobro y emisin de boletos, tiques, constancias de pagos, etc. Ellas poseen un CPU
controlador, impresoras matriciales o trmicas, pantallas de cristal lquido, lectores pticos de
tarjetas, validadores de moneda, etc. y las constancias que emiten sirven de documento, por
lo que deben ser tenidas en cuenta cuando se necesiten sobre ellos, cualquier tipo de compro-
bacin pericial dentro del espectro detallado para impresiones mecnicas.
218
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Se deja expresa constancia que la utilizacin de impresoras, equipos de fax o m-
quinas automticas que utilicen sistema de impresin trmico sobre papeles sensibilizados,
presentan como inconvenientes que debido a su sistema de jacin, los mismos tienden
a borrarse con el transcurso del tiempo o por el trato dado a un documento. Por ello se
hace necesario que todos aquellos documentos, afectados o no a una causa judicial, pero
especialmente aquellos que conforman parte probatoria en una causa, que hayan sido
realizados por algunos de estos sistemas de impresin y sobre ese tipo de papel, sean
asegurados por otro sistema y fedatados por autoridad competente, para evitar cualquier
prdida de informacin o de prueba por esa causal.
219
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD V )
n ALBARRACIN, Roberto; Manual de Criminalstica; Editorial Policial; Bs. As. 1971.
n GOBBI, Eduardo; PALACIOS y otros; Manual de Criminalstica; Ed. Policial; Bs. As.
1983.
n Revista de Polica y Criminalstica; Editorial Policial.
NOTA: todos los textos sealados se encuentran en la Biblioteca del Instituto Universitario de la
Polica Federal Argentina.
Bibliografa obligatoria
u6
unidad seis
investigacin cientca del delito
) (
223
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD VI
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Distintos tipos de Pericias Manuscritas.
2. Pasos metodolgicos y sistemticos que deben cumplimentarse en la realizacin de
este tipo de pericias.
3. Raticar contenidos de la semitica y entender cmo se adquiere el hbito de la escritura
y cules son las diferentes etapas que deben cumplimentarse.
4. Determinar qu es y cmo se conforman las esenciales constitutivas de personalidad
grca de una persona.
5. Determinar cules son y el por qu de los Principios Scopomtricos que rigen a esta
disciplina documentolgica.
6. Pasos metodolgicos y sistemticos que deben cumplimentarse para determinar pa-
ternidad o no de escrituras o rmas.
7. Detalle de los principales elementos que se valoran en forma cualicuantitativa para
establecer autora de escrituras o rmas.
8. Cmo se forma una Historia Grca y dnde reside su valor identicativo con relacin
a los cuerpos de escritura.
9. Cmo inuyen los elementos escritores en la produccin de escrituras y rmas.
10. Cmo se determinan los elementos escritores utilizados y su importancia para el es-
tablecimiento de maniobras adulterativas.
11. Qu es un documento, cmo es una falsicacin material y cmo una ideolgica, y
cules son pblicos y cules privados.
12. Cundo y cmo deben tomarse los Cuerpos de Escritura.
13. Participacin del perito en la toma de Cuerpos de Escrituras.
Mencin sinttica de los contenidos
224
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
225
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
n Introducirnos en el mundo de las escrituras manuales producidas por el hombre.
n Tomar conocimiento acerca de cmo se originan.
n Conocer las diferentes etapas del aprendizaje de la escritura.
n Conocer los diferentes elementos del cuerpo que intervienen en su produccin.
n Ver los diferentes tipos posibles de pericias manuscritas que permiten contestar los
distintos interrogantes que, en las causas judiciales, se pueden presentar.
n Conocer las causas que ocasionan variaciones transitorias o permanentes en las es-
crituras y los inconvenientes que plantea en el cumplimiento de la labor pericial.
n Conocer los principios tcnicos que rigen este tipo de peritaciones.
n Conocer los diferentes estudios que deben realizarse sobre el soporte de los docu-
mentos a peritar.
n Conocer las diferentes maniobras adulterativas que pueden realizarse sobre un docu-
mento y cmo se determinan acorde a los rastros dejados sobre el soporte.
n Denir qu es un documento manuscrito y precisar qu es falsicacin y qu adulter-
acin.
n Ver las diferentes maniobras de falsicacin y adulteracin realizardas sobre escrituras
y rmas.
n Conocer qu es y cmo se conforma la Historia Grca de una persona.
n Tomar conocimiento de como deben obtenerse los cuerpos de escrituras en las causas
para que resulten idneos para el cotejo.
n Tomar conocimiento de los diferentes elementos escritores que se utilizan en la confec-
cin de un documento.
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
226
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
227
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD VI )
Documentos pblicos (agravante)
Documentos privados
ATACA
Formas y signos externos autnticos
Hechos por quienes deben expedirlos
Mienten sobre aquello que deben probar
IDEOLGICA
Mienten sobre signos de autenticidad o contenidos
Sea imitando, creando o alterando verdaderos
Ataca la verdad, menoscabando autenticidad
MATERIAL
Instrumento escrito que prueba un hecho
Que le da vida, lo modica o extingue
O a los dichos de un sujeto
Dotndolo de signicacin jurdica
DOCUMENTO
Expresin del pensamiento de un sujeto
Que est realmente expresado por l (rma/letra)
TENOR
Hacer en todo o en parte un documento falso
Adulterar uno verdadero
De modo que pueda ocasionar perjuicio
DELITO
Ser idneo, mantener conanza, apariencia verdad
Que la conanza que infunden sea para todos
REQUISITOS
Material: alteracin signos de autenticidad
Ideolgica: deformacin de la verdad
FALSEDAD
228
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Gesto Acto volitivo o reejo
Antomo - siolgico
Psquico
ESCRITURA
Etapas Copiado
Mnemnica
Subconsciente
Esfera en que se produce
Por el sujeto Por accin creadora (juez)
Funcin fedataria (escribano)
PBLICO
Todo documento que no sea pblico PRIVADO
Lapiceros Plumas, gavilanes
Bolgrafos
Fibras
ELEMENTOS ESCRITORES
Lpices Grafticos
Copiativos
Crayones
Olgrafo: escrito, fechado y rmado a mano
Cerrado: rmado, dado a escribano con 5 testigos
TESTAMEN-
Ataque: tenor no verdadero como verdadero
Presentacin que pueda causar peligro cierto
De concretrase hecho pueden concurrir otros
ACCIN
Alterar un documento verdadero
Transforma su tenor, borrando y sustituyendo
ADULTERAR
En todo: crearlo atribuyndolo a otro
En parte: incluir maniestaciones no formuladas
HACER
Imitar signos de autenticidad
Imitar es igual a copiar
HACER UN DOCUMENTO ES
229
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Dbitos
Indbitos
Sobre originales
Anteriores, etc.
Pblicos o privados
Fuera de juicio
Igual caracterstica
Concl usi o- No rmas con letras
Se deben demostrar
PRINCIPIOS
Determinar cumplimiento de principios
Estudio del soporte
Extrnseco
Intrnseco
Evaluacin
Sobre elemento dubitado
Sobre indubitado
Comparativo
Sobre elemento dubitado
Sobre indubitado
Comparativo
PASOS
Copiar o reproducir ajenas
Desprenderse de las propias
NO ES POSIBLE
Psquica y social
Escritural (esenciales constitutivas)
PERSONALIDAD
Borrado
Raspado
Lavado
Enmiendas - agregados
Testados
Cortados
ESTUDIO SOPORTE
230
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
ANLISIS EXTRINSECO
Entre letras cortas y largas
Entre maysculas y minsculas
PROPORCIONES
Ingladiados
Gladiolados
Crecientes
CALIBRES
Movimientos horizontales
Movimientos verticales
IRRADIACIN
Legible
Medianamente legible
Ilegible
DIAGRAMACIN
Ascendente
Horizontal
Descendente
ORIENTACIN
Verticales
Con inclinacin derecha
Con inclinacin izquierda
EJES
Velocidad
Presionado
Grosor de trazos y rasgos
Continuidad
RITMO DE ESCRITURA
Entre gramas
Entre letras
Entre palabras
INTERVALOS
Excelente manejo del elemento escritor
Buen manejo del elemento escritor
Mediano manejo del elemento escritor
Mal manejo del elemento escritor
CULTURA GRFICA
231
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
ANLISIS INTRNSECO
Cortas: A - M - N - R - C - S
Sobresalientes: F - G - H - K -
Angostas: I - L-
Anchas: M - N
Medianas: letras restantes
Altura
Ancho
DIMENSIN
Normal
Anormal
ORTOGRAFA
Ubicacin
Situacin
Direccin
Forma
SIGNOS DE PUNTUACIN
Conformaciones MORFOLOGA
Base de rengln
Angulosa
Curva
Recta
Curva
Serpentina
Ligados entre gramas y letras
Desligados entre gramas y letras
ENLACES
Iniciales o ataques
Finales o remates
TRAZOS Y RASGOS
Hesitaciones o dudas
Detenciones y retormas
Retoques
Temblores
ESPONTANEIDAD
232
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
233
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
Antes de comenzar el desarrollo de toda la temtica relacionada con la identicacin de
rmas y manuscritos, se propone como actividad introductoria buscar antecedentes sobre uno de
los ms emocionantes e injustos procesos de la historia judicial relacionado, obviamente, con el tema
a tratar. No se busca el minucioso detalle de las muy variadas causales que se complementaron
para el desarrollo del acontecimiento que se inscribi para siempre en la historia de Francia y de la
civilizacin toda, sino simplemente el recordar un caso que sigue siendo referente jurdico.
Se trata del caso por espionaje que involucr a uno de los integrantes del Estado Mayor del
Ejrcito Francs, el Capitn Alfredo DREYFUS (1859-1935). El citado ocial fue condenado en 1894
tras un clebre proceso que suscit grandes polmicas. Luego de haber cumplido crcel en la tam-
bin clebre prisin conocida como la Isla del Diablo fue rehabilitado y reivindicado en 1906.
Busque y ubique los antecedentes del caso y luego efecte un anlisis y conjuntamente Busque y ubique Busque y ubique
con las consideraciones que crea oportuno efectuar, remtalos junto al trabajo de autoevaluacin
requerido a la nalizacin de esta unidad.
234
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
235
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD VI )
La temtica de esta unidad est centrada obviamente en el tratamiento de los
documentos en general y de los documentos manuscritos en particular. Por ello se hace
necesario efectuar algunas consideraciones sobre documentos, aunque sin intentar
agotar su signicancia jurdica.
Podemos considerar documento a todo instrumento que acredita los dichos de
una persona -volcados en palabras escritas- o que acredita la existencia de un hecho
-al que le da vida, lo modica o extingue, dotndolos de signicacin jurdica.
Los mismos se encuentran protegidos en el Libro Segundo, Ttulo XII, Delitos contra
la fe pblica del Cdigo Penal de la Nacin Argentina, ya que toda maniobra fraudulenta
relacionada con ellos afecta a la credibilidad pblica, haciendo perder la conanza colectiva
sobre lo que representan. Al vulnerarse su autenticidad, hacen que parezca verdadero lo
que no lo es. Para que esto ocurra, lgicamente, deben guardar las formas y ser lo suci-
entemente idneos para producir engao a cualquier sujeto.
Los documentos pueden ser pblicos o privados.
Documentos pblicos a todos aquellos en que el Estado le ha dado con su funcin
jurdica, la caracterstica de instrumentos de fe:
a) por las formas de su representacin o
b) por las personas que intervienen.
Por la representacin, son los otorgados o autorizados por ociales pblicos
luego de haberse cumplimentado las formalidades, es decir que son avalados como
tales por la esfera donde se producen; por las personas son los producidos por
aquellos que, sin ser ociales pblicos, estn debidamente legitimados por el derecho
vigente para cumplir funciones como tales, tanto por su accin creadora (la sentencia
de un Juez) o como fedatarios (escrituracin ante escribanos pblicos).
Escrituras manuales
236
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Por exclusin podemos entonces denir a los documentos privados: como todos
aquellos a los que no pueda asignrseles la categora de pblicos.
Normalmente son sus tenores los objetos de ataque, pudindose decir que:
Tenor es la expresin escrita de una persona por medio de la cual crea, modica rr
o extingue un hecho, avalndolo con su rma.
Estos ataques son los estudiados por la disciplina criminalstica desde tres
frentes distintos:
a) el investigativo: tratando de encontrar los documentos o testigos mudos que puedan
aportar luz al caso;
b) el pericial: determinando todos los ataques que pueden sufrir: y
c) el prevencional: incorporando medidas de seguridad que diculten o desalienten las
falsicaciones o adulteraciones.
El artculo 292 del Cdigo Penal penaliza al que hiciere en todo o en parte un docu-
mento falso o adultere uno verdadero de modo que pueda resultar perjuicio. Entendemos
que hacer es imitar los signos de autenticidad de un documento y que imitar es igual a
reproducir, simular, plagiar, copiar algo.
Aclara el cdigo en todo o en parte. Hacerlo en todo, es crearlo falsamente atribuy-
ndoselo a otro hacedor debidamente autorizado. En tanto que hacerlo en parte signica
incluirle manifestaciones no formuladas. Por su parte adulterar requiere primero contar con
un documento autntico y luego alterarlo, transformndolo por medio del borrado o lavado,
o bien sustituyendo o cercenando su tenor.
La accin se ejecuta al hacer pasar como verdadero un documento que no lo es, de
manera tal que su presentacin pueda causar un peligro cierto. El delito queda consumado
por la sola ejecucin falsicacin o adulteracin. Su uso y consecuencias pueden, de
concretarse, hacer concurrir otros delitos.
Como nico requisito se requiere que sean idneos, es decir ser capaces de man-
tener la conanza que deben inspirar debido a su apariencia de verdaderos. Se aclara que
esa conanza infundida debe ser genrica, es decir que debe ser para todos y no para un
determinado grupo o sector.
237
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
La falsedad puede ser, dentro de sus multifacticas formas, de dos tipos bien
diferenciados: a) material y b) ideolgica.
La material se concreta con la imitacin o alteracin fctica de los signos de autenticidad,
es decir ejecutando la falsicacin o la adulteracin de un documento, ya sea mintiendo
sobre sus signos de autenticidad o contenidos, o imitando, creando o alterando los
verdaderos. Con ello se ataca la verdad, menoscabando su autenticidad.
La ideolgica por su parte, se concreta por la deformacin de la verdad ejecutada justa-
mente por aquellos que deban asegurarla, mintiendo sobre aquello que deben probar.
Pero los signos externos y sus formas no parecen autnticos, lo son.
Dentro de la amplia gama de documentos podemos citar como ejemplo, debido a
su especial tratamiento legal, a los testamentos. Estos pueden ser efectuados de diferentes
maneras: a) cerrado y b) olgrafo.
Los cerrados deben darse rmados a un escribano en presencia de cinco testigos, quienes Los cerrados Los cerrados
dan fe del acto, de las facultades y de la voluntad del rmante.
Los olgrafos deben ser escritos, fechados y rmados por el puo y letra del testador. Frente Los olgrafos Los olgrafos
a cuestionamientos legales debern realizarse los estudios periciales correspondientes para
establecer su autenticidades.
Los documentos pueden estar realizados sobre diferentes soportes. Si bien la gran may-
ora estn realizados sobre papel, tambin pueden estar contenidos sobre plstico: tarjetas de
crditos y otras; metales: chapas patentes, motor de un auto, un arma; otros materiales: pare-
des escritos con amenazas, ocasionando daos, etc. Esta circunstancia obliga a que, desde
el punto de vista criminalstico, deban efectuarse estudios de los componentes de cada uno de
esos soportes para establecer, primero, si son autnticos y luego si presentan adulteraciones.
Sera largo y fatigoso describir todos y cada uno de los soportes posibles. Lgicamente
el papel requiere su tratamiento, pero ser analizado en la prxima unidad donde se descri-
birn los pasos, desde su fabricacin hasta la aplicacin de las medidas de seguridad que
pueden incorporrseles, los sistemas de impresin y los diferentes tipos de tintas utilizados
en la seguridad documental.
Lo que se desarrollar a continuacin, ser una breve referencia a los distintos elemen-
tos escritores que pueden ser utilizados. Primero debe especicarse que existen elementos
escritores propios e impropios.
Son propios aquellos que fueron creados para cumplir con esa funcin especca.
Son impropios aquellos que no habiendo sido creados para ello pueden utilizarse con ese Son impropios Son impropios
n, como por ejemplo: pintura, un ladrillo, carbn, lpices de labios o de ojos, etc.
238
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Dentro de la amplia gama de elementos escritores propios, casi imposible de
enumerarlas, se destacarn por grupos las principales especies: a) lpices; b) plumas;
c) bolgrafos y d) bras.
Lpices: estos instrumentos escritores estn compuestos generalmente de grato dispuesto en
barra o mina, que pueden estar recubiertas por madera, metal o plstico. Adems de:
a) el lpiz comn, deben distinguirse:
b) los copiativos: aquellos que poseen en su constitucin adems de grato y arcilla, frag-
mentos de un colorante orgnico, sustancia que, por humidicacin, permite la copia
de las escrituras con ellos realizadas y
c) los crayones: conformados por sustancias grasas o cerosas con parana y colorantes
orgnicos liposolubles, que pueden estar o no recubiertos.
Plumas: estos elementos son dispositivos aguzados terminados en astas o gavilanes casi
siempre divididos en el medio. En sus orgenes fueron plumas de aves, principalmente de
patos o gansos y de all su denominacin. Hoy se las sigue denominando as an cuando
ya no guarden esa forma primitiva. Las plumas de aves eran tratadas en su extremo libre,
aguzndolas y chanendolas para hacerlas ms aptas para la escritura.
Aproximadamente en 1830 y posiblemente por la corta vida para las escrituras que
posean estas plumas, se las comenz a fabricar en metal, acero u otras aleaciones, incluso oro,
lo que les aportaba mucha mayor duracin. Existen de stas una variada cantidad de especies,
con distintos tamaos, formatos, tipos de puntas, marcas, calidades, etc.
A partir de 1884, a ciertos modelos se les adiciona un almacn cargador de tinta
obliterado con un cono, que mediante la presin ejercida al escribir se retrae, permitiendo
uir la tinta. A estas plumas se las denomin fuentes o estilogrcas.
En algunos pases, como por ejemplo la India, utilizan adems una pluma de caa
preparada sobre pequeos bambes adecuadamente cortados.
Bolgrafos: estos elementos escritores fueron creados por BIRO -de all el nombre de birome, un
hngaro que a mediados de la dcada del 30 emigr a la Argentina donde comenz a fabricarlos
en serie. Se trata de un tubo contenedor de tinta que, en uno de sus extremos, posee una bolilla
que gira sobre su eje tomando tinta del depsito y depositndola sobre el papel. Su uso hoy
predomina en casi todos los pases del mundo.
Fibras: aparecen en la dcada del 60. Poseen una punta brosa cortada en chane que se co-
necta con un eltro embebido en tinta a la anilina, que a su vez se halla contenido en un tubo
plstico o de otros materiales. Su principal particularidad es que no produce surcos o indenta-
ciones. Actualmente se fabrican con puntas muy nas denominadas microbras. Una variante
239
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
de ellas son los marcadores, que poseen tintas uorescentes o al agua de rpido secado y de
diversos colores.
Cada uno de estos elementos escritores dejan sobre el papel las caractersticas propias
del medio de produccin del trazo o rasgo y la inuencia que ocasiona sobre l, circunstancias
que son determinadas y precisadas por los peritos y que acorde a la naturaleza de los casos
tratados, a solicitud del magistrado es posible su determinacin precisa.
Efectuada una rpida recorrida por los principales tipos de elementos escritores propios
por razones obvias, sobre los impropios no se efectuar referencia alguna, se impone hacer
algunas consideraciones sobre las escrituras manuscritas y las rmas.
Sin lugar a dudas, tanto las escrituras manuscritas como las rmas son gestos.
Gestos que resultan de un acto volitivo o de un reejo y depende en cuanto a su direccin,
extensin y fuerza de dos factores: a) antomos-siolgicos y b) psquicos.
Los antomos-siolgicos: estn representados, entre otros, por la rapidez de la transmisin
del impulso nervioso; de la fuerza muscular que permite sostener los elementos escritores y
dirigir los movimientos necesarios para su produccin; de la exibilidad de las articulaciones;
de la longitud de las palancas seas, etc.
Estos factores rigen una serie de movimientos imprescindibles para la escritura:
movimientos del hombro, del antebrazo, del pulso, de los dedos, de traslacin, que puede
ser: plana, a la izquierda, a la derecha, arriba, abajo, etc.
Los factores psquicos: donde tienen principal importancia todos los componentes cerebrales
o simpticos que permiten tanto la produccin de las ideas, como la codicacin y decodi-
cacin de sonidos y su correlatividad con el proceso semitico y la transmisin de las rdenes
escriturales.
A pesar de la aparente variedad de los casos particulares, el gesto para una misma
persona acusar una constante que lo har siempre reconocible y permitir distinguirlo del
gesto anlogo realizado por otro individuo. As como todo individuo posee una personalidad
psquico-social propia y nica, su escritura manuscrita posee esenciales constitutivas de
personalidad grca subconscientes, espontneas, propias y nicas.
La identicacin escritural se basa en la concordancia de las particulares caractersticas
que forman la denominada personalidad grca del escribiente, que va adquiriendo a travs
del tiempo con el ejercicio de la escritura y que se maniestan subconscientemente en el acto
de escribir, escapando al contralor de su autor y dotando a su escritura de particularidades
identicatorias que permiten distinguirlas de otras.
240
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Estas caractersticas no son advertidas a simple vista, donde slo se repara en el
aspecto morfolgico de las letras, sino que constituyen un cmulo de particularidades que
se interrelacionan de las ms diversas formas, dando origen a la personalidad individual a
que nos hemos referido.
El aprendizaje de la escritura reconoce tres etapas caractersticas cuya duracin y
lmites no pueden ser establecidos con precisin ya que dependen de muchos factores,
pero que se cumplen una a continuacin de la otra. Estas etapas son:
a) de copia;
b) nemnica y
c) subconsciente.
Etapa de copia: en esta primera etapa se efecta una verdadera actividad copiativa donde
se trata de reproducir, lo ms elmente posible, la forma del grasmo que se tiene a la
vista. Aqu la actividad est centrada simplemente en la de adquirir la habilidad de manejo
del elemento escritor y la de poder realizar los trazos de una manera similar al modelo.
Requiere atencin en un nivel absolutamente consciente.
Etapa nemnica: en esta segunda etapa el ejecutante ya no tiene ante su vista el modelo
a reproducir, debiendo el aprendiz recurrir a su memoria para recordar cmo se hace o
cmo es la morfologa de tal o cual letra y recordar, adems, cmo se relacionan unas con
otras para conformar cada una y todas las palabras.
Etapa subconsciente: en esta tercera etapa la actividad pscomotriz se realiza subconsci-
entemente, ya que el escritor no est consciente de cmo escribe sino de lo que escribe.
Es aqu donde de una manera instintiva, involuntaria, mecnica, el escritor va incorporando
elementos individuales o propios que apartan a sus grasmos de los modelos primitivos,
predeterminados y rgidos de la etapa de copia. Ahora le incorpora elementos netamente
personales que dan a los mismos, y con ellos a las escrituras o rmas, su individualidad.
Estos elementos, tales como los diferentes puntos de ataque y escape, el presionado,
la evolucin de los rasgos, la estructuracin alfabtica, los ligados y desligados, la proporcio-
nalidad, los valores angulares, el silabeo, etc, adquieren diversas formas y se combinan de
distintas maneras y es all donde radica precisamente la identidad escritural, siendo la morfologa
o estructuracin general slo un elemento ms para la identidad manuscrita, pero un elemento
absolutamente insuciente por si mismo para lograr su cometido.
Como estas esenciales constitutivas son el resultado de una actividad psicomotriz
subconsciente, escapan al control y an a la percepcin incluso del mismo autor, manifestn-
dose como automatismos escriturales. Su determinacin implica la necesidad de un profundo
anlisis con el auxilio de instrumental ptico de microscopa e iluminacin adecuada.
241
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Lo aqu expresado se cumple, asimismo, con las rmas y posibilita establecer la falsedad
de las mismas o su autenticidad, que es lo mismo que determinar que una persona es o no es
la autora de un escrito o de una rma en particular.
Por los motivos expuestos, el falsicador no puede reproducir las grafas ni las rmas autn-
ticas con todas sus caractersticas, ya que no posee los parmetros psco-motrices del verdadero
autor y adems se encuentra condicionado por los propios y sus esenciales constitutivas.
Esto motiva que la reproduccin de las escrituras y/o rmas autnticas, es slo una
imitacin realizada con mayor o menor habilidad de aquello que es apreciable a simple vista,
la morfologa del grasmo y sus caractersticas estructurales de carcter general. Por lo tanto
del anlisis correlativo entre las caractersticas de las rmas o escrituras autnticas y la de los
sospechosos de serlo, es posible establecer si estas ltimas son autnticas o falsas.
Por todo lo expuesto y siguiendo metodolgica y sistemticamente los principios tc-
nicos y cientcos que rigen la disciplina Criminalstica que sern detallados oportunamente- es
posible determinar o descartar la autora de rmas o manuscritos.
Para ello se hace necesario contar con abundante material indbito, es decir, autntico y
sin cuestionamiento, de rmas o escrituras pertenecientes a quin o quines se les atribuyen los
escritos, a n de establecer en un primer anlisis, las esenciales constitutivas de personalidad
grca emergentes de los mismos y posteriormente cotejarlos con los dbitos.
Antes de comenzar con el detalle de todas las caractersticas que deben ser analiza-
das y valoradas para la identicacin de manuscritos y rmas dentro del mtodo y sistema
scopomtrico, se hace necesario efectuar algunas precisiones sobre ciertos trminos que
sern frecuentemente utilizados y detallar las leyes que rigen la escritura.
Documento: sin perjuicio de las consideraciones legales vertidas, se considera docu-
mento a toda pieza donde se registra una idea o un hecho. Su composicin y soporte
puede ser de muy variada naturaleza.
Alfabeto: Conjunto de signos o ideogramas convencionales debidamente clasicados
y metodizados que permiten la representacin escrita de la palabra oral.
Letra: signo alfabtico representante de un sonido que depende de estilos, usos y pases.
Trazos: partes esenciales de una letra, sin los cuales la misma no quedara constituida.
Rasgos: son partes no esenciales de una letra, adquieren diversas formas y representan
adornos o modismos personales.
242
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Grama: es cada una de las partes esenciales de una letra ejecutada sin inversin de
movimiento. Es la unidad grca de la letra, as como sta es la unidad del alfabeto.
Grasmo: representacin del gesto grco humano mediante el cual se ja el pensamiento.
Documentologa, caligrafa, scopometra: disciplinas tcnicas cientcas que estudian
los grasmos humanos para la determinacin de paternidad.
El maestro francs Solange Pellat sintetiz a la escritura en un postulado y cuatro leyes.
Postulado: Las leyes de la escritura no dependen de los alfabetos utilizados. Esto deja perfecta-
mente aclarado que las consideraciones alcanzan a todos los tipos de grasmos y no dependen
de los signos que stos requieran.
Primera Ley: El gesto grco est bajo la inuencia directa del cerebro. Su forma no es modi-
cada por el rgano escritor, si ste funciona normalmente y se encuentra sucientemente
adaptado a su funcin.
Esta ley indica que, si se est en condiciones fsicas adecuadas, es el cerebro el que regula
la escritura, el que preside la funcin grca y los automatismos. De adquirir habilidad para escribir
con la boca o con los pies, conservar siempre las mismas caractersticas grcas.
Cada escritura posee particularidades denidas que permiten su identicacin. A pesar
de los cambios graduales durante la vida, mantendr las individualidades de cada uno.
Segunda Ley: Cuando se escribe, el yo est en accin, pero el sentimiento casi inconsciente de
que el yo obra, pasa por alternativas continuas de intensidad y de debilidad. Est en su mxima
intensidad donde existe un esfuerzo a realizar, esto es, en los inicios; y en su mnima, donde el
movimiento escritural est secundado por el impulso adquirido, esto es, en los nales.
Esta ley regula el automatismo grco, y fundamentalmente, representa que existe esfuerzo
cuando la voluntad interere, pero que despus va decayendo.
Tercera Ley: No se puede modicar voluntariamente, en un momento dado, la escritura natu-
ral, sino introduciendo en el trazado la propia marca del esfuerzo que se hizo para obtener la
modicacin.
Esto es que no se puede superar la escritura ni su destreza, sin reejar los esfuerzos real-
izados o sin una preparacin por largos perodos de automatizacin.
Esta ley preside los disfraces y las imitaciones. El esfuerzo realizado por el simulador,
fatalmente lo traicionar y quedar plasmado a travs de una seal como ser una detencin,
una hesitacin, un desvo, etc.
La deformacin de la escritura por cualquier motivo, afecta a todas las propiedades de la
misma, no slo algunas de ellas. Sin embargo aqu deben mensurarse las causales por declinacin
fsica por edad o por enfermedades transitorias o permanentes.
243
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Cuarta Ley: El escritor que acta en circunstancias en que el acto de escribir es particular-
mente difcil, traza instintivamente formas de letras que le son ms habituales o ms simples,
de esquema ms fcil de ser construido.
Esta ley preside las simplicaciones de los gestos grcos. Frente a una dicultad escritural,
el escritor adopta formas ms simples, ms familiares que las adoptadas normalmente.
La falta de uniformidad en la ejecucin y forma, especialmente en textos extensos, es
tpica de imitacin, ya que las variaciones son propiedades esenciales de cada escribiente.
Como surge de los contenidos de estas leyes, las caractersticas particulares de la es-
crituras y rmas de una persona, pese a las variaciones naturales que se producen, son estables
y por ello sern siempre reconocibles. Sin embargo existen causales que provocan variaciones
las que, acorde a la naturaleza de los cambios fsicos y psquicos que las motivan, pueden ser
de carcter: naturales o accidentales, transitorias o permanentes, voluntarias o involuntarias.
Son naturales: aquellas que se producen acompaando los cambios normales desde la infancia
a la madurez, donde se destacan las evoluciones, la estabilidad y las involuciones. Estos cambios
no son jos ni regulares y no acompaan taxativamente la edad cronolgica. Debe tenerse en
cuenta que no es posible establecer la edad de una persona a travs de sus grafas.
Como caractersticas ms saliente se destacan: que en la edad escolar, las escrituras
son lentas, muy similares en formas a los modelos caligrcos y ms rsticos o quebradizos.
En la edad madura, son mucho ms automticas, veloces, polimorfas, sin indecisiones ni
temblores. En la edad senil, aparecen temblores, trazos polidireccionales, de mayores cali-
bres y mucho ms simplicadas.
Las accidentales: son aquellas que se producen bajo la accin de elementos circunstanciales,
tales como: defectos del elemento escritor o del apoyo sobre el que se escribe, por incorrectas
posiciones o movimientos bruscos, etc.
Son transitorias: aquellas producidas bajo la accin de emociones depresivas o eufricas,
o por disturbios fsicos pasajeros dados por: fro, calor, dolores, alcohol, drogas, medi-
camentos, temblores, enfermedades redimibles, calambres, espasmos, delirios, etc.
Son permanentes: las causas por afectaciones en: accidentes traumticos, por enferme-
dades no redimibles, intoxicaciones crnicas, neurosis, degradaciones fsicas, incoordinacin
muscular, senilidad, perturbaciones motrices, etc.
Son voluntaria: aquellas realizadas con intencin de disfrazar, simular o fraguar escrituras,
bajo el efecto de intoxicaciones premeditadas, realizadas con mano no acostumbrada, etc.
Son involuntaria: adems de otras ya sealadas en los rubro: accidentales, transitorias o
permanentes, las ocasionadas por tics o trastornos psquicos convulsivos, sobresaltos,
choques, cansancio, por sndrome del suicida, etc.
244
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Los anlisis y estudios requeridos para la identicacin de manuscritos y rmas, como se
comprender, son variados, objetivos y minuciosos. Para su realizacin deben cumplimentarse todos
y cada uno de los pasos metodolgicos dispuestos, respetndose su ordenamiento sistemtico.
Lo primero a vericar es que el material aportado para estudio, cumpla con las
exigencias de los principios de orden scopomtrico. Estos principios estn referi-
dos a los materiales dubitado, indubitados, a los estudios y la conclusin, y ya fueron
tratados anteriormente, por lo que slo se efectuar un breve recordatorio.
Elementos dubitados: los mismos deben ser aportados en original, no aceptndose re-
producciones o copias por cualquier medio que fueren. Slo se trabajar sobre una copia
cuando exista una imposibilidad fctica, real y concreta de contar con el original.
Sobre los elementos indubitados:
a) los documentos indubitados deben provenir de documentos de fechas anteriores,
posteriores y contemporneas al dubitado, para poder realizar una historia grca del
escribiente y sealizar sobre ellos las esenciales constitutivas o caractersticas perma-
nentes y transitorias que hacen a su personalidad grca;
b) deben provenir de documentos pblicos y privados, debiendo estos ltimos ser de
fecha cierta;
c) no deben estar relacionados con la causa que se investiga, es decir que deben estar
realizados fuera de juicio y
d) deben estar confeccionados con elementos similares a los contenidos en el dubitado,
tanto en cuanto a los materiales - papeles, elementos escritores y tintas- como en la
forma -maysculas, imprenta, etc.
Es aqu donde los profesionales abogados que asistan a las partes involucradas en una causa,
deben extremar sus habilidades en procura de los documentos que cumplan con los requisitos o de
los datos que conduzcan a ellos para aportarlos al perito. Se debe tener en cuenta que los cuerpos
de escrituras tomados en las actuaciones judiciales, an cuando cumplan con los requisitos legales,
no lo hacen con los tcnicos, por lo que por principio no son idneos.
Frente a las dos factibilidades posibles:
a) autor de las grafas cuestionadas o
b) no autor de las mismas, la realizacin del acto judicial causa diferentes, pero valederas
razones, para incidir en cambios o alteraciones en las grafas.
En el primer caso las variaciones pueden ser de carcter voluntario y premeditado para im-
pedir la posterior identicacin.
En el segundo, el nerviosismo propio de estar involucrado en una causa puede motivar cambios
escriturales que podran ser valorados como intentos de disfraces.
245
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Lo ideal, de tener que recurrirse al mismo, es que sea realizado en presencia del perito que
tomar las prevenciones estratgicas correspondientes para evitar uno y atemperar o calmar al
otro. Como corolario nal se especica que los cuerpos de escritura podrn ser considerados
idneos slo en los casos en que permitan arribar a una conclusin positiva.
Los correspondientes a los estudios y conclusiones indican que:
a) no se pueden comparar textos con rmas o viceversa y
b) no debe armarse nada que no pueda ser debidamente demostrado por medios
fcticos.
El siguiente paso es el estudio del soporte. Se debe tener presente que el so-
porte, segn se ha dicho, puede ser de distintos materiales. De tratarse, por ejemplo,
de papel, debe establecerse si:
a) se trata de un papel original o autntico y
b) si ha sufrido algn tipo de adulteracin. Para la primera comprobacin, de ser requerida, debe
contarse con elementos indubitados de cotejo para establecer las caractersticas y medidas con-
tenidas en los autnticos y luego compararlas. Para el segundo, debe determinarse si presenta
algn tipo de adulteracin por: a) borrado, b) raspado, c) cortado, d) agregados, e) testados, f)
retoques y g) lavados.
Borrado: es toda erradicacin por remocin abrasiva de algun elemento obrante en un docu-
mento. Para lograr su cometido generalmente se utilizan gomas y acorde a la calidad de las tintas
que se pretende eliminar, se utilizan gomas blandas, semiduras y duras, realizadas con caucho
vulcanizado al que se le agrega yeso, talco, azufre, cuarzo, piedra pmez y arena.
Esta accin, si bien logra la eliminacin de las tintas con que fueron realizadas las constancias
que se desean erradicar, trae aparejada subsidiariamente la alteracin del satinado que recubre el
papel y que lo hace apto para la escritura y el erizamiento de las bras celulsicas que lo conforman.
Esta circunstancia es comprobable en forma microscpica y por transparencia, al observarse prdida
de sustancia y mayor paso de luz en las zonas afectadas.
Debe tenerse en cuenta que los falsarios, antes de asentar las nuevas constancias, tratan
de disimular la zona afectada por medio de friccin a presin con un objeto liso, duro y curvo, que
al producir una accin mecnica y calor, alisa la supercie produciendo una regeneracin del brillo,
disminuyendo adems la difusin de la tinta con la que se producirn los nuevos asentamientos.
Raspado: esta maniobra de erradicacin por abrasin es muy similar a la anteriormente
descripta, variando nicamente por el utensilio utilizado para su concrecin. Para lograrlo
246
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
se requiere un lo metlico como ser el de una hoja de afeitar, de bistur, cortaplumas, etc.
que debe ser manejado hbilmente, presentando como ventaja sobre el anterior, el hecho
de permitir un mejor control de la zona a trata. Generalmente sus resultados son ms de-
limitados pero ms profundos, produciendo similares alteraciones en el papel.
Cortado: esta maniobra se consuma por el cercenamiento de parte de un documento, lo
que puede alterar signicativamente su tenor. Su determinacin se efecta mediante el
estudio de los bordes del papel, ya que diferentes mtodos de corte, ocasionan diferentes
resultados, apreciables en forma microscpica.
A modo de ejemplo se detallan: por tijera: producen escalonamiento con cada abrir y
cerrar de hojas; por guillotina: diferente traccin de bras desde el inicio al nal, provocado
por la hoja en su descenso; por elemento cortante: como ser hoja de afeitar o de bistur,
provoca pequeos enganches de bras; por traccin: obviamente es el ms visible o detect-
able, por el anmalo corte de las bras que sufren estiramientos o roturas desparejas.
Agregados: se trata de la incorporacin de nuevas constancias que alteran, por ejemplo,
los importes o destinatarios de un cheque. Para su determinacin se deben establecer
las caractersticas que producen los elementos escritores utilizados, la reaccin de las
tintas a las diferentes ondas lumnicas y de requerirse, por anlisis qumicos sobre los
componentes y colores de las tintas utilizadas.
Testados: es la anulacin total o parcial de un escrito mediante la superposicin de
trazos realizados con la misma o distinta tinta, impidiendo con ello la lectura o visu-
alizacin de lo tachado. Esto puede ser fraudulento o legtimo, requiriendo para esto
ltimo el debido salvado acorde a las formas legales establecidas.
Las tintas utilizadas para efectuar los testados pueden ser de diferentes naturaleza,
por lo que para su revelado, se debe recurrir a diferentes anlisis, mtodos y estudios. Entre
los recursos ms efectivos se destacan: luces de diferentes espectros ultravioleta, visible
e infrarroja- y desde distintos ngulos de incidencia directa, por transparencia y tangencial
hasta rasante; suaves lavados con soluciones o reactivos idneos y recursos fotogrcos.
Retoques o enmiendas: consisten en la transformacin de ciertas constancias por otras.
De esta manera es posible cambiar la morfologa de algunas letras o nmeros y con
ellas el tenor de un documento. Se determinan de manera similar a los agregados.
Lavados: esta maniobra se realiza por medio de solventes adecuados que se aplican en
forma lenta y progresiva sobre los trazos a eliminar, por medio de hisopos o de conos
de papel de eltro, logrndose buen resultado con tintas solubles al agua y a solventes
orgnicos. Las tintas a la anilina se erradican con suave friccin de hisopos embebidos en
agua. Las tintas grasas de los bolgrafos son ms difciles de erradicar por este medio.
247
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Otra forma de producir erradicaciones por lavado pero ya no por medios fsicos sino
qumicos -utilizada para erradicar constancias realizadas con tintas uidas penetrantes- es la
utilizacin de reactivos especiales asociados, denominados borratintas que, aplicados con
mesura, logran una adecuada eliminacin. Estos reactivos actan como oxidantes suaves,
haciendo que sustancias coloreadas se tornen incoloras.
Acorde a la intensidad de las erradicaciones por medio fsicos o qumicos, es posible
por medios analticos mediante la utilizacin de reactivos y mtodos especcos, recuperar
parciales de letras y palabras de los textos erradicados llegando, en muchos casos por
asociacin, a determinarse el texto suplantado.
Determinada o no la presencia de falsicaciones o adulteraciones del o sobre el
documento, se deben realizar dos tipos de exmenes, uno de carcter generalizado o ex-
trnseco y otro pormenorizado, microscpico o intrnseco.
Para ambos exmenes, de contarse con los elementos ideales de carcter indu-
bitados ya referidos, debe efectuarse primeramente sobre todos ellos el anlisis, a n de
establecer las caractersticas generales y particulares y las esenciales constitutivas de per-
sonalidad grca. Luego deben realizarse similares estudios sobre el material dubitado y,
posteriormente, debe efectuarse la comparacin cualicuantitativa entre ambos.
Debido a la especicidad tcnica de cada uno de estos exmenes, se efectuar sola-
mente una breve referencia a los diferentes elementos que se analizan sobre las escrituras
y rmas, detallndose slo aquellas que sean necesarias para su comprensin.
Nota: sobre los pormenores de estos exmenes, el alumno slo deber incorporarlos como informacin, no
requirindose su estudio minucioso, ya que no es tarea que deber cumplimentar. S, se hace necesario su
conocimiento, para poder evaluar oportunamente los informes que deba analizar en el ejercicio profesional y para
conocer los diferentes elementos que son considerados por los peritos documentlogos.
248
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Dentro del anlisis extrnseco se evalan los siguientes elementos: a) ritmo de
escritura; b) inclinacin de ejes; c) orientacin; d) diagramacin; e) irradiacin; f) ff calibre
de trazos y rasgos; g) proporciones; h) intervalos; e i) cultura grca.
Ritmo de escritura: este est conformado por diferentes factores que deben ser evaluados
y mensurados por separado, a saber:
l Velocidad: la ejecucin de una escritura puede ser muy veloz, medianamente veloz y lenta.
l Presionado: es la fuerza ejercida por el escribiente sobre el elemento escritor y ste a
su vez sobre el papel y se trasunta por las indentaciones o surcos dejados sobre este
ltimo. Pueden ser intensos, medianos o leves y se los estudia con diferentes ngulos
lumnicos, con lupas y por examen del reverso. Se debe determinar, asimismo, el grado
de continuidad de este presionado, ya que el mismo puede ser continuo o discontinuo.
La integracin de estos dos elementos permite seis tipos de combinaciones.
l Grosor de trazos y rasgos: Si bien debe ser valorado en funcin del tipo de elemento es-
critor utilizado, su anlisis debe coadyuvar a la valoracin del presionado ya detallado.
l Continuidad: se hace necesario aqu aclarar que se denomina trazado, a todo desarrollo
grco que se realiza sin levantar el elemento escritor del papel. As, para producirlos, se
hace necesario apoyar el elemento escritor sobre el soporte, ejecutar un gesto grco
y luego levantar dicho elemento. Acorde a la cantidad de veces que se ejecuten estos
movimientos, sern las cantidades de trazados producidos. Si para la ejecucin de una
rma o de una palabra se han producido varios trazados, las mismas sern discontinuas,
si se los ha producido en pocas oportunidades, sern medianamente continuas y en
caso de que no se hubieran producido, sern continuas.
Inclinacin de ejes: Las posiciones de los ejes o lneas de equilibrio de las letras o rmas, pueden
ser a) verticales; b) inclinados a la derecha; c) inclinados a la izquierda y d) heterogneos.
l Verticales: sern as cuando mantengan la perpendicularidad con la lnea de base
de la rma o escritura, formando ngulos de 90 grados.
l Inclinados a derecha: sern as cuando las lneas de equilibrio de las rmas o letras
presenten inclinacin hacia derecha, debindose mensurar si presentan leve, me-
diana o pronunciada inclinacin.
l Inclinados a la izquierda: sern cuando los ejes se inclinen hacia ese lado, debiendo
mensurarse iguales valores.
l Heterogneos: cuando la relacin entre las letras o gramas de una escritura o cuando una
rma presente inclinaciones mixtas, indican automatismos subconscientes que hacen a
la personalidad grca de su autor, revistiendo una importante funcin identicativa.
249
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Orientacin: Esta circunstancia surge del trazado de una lnea unicadora de la base de
las letras de una escritura o de una rma, independientemente de los renglones o lneas
pautadas. Puede ser ascendente, descendente u horizontal, destacndose para las dos
primeras que adems pueden ser: leves, medianas o muy ascendentes o descendentes.
Diagramacin: esta circunstancia es ms destacable en las rmas que en las escrituras
y est dada por su mayor o menor legibilidad, pudiendo ser calicada como: legibles,
medianamente legibles e ilegibles.
Irradiacin: en los idiomas como el nuestro en que la escritura va de izquierda a derecha,
la ejecucin de las rmas o escrituras requiere movimientos hacia arriba y abajo y hacia
la derecha. Esto provoca equilibrios o no entre los movimientos horizontales y verticales,
los que pueden ser a su vez expansivos, medianamente expansivos y poco expansivos,
dando lugar sus vinculaciones a nueve tipos de posibilidades.
Calibre: es el espacio comprendido entre la lnea de base de las letras de la escritura o
rma y las cspides de las letras minsculas y se estudia trazando una lnea en cada uno
de esos sectores. El resultado de las mismas puede dar tres tipos de caractersticas:
a) ingladiolado;
b) gladiolado y
c) creciente.
Ingladiolado o constante: se denomina as al calibre resultante cuando las dos lneas
trazadas quedan paralelas.
Gladiolado o disminuido: es el calibre determinado cuando las dos lneas se van cerrando
a la derecha.
Creciente: es el calibre determinado cuando las dos lneas se van abriendo hacia la derecha.
Proporciones: se analiza esta circunstancia en lo que hace a las letras largas y cortas
minsculas y entre las maysculas y minsculas.
Intervalos: es el espacio comprendido entre dos gramas de una letra, entre dos letras consecu-
tivas de una palabra, o entre la nalizacin de una palabra y el comienzo de la siguiente.
Cultura grca: est dada por el grado de habilidad de manejo del elemento escritor. Esto
determina variaciones de excelente, bueno, regular y mal manejo del elemento escritor,
aunque tambin admite estadios intermedios.
250
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Dentro del anlisis intrnseco se valoran los siguientes elementos: a) espontaneidad;
b) estudio de trazos y rasgos; c) enlaces; d) morfologa; e) signos de puntuacin; f) orto-
grafa y g) dimensiones de las letras.
Espontaneidad: una escritura natural presenta una total y absoluta pureza y franqueza de
movimientos que determinan su espontaneidad. Por ello se hace necesario establecer si
presenta algunas de las caractersticas que ponen en evidencia la falta de ella y, de po-
seerla, vericar las posibles causales de produccin. Estos signos son: a) hesitaciones; b)
detenciones; c) retomas; d) retoques, y e) temblores.
l Hesitaciones: son dudas o vacilaciones que efecta el escritor durante el trazado de algu-
nas letras o en partes de la rma y se traducen en pequeos quebrados, especialmente
en la direccin que lleva el elemento escritor, e indican desaliento o intranquilidad durante
la ejecucin, normalmente por incertidumbre de cmo continuar dicho trazado. Estas
hesitaciones son un claro signo de falta de espontaneidad.
l Detenciones: son las paralizaciones momentneas o altos producidos durante la ejecucin
de un trazado y pueden deberse a varios factores: como normales se puede indicar los
debidos a un cambio de direccin del elemento escritor; y como fraudulentos a las provo-
cadas por dudas en la forma o continuidad del trazado que se est ejecutando. En ambos
casos dejan como seal un mayor depsito de tinta que se traduce en un notorio punto,
si el elemento escritor no es levantado del soporte.
l Retomas: De levantarse el elemento escritor luego de una detencin, para poder continuar
con la ejecucin de las letras o rmas se deber hacer incidir nuevamente el mismo sobre
el papel. La retoma efectuada se pondr de maniesto por el trazado independiente pro-
ducido, el que puede estar continuado, encimado, separado, etc.
l Retoques: son las modicaciones efectuadas tendientes a mejorar o modicar los trazados
ejecutados. Estos pueden tener causas fraudulentas, para reparar la ejecucin de los trazos
o rasgos realizados -por diferir de los imitados en angulosidades, evoluciones, involuciones,
trayectorias, etc.; para disimular los rastros de una retoma o simplemente para denir o
aclarar una letra que no ha resultado lo sucientemente legible.
l Temblores: son las vacilaciones o movimientos anormales producidos por la falta de
naturalidad o espontaneidad en la produccin de manuscritos o rmas.
Estudio de trazos y rasgos: como ya se especicara, los trazos son los componentes
esenciales de una letra sin los cuales no quedara denida, pudiendo ser curvos, rectos
o mixtos y perlados ascendentes- o magistrales descendentes-.
Los rasgos son partes no esenciales de las letras y pueden ser iniciales, nales y de en-
laces. Los iniciales y nales pueden ser ascendentes, descendentes, horizontales, cortos o largos y
251
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
presentan dos porciones bien denidas, recibiendo segn el caso, las siguientes denominaciones:
a) punto de ataque; b) ataque; c) remate y d) terminal.
Punto de ataque: es el rasgo inicial producido al tomar contacto el elemento escritor con el papel
y puede adoptar diversas formas: ganchosa: es un movimiento anguloso curvo sin vrtice; arpo-
nado: es un movimiento que conforma un ngulo agudo con su vrtice bien denido; acerado:
movimiento que comienza con una punta muy delgada; y en reposo: o movimiento formado por
un breve apoyo del elemento escritor sobre el papel, lo que produce o conforma un punto.
Ataque: es el primer sector del rasgo inicial que se realiza inmediatamente despus de producido
el punto de ataque y tambin puede adoptar diversas formas: en maza: movimiento de forma
triangular producto del engrosamiento producido por presin excesiva del elemento escritor;
golpe de sable: es un movimiento terminado en punta acerada o na; golpe de ltigo: es un
movimiento menos presionado, ms extenso y sin terminacin acerada; envolvente: es cuando
el rasgo vuelve sobre s mismo; adems del ganchoso y el arponado ya descriptos.
Remate: es el rasgo nal de una letra o rma y puede adoptar las formas descriptas
para el ataque.
Terminal: es el ltimo sector del remate y puede adoptar similares formas que las descriptas
para el punto de ataque.
Rasgos de enlaces: son los rasgos que sirven de nexo entre dos letras y pueden ser
curvos, rectos o mesetados.
Enlaces: se denomina as, a las uniones que vinculan entre s a las gramas de una misma
letra o las uniones que vinculan a las diferentes letras de una palabra. Acorde a las distintas
modalidades escritoras, estos se presentan a) ligados o b) desligados.
l Ligados: son los rasgos que sirven de nexo a dos gramas o a dos letras de una misma
palabra.
l Desligados: es la falta de rasgos que sirven de nexo entre dos gramas o letras.
Morfologa: como su nombre lo indica, es la construccin, constitucin o conguracin de
dos aspectos importantes de una rma o de un manuscrito: a) su forma o conformacin
genrica y b) la lnea o base de rengln.
l Forma o conformacin: este estudio se centra en el anlisis predominante de las formas
curvas o angulosas. Con relacin a las curvas se determina asimismo si stas son evo-
lucionadas o involucionadas.
l Lnea o base del rengln: es independiente de que el papel donde se encuentren los escritos
o rmas posea o no rayado o renglonado. Es la lnea imaginaria que vincula la totalidad de
las bases de las letras de un rengln de un manuscrito o de las diferentes partes de una
rma. Acorde a su trazado, la misma puede ser: a) recta; b) curva y c) serpentina.
Ser recta: cuando la lnea que toque la base de todas las letras o de todas las partes de
la rma resulte el camino mas corto o casi el ms corto, entre el punto inicial y el nal.
252
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Curva: cuando la resultante adquiera diferentes alturas en creciente y decreciente,
pudiendo ser cncava o convexa.
Serpentina: cuando la lnea sea una sucesin de concavidades y convexidades.
Signos de Puntuacin: Estos aportan una gran cantidad y variedad de datos donde interviene, adems
de la forma, su ubicacin, posicin y direccin. Tmese a modo de ejemplo el punto de la letra i
, este puede estar representado como un punto, una raya, un tilde, un redondel, una coma, etc.
Adems puede estar ubicado sobre el eje de la letra, a su izquierda o derecha, prximo o alejado
y en los casos que corresponda por su forma, se debe vericar la direccin asignada.
Ortografa: debe vericarse en este rubro las faltas ortogrcas que posea, tanto en lo que
hace a la construccin de las palabras como a su gramtica, determinndose su grado de
normalidad o anormalidad y la coherencia de repeticiones en cada texto y comparativamente
entre los dubitados e indubitados.
Dimensin de letras: donde se considera con relacin a su altura si son cortas o sobresalientes
y con relacin a su ancho sin son angostas, medianas o anchas.
La evaluacin pormenorizada en forma cualicuantitativa de todos y cada uno de los
items que se han detallado, permiten al perito una profunda compenetracin de las esenciales
constitutivas o gestos iditicos subconscientes que conforman una personalidad grca y
con ello la determinacin de autora o paternidad en manuscritos o rmas.
Tal como fcilmente habr comprendido el alumno, la temtica de la identicacin de
manuscritos y rmas es sumamente compleja y tcnica, por lo que slo se requiere la lectura
y comprensin de los diferentes temas que componen los estudios extrnsecos e intrnsecos
y su conservacin material, para poder oportunamente, cuando la actividad profesional as se
lo imponga, contar con los elementos que el perito debi tener en cuenta y de all valorar su
actividad en procura de sostener o rebatir el informe presentado.
Debe asimismo tener en cuenta que todo lo detallado en el informe debe ser debidamente
sealizado en las lminas complementarias, ya que es funcin especca del perito demostrar
todo aquello que dictamine en sus conclusiones, para diferenciar sus dichos de los del testigo.
Se requiere, tambin, comprender que la diferencia fundamental con la determinacin de
identidad papiloscpica ya analizada, es que para la mayora de las cuestiones criminalsticas, en
general, se arriba a las conclusiones luego de mensurar en calidad y en cantidad pero no en forma
matemtica, las caractersticas aportadas por los testigos mudos o cosas en su interrogatorio.
Para su ilustracin, podra llegar a parangonarse con los sntomas aportados por el paciente a
un profesional mdico, que son los que le permitirn a ste, arribar a un diagnstico.
253
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Como corolario, es bueno aclarar que todos los peritos que analicen los mismos el-
ementos, bajo las mismas condiciones y con similares tcnicas e instrumental, debern efectuar
objetivamente idnticas determinaciones. La diferencia entre ellos estar dada en las
evaluaciones subjetivas de esas determinaciones las que, segn los casos, permitirn
concluir en forma diferente dentro de un marco de buena fe, tal como dos mdicos frente
a los mismos sntomas, pueden arribar a dos diagnsticos o terapias diferentes.
254
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
255
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD VI )
n Enciclopedia Universal, Tomo XX, pginas 929 a 980.
Dada la especicidad del tema tratado, el resto de la bibliografa de esta unidad debe
ser considerada optativa y se indica slo para ilustracin o consulta especca del alumno.
n GUZMAN, Carlos; El Peritaje Caligrco; Ed. Policial; Bs. As. 1997.
n DEL PICCHIA, Jos; Manual de Documentoscopa; Ed. La Rocca. Bs. As. 1993.
n CREUS, Carlos; Falsicacin de Documentos en General; Ed. Policial; Bs As. As-
trea.
n Revistas de Polica y Criminalstica n 2; Ed. Policial.
Nota: todos los textos mencionados se encuentran para consulta y/o prstamo en la Biblioteca del
Instituto Universitario de la Polica Federal Argentina.
u7
unidad siete
investigacin cientca del delito
) (
259
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD VII
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Qu es Seguridad Documental.
2. Dnde, para qu y cules son los benecios que aporta su implementacin.
3. Evolucin sufrida desde los primeros elementos utilizados como papel hasta la fecha.
4. Denicin de papel y su constitucin genrica.
5. Fuentes de recursos para la obtencin de materia prima.
6. Fabricacin del papel y los diferentes procesos a los que se someten.
7. Distintos tipos de papeles.
8. Distintos tipos de tintas en general y de seguridad.
9. Tintas especiales para funciones determinadas.
10. Distintos tipos de sistemas de impresin.
11. Reconocimiento de los principales sistemas utilizados en seguridad documental.
12. Distintas medidas de seguridad documental.
13. Aplicacin de las mismas acordes a destinos, usos y costos.
14. Aplicacin de estas medidas en los documentos de identidad y otros.
15. Conocimiento y reconocimiento de las distintas medidas en los documentos a analizar.
16. Aplicacin de estas medidas de seguridad en diferentes tipos de soportes.
17. Vericacin visual en prevencin de falsicaciones y adulteraciones.
Mencin sinttica de los contenidos
260
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
261
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n Introducirnos en el mundo de la Criminalstica Prevencional.
n Dentro del amplio espectro que comprende, especcamente en la proteccin docu-
mental.
n Conocer cules son los componentes del papel, soporte base de los documentos
analizados en esta unidad.
n Conocer las fuentes de materia prima y su importancia acorde al uso a que posterior-
mente est destinado.
n Hacer un breve comentario de las diferentes maneras en que se fabrica el papel.
n Comprender uno de los procesos de fabricacin del papel.
n Conocer las medidas de seguridad que sobre l pueden incorporarse en el momento
de su fabricacin.
n Distinguir esas medidas autnticas de las imitaciones realizadas por los falsarios.
n Conocer las categoras de calidad dada a los papeles segn el uso al que est desti-
nado y sus regulaciones.
n Conocer la mecnica de trabajo de los principales sistemas de impresin sobre papel.
n Reconocer en los documentos la presencia de estos sistemas.
n Tomar conocimiento de algunas tintas denominadas de seguridad.
n Comprender qu otras funciones cumplen algunas tintas especcas en determinados
documentos.
n Detallar las principales medidas de seguridad utilizadas para la proteccin documental
en la mayora de los pases del mundo.
n Conocer algunas de las diferentes medidas de seguridad aplicadas en los distintos
documentos de identidad o pertenencia.
n Distintos usos de las medidas de seguridad y formas de reconocimiento.
262
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
263
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD VII )
SEGURIDAD: ES LA CONFIANZA Y TRANQUILIDAD QUE SE POSEE ANTE LA IDEA DE
QUE NO HAY PELIGROS QUE TEMER.
PAPEL: PRODUCTO FOLIOLAR DE FIBRAS ENTRELAZADAS, O AGLOMERACIN DE
FIBRAS CELULSICAS DISPUESTAS EN FORMA LISA Y PLANA.
Trapos: lino, algodn, camo
Maderas: bosques naturales o cultivados
Bagazo de la caa de azucar
Residuos agrcolas: paja de trigo
Reciclaje
FUENTES
Papiro o junco 3.500 A.C. en Alejandra
Pergamino: piel de oveja, cabra: en Asia
Papel: bambu + seda: en China 200 D.C.
Papel vegetal: damasco, 710 D.C.
HISTORIA
Amasado y formacin de la hoja
Prensado por rodillos y secado
Amalgamamientos y santinados
Bobinado en cilindros
Rebobinados y cortes
PASOS
Trozado y descortezado de la madera
Molino con agua
Tamizado en cribas
Depurado y mezclado
Prensado: 60% agua y 40% pasta
PASTA
264
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Comn: sin ligrana, distintos usos
Certicacin de origen: identica fabricante
Emisin controlada: identica a impresor
Emisin registrada: regulada por ley
TIPOS PAPEL
Claroscuro puestos durante la fabricacin
Localizada: ubicada en un sector predeterminado
Repartida: distribuida en todo el papel
FILIGRANA
Gramaje: gramos por metro cuadrado
Resistencia a la traccin = Tensin KG/CM.
Espesor: exactitud de 0,01 MM.
P H.
Rasgado: fuerza necesaria para rotura
Opacidad: paso de la luz
Permeabilidad: a tintas
Doble plegado: resistencia al doblado
Suavidad o lisura: acorde elemento escritor
Brillo: acorde a destino
Penetracin: por absorcin
Compresin: disminucin del espesor
CALIDAD
Fluorescentes o no
Filigranas o marcas de agua
Fibras: Hilos nylon 5 MM visibles o no
Localizada por zonas o tiras jas
Confetis: 1 MM distintos colores = distribucin
Otros: cenizas de papel, bras especiales
Sensibilizado
Hilo de seguridad
MEDIDAS SEGURIDAD
265
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Fondos de seguridad
Fondos iridiscentes
Microletra o microcalco
Imagen latente
Registro perfecto o simultn
Leyendas invisibles
Leyendas fotocromticas con tintas O.V.I.
Holografas
Plaquetas de seguridad
Film transparente de seguridad
Film con microesferas
Botones de seguridad
Sellos secos
Cdigos de barras
Perforaciones
MEDIDAS
Offset: indirecto y plano
Tipogrcas
Calcogrcas
Computacionales
IMPRESIONES
Fugitivas
Variacin cromtica u O.V.I.
Electrostticas
Magnticas (xidos de hierro)
Termosensibles
Secretas o simpticas
Antifotogrcas o antirreex
Fotocromticas
Reactivas al agua
TIPOS
TINTAS: VEHCULOS COLORANTES QUE POR EVAPORACIN O REACCIN QUMICA
DEJAN COLORES INTENSOS Y PERENNES..
266
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
267
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
Lea atentamente el artculo periodstico que se adjunta a continuacin, extrado del
diario La Nacin del 15 de abril de 2001.
Aplicando sus conocimientos de derecho, calique la o las gura/s delictiva/s imputable/s
a los integrantes de la organizacin delictiva desbaratada.
Mensure a continuacin todo el espectro delictivo que puede desprenderse de la utilizacin
de documentos falsicados.
Calique nuevamente las nuevas y variadas guras delictivas que se desprenden de
esa utilizacin y mensure la gravedad de la maniobra, no tanto desde el punto de vista es-
trictamente de derecho, sino desde un enfoque social.
Valorada la magnitud del dao ocasionado, se entender el por qu de la obligacin de
todo Estado en dotar a sus documentos pblicos y/u ociales de sucientes medidas de seguri-
268
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
dad para que stos sean fcilmente reconocibles (recordar dentro de qu captulo est protegido
este tipo de delitos en el Cdigo Penal), y el por qu de la necesidad por parte de los usuarios de
conocerlas y reconocerlas.
Esta unidad tiende a detallar las medidas de seguridad que se pueden utilizar y las formas
de su reconocimiento.
269
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD VII )
Debemos comenzar el tratamiento de esta unidad deniendo el concepto de
Seguridad y luego ampliar su signicado a un contexto mucho ms amplio.
Seguridad: segn el Diccionario Ilustrado de Ramn GARCIA-PELAYO Y GROSS, Ediciones
Larousse, de la Editorial Policial, ao 1988, es la Conanza, tranquilidad de una persona
procedente de la idea de que no hay ningn peligro que temer....; Ramo de la Adminis-
tracin Pblica que vela por la tranquilidad de los ciudadanos...; Conjunto de leyes, y de los
organismos que las aplican, que tienen por objeto proteger contra determinados riesgos..
Si bien el concepto en s es lo sucientemente claro, tambin lo es el concepto de que
nada ni nadie puede asegurar seguridad, ya que siempre habr factores internos o externos;
intencionales o accidentales; dolosos o culposos; naturales o no, que pueden hacer variar las
condiciones o mecanismos de funcionamiento de la compleja maquinaria resultante, pero
absolutamente necesaria para el cumplimiento de una funcin tan amplia como ardua.
Dotar, por ejemplo, a una casa de cerraduras especiales, rejas, sistemas de alarmas
y an vigilancia efectiva por medios electrnicos y fsicos, no garantiza en modo terminante
que no pueda ser objeto de un hecho delictuoso o accidental. Lo que sin duda produce, es
una minimizacin de riesgos y es as como debemos entender el concepto de Seguridad
dentro de este desarrollo temtico.
Acorde al tipo de proteccin que se pretenda brindar y sobre quines o qu
se efectivizar, se debern implementar diferentes aportes tecnolgicos y se deber
recurrir a los profesionales idneos correspondientes.
Se ha detallado, en unidades anteriores, los diferentes aportes que la disciplina
Criminalstica puede brindar. Si es posible determinar y esclarecer un hecho y sus autores
luego de que ste se ha producido a travs de la aplicacin de conocimientos tcnicos y
cientcos, utilizando de los mismos medios se podrn prevenir vulneraciones a la seguridad,
adoptando las medidas que fueren necesarias.
Seguridad documental
270
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Asimismo se ha denido y comprendido el concepto de documento y se han de-
tallado las formas mecnicas y manuales que se utilizan para su confeccin, los ataques a
que son sometidos y las comprobaciones que sobre ellos pueden realizarse. La aplicacin
de la ciencia y la tecnologa a la prevencin de fraudes contra los documentos, es lo que
se denomina Seguridad Documental.
Los documentos pueden estar realizados sobre diversos tipos de elementos, es
decir confeccionados sobre diferentes soportes. En este captulo nos referiremos fun-
damentalmente a los realizados sobre papel, efectuando algunas consideraciones
sobre otros, como ser plsticos o metales.
Con relacin al papel se hace necesario efectuar una breve mencin sobre qu es,
cules fueron sus precursores, sus orgenes, sus fuentes de materia prima, las formas de
su produccin y sus distintos tipos.
Papel: se podra denir como una hoja delgada producto de una combinacin de materias
brosas en su mayora de origen vegetal, -porque tambin pueden ser de origen animal o
mineral-, sometidas a diversos procesos y destinada a diferentes usos. Este conjunto foliolar
de bras celulsicas, lignocelulsicas o ambas, entrecruzadas y/o aglutinadas entre s en
forma de lminas exibles u hojas lisas, planas, homogneas y suaves, de diferentes durezas,
color, satinado, duracin, etc. -segn el uso al que ser destinado-, puede estar dispuestos
en forma delgada o gruesa, constituyendo as papel o cartn respectivamente.
Obviamente este producto articial puede adaptarse a diferentes funciones acorde al tipo
de supercie que se le asigne, pudindose mencionarse, entre otros, para envoltorio, escritura,
absorbentes, etc., lo que hace que el papel sea un material de suma utilidad para el hombre.
Sin intentar hacer un resumen histrico, se puede mencionar que antes que los rabes
introdujeran la fabricacin manual del papel en Europa en la Edad Media, en la antigedad
se emplearon otros materiales de manera similar al papel. Desde los ms antiguos hasta el
papel como lo conocemos hoy, podemos mencionar: a) el papiro, b) el pergamino, c) el
papel chino y d) el papel rabe.
El papiro: nombre egipcio que signica producto del ro, data de tres mil quinientos
aos antes de nuestra era y se obtena de un arbusto o junco, el Cyparus papyrus L
que brindaba a esa antigua civilizacin mltiples benecios y usos. El papiro adems de
servir para la escritura, se lo utilizaba para la alimentacin humana, para la fabricacin
de utensilios domsticos, embarcaciones, productos medicinales, etc.
271
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
La industria del papiro alcanz gran desarrollo, especialmente en Alejandra, donde se
utilizaba para su produccin, adems de la pulpa celulsica del arbusto o junco mencionado,
una sustancia aglutinante a modo de encolado extrada del tallo del mismo, agregndose luego
harinas que actuaban como carga, logrando uniformidad.
El pergamino: para muchos autores su origen se remonta al siglo III o II antes de Cristo y
su invencin se la adjudican al rey Eumenes de Prgamo (antigua ciudad del Asia Menor,
hoy Bergama). Sin embargo, estos materiales de origen animal obtenidos por depilacin,
secado, estiramiento y otros procedimientos de la piel de animales jvenes tales como ove-
jas, corderos, asnos, cerdos, cabras, etc. fueron utilizados anteriormente por los jonios y los
israelitas segn los clsicos Herodoto y Muspratt. Aunque sus orgenes sean inciertos, sobre
l se han registrado cdices, escritos monacales y los acontecimientos ms importantes de
la Edad Media.
El papel chino: sus orgenes datan del Siglo II despus de Cristo y consista en hojas
obtenidas por el alisamiento de las bras de bamb y trapos de seda deshilachados
amalgamados en agua. De su evolucin surge un papel de bras vegetales muy similar
al hoy utilizado, fabricado en Samarcanda por prisioneros chinos, en el Siglo VIII.
El papel rabe: en el Siglo VIII un rabe de nombre Amru, en conocimiento del secreto
de fabricacin del papel chino, comenz su produccin en tierras rabes, convirtiendo a
Damasco en el centro de una nueva industria cuyo producto fue exportado primeramente a
Italia y Espaa y luego por todo el Mediterrneo, a comienzos del Siglo IX. El agregado de
encolados y cargas a base de almidn de trigo introdujo mejoras en la calidad del papel
de esta procedencia.
Adems de lo detallado existen referencias histricas que, en diferentes pases de Eu-
ropa, se utilizaban papeles confeccionados con bras de algodn y lino y que en Alemania se
estableci, en la ciudad de Ravensburg en el ao 1290, el primer molino y fbrica de papel.
La aparicin de la imprenta y el avance de las industrias, hicieron notar que el pro-
gresivo aumento del consumo de papel requerira a la brevedad de fuentes naturales y de
cultivo de materias primas celulsicas y del desarrollo de nuevas tecnologas aplicables en
el proceso de fabricacin, logrndose con su incorporacin mejores calidades, incremento
de produccin y baja de costos y precios.
Actualmente las principales materias primas de las cuales se obtienen las bras ce-
lulsicas o lignocelulsicas aplicables a esta industria, son del reino vegetal: provenientes de
bosques naturales y cultivados; del bagazo o cscara de la baga de la caa de azcar; y
de residuos agrcolas tales como pajas de trigo, lino, el linter o borra del algodn, etc.
272
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
El reino animal ofrece tambin materiales brosos de origen proteicos no
celulsico, como pelos, lana, seda, etc. que se utilizan como complemento de las
vegetales, ya que de por s no satisfacen las necesidades exigibles de exibilidad,
nura y tenacidad requerida para la fabricacin del papel.
Dentro del reino mineral debe mencionarse al asbesto o amianto que, si bien no
se utiliza para el uso corriente del papel, se fabrican con sus bras papeles y cartones
para uso industrial por sus propiedades de alta resistencia a las temperaturas.
Debe mencionarse asimismo otros aportes o fuentes: los trapos, es decir los
restos de tejidos, telas, redes, etc. confeccionados con bras de lino, camo y algodn
los cuales, luego de su vida til para los nes predeterminados para los que haban sido
creados, se utilizan para la fabricacin del papel y el reciclado de papeles en desuso.
La utilizacin de las distintas fuentes de recursos de materias primas para la obten-
cin del papel, da diferentes calidades y deben ser especialmente tenidas en cuenta en el
primer momento de su elaboracin.
Para la fabricacin del papel se hace necesario, primeramente, transformar la materia
prima, desbrando o separando sus bras. Realizado sto se obtiene la pasta o base del papel
que, acorde a las caractersticas del tipo de papel que se desea fabricar puede ser: a) pasta
mecnica, b) pasta semi-qumica, c) pasta quimi-mecnica y d) pasta qumica.
Pasta mecnica: esta pasta puede ser utilizada cruda para la obtencin de cartones y
papel para diarios, o cocida para la obtencin de cartulinas y papel obra de segunda. Por
no ser el tipo de papel de inters para el tratamiento de esta unidad, no se especicarn
las diferentes etapas de su fabricacin.
Pasta semiqumica en crudo: se obtiene papel de embalaje, corrugado y cartones y
blanqueada, papeles para escribir e imprimir. Por obtenerse con sta y con la pasta
quimi; mecncias papeles de menor calidad que con la pasta qumica, slo se describir
el proceso de fabricacin para aquellas.
Pasta quimi-mecnica en crudo: se obtienen papeles para diarios y para empapelar; y
blanqueada: papel para libros, o papeles tis o higinicos.
Pasta qumica: para la obtencin de esta pasta partiendo de la madera, deben realizarse,
en general, los siguientes pasos:
Trozado de troncos: este paso consiste en el seccionado de los troncos en segmentos de
unos sesenta centmetros de longitud.
273
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Descortezado: procedimiento por el cual se separa la corteza de los troncos mediante el uso
de cuchillas en un tambor giratorio o por medio de presin de agua.
Chipeado: es el astillado o desmenuzado de la madera realizado a travs de dos discos me-
tlicos estriados y enfrentados que giran en sentido contrario a gran velocidad. Esto provoca
el chipeado, que no es otra cosa que hacer pedazos menudos de una cosa.
Coccin: luego de almacenados en depsitos, los chips son colocados en recipientes me-
tlicos de gran capacidad denominados digestores, donde son sometidos a la accin del
vapor de agua, presin y determinados reactivos qumicos.
Tanque de soplado: luego de la coccin las astillas son descargadas en un tanque denomi-
nado Blow Tank donde son tratadas.
Lavado: luego de ser tratadas en el tanque de soplado se procede al lavado de la pasta
con ltros de lavajes o espesadores, que tienen como tarea separar el denominado licor
negro o lquido resultante de la coccin. Separado este licor es enviado a recuperacin,
recomenzando su ciclo en la coccin.
Depurado: la pasta lavada es depurada, ltrada y espesada a travs de diferentes cribas, renn-
dose aquellos trozos que no estn lo sucientemente desmenuzados. Aqu, segn el resultado ob-
tenido y/o deseado, se divide el proceso para obtener la pasta cruda o pasta blanqueada.
Prensa pasta: el material resultante de la renacin es tratado para su desecado con ltros
al vaco o en mesas especiales con secado por aire, conformando la denominada pasta
celulsica cruda. Con esta pasta se obtienen papeles resistentes, ache, embalaje, etc.
Blanqueado: Si lo que se desea es pasta celulsica blanqueada, despus del depurado se
somete la pasta obtenida a un proceso de blanqueo. Con esta pasta se obtienen papeles
para escribir, imprimir y para envases especiales.
274
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Obsrvese en la gura siguiente, el esquema secuencial de los diferentes pasos
que deben seguirse para la obtencin de pasta qumica.
Las pastas as obtenidas son sometidas a lavado, decolorado, secado y prensado en
lminas, para ser trasladadas al molino para la fabricacin del papel. All se las introduce con
agua en una mquina llamada hidrodesbradora o hidropulpar obtenindose una suspensin
acuosa homognea.
Segn la calidad de papel que se desee obtener, se procede a su renado para hacerla
ms exible, siendo durante este proceso donde pueden agregarse distintas sustancias para
mejorar la calidad y modicar el aspecto del papel. De este proceso depender su lisura,
color, resistencia, etc.
La pasta as mejorada pasa a una mquina continua donde uye en un altsimo por-
centaje de agua (entre un 60 y un 90 por ciento), siendo posteriormente depositada en una
tela metlica sinfn de reticulado muy no que permite el drenaje por succin, convirtiendo
a la pasta en una membrana hmeda.
275
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Esa membrana es prensada por distintos tipos de rodillos -algunos de ellos calentados
al vapor- que la aplastan y reducen su humedad a un cinco por ciento, para luego ser sometida
a otros rodillos secadores ms pesados que la aplanan, alisan y la convierten en hojas de papel
que, luego de su secado nal, es enrollado en bobinas.
Durante su recorrido por esta mquina continua y cuando el papel an est mojado, se
pueden incorporar distintas medidas de seguridad -que veremos a continuacin- o se lo puede
someter a diferentes procesos: para darle rugosidad por raspado de cuchilla luego de pasar
por los rodillos, obtenindose as el papel tis; o al relleno de las pequeas irregularidades que
puedan presentar por los variados tamaos de las bras de la madera, mediante el agregado de
una mezcla de materiales arcillosos, adhesivos, colorantes, etc., que producen el revestimiento
del papel de imprenta no destinado a la escritura; o por medio de un rodillo de acero pulido
calentado al vapor proceder a su abrillantado o satinado; etc.
Dentro de los distintos tipos de calidades fsicas que pueden determinarse sobre el
papel se mencionarn entre muchas, las siguientes: a) Gramaje; b) Resistencia a la traccin;
c) Opacidad o transparencia; d) Espesor; e) Permeabilidad; f) pH; g) Lisura h) Fluores-
cencia; i) Resistencia al doble plegado; y j) Compresibilidad.
Gramaje: esta cualidad se expresa en gramos sobre metro cuadrado y es usado en toda operacin
comercial.
Resistencia a la traccin: se mide en los metros de papel necesarios para que por el esfuerzo
de la traccin o estiramiento, se produzca la rotura por efecto de su propio peso.
Opacidad o transparencia: esta cualidad reere al resultado de la medicin fotomtrica de la
cantidad de luz que pasa a travs de las bras del papel.
Espesor: por ser el papel un cuerpo slido, se determina su grosor, anchura, corpulencia o
carcter macizo por valores comparativos en toda su extensin.
Permeabilidad: es la capacidad de ser penetrado por un medio lquido como ser las diferentes
calidades de tinta.
pH: es la abreviatura de potencial Hidrgeno e indica el coeciente que caracteriza el grado de acidez
de un medio. Su nmero indica el logaritmo inverso de la concentracin de iones H. Si este nmero
es 7 su valor es neutro, de ste hacia abajo ser cido y de ste para arriba ser alcalino o base. El
control del pH en el papel permite su sensibilizado al ataque de sustancias qumicas.
Lisura: es la calidad de acabado supercial del papel, acorde a los diferentes procesos de impresin
a los que estn destinados.
Fluorescencia: es la respuesta luminosa que presentan algunos cuerpos o sustancias cuando
reciben la accin de ciertas longitudes de ondas lumnicas. El uso de radiaciones ultravioletas
276
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
permite diferenciar composiciones blanqueadas o no blanqueadas y la presencia de otros
elementos que posean esta propiedad.
Resistencia al doble plegado: es el nmero de veces que puede ser doblado un papel, antes de
su rotura por causa de esos dobleces.
Compresibilidad: es la disminucin del espesor que se produce sobre el papel cuando sobre
l se ejerce una fuerza perpendicular a su supercie.
Dentro de las medidas de seguridad que pueden incorporarse al papel en el
momento de su fabricacin se describirn las siguientes: a) Filigrana o marca de agua;
b) Fibras de seguridad; c) Confetis o letenjuelas de seguridad; d) Hilos o bandas de se-
guridad; e) Fluorescencia; y f) Sensibilizado.
Filigrana o marca de Agua: se realiza durante el proceso de fabricacin del papel mientras
se encuentra en la mquina continua y antes de su secado. La presin ejercida por las matri-
ces de las mquinas fourdinier o las de bombo, producen distintos grados de debilitamientos
por agrupacin o separacin de bras, originando claroscuros que facilitan o dicultan el
paso de la luz y, por contraste, determinan guras, letras, logos, dibujos, etc.
El uso de una u otra de las mquinas detalladas permite su confeccin en forma
localizada es decir en un sector predeterminado del papel- o bien repartida dispuesta
en toda su supercie-. La ausencia o el reconocimiento del tipo de ligrana produce cuatro
tipos genricos de papel, a saber: a) papel comn; b) papel con certicacin de origen;
c) papel de emisin controlada; y d) papel de emisin registrada.
a) Papel comn: este tipo de papel no posee ligrana y acorde a la fuente de materia
prima utilizada y a las sustancias y pasos de rodillos utilizados durante el proceso
de fabricacin determinan diferentes calidades, pudindose citar entre ellas: el de
envolver en todas sus variantes; el de escrituras comunes tanto manuscritas como
mecnicas; los higinicos; los de uso escolar tipo calcar, glac, cartulinas; etc.
b) Papel con certicacin de origen: posee ligranas que identican al fabricante del papel y
segn su destino pueden ser de variadas calidades, no existiendo ningn tipo de regulacin
para su adquisicin y/o utilizacin.
c) Papel de emisin controlada: posee ligranas que identican al impresor, siendo ste respon-
sable de la utilizacin del mismo y puede destinarse a diferentes productos o emisiones.
d) Papel de emisin registrada: posee ligranas especiales, exclusivas y registradas del emisor
y es suya la responsabilidad de fabricacin y emisin, ya que dicho papel esta destinado
exclusivamente para sus productos.
277
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Este tipo de papel posee regulaciones para su adquisicin tanto en la faz legal como para
su comercializacin. Su importacin est regulada por la Ley 19.174 que establece en su artculo
1que toda operacin debe contar con la autorizacin previa de la Casa de la Moneda.
Las ligranas se imitan por estampado con sustancias oleosas o por impresin en una
capa central de papel delgado, sobre la que se adhieren por arriba y abajo otras dos capas de
papel. Se distinguen de las autnticas por observarse ms de un lado que del otro lado del
estampe- o por su falta de calidad y nitidez.
Fibras de seguridad: son hilos de material sinttico -generalmente nylon- y de un tamao
aproximado de 5 milmetros de largo. Pueden tener diferentes colores y ser visibles a
simple vista o invisibles, es decir que slo ser posible visualizarlos al exponerlos a una
radiacin ultravioleta.
Se adicionan a la pasta en el momento de su fabricacin y su distribucin puede ser
localizada u homognea en toda su supercie. Se los imita mediante la impresin de lneas
de colores visibles o invisibles a simple vista o por pegado de bras con sustancias adhesivas
sobre el papel. Se distinguen de las autnticas porque las primeras estn dentro de la masa del
papel y las falsas o estn impresas o estn adheridas sobre el papel.
Confetis o lentejuelas de seguridad: son pequeos crculos de papel de aproximadamente
un milmetro de dimetro, pueden ser de diversos colores, visibles, invisibles y estar dis-
tribuidos en forma localizada u homognea.
Hilos o bandas de seguridad: pueden ser de diferentes materiales metlicos, plsticos,
sintticos, papel, etc.-, de diversos colores, uorescentes, sin o con microimpesiones
entre dos capas de material celulsico, con seales morse, con leyendas, total o entre-
cruzadamente incorporados a la masa del papel, etc.
Estas dos ltimas medidas de seguridad se imitan y se distinguen de manera semejante
a las detalladas para las bras de seguridad.
Fluorescencia: esta capacidad lumnica es de carcter neutro en los papeles de seguri-
dad para no producir enmascaramientos, permitiendo la visualizacin de tintas u otros
elementos uorescentes impresos o incorporados al papel.
Sensibilizado: Mediante el control y manejo del potencial Hidrgeno (pH) se sensibiliza el
papel para que reaccione en forma notoria a travs de manchas, cuando ste es atacado
con reactivos especiales. Estos reactivos son normalmente utilizados para la erradicacin
fraudulenta de constancias escritas en los documentos y la maniobra queda delatada por
las manchas que ocasiona la accin de esas sustancias ante el sensibilizado del papel.
278
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Detalladas las principales medidas de seguridad que se incorporan al papel en el mo-
mento de su fabricacin, se hace necesario ahora detallar las principales tintas de seguridad
o no utilizadas en este tipo de documentacin. Entre ellas sealaremos: a) tintas fugitivas;
b) tintas de variacin cromticas; c) tintas electrostticas; d) tintas magnticas; e) tintas
invisibles o simpticas; f) tintas termosensibles; g) tintas antifotogrcas o antirex; h)
tintas fotocromticas e i) tintas reactivas al agua.
Tintas fugitivas: son tintas sensibilizadas al agua, alcohol y a otros reactivos qumicos y
procesos fsicos, de manera tal que al entrar en contacto con ellos desaparecen, sufren
deformaciones, manchas o ligeras uorescencias. Se utilizan normalmente en fondos de
seguridad y es una importante medida contra las adulteraciones de los documentos, ya que
al intentar eliminar alguna constancia por cualquier medio, se destruyen o desaparecen las
impresiones realizadas con ellas poniendo en evidencia la maniobra.
Tintas de variacin cromtica u O.V.I.: son tintas que poseen microcomponentes qumicos
que cambian de color segn el ngulo de incidencia de la luz de all su denominacin o.v.i.
resultante de las iniciales de optical variation ink o tintas de variacin pticas. Para su
determinacin se debe inclinar suavemente los sectores impresos con este tipo de tintas.
Constituyen una excelente medida contra la falsicacin, ya que no pueden ser copiadas
por escner o fotocopiado.
Tintas electrostticas: son tintas que poseen cargas u iones elctricos como ser el tner- y
ya fueron detalladas cuando se describieron las fotocopiadoras. Se utilizan en un documento
para la incorporacin de los datos variables, como ser: los de liacin, reproduccin de foto-
grafas, de impresiones digitales y numeraciones o datos en general que lo particularizan. Si
bien son tintas de fcil erradicacin por borrado o raspado, su uso se ha generalizado por
las bondades que brinda su sistema de aplicacin a travs de impresoras lser.
Tintas magnticas: son tintas que poseen en suspensin material magnetizable partculas
o limaduras de hierro- que son detectadas por lectores automticos que reaccionan en su
presencia. Se utilizan, por ejemplo, para la confeccin del cdigo magntico al pie de los
cheques. Son tintas que brindan proteccin contra las falsicaciones y las adulteraciones.
Tintas invisibles o simpticas: son tintas que no pueden visualizarse a simple vista y que
requieren para su lectura un agente revelador. Ejemplos de estos agentes son la luz ul-
travioleta, los rayos infrarrojos y los X, vapores de yodo, calor, etc. Con ellas se efectan
escrituras o cubiertas de sectores predeterminados o textos de los documentos. Estas
tintas tambin dicultan las falsicaciones y las adulteraciones.
Tintas termosensibles: son tintas que tienen la propiedad de virar de color o desapa-
recer, cuando son sometidas a temperaturas variables como por ejemplo el calor de la
279
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
piel humana. Desaparecido el estmulo vuelven a recuperar su color o estado. Son tintas
que protegen contra la falsicacin al favorecer el reconocimiento de los documentos
que las utilizan.
Tintas antifotogrcas o antireex: son tintas que dicultan su captacin por medios fotogr-
cos, lo que convierte su utilizacin en un medio importante contra las falsicaciones, al no
poder lograrse la base negativa para la obtencin de una plancha de impresin.
Tintas fotocromticas: son tintas que poseen un componente que reacciona frente a una
fuente lumnica ultravioleta o similar, cambiando de color por excitacin fotocromtica.
Quitado el estmulo, recupera gradual y espontneamente su color original.
Tintas reactivas al agua: son tintas de impresin de color negro que al entrar en con-
tacto con el agua, cambian su tonalidad al azul, rojo o amarillo. Son tintas que brindan
una adecuada proteccin contra las adulteraciones.
Existen en la actualidad, una variada gama de mtodos grcos posibles que se
encuentran a disposicin relativamente fcil de los falsarios, logrando as sorprender a
los desprevenidos con los efectos visuales de autenticidad que producen. Por ello es que
ahora resulta extremadamente importante conocer los principales sistemas de impre-
sin utilizados en la confeccin de documentos de seguridad, para adquirir las bases de
compresin y reconocimiento de los mismos. Entre ellos se mencionarn por sus par-
ticulares caractersticas, los siguientes: a) sistema offset o plano; b) sistema tipogrco;
c) sistema calcogrco; y d) sistema computacional.
Sistema Offset o plano: su nombre deriva del trmino ingls offsetting con el que se
designa el transporte o medio que transere la imagen de la plancha al papel dando la
idea de calco y reporte y el sistema en s deriva de un procedimiento anterior denominado
Litografa, del griego litos igual a piedra.
La litografa fue incorporada en 1798 por Aloys Senefelder quin determin que la pie-
dra caliza tratada con procesos fsicos y qumicos formaba dos tipos de zonas, una hidrfoba
que rechaza el agua y acepta la tinta- y otra hidrfuga que acepta el agua y rechaza la tinta,
circunstancia sta que la haca til como placa impresora.
El procedimiento que empleaba era el de estampar sobre esa piedra debidamente
tratada, la imagen a reproducir por medio de un material graso hidrfobo. Luego humedeca
toda la supercie con agua -la que era rechazada en todos los sectores donde se encontraba
la imagen- y posteriormente aplicaba las tintas que no eran absorbidas en las zonas hme-
das-, obteniendo una imagen entintada que luego por presin, era transferida al papel.
280
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
En el sistema offset se reemplaza la piedra caliza por planchas o delgadas hojas de
cinc, aluminio o bimetlicas presensibilizadas, sobre las que se estampa en forma invertida o
en espejo la imagen a reproducir por medio de una placa obtenida por reproduccin fotogrca
del original y la accin de procesos qumicos, las que luego se ajustan a la mquina impresora
alrededor de un cilindro portaplancha.
En este sistema la impresin es indirecta ya que la plancha no entra en contacto con el
papel, sino que la imagen entintada se traslada a una mantilla o rodillo de caucho que la calca
y la transere luego al soporte preseleccionado. Como consecuencia las reas impresas y las
no impresas se hallan en un mismo plano y de all su otra denominacin.
Si bien existen diversas calidades de impresin, este es el sistema que se utiliza en
forma nica en la mayora de los impresos sobre cualquier tipo de soporte que lo admita. Hoy
resulta muy econmico y fcil de utilizar, por lo que se encuentra al alcance de todos los que
lo requieran, incluso los falsicadores.
Brinda especialmente ventajas en impresiones donde haya combinacin de textos e
imgenes en uno o varios colores. Las planchas son durables y fciles de almacenar lo que
ofrece economa en trabajos que se deban repetir.
Sistema tipogrco: de este sistema se ha hecho referencia en la unidad anterior, por lo
que slo se reiterar que, debido a la presin que ejercen los tipos sobre el soporte, se de-
terminan sobre l bajorrelieves, depresiones o indentaciones que lo hacen reconocible.
Este sistema resulta particularmente apto en operaciones de numeracin, donde
no haya combinaciones de colores o ilustraciones que requieran de una alta calidad.
Sistema calcogrco: en sus orgenes este sistema de huecograbado utilizaba planchas de
cobre grabadas -lo que dio origen a su nombre: chalcs del griego cobre. Actualmente el
grabado se efecta a buril sobre una planchuela de acero que luego es atacada por cidos,
circunstancia que permite obtener diferentes profundidades de grabado. Luego de obtenida
la plancha grabada, por diversos procesos galvnicos se obtiene la matriz.
Aunque el proceso es un poco ms complejo que lo narrado, basta comprender que la
matriz es el negativo de la imagen a imprimir y est conformada por surcos de profundidades
variables donde se deposita la tinta, la que luego es transferida por presin al papel quedando
depositada sobre l y provocando sobrerrelieves sensibles al tacto.
281
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Su principal desventaja es el costo por la tecnologa y mano de obra requerida, por lo
que su uso se justica en casos de largos tirajes o en impresos de alta calidad y seguridad.
Sistema computacional: Sobre la forma de produccin de las impresiones con este sistema
ya se ha hecho referencia en la unidad anterior y al hablar sobre tintas electrostticas. Se
utiliza este sistema para imprimir en los cheques todos los datos variables es decir los
siguientes: nombre y direccin de la sucursal bancaria; nmero de cheque; cdigos de
ruta; nmero, nombre, direccin y datos de registro impositivo de los titulares y el cdigo
magntico caracteres siete bastones C.M.C.7-.
Enumerados los principales tipos de papeles, tintas y sistemas de impresin utilizados
en la confeccin de documentos de seguridad, se hace necesario ahora detallar las medidas
de seguridad de impresin que pueden realizarse en los mismos. De ellas mencionar-
emos: a) fondos de seguridad; b) microletras o microcalcos; c) imagen latente; d) registro
perfecto o impresin simultn; e) impresiones invisibles; f) impresiones citocromticas; g)
holografas; h) plaquetas de seguridad; i) lm de seguridad; j) botones de seguridad; k)
grabado en seco; l) perforaciones; m) cdigos de barra; n) ornamentaciones; ) patrones
geomtricos; o) laminados; p) imagen retrorreexiva; q) indicia confusa; r) encuadernacin
o costura; s) caracteres magnticos; y t) banda iridiscente.
Fondos de seguridad: es la impresin de un diseo elegido por esttica grca que a
modo de subtinte se realiza sobre el papel destinado a ser un documento de seguridad.
El motivo y los colores seleccionados permiten adems identicar al documento ejemplo
Cdula de Identicacin del Automotor que por color del fondo de seguridad o impresin
es conocida vulgarmente como la Cdula Verde del Automotor.
Esta impresin se realiza con tintas fugitivas en aquellos documentos susceptibles
de ser adulterados, los que ante cualquier maniobra de erradicacin de constancias hacen
que estas desaparezcan o degraden. La complejidad, dibujos y o colores utilizados en este
tipo de impresiones y las tintas utilizadas para ello, lo convierte en una muy buena medida
de seguridad contra las falsicaciones y las adulteraciones.
Microletras o microcalcos: son letras sumamente pequeas que no pueden ser visualizadas
a simple vista debindose recurrir para ello a un instrumental ptico adecuado como ser
una lupa. Con este tipo de letra se reproduce sin solucin de continuidad una leyenda o el
nombre de una entidad o institucin, como por ejemplo policafederalargentinapolicafed-
eralargentinapolic. Como no es posible descifrarlas a simple vista aparentan ser una na
lnea impresa a modo de rengln que, en lugares seleccionados estratgicamente -como ser
donde se detalla el importe en nmero y letras y el destinatario en un cheque- actan como
medida de seguridad contra las falsicaciones y las adulteraciones.
282
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Su implementacin requiere de una adecuada capacidad y tecnologa lo que diculta
su reproduccin- no siendo posible su fotocopiado, escaneado o reinsertado, sufriendo de-
terioros imposibles de reparar en caso de ser borradas al tratar de eliminar constancias para
sustituirlas por otras.
Si el sistema utilizado para su impresin es offset, se denominarn microletras, si el
sistema utilizado es el calcogrco se las denomina microcalco, pero una u otra denominacin
indica la misma medida de seguridad.
Imagen latente: son imgenes impresas que para su visualizacin requieren ser reveladas.
Estn conformadas por lneas horizontales y verticales que conforman unas, las letras, guras,
logotipos, etc, que se desee realizar y las otras el marco o caja contenedora. Se revelan acorde
al ngulo de incidencia de la luz que, al chocar contra las lneas dispuestas en una forma las de-
stacan y permiten verlas y por oposicin se revelan las lneas dispuestas de la otra manera.
Se realizan con sistema calcogrco no pudindose ser imitada con sistemas planos
ni por fotocopiado, por lo que constituyen una buena medida contra las falsicaciones.
Registro perfecto o impresin simultn: son dos imgenes complementarias que se realizan en
forma simultnea en el anverso y el reverso del documento de all una de sus denominaciones-
que se corresponden perfectamente al ser observadas por transparencia. Su implementacin
requiere de mquinas especiales. Los falsarios imprimen por separado una y otra cara del
documento, no logrndose as perfecta complementacin o alineo de imgenes por lo que
se pone en evidencia la maniobra. Es una excelente medida contra las falsicaciones.
Impresiones invisibles: son impresiones realizadas con sistema offset y tintas simpticas que
no pueden ser visualizadas a simple vista. Para su revelado requieren longitudes de ondas
determinadas normalmente ultravioletas- o calor. Pueden reproducir imgenes, leyendas,
dibujos, logotipos, etc. Es una medida contra las falsicaciones al constituir un mtodo de
reconocimiento de un documento.
Impresiones citocromticas: son impresiones realizadas en un solo proceso y con diversos colores
que no presentan una denida separacin ya que fueron fusionados gradualmente unos con otros.
Su confeccin requiere de tecnologa adecuada siendo una medida contra la falsicacin.
Holografas: son imgenes tridimensionales que brindan espectacular colorido y profundi-
dad, produciendo, acorde al ngulo de incidencia de la luz, sensaciones de movimientos
o cambios de color. Conforme a su destino, se las efecta con estampado en color con
sistema de registro lser o con autoadhesivos. Para lograr su impresin se divide un rayo de
luz lser en dos haces. El primero se reeja sobre el objeto en una toma fotogrca espe-
cial. Esa placa es luego iluminada directamente por la otra luz lser. Ambas luces brillantes
interactan reejadas y direccionadas sobre una supercie plana formando el holograma.
283
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Debe distinguirse esta medida de otra denominada smil holograma, que es una
novedosa creacin de efectos especiales o pigmentados con la cual se reproducen textos,
logotipos o rosetas de autenticidad en color plata o transparente. Ambas son irreproducibles
por fotocopiado color o por escner, lo que las convierten en buenas medidas de seguridad
contra las falsicaciones.
Plaquetas de seguridad: es una impresin con tintas invisibles de color rojo que se obser-
van bajo la accin de luz ultravioleta que protegen los datos variables y con otros colores
todas aquellas zonas susceptibles de ser adulteradas. En caso de efectuarse una manio-
bra de borrado o por cualquier tipo de abrasin sobre esos datos o zona, esta cobertura
tambin se erradica poniendo en evidencia la maniobra al provocar manchas.
Film de seguridad: son lmes o nas pelculas transparentes de aplicacin trmica sobre
los datos que se pretende resguardar contra las adulteraciones, cumpliendo similar pro-
teccin que las plaquetas ya descriptas. Un procedimiento casero es el empleo de cintas
transparentes autoadhesivas. Una vez adheridos sobre el papel no es posible despegarlas
ni su repegado sin que la maniobra sea fcilmente detectable.
Este lm puede contener, adems, imgenes impresas o imgenes retroexivas con
microesferas que permiten ser visualizadas segn los ngulos de incidencia de la luz.
Botones de seguridad: son accesorios metlicos que pueden contener o no marcas,
logotipos, siglas o leyendas estampadas sobre ellos y tienen como funcin asegurar
elementos agregados a un documento como por ejemplo, una fotografa. Estos botones
una vez hermanados no se pueden volver a abrir y su extraccin implica la rotura del
soporte donde se encuentran adheridos.
Grabado en seco: son impresiones a modo de estampado sin tinta que pueden reproducir
leyendas, iniciales, escudos, etc. Producen desnivelado del papel por compresin de
bras y es una medida contra la falsicacin.
Perforaciones: se realiza a travs del empleo de punzones o agujas que en un solo paso,
perforan el soporte del documento reproduciendo nmeros, leyendas, etc. Es una me-
dida de fcil aplicacin y econmica. Su principal contra es que si las perforaciones son
grandes suelen romper el soporte y si son muy pequeas pueden adulterarse por pegado
y posterior perforacin.
Cdigos de barra: son cdigos que utilizan combinacin de lneas verticales, con varia-
ciones de grosor, altura, espaciado, colores, etc. y que adems se complementan con
dgitos, letras o signos. Actualmente se le incorporan distintos tipos de tintas, cdigos
morse, rastreadores, etc. Las impresoras utilizadas para su realizacin al dividir cada barra
en pxeles, le asigna a este cdigo una casi innita posibilidad de combinaciones.
284
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
La lectura de sus datos puede efectuarse por lectores lumnicos de contacto o aproxi-
macin lectores en supermercados- o a distancia telepeajes. Su utilizacin es sencilla y
econmica y permite un importante nmero de usos.
Ornamentaciones: son tambin denominados guilloches y son imgenes decorativas
compuestas por un conjunto de lneas nas curvas, prximas y entrelazadas que detallan
o denen los dibujos reproducidos. Es una importante medida de seguridad contra las
falsicaciones ya que el sistema de impresin requerido es de alta calidad y los falsarios
al utilizar el offset empastan, unen o pierden estas nas lneas, obteniendo impresiones
de baja calidad.
Patrones geomtricos: se utilizan normalmente como guras del fondo de seguridad ya
tratado y se trata de una serie de formas recurrentes de neto corte geomtrico. Acorde a
su calidad de impresin representa una medida de seguridad contra las falsicaciones.
Laminados: son coberturas de un material sinttico y transparente conformado en forma
de lminas u hojas que se adhieren normalmente con adhesivos o por termofusin - que
protegen las hojas, rmas o datos de un documento contra las adulteraciones. Tambin
pueden tener imgenes o impresiones retroexivas.
Imagen retrorreexiva: son imgenes invisibles incorporadas en algunos tipos de soportes
y requieren para su visualizacin el uso de visores retrorreexios. Es una importante me-
dida contra la falsicacin.
Indicia confusa: son imgenes visibles que, como su nombre lo indica, fueron realizadas
con impresin confusa y que para poder ser visualizadas requieren de un visor especial
que altere la trayectoria o paso de la luz. Debe usarse tecnologa especial para su incor-
poracin en un documento, siendo una medida contra la falsicacin.
Encuadernacin o costura: la realizacin de la encuadernacin o armado a travs de cos-
tura de un documento compuesto por varias fojas, constituye un elemento de seguridad
ya que disminuye los riesgos de desarmado, sustitucin y rearmado. Para esta tarea se
utilizan hilos de costura especiales que reaccionan a la luz ultravioleta y que no deben
dejarse muy ojos. Su reconocimiento a simple vista o bajo la luz ultravioleta los convierten
en una medida de seguridad contra las falsicaciones y las adulteraciones.
Caracteres magnticos: estos pueden hacerse por impacto o por sistema lser y con
tintas magnticas. Se utilizan entre otros documentos, en los cheques para el cdigo
denominado Caracteres Magnticos Codicado 7 bastones -C.M.C.7-, compuesto por
siete lneas verticales o bastones separadas entre s por seis intervalos cortos y largos,
es decir ms juntos o ms distantes, diseados de manera tal que el conjunto congura
la forma de un carcter convencional.
285
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
La combinacin de los intervalos largos y cortos permiten la determinacin del
cdigo que consta de diez caracteres numricos y cinco smbolos que resultan de la
combinacin de dos intervalos largos y cuatro cortos.
La combinacin de uno o tres intervalos largos con cinco o tres intervalos
cortos permiten construir las veintisis letras del alfabeto. Ver la familia completa en
el cuadro siguiente:
Banda iridiscente: es la impresin de una banda que bajo la accin de una fuerte luminosidad adqui-
ere un brillo caracterstico y cambia ligeramente de color. Es una medida contra la falsicacin.
La combinacin de estas medidas de seguridad incorporadas al papel, en las tintas,
en la interaccin de los distintos sistemas de impresin y las medidas incorporadas al docu-
mento, brindan a ste proteccin contra las falsicaciones y las adulteraciones. Su eleccin
y cantidad depender del tipo de documento y del costo que se destine a su confeccin.
El conocimiento de las mismas y su reconocimiento cuando se los aplica en los distintos
documentos de seguridad que se deban manejar acorde a los diferentes ejercicios profesio-
nales, es la nica manera infalible de no ser perjudicado por el accionar de una delincuencia
cada vez ms organizada y con ms medios tecnolgicos a su disposicin. Recordar que
no existe, pese a las propagandas comerciales, ningn producto en el mercado que pueda
detectar falsicaciones o adulteraciones documentales. El mejor detector es el ojo humano
al reconocer las medidas utilizadas.
286
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
En el ejercicio profesional de un escribano, por ejemplo, no slo debe dar fe del acto
realizado, sino tambin de las personas que forman parte del mismo en la frmula persona de
mi conocimiento doy fe. La globalizacin hace imposible conocer a todas las personas con las
que debe intervenir, por lo que debe conocerlas a travs de su documento de identidad.
La nica posibilidad cierta de estar frente a un documento autntico es cuando se
tiene una pericia comparativa y el informe del organismo que lo expidi, ya que de esa
manera se asegura tanto la autenticidad material como la ideolgica. Como es lgico
deducir no resultara prctico, rpido, fcil, ni econmico cumplir estos requisitos en cada
actuacin. Por ello se hace necesario el conocer y reconocer estas medidas de seguridad y
determinarlas en los documentos presentados. El reconocimiento de varias de ellas brinda
la suciente seguridad como para un tranquilizador ejercicio profesional.
Se detallar a continuacin la aplicacin de estas medidas de seguridad en los
siguientes documentos:
a) pasaporte argentino;
b) chapa patente de identicacin del automotor y
c) tarjetas de crdito.
PASAPORTE ARGENTINO
Para la confeccin de este tipo de documento, cada pas impone y adopta sus
propias normas en lo relativo al formato, diseo y modo de incorporacin de los datos de
su titular. En nuestro pas la tarea de Identicacin, Registro y Clasicacin del Potencial
Humano, fue asignada al Registro Nacional de las Personas por las Leyes 17.671 y 20.974,
que disponen adems que es el organismo encargado de la expedicin de documentos,
certicados e informes. Sin embargo las funciones de emisin de documentos de viajes
(pasaportes) y cdulas de identidad fueron atribuidas a la Polica Federal Argentina a travs
del Decreto 2015 del ao 1966.
Acorde a las variables exigencias globales, necesidades y nuevas tecnologas, los
formatos y contenidos de los pasaportes fueron cambiando y modernizndose en todos
los pases, incorporndose por decisin de la Organizacin Internacional de Aviacin Civil
(O.A.C.I.) en muchos de ellos un sistema de lectura mecnica de datos, lo que permite en
forma inmediata cotejarlos con los bancos de informacin.
287
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Las avanzadas metodologas de falsicacin y adulteracin que brindan los es-
peciales aprovechamientos dolosos de altas tecnologas, derivaron en la necesidad de
reestructurar estos documentos. La informacin aportada por la O.A.C.I., por empresas
lderes en el plano nacional e internacional dedicadas a la produccin de documentos de
seguridad, las reuniones y congresos llevados a cabo por Interpol y los conocimientos y
experiencias criminalsticas dieron origen al nuevo pasaporte argentino, que presenta la
incorporacin de las siguientes medidas de seguridad:
Papel: de seguridad de emisin controlada, de alta resistencia y uorescencia neutra.
Hilo o banda de seguridad: dispuesta en forma vertical conteniendo en su interior en
microimpresin el texto Repblica Argentina Pasaporte.
Fibrillas de seguridad: fluorescentes con la aplicacin de luz ultravioleta en colores amarillo
y azul.
Filigrana: multitonal centralizada en cada una de sus fojas que ofrece con excelente
denicin la visin por transparencia del Escudo de la Polica Federal Argentina.
Ver en ilustracin siguiente un ejemplo de la ligrana utilizada en el documento
que se est describiendo:
Fondo de seguridad: todas las hojas poseen fondos de seguridad realizados con tintas
fugitivas que brindan proteccin contra las adulteraciones.
Fondo Irisado: las impresiones del fondo de seguridad contienen delgadas lneas que confor-
man las palabras REPUBLICA ARGENTINA separadas entre s por dos soles situados a los REPUBLICA ARGENTINA REPUBLICA ARGENTINA
laterales de una formacin geomtrica. El color azul de los laterales vara progresivamente
hacia el centro donde predomina el color rosa. Es una medida contra las falsicaciones y
las adulteraciones. En la gura siguiente se pueden observar estas dos ltimas medidas.
288
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Impresin Offset: las caras internas de la tapa y contratapa presentan impresiones pla-
nas bicolor que alternadamente, en forma expansiva y comprimida con efecto ondulado,
reproducen las palabras REPUBLICA ARGENTINA
Impresiones Calcogrcas: o en relieve, en guilloches u ornamentaciones dispuestas en
espacios no destinados a escrituras.
Microcalco: la lnea interior del marco del dibujo de la cara interna de la tapa y la lnea
que subraya la palabra MERCOSUR en la foja tres, estn conformadas por la repeticin
sin solucin de continuidad de la leyenda REPUBLICAARGENTINAREP
Ver en ilustraciones siguientes ejemplos de esta medida de seguridad.
Imagen Latente: en la franja ancha con soles de la cara interna de la tapa y en las guras
azules en la parte superior en el anverso en la primera mitad y en el reverso en la segunda
mitad, se encuentra esta medida que permite visualizar segn el ngulo de incidencia de
la luz la palabra REPUBLICA ARGENTIA y la sigla REPUBLICA ARGENTIA REPUBLICA ARGENTIA RA respectivamente. Es una medida RA RA
contra las falsicaciones. Ver ejemplos de esta medida.
289
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)

Tintas O.V.I.: en las mismas fojas donde se encuentra la imagen latente, en forma central
y por encima del nmero indicador de pgina, se ha estampado con tintas de variacin
cromtica una gura que, acorde el ngulo de incidencia de la luz y de la posicin del
observador, cambian de un azul a dorado y de un verde a violeta. Es una excelente me-
dida contra las falsicaciones. Ver la siguiente ilustracin.
Registro Perfecto: prximas a estas impresiones O.V.I., a igual nivel pero sobre el extremo
externo de las hojas, se han impreso con sistema offset de alta denicin dos impresiones
simultneas en anverso y reverso que se complementan perfectamente al ser observadas
por transparencia. La gura siguiente muestra las dos imgenes perfectamente comple-
mentadas de esta medida de seguridad contra las falsicaciones.
Diseo Fotocromtico: en el lado opuesto de estas impresiones O.V.I. en el mismo nivel y prximas
a la costura, se han estampado guras con tintas fotocromticas que con luz blanca se visualizan
en color rosa y con luz ultravioleta en color azul, lo que constituye una excelente medida contra las
falsicaciones. En la siguiente ilustracin pueden observarse el diseo con ambas coloraciones.
290
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Impresiones Invisibles: con tintas invisibles que pueden ser visualizadas con luz ultravio-
leta se han estampado con una misma tonalidad uorescente la leyenda en dos lneas
REPUBLICA ARGENTINA en la parte superior de la foja y en su parte inferior el nmero REPUBLICA ARGENTINA REPUBLICA ARGENTINA
correspondiente a la pgina y la palabra PASAPORTE y con otra tonalidad uorescente PASAPORTE PASAPORTE
entre ambas leyendas, dos lneas de escudos nacionales.
Hilo de seguridad: la costura de armado del pasaporte fue realizada con hilo de seguridad
que con luz normal se visualiza blanco y con luz ultravioleta en color rojo.
En la siguiente ilustracin pueden observarse parciales de estas dos ltimas
medidas contra las falsicaciones descriptas.
Impresin Lser: los datos que individualizan al titular, su imagen, impresin digital y rma
son digitalizadas y transferidas al pasaporte por sistema lser.
Codicacin de datos: los datos mencionados precedentemente son codicados al pie de
la pgina lo que permite su lectura inmediata facilitando las tramitaciones migratorias.
Laminado de pgina 3: esta pgina que contiene los datos del titular del documento -
incorporados por sistema lser- se encuentra protegida contra las adulteraciones y las
falsicaciones por un laminado de caractersticas especiales. Al ser iluminado con una
lmpara retrorreectiva el lm permite visualizar en toda su supercie y dispuestos en forma
lineal, el escudo o emblema de la Polica Federal Argentina y las iniciales PFA encerrada PFA PFA
dentro de crculos. Obsrvese en ilustracin siguiente la imagen retroreexiva
291
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Laminado de pgina 4: esta pgina que tambin contiene datos del titular en blanco y
negro se encuentra protegida por un lm con hologramas que representan el emblema
de la Polica Federal Argentina. Si al documento se le realiza un movimiento se podr
captar el efecto tridimensional del diseo con cambios de color.
Estos laminados son protecciones contra las falsicaciones ya que los mismos
no pueden ser adquiridos por terceros, ni imitados; y lo son contra las adulteraciones
porque no es posible su despegado y repegado. Ver reproduccin de la ltima medida
descripta en la gura siguiente.
Perforado: las fojas del pasaporte presentan con perforado la numeracin correspondiente
al documento.
292
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
CHAPA PATENTE DE IDENTIFICACIN DEL AUTOMOTOR
Dentro de los delitos contra la propiedad un alto ndice lo ocupa la indebida apropi-
acin de automotores, la que a su vez da lugar a una multiplicidad de otros ilcitos conexos
como ser, la duplicacin de vehculos y la falsicacin y adulteracin de los documentos que
hacen a su titularidad, circunstancia que se vea favorecida por la indiscriminada produccin
de chapas patentes y por la vulnerabilidad de los documentos.
En el nuevo sistema de identicacin del parque automotor que hoy rige, se ha con-
siderado no slo la inclusin de medidas de seguridad en las documentaciones propiamente
dichas sino tambin en las chapas patentes, logrndose as una mancomunada relacin
entre el vehculo y su identicacin.
Se han incorporado a las patentes estrictas normas y stas slo pueden ser entrega-
das por el Registro Nacional de la Propiedad del Automotor. Estas patentes son reectivas
con marca de seguridad y poseen los siguientes resguardos:
Composicin: son de aluminio aleacin 1100, anticorrosivas y poseen especiales
caractersticas de temple, resistencia y elongacin que las hacen ms durables.
Pintura: al thiner color negro mate desarrollada especialmente para las patentes ya
que deben ser compatibles con las lminas reexivas protectoras que las recubren.
Formato y Caractersticas: poseen cdigos de seguridad e impresin grca con el
Escudo Nacional y la leyenda ARGENTINA. El cdigo est conformado por tres
letras y tres dgitos, habiendo comenzado con AAA 000 en los vehculos de primer
patentamiento y con RAA 000 para los repatentados.
Estos seis caracteres indicadores estn en el mismo plano supercial de la plancha.
El efecto tridimensional en sentido contrario que en las placas anteriores se logra produci-
endo relieve slo en el sector que luego ser pintado con negro.
En caso de prdida, robo o destruccin de las placas originales el Registro proveer
de otras incluyendo una letra ms pequea en el espacio existente entre el indicativo alfa y
el numrico, que simbolizar la inicial de repeticin: D = duplicado; T = triplicado, etc.
En la gura siguiente se puede apreciar el formato de una chapa patente.
293
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Lmina reectiva autoadhesiva: Esta lmina cubre el sustrato metlico adhirindose
por termoimpresin, es decir con una combinacin de calor e impresin que las ja en
forma permanente. Ante cualquier intento de remocin se destruye anulando el elemento
y evitando su reutilizacin.
Esta lmina est compuesta por elementos pticos que combinan ndices de re-
fraccin que pueden visualizarse desde un adecuado ngulo de observacin. Teniendo en
cuenta la altura del vehculo y del observador se debe conformar un ngulo de 30 grados
con respecto de la perpendicular y con una iluminacin suciente diurna o articial a travs
de linternas, faros de vehculos, alumbrado pblico, etc.- podr revelarse la imagen de
identicacin positiva direccional conformada por las siglas identicacin positiva direccional identicacin positiva direccional RNPA distribuidas en toda
la supercie de la placa, excepto en los espacios con pintura negra.
La tcnica de determinacin de estas imgenes para comprobar su autenticidad es que las
mismas deben verse y dejar de verse, al cumplir o no respectivamente- el ngulo de observacin.
La no visin desde ese ngulo o la visin en forma permanente son indicadores de falsicacin.
La falta de este material reectivo de seguridad convierte en falsas las patentes
aunque los datos identicadores del vehculo fueran correctos. La comercializacin de este
laminado es restrictivo al Registro Nacional de la Propiedad del Automotor, lo que implica
que ste es el nico organismo autorizado para el otorgamiento de chapas patentes.
El material reectivo es, adems, un elemento de importancia en la seguridad
vial pues aumenta la visibilidad nocturna al refractar los faros de otros vehculos sobre
la patente, otorgando la facultad de ver y ser visto al mismo tiempo.
Obsrvese en la siguiente gura la forma de visualizar la imagen positiva direccional
294
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
TARJETAS DE CRDITO
Sus orgenes se remontan a 1914 cuando la Unin Occidental emiti la primera tarjeta de
cargo al consumo para proveerlas a clientes especiales, a quienes les brindaba una serie de ventajas
entre las que guraba el pago diferido gratuito. En 1950 fue introducida la tarjeta Diners Club donde
los usuarios deban pagar mensualmente a la recepcin de la cuenta el total de lo gastado.
El Banco de Amrica en el Estado de California Estados Unidos de Norte Amrica-
otorga las Bank Americard en 1958 para funcionar como tarjetas de crdito en forma local, ex-
tendindose luego su uso en otros Estados al asociarse otros bancos, crendose as las tarjetas
de Pago Maestro. Estas dos tarjetas se transforman luego en Visa y Master respectivamente y
para 1979 ms de 1.400 bancos dentro y fuera de los Estados Unidos adoptaban este sistema
como medio de pago.
Podemos denirlas como documentos intransferibles de pago pactado,
donde el Emisor otorga crdito pactado al Titular y a su vez pacta el pago con los
Comerciantes Adheridos.
Los contratos entre las partes son por adhesin, es decir el Emisor impone las reglas
y los solicitantes, empresas y comercios las deben aceptar. Las tarjetas son el medio
de efectivizar dichos contratos -que son celebrados entre el Emisor y el Titular y entre el
Emisor y los Comercios- y los cupones son los documentos que prueban la conformi-
dad de las partes en las operaciones realizadas. Las operaciones se dan por vlidas con
la rma del titular o por la lectura de la banda magntica, aunque recientemente se ha
generalizado su uso al dictado de datos.
Dentro de las obligaciones es responsabilidad del titular el pago de todas las
operaciones realizadas con las tarjetas otorgadas, tanto a su nombre como la de todas
las extensiones solicitadas. Con respecto a los titulares de las extensiones slo son re-
sponsables solidarios por la utilizacin de su extensin, aunque puede acordarse con la
entidad estas otras dos posibilidades si as se estableciera en los contratos celebrados,
requiriendo obviamente la conformidad y rma de todos: a) solidario por el uso total de
todas las tarjetas, o bien b) no solidario ni an con la extendida a su nombre.
Se ha estandarizado sus medidas que responden a las siguientes caractersticas:
Altura: 53,975 mm; Ancho: 85,725 mm; Grosor: 0,762 mm; Peso: 5 grs; Primera Lnea Impresa: 5
mm; Segunda Lnea Impresa: 3 o 4 mm; Relieve de Impresin: 0,5 mm y Radio de Curvatura en
Esquinas: 3,175 mm. Son grabadas slo en el anverso por impresoras Farrington 7 B de pasos
mecnicos de 3,60 mm en la primera lnea y de 2,54 mm en la segunda lnea.
295
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El soporte es de baquelita sobrelaminada con opacidad de un 70% y el em-
bozado o datos que contienen son:
a) clave numrica del banco;
b) nmero de cuenta del cliente;
c) crdito y monto; y
d) nombre del cliente y tiempo de validez de la tarjeta.
La mayor parte de las tarjetas son de origen importado provistas por Data Card y Sill-
cocks y las importa Ciccone S.A. La empresa Nacional que tiene a su cargo la fabricacin de
las tarjetas es Multimac S.A. y utiliza para su impresin dos sistemas: offset y serigrafa.
Con offset se realizan los fondos de seguridad tanto en las planchas del anverso como en
las del reverso, las que luego se unican por medio de una pelcula transparente. Algunas presen-
tan hologramas distintivos y diferentes colores. La rma del titular se realiza en el reverso de
la tarjeta sobre un papel de caractersticas especiales de inviolabilidad denominado safetig
que se destruye o cambia de color al ser sometido a maniobras de borrado, raspado o lavados
adulterativos.
Poseen adems banda magntica con informacin codicada electrnicamente que
posee tres pistas o tracks que son bloques de informacin impresos magnticamente por
algoritmos que requieren un lector especco y compatible. El primer track posee caracteres
alfanumricos con el nombre del titular y datos de la cuenta. El segundo slo caracteres nu-
mricos con informacin sobre la cuenta datos, validez, etc. El tercero encripta informacin
algortmica que se utiliza en los cajeros automticos ATM- que le permite comunicacin con
la cuenta y que en caso de no estar en lnea, graba los movimientos realizados.
A modo de ejemplo se detallan las principales caractersticas de una tarjeta Visa:
1) Nmero de la tarjeta: Comienza con un grupo de cuatro dgitos siendo el primero siempre
un 4 y se contina con tres grupos de cuatro dgitos ms (16 en total) o de tres dgitos
ms (13 en total). Se debe vericar la no existencia de maniobras de planchado o enmen-
dado de nmeros.
2) Nmero de Identicacin del Banco Emisor: posee cuatro nmeros y se lo denomina BIN Bank
Identication Number-, debe ser idntico que los primeros cuatro nmeros de la tarjeta y se
encuentra impreso por encima o debajo de stos. Se debe comprobar esta coincidencia.
3) Holograma: representa una paloma que por su efecto tridimensional cambia de color y
posee movimiento. Se debe vericar ese efecto y ese dibujo.
296
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
4) Vigencia: pueden presentar fecha de iniciacin o no, pero siempre se debe vericar que
se encuentre dentro del perodo de validez.
5) Smbolo de seguridad: todas las tarjetas Visa llevan grabadas en relieve una v. Veri-
que que sea de igual diseo.
6) Panel de rma: posee impresa la palabra VISA en toda su supercie realizadas en
color azul y oro. Se debe vericar que posea estas caractersticas, sin raspaduras, que
no aparezcan las palabras VOID o ANULADO y que posea la rma estampada.
7) Cdigo de Seguridad: est impreso sobre el papel de la rma y esta constituido por tres
dgitos con caracteres inclinados hacia la izquierda. Obsrvese en la siguiente gura el
detalle de las caractersticas sealadas.
Actualmente se estn implementando otros tipos de tarjetas:
a) con cdigos de barra;
b) con bandas magnticas;
c) con microchips o inteligentes; y
d) biomtricas.
Con cdigos de barra: son meros instrumentos de control que sirven para identicar y/o
transferir artculos. Son de bajo costo, desechables, precisas, recopilan informacin y evitan
errores, se pueden recomponer, hay variadas tcnicas de marcado y lectura que puede ser
por contacto o no contacto y se aplican por impresin lser. Sus barras pueden ser lineales,
gruesas, nas, con nmeros, de barras acumuladas, con colores, manejada por pixeles, etc.,
lo que brinda una amplia gama de usos y una casi innita capacidad de combinaciones.
Con bandas magnticas: de utilizacin con nes nancieros, de crdito, familiares, de
identicacin personal, tributaria, membresas, de aperturas de puertas o contraseas de
empleados, etc. Requieren grabacin digital o encording en bandas magnticas con codi-
cador y lectores binarios que pueden estar encriptados o no. Son ms conables que las de
barras, codican informacin y poseen gran capacidad de almacenaje de datos, son fciles
de hacer y los equipos necesarios son hoy accesibles.
297
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Con microchips o inteligentes: comienzaron en 1970 en Japn creadas por Kunitake Arimura
y presentaban un circuito integrado. Evolucionan en los 80 denominndoselas tarjetas inteli-
gentes Inteligent Card, Smart Card o Chip Card. Las hay con memoria no borrable o ja o
borrables y actualizables. Poseen igual formato que las de crdito, contactos metlicos con
capa de oro, cuyas posiciones estn regulados por normas ISO 150 y poseen circuito inte-
grado solidario con los contactos. Incluyen claves de acceso, algoritmos cifrados, claves de
autenticacin de algoritmos y ejecutan protocolos, es decir evitan lecturas no autorizadas.
Biomtricas: son de alto costo y complejidad por lo que se utilizan en alta seguridad. Pu-
eden ser extensibles a usos bancarios, de salud, laborales, archivos, etc. Capturan datos
biomtricos cuyas descripciones y tipos se han efectuado en una unidad anterior.
En todas estas tarjetas y en papeles monedas (que sern analizados en la
siguiente unidad) o en sus representativos como ser: ttulos de deudas, acciones,
cheques, plazos jos y documentos en general, se utilizan las medidas de seguridad
detalladas en prevencin de falsicaciones y adulteraciones.
El acopio de estos conocimientos e informacin por parte del alumno le permitir
no slo enfrentar los inconvenientes que traen estos tipos de delitos en el ejercicio de
la profesin, sino tambin resolver las dudas que puedan presentarse en la recepcin
de este tipo de exponentes documentales.
298
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
299
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD VII )
n CAPELLO, Roberto; GOBBI, Eduardo; Celia POGGIO de PALACIOS y otros; Tratado
de Criminalstica; Tomo I. Documentos; Ed. Policial; Bs. As.
n GUZMAN, Carlos; Manual de Criminalstica; Ed. La Rocca; Bs. As. 1997.
n MACHADO SCHIAFFINO, Carlos; Pruebas Periciales; Ed. La Rocca; Bs. As. 1989.
n Revista de Polica y Criminalstica; Nmeros 1 y 2; Ed. Policial.
Bibliografa obligatoria
u8
unidad ocho
investigacin cientca del delito
) (
303
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD VII
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Qu es el Trueque.
2. Dnde, para qu y cules son los benecios o inconvenientes de su implementacin.
3. Orgenes y concepto de Moneda
4. Evolucin sufrida desde los primeros elementos utilizados como valores de cambio
hasta la fecha.
5. Cules son sus propiedades.
6. Cules son las condiciones que deben reunir.
7. Orgenes del Dinero.
8. Diversos tipos de dinero.
9. Antecedentes en nuestro pas.
10. Primeras monedas y billetes Argentinos.
11. Cronologa y devaluacin histrica de nuestro Papel Moneda.
12. Caractersticas del Papel Moneda actual.
13. Caractersticas del Patacn.
14. Caractersticas del Dlar estadounidense.
15. Cronologa histrica de los billetes Dlares estadounidenses.
16. Distintos tipos de dlares.
17. Caractersticas diferenciales de los distintos tipos de emisiones.
18. Descripcin de las principales medidas de seguridad.
19. Reconocimiento de las medidas de seguridad utilizadas en los billetes de estas monedas.
20. Distintos tipos de falsicaciones.
21. Billetes polmeros.
Mencin sinttica de los contenidos
304
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
305
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
n Conocer acerca de los Orgenes del Dinero
n Conocer la aplicacin de las medidas de seguridad -detalladas en la unidad anterior- en
los billetes de Papel Moneda Nacional.
n Conocer cules son los componentes del papel utilizado y su reconocimiento.
n Conocer las tintas de seguridad que para su fabricacin se utilizan.
n Conocer los sistemas de impresin que se utilizan.
n Detallar las principales medidas de seguridad en ellos utilizadas.
n Efectuar idnticos reconocimientos sobre las Letras de Tesorera para Cancelacin de Ob-
ligaciones de la Provincia de Buenos Aires denominadas Patacn en sus series A y B.
n Detallar iguales caractersticas sobre los billetes dlares estadounidenses.
n Detallar sobre los dlares estadounidenses, tipos de billetes y las variaciones sufridas
a travs del tiempo.
n Recordar la proteccin legal que posee en nuestro pas, el Papel Moneda.
n Tomar conocimiento del soporte polmero para billetes de papel moneda.
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
306
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
307
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD VIII )
Medidas de seguridad en el papel
Medidas de seguridad en las tintas
Sistemas de impresin utilizados
Medidas de seguridad incorporadas
Distintos tipos y caractersticas de billetes
DOLAR ESTADOUNIDENSE
Medidas de seguridad en el papel
Medidas de seguridad en las tintas
Sistemas de impresin utilizados
Medidas de seguridad incorporadas
MONEDA NACIONAL
Orgenes de la Moneda y del Dinero
Historia del Papel Moneda Argentino
Cronologa de devaluaciones y tipos de papeles monedas
Creacin de los Patacones
Historia del Dlar estadounidense
Cronologa, tipos y valores de dlares estadounidense
REFERENCIAS
BILLETES POLMEROS Caractersticas Generales
308
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
309
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
Lea el siguiente prrafo tomado del libro Falsicacin de Moneda de los autores
Silveyra Lozano Daz, de la Editorial Policial, Volumen 334, Pgina 18.
Si bien las primeras falsicaciones de moneda datan desde antes de Cristo, de la lectura
del prrafo precedente surge que los daos que ocasionan pueden ser de tal magnitud para un
pas, que puede llegar a desestabilizarlo. Esto fue cabalmente comprendido por todos los estados
emisores, quienes han debido legislar al respecto.
Como ejercicio introductor al tema de esta unidad, determine el articulado de nuestro
Cdigo Penal que trata sobre falsicacin de moneda y realice un cuadro sinptico de sus
principales resguardos.
310
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
311
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD VIII )
La atencin de muchos lsofos sociales, juristas, historiadores y economistas
prcticos se ha centrado en un fenmeno difundido desde hace mucho tiempo en todos
los rincones del mundo, que es la aceptacin de piezas de oro y plata -y luego de unos
documentos que las representaban- como medios o valores de cambio universales.
El trueque, intercambio o permuta de una mercadera -excedente para una
persona y necesaria para otra a la que le ser de mayor utilidad- es una circunstancia
racional y lgica, pero el cambio de una mercadera til por pequeos discos metlicos
sin una aparente utilidad es un acontecimiento tan opuesto a un curso natural, que
su uso y universalizacin fue denida por el distinguido pensador Savigny como un
fenmeno misterioso.
El problema del trueque es que se necesita lo que se ha dado en llamar la doble co-
incidencia de deseos, es decir la casualidad de que dos personas tengan bienes o servicios
que quiera la otra. Una economa de este tipo tiene normalmente problemas en distribuir
ecientemente sus recursos. La utilizacin de esas piezas metlicas o documentos que las
representan dinero- facilita el comercio. El ujo del dinero de una persona a otra a
cambio de mercaderas ms tiles facilita la produccin, la especializacin cada uno
realiza lo que mejor hace- y eleva el nivel de vida de la gente.
Para Aristteles el dinero es una mercadera intermediaria que facilita los intercam-
bios. Sin embargo para los economistas:
Dinero: es el conjunto de activos que utilizan los individuos para comprar bienes y
servicios a otras personas.
Debe cumplir estas tres funciones:
a) debe ser un medio de cambio;
b) una unidad de cuenta y
c) un depsito de valor.
Papeles moneda
312
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Medio de cambio: acta como artculo que es aceptado gustosamente a cambio de los
bienes o servicios que se compran, permitiendo la realizacin de la transaccin.
Unidad de cuenta: acta como patrn para la regulacin de precios y permite registrar
las deudas teniendo como base una unidad monetaria y no por la acumulacin de can-
tidades de bienes o servicios.
Depsito de valor: acta como artculo que permite transferir poder adquisitivo del pre-
sente al futuro.
Para cumplir con su objetivo el dinero, debe reunir ciertas condiciones. Entre ellas se
destacan las siguientes: que convenga a todos, en todo tiempo y con el mismo grado; til por
s mismo, con valor propio e incorruptible; homogneo en todas sus partes pero sumamente
divisible para facilitar cambios; de manejo sencillo y en cantidad suciente ni mucho ni poco;
que no est sujeto a variaciones bruscas de valor y que sea de fcil y segura acuacin.
Siguiendo un orden evolutivo, la mercanca de cambio que reemplaz al trueque eran
pequeas piezas de metales preciosos -oro y plata- que tenan valor intrnseco. La dicultad de
su implementacin la representaba el difcil contralor de sus grados de pureza, lo problemtico
de comprobar la exactitud de su peso y lo problemtico de su divisibilidad para cambios. Esto
limitaba el crecimiento del comercio y la industria, por lo que se hizo necesario que el Estado
avalara estas piezas y rediseara sus formas, naciendo as la moneda.
Si bien no est perfectamente determinado el origen de este nombre, el trmino provi-
ene de la voz latina moneta. En el templo de la diosa Juno -apodada Moneta- en Roma, se
hallaba el lugar donde eran acuadas esas piezas metlicas, circunstancia que deriv en que
a los trabajadores se los denominara monetari y a las piezas acuadas monates o su
equivalente almoneda y de all su derivacin.
Sin embargo hay que destacar que desde antes del uso de las piezas metlicas y
de la acuacin de la moneda y tambin mucho despus-, diferentes culturas utilizaron
otros tipos de monedas consideradas como no acuadas, como por ejemplo: en Egipto
y Babilonia los cereales; en Grecia e Italia los animales domsticos; en frica la sal; en
otras regiones el cuero, esclavos, caf, cacao; etc.
Segn Herodoto fueron los Lidios pueblo comerciante del Asia Menor- los que antes del ao
700 aC acuaron piezas metlicas de oro, de plata y de ambos metales. Rpidamente comenzaron a
aparecer en China, Engina, Atenas, Corinto y en el Imperio Persa. En Italia, y especialmente en Roma,
la moneda metlica tuvo una aparicin tarda -los romanos utilizaban el ganado como moneda- pero
fueron los que la homogeneizaron en tamaos, pesos y valores y prohibieron la acuacin por par-
ticulares, convirtindola en monopolio estatal.
313
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
En Amrica comenzaron a funcionar las casas de acuacin o cecas de la palabra rabe
zicah = troquel- a partir de la orden del emperador Carlos V (Carlos I de Espaa) en 1525. A partir
de ella se instalaron cecas en Mxico en 1537, en Santo Domingo en 1542 y en Lima en 1565.
Debido a la dicultad, peso y costo del transporte de grandes cantidades de mone-
das metlicas en transacciones comerciales de importancia entre distintas regiones -lo
que implicaba un alto riesgo en seguridad- y el advenimiento del papel, se sustituyeron las
monedas metlicas por papel moneda, que careca de valor por s mismo, no signicaba
incremento de riqueza sino, simplemente, el reemplazante circulatorio que requera
de aval por acopio del metal.
Es en el siglo IX en China durante la dinasta Tang, cuando los bancos privados
comenzaron a emitir papel moneda, hasta que en el siglo XI la dinasta Song convirti la
emisin en un monopolio del Estado. En Europa cada banco emita su propia moneda res-
paldando sus emisiones con oro y plata. Ms tarde con la aparicin de los Bancos Centrales
se empezaron a emitir con el respaldo del gobierno de cada pas.
El origen del papel moneda privado surge como constancias de depsitos. Los
inconvenientes del traslado y resguardo de las monedas metlicas provoc que hbiles
comerciantes crearan casas seguras para su depsito. Los depositantes deban abonar
un cargo por el servicio, recibiendo como certicacin de los valores depositados docu-
mentos que acreditaban su propiedad. Estas acreditaciones eran emitidas por cada banco
y comenzaron a ser utilizadas como dinero en pago de servicios o bienes.
Cuando esos comerciantes hoy denominados banqueros- comprendieron que no
era necesario tener la totalidad del dinero depositado en sus arcas y que con un porcentaje
de los mismos alcanzaba para los movimientos requeridos, comenzaron a otorgar crditos,
cambiando sus comisiones por intereses.
Al comenzar los gobiernos la emisin de papel moneda, estos deban estar respalda-
dos con reservas de metales preciosos. Al ser mayor la necesidad de circulante que stas
y al emitirse sin su respaldo, se comienza con una interminable consecuencia inacionaria.
Despus de la segunda guerra mundial slo los Estados Unidos tenan equiparado su res-
paldo en oro o plata, el que fue abandonado en 1971.
PESOS: Como antecedentes en nuestro pas cabe indicar que luego de la gesta de Mayo de
1810, Buenos Aires y las Provincias del Ro de la Plata comenzaron la campaa por la indepen-
dencia, combatiendo a la resistencia realista en el Alto Per, tomando la Villa Imperial y su casa
de moneda y cambiando los tipos de monedas emitidos suplantando el busto real y emblemas
hispnicos por otros que ostentaban smbolos patrios de Unin y Libertad.
314
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
La Asamblea General Constituyente aprueba, el 13 de abril de 1813, el proyecto de
Ley de Moneda presentado por el diputado Pedro Jos Agrelo disponindose la acuacin de
monedas de oro y plata en la Villa de Potos que, con el sol radiante y la leyenda PROVINCIAS
DEL RIO DE LA PLATA en el anverso y con el Escudo Nacional y la leyenda DEL RIO DE LA PLATA DEL RIO DE LA PLATA UNION Y LIBER-
TAD en el reverso, se acuaron hasta nes de ese ao cuando por los reveses de Vilcapugio TAD TAD
y Ayohuma los espaoles recuperaron la ceca y retornaron a los modelos anteriores.
Lograda la independencia argentina, las continuas batallas que se debieron efectuar en
toda la regin provocaron el agotamiento de las reservas del nuevo gobierno. El pronunciamiento
del General Alvear contra las autoridades bonaerenses motiv que el gobernador de la Provincia
de Buenos Aires Don Manuel de Sarratea el 28 de enero de 1820 publicara su histrico bando
justicando la emisin de papel moneda en los artculos 4y 5que textualmente dicen:
4) Siendo como es constante que el erario de la provincia no slo se halla exhausto
sino que absolutamente no tiene recursos con que auxiliar al General del Ejrcito que
debe moverse en el da con todas las fuerzas de su mando espera que el vecindario de
Buenos Aires no se desentender de la cruel situacin en que se halla su Gobierno para
presentarle toda clase de auxilios pecuniarios.
5) Todo individuo que quiera hacer suplementos o donativos al Gobierno para sacar a
la patria del desastre que le amenaza, deber presentarse con ellos al Exmo. Cabildo,
quien dispondr de su recibo en la forma acordada, quedando ambas autoridades con la
obligacin de reintegro tan sagrado luego que pasen los presentes momentos del apuro,
y de los primeros fondos pblicos que se recolecten.
Estos recibos a modo de vales -tanto de la primera como de la segunda emisin-
tuvieron el carcter de moneda corriente y se podan canjear por moneda metlica, aunque
en la prctica su utilizacin fue funesta, ya que no eran aceptados por los comerciantes o
si lo admitan lo hacan con una sensible disminucin de valor.
Hasta 1840 slo el gobierno de la Provincia de Buenos Aires haba emitido papel
moneda, pero luego del pronunciamiento del General Gregorio de Lamadrid contra
Rosas se forma la Unin de las Provincias Aliadas del Norte que a travs del Banco
Hipotecario de Tucumn emite billetes con la promesa que sern pagados despus
del triunfo, condenando a la pena de muerte a sus falsicadores.
Las diferencias polticas y las ansias independentistas de muchas provincias mo-
tivaron que fueran muchas las que acuaran monedas adems de Tucumn, La Rioja,
Santiago del Estero y Mendoza- lo que trajo como consecuencia un importante ujo de
variados modelos y tipos y con ellos un gran caudal de moneda falsa.
315
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Terminadas las rencillas internas y a travs de los pactos de unin nacional celebra-
dos por Urquiza y Mitre en el ao 1860, se comienza a normalizar la economa domstica
emitiendo los Bancos Provinciales, Privados y casas Comerciales circulantes con promesas
de canje en pesos fuertes o plata.
La primera moneda nacional en oro y plata aparece en el ao 1881 y se dispone
que los billetes de papel deben indicar su valor en esa moneda. En 1886 se crean los
Bancos Garantidos y es la Nacin la que responde por las emisiones de todos los
bancos provinciales autorizados disponindose, asimismo, su curso forzoso.
Creada por Ley del 20 de septiembre de 1897 la Caja de Conversin, se emiten
los nuevos billetes denominados Del Progreso caducando as todas las emisiones
anteriores y siendo la Repblica Argentina la que garantiza y paga por intermedio del
Banco de la Nacin sus billetes, que sern canjeados por monedas de oro y plata.
Se reproduce a continuacin la unidad de ese tipo de moneda.
Este papel moneda presentaba diferentes tamaos para cada denominacin. El billete
de un peso era de 130 x 65 milmetros, en el anverso presentaba la Egie del Progreso y puede
leerse Repblica Argentina, La Nacin, pagar al portador y a la vista Un Peso y en el
reverso presenta el Escudo Nacional y las leyendas Repblica Argentina y Repblica Argentina Repblica Argentina Un Peso.
Mediante la sancin de la Ley nmero 1.130 modicada por Ley 3.871 del 4 de noviem-
bre de 1899 se establece como unidad monetaria argentina el Peso Moneda Nacional cuyo Peso Moneda Nacional Peso Moneda Nacional
smbolo es m$n. Se reproduce a continuacin la unidad de este tipo de moneda.
316
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Esta moneda tambin presentaba diferentes colores y tamaos segn su denomi-
nacin. El billete de un peso era de igual medida que la serie Del Progreso y presentaba
en el anverso a La Justicia y en el reverso La Casa de Tucumn. Estos billetes tuvieron
curso legal hasta diciembre de 1969.
En enero de 1970 por disposicin de la Ley 18.188 se crea el Peso Ley ($L) que reem- Peso Ley Peso Ley
plaza a su equivalente 100 pesos moneda nacional. Los billetes presentan igual tamao
155 x 75 milmetros diriendo en color y motivos del reverso. Los billetes de 1, 5 y 10
pesos tienen la gura del General Manuel Belgrano los de 50, 100, 500, 1.000, 5.000,
10.000, 50.000, 100.000, 500.000 y 1.000.000 de pesos tienen la gura del General San
Martn-. Esta moneda circula hasta mayo de 1983.
Se reproduce a continuacin la unidad de este tipo de moneda que en el re-
verso presenta el Hotel Llao Llao en Bariloche.
En junio de 1983 se emite el Peso Argentino ($a.) que reemplaza a su equivalente
de 1.000 pesos ley 18.188 y presenta igual tamao que los anteriores. En los billetes de
1, 5, 10, 50, 100, 500 y 1.000 pesos argentinos, est la gura del General San Martn,
el de 5.000 la de Juan Bautista Alberti y el de 10.000 la del General Manuel Belgrano.
Poseen diferentes colores y motivos en el reverso.
Se reproduce a continuacin la unidad de este tipo de moneda que tuvo cir-
culacin legal hasta mayo de 1985.
317
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
En junio de 1983 comienza la vigencia del Austral (A) que reemplaza a su equivalente de
1.000 pesos argentinos. Estos billetes mantienen el tamao anterior, cambiando el color y guras
del retrato en todas las denominaciones. En sus reversos presentan la Egie del Progreso.
Se reproduce a continuacin la unidad de este tipo de moneda que presenta
el retrato de Bernardino Rivadavia. Esta moneda circul hasta diciembre de 1991.
En enero de 1992 el signo monetario Peso ($) reemplaza a su equivalente de 10.000
australes. De esta manera las sucesivas depreciaciones monetarias hicieron perder
un total de trece ceros, los que precedidos de la unidad da esta impresionante cifra:
10.000.000.000.000 que indica la conversin de peso moneda nacional a peso actual.
Se reproduce a continuacin la unidad de este tipo de moneda que ya no tiene
circulacin legal pero que sigue manteniendo su valor.
Los primeros billetes de esta moneda puestos en circulacin -dado el avance tecnolgi-
co actual- han debido ser modicados para dicultar su falsicacin a travs de procesos de
fotocopiado o escaneado y reproduccin lser. A partir de 1997 se ha dispuesto una nueva serie
que si bien conservan las principales caractersticas de formato, color y motivos principales
del anverso y reverso de los anteriores, se le han introducido nuevas medidas de seguridad.
Su impresin est a cargo de la Sociedad del Estado Casa de la Moneda Argentina.
Todos los billetes tienen 155 x 65 milmetros y se hallan realizados en papel de
calidad emisin registrada de 90 gramos por metro cuadrado y presentan:
Filigrana o marca de agua localizada: en el sector sin impresin del anverso y reverso que
reproduce la gura del prcer del retrato y sus iniciales. Presentan una excelente denicin de
claros-oscuros multitonales y pueden ser observadas con igual calidad desde ambas caras.
318
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Fibras de seguridad invisibles con luz directa y visibles en colores rojo, azul y amarillo con luz ul-
travioleta diseminados en toda la masa del papel, que pueden ser levantadas con una aguja.
Hilo de seguridad: En los valores desde 10 pesos en adelante se les incorpora esta medida
sobre el que puede leerse a trasluz la leyenda BCRA, el signo $ y el nmero indicador del
valor. Pueden estar incorporados totalmente a la masa del papel o en forma entrecruzada y
al ser observados con luz ultravioleta presentan distintas respuestas uorescentes: el de diez
pesos en color azul; los de veinte pesos en color rojo; los de cincuenta pesos tambin en
color rojo, pero son visibles a simple vista en color metlico en forma entrecruzada y los de
cien pesos tambin visible y entrecruzado en color metlico y uorescentes en color azul.
Fondos de seguridad estn realizados en offset con los colores determinados para cada
valor. Con ese mismo sistema presenta en el anverso reproduccin parcial de manuscritos
del personaje del retrato y en el reverso una sntesis biogrca del mismo.
Calcografa: con este sistema se confeccionan los retratos, los motivos que lo acompaan
y otras impresiones reconocibles al tacto. Estas impresiones centrales estn realizadas
con tintas que cambian de color al ser observadas con luz ultravioleta.
Tipografa: este sistema es utilizado para la realizacin de las numeraciones de los billetes que se
encuentran en dos posiciones, una en forma vertical y en tintas de color rojo en el sector izqui-
erdo y otra en forma horizontal con nmeros de diferentes tamaos y en color negro en el sector
superior derecho. Estas tintas tambin cambian de color al ser observadas con luz ultravioleta.
Tintas O.V.I.: el nmero indicador del valor del billete ubicado en el sector superior izqui-
erdo del anverso est realizado con tintas dicroicas o de variacin ptica o cromtica
que, segn el ngulo de observacin pueden verse verdes o azules.
Microletras: los billetes de 2, 5 y 10 pesos presentan microletras que repiten las siglas BCRA
en el interior del nmero indicador del valor ubicado en el sector inferior derecho del anverso
y en ambos nmeros del reverso. Los restantes billetes poseen microletras en los nmeros del
reverso y en el del anverso tienen Imagen Latente que reproduce el mismo nmero en forma
ms pequea, los que pueden ser visualizados a la altura de los ojos frente a una luz.
Identicacin para no videntes: presentan este tipo de identicacin por medio de rombos
en relieve ubicados en el sector superior lado izquierdo. La presencia de seis de ellos le
corresponde al billete de dos pesos y se resta uno a medida que el billete es de mayor
valor, terminando con un rombo en el billete de cien pesos.
Registro Perfecto: diferentes motivos geomtricos, alegoras o nmeros a la derecha del
retrato, conforman un registro perfecto o complementacin frente-dorso. La perfecta inter-
relacin entre los dibujos en ambas caras del billete al ser observados a tras luz indica una
impresin simultnea en ambos lados que no pueden lograr los falsicadores al imprimir por
separado los anversos y los reversos.
319
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
A n de visualizar la ubicacin de las distintas medidas de seguridad detalladas,
se sealarn en dos billetes tipos, las mismas:
Tintas O.V.I.
Filigrana
Identicacin para
no videntes
Impresiones Calcogrcas
Numeracin
Fluorescente con U.V.
Numeracin
Impresiones con tintas
reactivas a U.V.
Registro Perfecto
Microletra
Impresin Offset
Numeracin
Impresiones con tintas
Impresin Offset
Microletra
Registro Perfecto
Impresiones Offset
Sntesis Biogrca
Fibra de Seguridad Impresiones Offset
Sntesis Biogrca
320
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Tintas O.V.I.
Filigrana
Identicacin No Videntes Impresiones Calcogrcas
Numeracin Fluorescente Hilo de Seguridad
Impresiones Calcogrcas
Impresiones con tintas
Reactivas a U.V.
Impresin Offset
Registro Perfecto
Fibra de Seguridad
Imagen Latente
Registro Perfecto
Imagen Latente
Microletra Sntesis Biogrca
Microletra
Impresiones Offset Impresiones Calcogrcas Fibra de Seguridad
Se debe recordar que para determinar autenticidad o falsedad en papeles monedas hay
que vericar las medidas de seguridad que stos presenten, requirindose idealmente para ello una
lupa y una luz ultravioleta -ambos elementos son de bajo costo y fcil adquisicin. Teniendo
en cuenta las diferencias que presentan las distintas denominaciones, en nuestros billetes se
debe vericar lo siguiente:
Por medio de la vista la presencia de una ntida ligrana desde ambas caras; el hilo
de seguridad; el cambio cromtico de las tintas O.V.I.; la imagen latente y la coincidencia
del registro perfecto. Por medio del tacto reconocer las impresiones calcogrcas por el
sobrerrelieve que producen.
Con una lmpara de luz ultravioleta se determinan las bras de seguridad uorescentes
en rojo, azul y amarillo; la distinta respuesta uorescente -segn las denominaciones- de los
hilos de seguridad; la reaccin de las tintas uorescentes y la uorescencia neutra del papel.
321
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Por medio de una lupa se deben determinar las leyendas en Microletras; las nas
lneas del fondo de seguridad y el reconocimiento de los distintos tipos de impresin.
Los falsicadores tratan de reproducir lo ms elmente posible todas estas medidas de segu-
ridad. Algunas son logradas de manera aceptable, pero lo difcil es lograr que todas tengan suciente
idoneidad para producir engao a las personas que lo examinen bajo las pautas indicadas.
Dentro de las caractersticas ms sobresalientes en algunas falsicaciones se
pueden mencionar las siguientes:
l Ausencia de ligrana o impresin simulada en forma grca o manual.
l Ausencia de bras de seguridad o imitacin con lneas de colores impresas o pegado
supercial de bras.
l Ausencia o simulacin de hilos de seguridad por medio de impresin de una lnea
oscura, sin leyenda interior y sin respuesta uorescente.
l Falta de los sobrerrelieves de las impresiones calcogrcas ya que estn realizados
en sistema offset o por impresin lser.
l Las lneas del fondo de seguridad estn realizadas por puntos separados.
l Falta de interrelacin entre los dibujos o diseos del registro perfecto -por haberse
realizado las impresiones por separado-.
l Variaciones en las tonalidades de las tintas.
l Cortes irregulares del papel.
l Gran luminosidad del papel al ser sometido a radiaciones ultravioletas.
Por ltimo y a los efectos de diferenciar las calidades de realizacin de las ligranas
o marcas de agua, se ilustra las diferencias entre una autntica y una falsa.
Filigrana Falsa Filigrana Autntica
322
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
DLAR ESTADOUNIDENSE: Su origen se remonta al ao 1519 cuando luego de descubierta una mina
de plata en Sankt Joachimsthal Valle de San Joaqun en el Imperio Germnico-, el conde Schlick
acu una moneda de plata que recibi el nombre de Joachimsthaler, que luego se abrevi a Tha-
ler o Taler. En 1520 Carlos I de Espaa al asumir como soberano del Imperio Germnico dispuso la
acuacin de monedas espaolas de igual valor denominndola Talero, para ser utilizadas durante
el intercambio comercial con las colonias inglesas en Amrica del Norte, donde fueron traducidas al
ingls como Dollar, moneda que tuvo gran circulacin en esa parte de Amrica.
Lograda la independencia el 4 de julio de 1776 y luego de su constitucin como pas,
el pueblo de los Estados Unidos de Norte Amrica elige como primer presidente a George
Washington, quien el 2 de abril de 1792 sanciona la Ley de Acuacin que designa al dlar
como unidad monetaria nacional y al signo U$S como su representacin, formado por las
iniciales del pas United y States y las dos columnas de Hrcules con las cintas liadas con
la leyenda Plus Ultra como smbolo de fuerza y solidez.
A partir de esa Ley los Estados Unidos han emitido siete categoras de billetes: a) Silver
Certicates; b) Gold Certicates; c) United Stated Notes; d) Treasury Notes -en 1890 y 1891-;
e) Federal Reserve Notes; f) Federal Reserve Bank Notes y g) National Bank Notes. Si a estas
emisiones se les suman las constancias de depsitos bancarios que circulaban paralelamente,
al no estar uniformado ni el tamao, ni el color, ni las guras o dibujos, el total de circulante tena
miles de diseos, siendo fcil comprender las dicultades que ocasionaba su reconocimiento
y la cantidad de billetes falsos que haba.
En 1865 la Tesorera estableci el Secret Service, seccin que tena como n el control
de las falsicaciones. Despus de los pnicos nancieros de 1893 y 1907, se crea en 1913
el Sistema de la Reserva Federal como el Banco Central de la Nacin siendo autorizado
para emitir los billetes de la Reserva Federal -que se concretan en 1914, siendo ahora los
nicos billetes que se producen y constituyen el 90% del circulante.
En 1928 se estandarizaron los tamaos, papel, color de tintas, retratos, emblemas
y diseos del reverso, los que renen las siguientes caractersticas:
Tamao: los billetes presentan el mismo tamao 155 x 65 milmetros en todas las denominaciones.
Papel: especial de frmula secreta, se sabe que posee el 75% de algodn y un 25% de lino, que
junto con encolantes sintticos le coneren resistencia al manipuleo. Posee una tonalidad blanco
mate; uorescencia neutra y lamentos visibles azules y rojos. Al ser observado por medio de un
microscopio se revelan pequeos puntos luminosos.
Calidad y color de tintas: tambin son de frmulas secretas, presentan la cualidad especial de ser
del tipo nunca seco -por lo que se corren al ser frotadas- sin que esto deba ser considerado
como una medida de seguridad, y algunas tienen componentes metlicos. Las mismas son de color
verde, con un intenso sombreado en negro en el anverso.
323
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Con relacin a los retratos, diseos del reverso y emblemas, los mismos sern
analizados oportunamente.
Desde 1928 el Gobierno de los Estados Unidos ha impreso cinco tipos de billetes:
a) Federal Reserve Notes;
b) United States Notes;
c) Silver Certicates;
d) Gold Certicates; y
e) National Currency Notes.
Federal Reserve Notes: presentan el sello de la Tesorera y el nmero de la serie en color
verde. Este tipo de billete constituye entre el 90 y el 99% del circulante.
United States Notes: presentan el sello de la Tesorera y el nmero de la serie en color rojo.
Silver Certicates: presentan el sello de la Tesorera y el nmero de la serie en color azul. Estos
dos ltimos tipos detallados constituyen la diferencia porcentual del circulante actual.
En la siguiente gura se puede visualizar en detalle estos tres tipos de billetes donde
se observa la posicin del sello del tesoro y de los nmeros de serie.
324
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Gold Certicates: presentan el sello de la Tesorera y el nmero de la serie en color oro.
National Currency Notes: presentan el sello de la Tesorera y el nmero de la serie en color mar-
rn. Estos dos ltimos tipos actualmente no se imprimen, habiendo pocos en circulacin.
Se describen a continuacin las principales caractersticas de los billetes: a) impre-
siones; b) retrato; c) sello del tesoro; d) sello del banco; e) guilloches; f) vietas; g) nu-
meracin o serie; h) letra de control o nmero de cuadrante; i) series; y j) reversos.
Impresin: se realizan en intaglio o calcografa y tipografa. Se imprimen primero los diseos
bsicos del anverso y todos los del reverso con calcografa y despus con tipografa se
realiza la numeracin, los sellos y los datos variables como ser rmas de los funcionarios
y series. El reverso presenta una impresin de menor tamao. Luego de su control se lo
apresta para darle mayor resistencia al manoseo y a la suciedad, alargndole su vida til
estimada en unos dieciocho meses.
Retrato: corresponde a una conocida gura norteamericana y estn enmarcados con un valo. La
calidad de impresin de stos es observable en los detalles del cabello, barba, nariz, vestimenta,
reticulado del fondo y fundamentalmente en los ojos, que le dan una real apariencia de vida. Asi-
mismo debe prestarse especial atencin a las nas lneas de color blanco de las ornamentas.
Sello del tesoro: segn el tipo de billete, como ya se especicara, este sello se encuentra sobre-
impreso en el color correspondiente al nmero de serie. La fecha que presenta (1789) recuerda el
ao de la creacin del Departamento del Tesoro, es una rueda dentada y contiene los siguientes
elementos: una balanza de doble platillo que representa a la igualdad y a la justicia; una gura
a modo de V invertida con trece estrellas que representan los primeros Estados de la Unin;
una llave como representacin de la autoridad ocial y un escudo que simboliza la rectitud.
Se encuentra ubicado en el sector medio del lado derecho del anverso y se distinguen
dos modelos conteniendo los mismos elementos. Las diferencias estn en los bordes del escudo
interior que en los primeros eran curvos y ahora son rectos, y que antes tena una leyenda en
latn Thesaur Amer Septent Sigil y ahora tiene una en ingls The Departant Of Treasury. La
fecha de cambio de un sello a otro fue en 1963 para los de un dlar y para 1969 ya haba sido
incorporado en todos los valores.
325
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Sello del Banco: este sello se encuentra ubicado en el sector medio del lado izquierdo del
anverso y est conformado por una rueda de bordes dentados en cuyo centro se ubica
la letra asignada a la entidad emisora, realizada en color blanco. En forma circular en su
parte superior lleva impreso Federal Reserve Bank y en su parte inferior la ciudad y el
estado en que se encuentra la entidad o banco emisor.
Se hace necesario indicar aqu que son doce los bancos de la Federal Reserve que
emiten dinero y cada uno de ellos est identicado con un nmero correlativo al que le cor-
responde una letra en orden alfabtico, que sigue al orden numeral. Se detalla a continuacin
los bancos, ciudad, estado y los nmeros y letras que le corresponden:
1 A Boston, Massachussets; 2 B Nueva York, Nueva York; 3 C Philadelphia, Pennsyl-
vania; 4 D Cleveland, Ohio; 5 E Richmond, Virginia; 6 F Atlanta, Georgia; 7 G Chicago,
Illinois; 8 H Saint Louis, Missouri; 9 I Minneapolis, Minnesota: 10 J Kansas City, Mis-
souri; 11 K Dallas, Texas; y 12 L San Francisco, California.
Filigrammas o tramados: los bordes del billete -tanto del anverso como del reverso- es-
tn enmarcados por ligrammas o tramados ejecutados con excelentes detalles. Estos
tramados tienen una perfecta denicin y estn constituidos por lneas negras o verdes
muy nas que en forma ntida se entrecruzan -sin nudos ni manchas- en forma de tejidos
continuos y uniformes a modo de telaraas sobre un fondo blanco.
Guilloches: este sistema aporta la posibilidad de efectuar dibujos muy delicados y artsti-
cos con nas lneas de color blanco. Estas lneas son muy difciles de copiar por otros
sistemas de impresin que las empastan o unen.
Vietas: con impresin de medios tonos se logra una excelente gama de grises que
elimina los contrastes muy marcados y sombreados claroscuros, como las que rodean
el borde del valor del billete.
Numeracin o serie: esta numeracin est conformada por ocho dgitos precedidos y
seguidos de una letra. La primera es la letra correspondiente al banco emisor y la ltima
indica grupo de cien millones de billetes impresos. Se utilizan veinticinco letras -no la O
para evitar ser confundida por un dgito 0. Este nmero se imprime con el mismo color
de tinta que el sello del tesoro, tal como ya se indicara anteriormente.
Letra de Control o Nmero de cuadrante: los billetes anteriores al ao 1963 presentan una letra
en el ngulo superior izquierdo del anverso que indican la posicin del billete en la plancha.
Al imprimirse por hoja 12 o 18 billetes, su posicin es indicada en la misma por esta letra de
control. Despus de esa fecha al imprimirse 32 billetes por plancha se hizo necesario -al no
haber tantas letras- cambiar este control por el de nmero de cuadrante. Ahora se divide la
hoja en cuatro cuadrantes identicados con los dgitos 1 a 4 y la posicin de los ocho billetes
por cuadrante se indican por las letras A hasta la H, por ejemplo B2.
326
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Desde 1992 a modo de prueba y mediante el sistema Web-Fed Intaglio se imprimen
96 billetes en forma simultnea del anverso y del reverso en papel continuo en cilindros, reu-
bicndose el nmero de control a la derecha de la palabra TRUST
Nmero de lmina: en el ngulo inferior derecho, tanto del anverso como del reverso, se
visualiza el nmero de control de la plancha. Ese nmero, que aparece en el margen de
la plancha, es el que controla la cantidad de hojas de papel, indicador que se corta y se
perdera al seccionar los billetes.
Serie de emisin: las ms comunes en circulacin son las siguientes: 1963, 1966, 1974,
1977, 1981, 1985, 1990 y 1996. Con respecto a estas dos ltimas series se detallarn sus
caractersticas por separado, por presentar diferencias entre s y con las anteriores.
En las siguientes ilustraciones del anverso y reverso de un billete de cien dlares
de las series anteriores a 1990, se detallan la ubicacin de las caractersticas descriptas
para su fcil visualizacin.
N de Cuadrante
N del Banco
Sello del Banco
Tipo de Billete
Reticulado del Retrato
Sello del Tesoro
Fibra de Seguridad
Numeracin
Letra del Banco Guilloches Firmas de Funcionarios
Filigramma
Serie de Emisin Letra del Banco Guilloches Firmas de Funcionarios Firmas de Funcionarios Serie de Emisin
Fibra de Seguridad
Impresin Intaglio Efecto Cielo
Impresin de Menor Tamao
Independencia Hall
N de Lmina
Vieta
Impresin de Menor Tamao
Independencia Hall Vieta
N de Lmina
327
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
A los efectos de una mayor identicacin se aclara que las impresiones realizadas
en sistema intaglio o en calcografa presentan sobrerrelieves que pueden ser detectadas
por el tacto. El efecto cielo -tambin realizado en ese sistema- est conformado por lneas
muy nas con interrupciones que son muy difciles de imitar con cualquier otro sistema
de impresin.
Existen doce valores de billetes dlar, de los cuales los cinco de ms alta denomi-
nacin son de circulacin interbancaria restringida, no circulando entre el pblico. Se detal-
lan a continuacin la nmina y las caractersticas diferenciales del anverso y del reverso.
VALOR RETRATO REVERSO
1 dlar Presidente George Washington Gran sello de los Estados Unidos
2 dlares
5 dlares
10 dlares
20 dlares
50 dlares
100 dlares
10.000 dlares
100.000 dlares
5.000 dlares
1.000 dlares
500 dlares
Presidente Thomas Jefferson Monticello. Declaracin Independencia.
Presidente Abraham Lincoln Monumento a Lincoln -en Washington-
Secretario Alexander Hamilton Edicio del Tesoro de los EE.UU.
Presidente Andrew Jackson Casa Blanca -en Washington-
Presidente Ulises Grant Capitolio, Congreso -en Washington-
Legislador Benjamn Franklin Saln de la Independencia -Philadela-
Presidente William McKinley Nmero del valor, ornamentado
Presidente Grover Cleveland Valor ornamentado
Presidente James Madison Valor ornamentado
Secretario Salmon Chase Valor ornamentado
Presidente Woodrow Wilson Valor ornamentado
328
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Para establecer si el billete es legtimo o no deben efectuarse las siguientes comprobaciones:
1) Resistencia, exibilidad y sonido del papel.
2) Presencia de bras de seguridad rojas y azules. De tenerse dudas acerca de su legit-
imidad se las puede desprender con una aguja.
3) Calidad del retrato en lo que hace a su nitidez, expresin de vida y brillo en los ojos y
la limpieza de las lneas de su fondo o reticulado.
4) Las nas lneas blancas de las ornamentaciones o guilloches.
5) Relieve de las impresiones en intaglio o calcografa.
6) Superposicin del Sello del Tesoro hecho en tipografa y con tinta color verde, con el
valor del billete hecho en calcografa.
7) La nitidez de los dibujos del anverso y reverso especialmente en ligrammas y ornamentas.
En la serie de 1990 se han implementado dos medidas de seguridad sobre el
mismo formato -en todas las denominaciones menos en el billete de un dlar que se
mantiene igual. Estas medidas son a) hilo de seguridad y b) microletras.
Hilo de seguridad: se ha incorporado durante el proceso de fabricacin del papel un hilo de
seguridad de polister entre el retrato y el borde izquierdo del billete que se puede visualizar
por transparencia, conteniendo en su interior la sigla USA y el valor del billete -en nmero para
el de 100 dlares USA 100 y en letras para el resto de los billetes por ejemplo USA Fifty.
Microletras: la tercera lnea externa del marco del retrato est constituida por la repeticin
de la leyenda THEUNITEDSTATESOFAMERICA sin solucin de continuidad. Esta medida
de seguridad slo se puede ver con el uso de una lupa u otro elemento ptico.
El uso de modernas tecnologas por parte de los falsicadores y con el n de facilitar
el reconocimiento de los billetes autnticos motiv la aplicacin de nuevas medidas que
obligaron a un cambio ms pronunciado del modelo de billete. Se detalla a continuacin
las caractersticas de los nuevos billetes dlares de la serie 1996:
Filigrana o marca de agua: se incorpora durante el proceso de fabricacin del papel y
cuando an las bras estn hmedas. Esta marca la realizan mquinas especiales que
separan o juntan las bras formando claroscuros que pueden ser observados por trans-
parencia y que reproducen la misma sonoma de la gura del retrato.
Retrato: amplicado y descentrado hacia la izquierda de las mismas guras ya detalladas
para cada valor, que coincide con la ligrana. El reticulado del fondo es reemplazado por
lneas concntricas que dicultan su reproduccin en las falsicaciones.
Microletra: esta medida de seguridad se mantiene pero no ya en la tercera lnea externa del
marco del retrato, sino en el sombreado del nmero indicador del valor en el sector izquierdo
y en diferentes posiciones acorde al valor del billete: en los de 100 dlares se encuentra
329
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
conformando la lnea de la solapa de la chaqueta de Franklin; en el de 50 dlares en la parte
inferior del marco y en el resto de los billetes en diferentes adornos del marco.
Hilo de seguridad: se mantiene esta medida con las mismas caractersticas, pero presentan
diferentes ubicaciones y uorescencias al ser expuestos a la luz ultravioleta, en cada valor. En
los billetes de 100 dlares la respuesta uorescente es en color rojo; en los de 50 en amarillo:
en los de 20 en verde amarillento; en los de 10 en blanco y en los de 5 en azul.
Tintas O.V.I.: se ha impreso con tintas de variacin cromtica o dicroicas el nmero indica-
dor del valor del billete ubicado en sector inferior derecho del anverso. Estas tintas tienen la
propiedad de cambiar de color segn el ngulo de incidencia de la luz y de observacin. Al ser
observadas de frente se las visualiza en color verde pero al variar el ngulo cambia a negro.
Sello del banco: se unica este sello para todos los bancos emisores, universalizando as
el smbolo del Sistema de la Reserva Federal. Los bancos siguen conservado sus letras
pero no dentro de este sello. La letra y el nmero que identica al banco emisor aparecen
debajo del nmero de serie del lado izquierdo.
Nmeros de serie: a este nmero se le ha aadido una letra ms -resultando una combinacin al-
fanumrica de once caracteres- y aparece dos veces en el anverso, en el sector superior izquierdo y
en el sector inferior derecho. La segunda letra sigue siendo la correspondiente al banco emisor.
Serie de emisin: el ao de la serie cambia de posicin ubicndose a la izquierda del retrato.
Ayuda visual: en los billetes de 50 dlares y en los de menor denominacin se incorpora
en el reverso, el nmero del valor con caracteres ms grandes.
Efecto cielo: el efecto cielo est ahora constituido por lneas concntricas que dicultan su
falsicacin.
Se reproduce para su visualizacin el anverso y el reverso de un billete de cien
dlares de la serie 1996.
Tipo de Billete
Letra Banco
Hilo de Seguridad
Fondo Retrato
Filigrana o marca de agua
Microletra
Sello Federal Reserve
Serie Emisin
Numeracin 2 Letra del Banco
Tinta Dicroica Tinta Dicroica Serie Emisin
Sello Federal Reserve
Microletra Microletra
330
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Cmo vericar los elementos de seguridad: a) con la vista; b) por el tacto;
c) con luz ultravioleta; y d) con lupa.
Con la vista: vericar la presencia y calidad de la ligrana o marca de agua, la pres-
encia del hilo de seguridad con la inscripcin USA y el valor del billete; y las tintas
dicroicas o de variacin cromtica.
Por el tacto: los sobrerrelieves de las impresiones calcogrcas que son fcilmente
detectables por este sentido.
Con luz ultravioleta: la opacidad o uorescencia neutra del papel.
Con lupa: las leyendas microimpresas; las bras de seguridad azules y rojas; el efecto
cielo y las lneas del fondo del retrato; los guilloches; las vietas; etc.
Otros datos: Por ley sancionada el 11 de julio de 1955 se estipul la leyenda In God
We Trust En Dios Conamos- en el reverso de los billetes dlar. Esta leyenda aparece en
los billetes de un dlar a partir del 1de octubre de 1957 y a partir de 1963 en todas las de-
nominaciones. Los billetes anteriores a esa fecha sin esa leyenda conservan su valor.
Billetes estrella: Una estrella siguiendo el nmero de serie indica que ese billete es
sustituto de otro que fue impreso en forma defectuosa. Tambin son usados para reemplazar
el billete nmero cien millones -para que no se emita un billete con el nmero 00.000.000-.
Con miras de proteger el dinero de sus habitantes, el gobierno de los Estados Unidos
de Norteamrica en el ao 2003, comenz progresivamente a emitir billetes que sern ms
conables, seguros e inteligentes. Aseguran que los nuevos diseos son ms conables
porque poseen medidas de seguridad ms fciles de vericar y ms difciles de falsicar.
Son ms inteligentes porque estarn un paso delante de los falsicadores y se utilizarn las
tecnologas ms modernas, y ms seguros para proteger la integridad y la economa del pas.
Planean cambiar los diseos cada 7 o 10 aos. A nales del 2003 reemplazaron los billetes
Filigrana Impresin ms pequea Efecto Cielo
Fibra de Seguridad N de Lmina Fibra de Seguridad
331
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
de 20 dlares, en el 2004 los de 50 dlares y en el 2005 los de 10 dlares, planeando hacer
lo propio con los de 100 y de 5 dlares, pero no los de un dlar. El gobierno estadounidense
considera que el dlar es un smbolo mundial de seguridad y que se ha ganado merecidam-
ente la conanza de la gente. A modo de ejemplo se describir el billete de 20 dlares.
Los nuevos billetes de 20 dlares tienen la gura del presidente Andrew Jack-
son en el anverso y la Casa Blanca en el reverso y como los actuales, conservan su
tamao, su diseo genrico y cuentan con las siguientes medidas de seguridad:
Papel: de formula secreta, contiene adems de amalgamadores sintticos, bras de algodn y lino
para aumentar su resistencia. Su particular textura produce un sonido caracterstico denominado
carteo, vericndose su exibilidad, resistencia a roturas y tolerancia a los dobleces a travs
de instrumentos de precisin. Posee uorescencia neutra, brillas de seguridad rojas, azules y
amarillas y al observarse al microscopio presenta diminutos puntos luminosos.
Presenta ligrana o marca de agua localizada -es decir en el sector medio del lado
derecho visto desde el anverso- con una imagen que se desvanece, similar a la del retrato,
que puede ser visualizada con idntica nitidez por transparencia desde ambos lados. Adems
presenta hilo plstico de seguridad incrustado en forma vertical en el papel, visualizndose
tambin a trasluz y de ambos lados, las palabras USA TWENTY y una pequea bandera. Este
hilo presenta uorescencia verde bajo la accin de longitudes de ondas ultravioletas.
Tinta de Impresin: tambin de composicin secreta son testeadas su reaccin al calor
y frente a luces potentes y tambin su viscosidad, densidad y penetracin.
En el nmero 20 -representativo de la denominacin- ubicado en la esquina inferior
derecha del anverso, se ha utilizado tinta de variacin ptica (o.v.i.). Esto permite que al
mover el billete hacia arriba y abajo, en forma ms radical o drstica vire de color pasando
del cobre al verde y viceversa.
Se han utilizado colores tenues para la impresin del fondo del billete que ahora
presenta los colores verde, durazno y azul en ambos lados, siendo la primera vez desde la
poca histrica moderna -1929 en adelante- que se abandona la exclusividad de los tradi-
cionales colores verde y negro. Estos colores -distintos para cada denominacin-, permitirn
un ms rpido reconocimiento.
Sistemas de impresin: se ha utilizado el sistema calcogrco que produce sobrerrelieve
por depsito de tinta a presin -cuatro toneladas por centmetro, lo que produce intima
penetracin, en todo el billete menos en el sello del Tesoro, las rmas, las numeraciones
y la letra y numeracin indicadora del banco emisor, que es tipografa.
332
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Anverso del billete: Adems de las caractersticas generales que se indicaran con relacin
al papel y las tintas, se detallan las siguientes:
El retrato no posee ms los bordes ovalados que lo enmarcaban, ni las lneas nas que
lo rodeaban. Andrew Jackson (1767-1845) elegido dos veces presidente (1829 a 1837) sigue
siendo la gura principal, pero ahora se halla desplazado ms arriba y presenta los hombros ex-
tendidos hasta el borde inferior de la vieta, la que presenta detalles adicionales en su fondo.
Se le ha incorporado los siguientes elementos -que sern distintos para cada de-
nominacin, que fueron designados como Smbolos de la Libertad. En el fondo del billete
y a la izquierda del retrato, el guila americana -ejecutada con la forma de los dibujos y los
esculpidos usados durante el perodo del presidente Jackson-, en gran tamao y en color azul.
A la derecha, abajo y prximo a los hombros del retrato, se halla impreso en realce un guila
ms pequea -de diseo ms reciente- y un escudo, ambos en color verde metalizado.
Adems en el fondo a la derecha del retrato, la palabra Twenty Usa en color azul.
Con microletra presenta dos nuevas impresiones. Una con la leyenda Usa20 en color
azul, bordeando las tres primeras letras de Twenty Usa de dicha cinta; y la segunda con
la leyenda theunitedstatesofamerica20usa20 en color negro, en el borde inferior de la
rma del funcionario del Tesoro.
El sello universal de la Reserva Federal se halla ubicado a la izquierda del retrato
y a la izquierda de ste, debajo del nmero de serie de ese lado, una letra y un nmero
representativo del banco emisor. La combinacin de once nmeros y dos letras que
identican el nmero del billete se incorpora dos veces, una en la parte superior izquierda
ya mencionada y otra en el sector inferior lado derecho. La serie con el ao de emisin
2003 se ubica abajo y a la derecha del retrato.
Reverso del billete: Se le ha quitado las lneas que rodeaban la vieta de la Casa Blanca y
a ambos lados de esa gura se le ha incorporado varias cifras 20 en pequeo tamao,
con tintas visibles en color amarillo.
Se mantiene la cifra 20 de gran tamao en la esquina inferior lado derecho,
como caracterstica facilitadota en caso de baja visin, ya que facilita su lectura.
333
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
BILLETES POLMEROS O DURANOTE: el polmero es un sustrato transparente de pelcula plstica
que ha sido utilizado por los australianos en la produccin de papel moneda, reemplazando al
papel a base de bras celulsicas. Este soporte brinda mucha mayor durabilidad cuadriplica su
vida til lo que signica un importante ahorro en los costos de impresin; son ms limpios me-
joran el funcionamiento de cajeros automticos y mquinas de recuento- y son reciclables.
Para hacerlo apto para ese destino, una vez cortado el polmero en planchas, se
lo debe opacar con capas de tinta -salvo en las ventanas o lugares que adrede se desea
mantener transparentes, pudindose utilizar los tradicionales sistemas de impresin de bil-
letes, es decir el offset, el calcogrco y el tipogrco.
Se les pueden incorporar durante el proceso de fabricacin imgenes sombreadas
que actan a modo de ligrana, logrndose diferentes efectos al poder utilizar un completo
rango multitonal del claro al opaco. Asimismo se les pueden incorporar bras e hilos de
seguridad con o sin inscripciones o cdigos.
Admiten las mismas tintas que las utilizadas sobre el papel, es decir visibles, invisibles,
uorescentes, fosforescentes, cromticas, metlicas y de variacin cromtica u pticas.
Los billetes estn constituidos por un ncleo y dos capas externas que son las que
reciben el tratamiento de opacidad -las que luego de ser unidas no pueden ser deslaminadas
debido a la alta resistencia de la unin. La transferencia de los diseos al sustrato puede
hacerse en fro, utilizando adhesivos curables o mediante estampados en caliente.
Las medidas de seguridad que se les incorporen dependern del costo de produccin,
pero admite las mismas que para el papel. A modo de ejemplo se detallarn las medidas
implementadas sobre el billete de diez reales realizado en conmemoracin de los quinientos
aos de la fundacin de Brasil.

Registro Perfecto
Ventana Transparente Hilo de Seguridad
Impresiones en Relieve
Fondo de Seguridad
Marca Tctil
Filtro Vericador
Imagen Latente
N 10 Visible a U.V.
Imagen Oculta Imagen Oculta
N 10 Visible a U.V.
Imagen Latente
Filtro Vericador
Marca Tctil
334
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Registro Perfecto: cuando la rosa de los vientos es observada a contraluz, la exacta co-
incidencia del anverso y reverso permite apreciar un cambio de color en sus puntas.
Ventana Transparente: es parte del diseo de la rosa de los vientos centro y puntas-
combina reas transparentes con medios tonos.
Marca Tctil: la impresin sin tinta del nmero diez sobre la ventana transparente es
perceptible al tacto.
Hilo de Seguridad: incorporado al sustrato en el momento de su fabricacin tiene la propiedad de
ser magntico lo que permite su lectura por mquinas electrnicas de conteo y seleccin.
Filtro Vericador: es el rea roja sobre la ventana transparente y presenta en su interior el
nmero diez, cuyo realce puede visualizarse al doblar el billete a la mitad y hacer incidir
el ltro sobre la embarcacin impresa en el anverso.
Imagen Oculta: una de las embarcaciones de Pedro A. Cabral se visualiza por transparencia en
el sector superior derecho cuando el billete es observado a contraluz. El efecto tridimensional
dado por el manejo de claros y oscuros es similar a una ligrana efectuada sobre papel.
Impresiones en Relieve: el sobrerrelieve dejado por las tintas de impresin es perceptible en el
retrato, en las leyendas Banco Central do Brasil, en los nmeros y las leyendas Dez Reais del
anverso y del reverso, en el mapa Terra Brasilis y en las imgenes de brasileros del reverso.
Nmero 10 visible con Luz Ultravioleta: ese nmero es visible sobre el mapa Terra Brasilis
bajo la radiacin de luz ultravioleta.
Fondos Especiales de Seguridad: estos fondos estn conformados por lneas coloreadas
multidireccionales.
Imagen Latente: en el azulejo portugus ubicado en el sector inferior izquierdo del anverso, con
abundante luz y colocando el billete a la altura de los ojos, se visualizan las letras BC.
Imgenes de Brasileros Registro Perfecto Fondos Especiales de Seguridad
Microletras Impresiones en Relieve Impresiones en Relieve Impresiones en Relieve Impresiones en Relieve Microletras
335
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Microletras: en el sector inferior izquierdo del reverso se ha impreso con microletras
Brasil 500 anos, las siglas de los estados brasileros, las letras BC y el nmero 10.
A estos billetes, una vez que se le han realizado todas las impresiones, se los
recubre con un barniz que los protege contra la suciedad y el manoseo.
La descripcin de los billetes pesos, dlares y polmeros tiene como n que el alumno
sepa cmo buscar las medidas de seguridad que permiten el reconocimiento de un billete
autntico. Este conocimiento es til tanto en la vida profesional como en la cotidiana por lo
que se recomienda su difusin entre familiares y amigos.
336
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
337
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD VIII )
n SILVEYRA, Jorge y otros; Dlar, La moneda del Siglo; Editado por Aplicacin Tribu-
taria S.A. Bs. As. 2000.
n SILVEYRA, Jorge y otros; Falsicacin de Moneda; Ed. Policial; vol. 334. Bs. As. 2001.
n MACHADO SCHIAFFINO, Carlos; Pruebas Periciales; Ed. La Rocca; Bs. As. 1989
n Revista de Polica y Criminalstica; Ed. Policial.
n Publicaciones del Banco Central de la Nacin Argentina.
Bibliografa
u9
unidad nueve
investigacin cientca del delito
) (
341
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
CONTENIDOS DE LA UNIDAD IX
( INVESTIGACIN CIENTFICA DEL DELITO )
1. Distintos tipos de peritajes balsticos.
2. Concepto de Armas.
3. Armas Propias e Impropias.
4. Tipos de armas.
5. Tipos de armas de fuego.
6. Balstica en general.
7. Divisin de la Balstica segn su objeto de estudio.
8. Componentes de algunas armas de fuego.
9. Identicacin de las armas de fuego.
10. Aptitudes y funcionamiento de las armas de fuego.
11. Aptitudes y funcionamiento de los cartuchos a bala.
12. Partes componentes de un cartucho a bala.
13. Identicacin de un arma a travs de los proyectiles secuestrados.
14. Identicacin de un arma a travs de las vainas secuestradas.
15. Calibres.
16. Determinacin de distancias de disparo.
17. Determinacin de impactos.
18. Determinacin de trayectorias.
19. Formas y equipos tcnicos para la determinacin de trayectorias.
20. Celosidad de las armas de fuego.
21. Determinacin de las herramientas utilizadas en el delito.
Mencin sinttica de los contenidos
342
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
343
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
objetivos de aprendizaje de la unidad
oa abogaca a distancia
)
n Introducirnos en el mundo de la Balstica
n Conocer su temtica y principios.
n Partes en que se divide para el cumplimiento de sus objetivos.
n Conocer el concepto de Armas.
n Distinguir los distintos tipos de armas sealadas por la Ley.
n Dentro de las armas en general destacar las armas de fuego.
n Dentro de las armas de fuego, sus diferentes categoras.
n La importancia de la determinacin del calibre de un arma de fuego.
n Partes constitutivas de algunas armas de fuego.
n Posibilidades de Identicacin de las armas de fuego.
n Partes constitutivas de algunos cartuchos a balas.
n Aportes que pueden brindar los proyectiles y las vainas secuestradas en el lugar de los hechos.
n Orientacin investigativa.
n Trayectorias de proyectiles.
n Distancias de disparo.
n Medios tcnicos utilizables para sus determinaciones.
n Celosidades de las armas de fuego.
n Herramientas. Tipos e Identicacin.
344
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
345
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( ESQUEMA CONCEPTUAL DE LA UNIDAD IX )
Distancias de los Disparos
Trayectorias
Celosidades
Efracciones con Herramientas
DETERMINACIN
A travs de los proyectiles
A travs de las vainas
IDENTIFICACIN
Balstica Interior
Balstica Exterior
Balstica de Efectos
BALSTICA
Impropias
Propias
ARMAS
Distintos Tipos
Especialmente de Fuego
346
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
347
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
actividad introductoria
ai
abogaca a distancia
)
El ataque cotidiano y lamentablemente tambin ms salvaje y violento- de la delin-
cuencia, hace que hechos de real importancia slo ocupen un pequeo lugar en la prensa.
Lea el siguiente artculo tomado del diario Publimetro del 30 de abril de 2001.
La muerte de un joven de 23 aos asesinado con el uso de un arma de fuego, dada su
frecuencia, ya casi no es tomada en consideracin ni causa la conmocin que debiera, a pesar
de que el accionar policial logra -segn se desprende del mismo- la identicacin del autor.
Como profesional abogado son muchos los roles que en un caso similar se puede de-
sempear: Juez y/o personal del juzgado, Fiscal, Defensor, Querella. Para ello es necesario
tener conocimientos esenciales en balstica que hacen a la conformacin o desnaturalizacin
de la prueba. Ese el objeto de esta unidad.
En un tema tan amplio como es la balstica, slo se podr resear brevemente sus
principales lineamientos los que, empero y sin lugar a dudas, les aportarn un apreciable
auxilio en las tareas que deban desempear.
Reexione, antes de introducirse en el tema cules, son sus conocimientos actuales
y despus vuelva a revisar los resultados obtenidos.
348
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
349
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( DESARROLLO DE LA UNIDAD IX )
Tratar un tema tan extenso como Balstica en una unidad es una tarea tan compleja
como ilusoria, ya que sus alcances son muy variados y el tratamiento de todos y cada uno
de los temas requiere conocimientos prcticos de Fsica, de Qumica, de Criminologa, de
Medicina, de Medicina Legal, del Derecho, etc.
Como se desprende de la sntesis de contenidos y del objeto de aprendizaje de esta
Unidad, slo se efectuar un recorrido sobre los principales tpicos, con el n de que el
alumno se mimetice con el entorno balstico y que, de resultarle de inters, lo profundice
con la amplia variedad de textos que desarrollan la temtica.
Si bien de las acepciones de balstica que sern aportadas oportunamente- surge
que corresponde su intervencin ante cualquier elemento lanzado por el medio que fuera
o que caiga libremente por efecto de la gravedad, en el presente desarrollo, se tratarn
nicamente los referidos a intervenciones con armas y dentro de ellas las de fuego.
Se hace necesario, entonces, denir el concepto de armas. Muchas son las deni-
ciones aportadas por aquellos que han tratado y/o tratan sobre el tema. Particularmente por
su simpleza y alcances, se estima que la siguiente cumple acabadamente con su misin,
sin que por ello se desmerezcan las otras:
Arma: es todo elemento que aumenta el poder ofensivo o defensivo del hombre.
Dentro de este alcance se encuentran las armas propias y las impropias, a las
que se puede denir de la siguiente manera:
Armas propias: son todos aquellos elementos que han sido creados para aumentar el
poder ofensivo o defensivo del hombre.
Armas impropias: son todos aquellos elementos que, no habiendo sido creados para aumentar
el poder ofensivo o defensivo del hombre, pueden ser utilizados para ese n.
Son ejemplos de estas ltimas entre otros: un palo de golf, un martillo, una madera,
una piedra, un hacha, etc.
Balistca
350
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Genricamente las armas propias se las puede clasicar, entre otras, en: a) armas blancas; armas blancas armas blancas
b) armas arrojadizas; c) armas de proyeccin; d) armas de contusin y f) armas de fuego:
Armas blancas: son armas de puo que poseen una hoja de acero con o sin lo, de dis-
tintos tamaos y formas. A su vez por su accin, se las clasican en:
1) de punta y 2) de punta y corte.
De punta: la hoja de acero slo presenta lo o aguzamiento en su punta y como su
nombre lo indica deben ser utilizadas como armas de penetracin o perforacin por
incidencia de la misma. El ejemplo ms claro de este tipo de armas es el orete, que
acta por introduccin de su punta provocando un oricio lesivo. De no ser utilizado
de esa manera, debe ser considerado como un arma impropia.
De punta y corte: la hoja de acero presenta adems de una punta aguzada, lo en uno o
ms bordes y en forma parcial o en toda su extensin, por lo que adems de penetrar pro-
voca cortes laterales. El ejemplo ms claro es un cuchillo o una espada. Una u otra forma
de lesionar punta o corte- pueden ser utilizadas en forma conjunta o separada.
Armas arrojadizas: son armas de utilizacin manual por arrojamiento y pueden presentar
distintas formas, tamaos y composiciones, como por ejemplo: las boleadoras, el bumern,
la lanza, la jabalina, etc.
Armas de proyeccin: son armas que poseen mecanismos que dotan de fuerza impulsora a
elementos especialmente preparados para causar daos. A diferencia de las anteriores estn
compuestas por dos partes vinculantes: el arma de proyeccin y los elementos o municiones
para ser arrojados. Ejemplos: arcos y echas; cerbatana y dardos; honda y piedras; etc.
Armas de contusin: son armas que provocan lesiones por golpe, choque o incidencia
directa. Ejemplos: el ltigo, la fusta, el bastn -tonfa, la cachiporra, etc.
Armas de fuego: son armas que arrojan proyectiles a distancia, utilizando para ello la
energa resultante de la deagracin de la plvora. Al igual que las armas de proyeccin
requieren de dos partes vinculantes: el arma y la municin.
Segn la forma de su carga pueden ser: a) de avancarga y b) retrocarga.
Avancarga: la colocacin de su carga o proyectil se efecta por la boca del can, de-
pendiendo del tipo de arma el grado de complejidad de esta operacin. Ejemplos: obs,
mortero, can, etc.
Retrocarga: son armas que se cargan por la parte posterior de su mecanismo y normalmente
tienen un almacn cargador. Ejemplos: revlver, pistola, escopeta, etc.
351
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Las armas de fuego estn reguladas por la Ley Nacional de Armas y Explosivos nmero
20.429 del ao 1973 y su Decreto Reglamentario 395 del ao 1975. Segn estas disposicio-
nes las armas de fuego se clasican en: a) armas de lanzamiento; b) armas porttiles; c)
armas no porttiles; d) armas de puo; e) armas de hombro; f) armas de carga tiro a
tiro; g) armas de repeticin; h) armas semiautomticas; e i) armas automticas.
Armas de lanzamiento: se denominan as a aquellas armas que arrojan proyectiles o elementos
autopropulsados, granadas y municiones qumicas o explosivas. Son algunos ejemplos: lan-
zamisiles, lanzagases, lanzallamas, torpederos, etc.
Armas porttiles: son todas aquellas armas que pueden ser transportadas y/o disparadas por un
solo hombre, sin requerir ayuda alguna. Ejemplos: fusiles, pistolas, revlveres, escopetas, etc.
Armas no porttiles: son todas aquellas armas que para ser transportadas o disparadas requi-
eren de la participacin de ms de un hombre o la cooperacin de un animal o mecanismos
diversos. Ejemplos: tanques, caones de gran porte, artillera pesada, etc.
Armas de puo: tambin denominadas armas cortas. Son armas de empue diseadas
para ser utilizadas por un solo hombre con una sola mano, no requiriendo apoyo de otra
parte del cuerpo ni externo. Ejemplos: pistolas, revlveres, etc.
Armas de hombro: tambin denominadas armas largas. Son armas que requieren el uso
de ambas manos o del apoyo en el hombro del tirador y de all su nombre. Ejemplos:
escopetas, fusiles, etc.
Armas tiro a tiro: son todas aquellas armas donde el tirador debe efectuar para cada disparo, toda
la operacin de carga y descarga en forma manual. Ejemplo: escopetas, pistoln de caza, etc.
Armas de repeticin: al igual que en las armas de tiro a tiro, toda la operacin de carga y des-
carga la debe efectuar el tirador con cada disparo, la diferencia est en que estas armas poseen
almacn cargador para alojar los cartuchos facilitando as esta operacin. Ejemplo: fusil Mauser,
escopetas a repeticin.
Armas semiautomticas: son todas aquellas armas que poseen el ciclo de descarga y carga en
forma automtica y donde el tirador debe presionar la cola del disparador para cada disparo.
Ejemplo: pistolas.
Armas automticas: son armas donde el ciclo de carga y recarga es automtico y dependiendo
de la presin ejercida sobre la cola del disparador, se puede realizar desde varios disparos hasta
agotar la carga del almacn cargador. Ejemplo: pistolas ametralladoras.
352
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Por su nima hueco conformado por las paredes interiores del can de las armas
de fuego, estas armas pueden ser de nima lisa o nima rayada. En las correspondientes al
primer tipo, las paredes interiores del can son lisas y pulidas no presentando ningn tipo
de relieve. Las que poseen nima rayada presentan estriado o depresiones hechas por un
troquel, que tienen como funcin dotar al proyectil de un movimiento helicoidal giroscpico
que lo estabiliza, asegurando una correcta trayectoria direccional.
Son ejemplos: el pistoln de caza, las escopetas, etc. para las armas de nima lisa,
y las pistolas, revlveres, ametralladoras, etc. para las de nima rayada.
Efectuadas estas consideraciones se hace necesario ahora introducirnos en el concepto
de Balstica (vocablo cuya etimologa es de origen latino, proveniente de la palabra balista -y
sta del griego ballein arrojar, denominndose as a una mquina de guerra antigua -especie
de ballesta grande- que serva para arrojar saetas, balas, etc.) denindosela como:
Balstica: es la ciencia o arte de calcular la direccin y alcance de los proyectiles.
Estudia asimismo en forma integral a las armas de fuego, a sus municiones, y den-
tro del amplio concepto que abarca el trmino proyectil, engloba a cualquier cuerpo que
pueda ser lanzado al aire por cualquier medio manual o neumtico- o bien que caiga por
su propio peso y tambin a los efectos que stos provocan.
En base a los objetos temticos que abarca, se la divide en tres grandas ramas o
partes fundamentales: a) balstica interior; b) balstica exterior y c) balstica de efecto,
las que se analizarn por separado.
Balstica Interior: tiene a su cargo el estudio de todas y cada una de las partes o piezas com-
ponentes de un arma, tendiente a determinar sus estados, sus calidades y capacidades y las
interrelaciones sincrnicas con las dems. Asimismo la realizacin de idnticos estudios con
relacin a los cartuchos a bala correspondientes al arma. Del anlisis surgido se determina las
aptitudes para el disparo y el funcionamiento de las armas de fuego y de sus municiones.
Corresponde tambin a la balstica interior, todas las determinaciones mecnicas
y fcticas que hacen a la produccin de un disparo hasta que el proyectil abandona la
boca del can, es decir, desde que el percutor activado por el accionamiento de la cola
del disparador provoca la electricidad o chispa necesaria para la combustin de la carga
propulsora, que dota al proyectil -a travs de la fuerza expansiva de los gases producidos-,
del necesario ngulo de inclinacin para su entallado en las estras, de velocidad, de giro
alrededor de su eje, de forzamiento y direccin para que abandone el nima del can a
353
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
travs de su boca, hasta en las armas semiautomticas o automticas- realizar los mov-
imientos de expulsin de la vaina servida y el alojamiento del nuevo cartucho, para dejar al
arma preparada para efectuar un nuevo disparo.
Balstica Exterior: comienza cuando el proyectil, as dotado de velocidad y rotacin sobre su eje
que le permitir dirigirse hacia el blanco con estabilidad y precisin, inicia su trayectoria inme-
diatamente despus de abandonar la boca del can. A partir de all ir sufriendo las incidencias
de las fuerzas de resistencia del aire y de la gravedad, que le hacen perder velocidad y, por ende,
alcance y lo atraen hacia el suelo, provocando que la trayectoria sea una curva parablica.
Tambin inuyen sobre el proyectil los siguientes factores atmosfricos: a) el peso del
aire: que depende de la presin atmosfrica, de su densidad, del coeciente de hume-
dad, de la temperatura y de la altura a nivel del mar; y b) el viento: que frena, aumenta
su velocidad o lo desva lateralmente, ya sea que inuyan de frente, desde atrs o de los
costados respectivamente.
Corresponde entonces a la balstica exterior, el comportamiento del proyectil desde
que abandona la boca del can hasta que alcanza el blanco o cae por su propio peso.
Balstica de efecto: como su nombre lo indica estudia la accin o efectos que el proyectil
provoca al impactar -sea en el blanco deseado o no- sobre personas, animales o cosas.
Adems de los factores que intervienen sobre el proyectil en los dos componentes de la
balstica interior y exterior- ya analizados, la penetracin y/o perforacin que provocar
al impactar, estar en relacin directa con la naturaleza constitutiva del objeto alcanzado,
del proyectil y de otros factores imponderables.
El blanco puede ser de naturaleza blanda cuerpos humanos, animales, etc.- o dura cu-
erpos rgidos-. Dentro de las propiedades fsicas del blanco o del proyectil que inuyen sobre los
efectos que ste puede provocar, se pueden mencionar las siguientes: dureza; exibilidad; aus-
encia de defectos o anomalas constitutivas; rebotes o saltos sufridos luego de haber impactado
sobre otra supercie; deformaciones; lugares de impacto msculos, huesos, plegados, dobleces,
soldaduras, bordes, etc.-; ngulos de tiro, de impacto o incidencia y de penetracin; etc.
Como se comprender de lo detallado, la problemtica balstica es realmente muy amplia.
A los efectos de esta materia se efectuar un recorrido sobre los principales temas. De todas
las armas detalladas -por la frecuencia de su uso en el campo delictivo- slo nos referiremos a
las de puo o cortas, y en ellas a las diferencias fundamentales entre sus dos principales tipos:
los revlveres y las pistolas.
354
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Calibre tomado sobre los campos del proyectil.
Calibre tomado desde los macizos del nima del can
Revlveres: a pesar de la gran cantidad de modelos, marcas, calibres y largos de can
existentes, su funcionamiento es, bsicamente, comn a todos. La totalidad de los modelos
poseen una armadura que sostiene todas las piezas y permite su empue. El resto de su
descripcin requiere pormenores de sus: a) calibres; b) largos de caones y de municiones;
c) mecanismos de disparo; d) sistemas de percusin y e) sistemas de carga.
Calibre: es una de las caractersticas ms relevante de un arma de fuego y se reere al dimetro
interior de sus caones o dimetro de sus nimas y por extensin al dimetro de los proyectiles
por ellas disparados. La boca del can o abertura que da al exterior se denomina boca de
fuego, cuya medida es la que conforma o determina el calibre del arma. La bala del
cartucho es de dimensin superior a la boca de fuego para poder recibir, al ser impulsada
por los gases de la deagracin de la plvora, el forzamiento requerido para adquirir, en
forma aumentada, el impulso que lo arroja a gran distancia.
En los caones de nima rayada el calibre se mide a nivel de los macizos ya
que corresponde a la medida del nima virgen, es decir, antes de efectuarse el estriado.
Por contrario imperio en los proyectiles se mide sobre los campos, que corresponde
al dimetro del proyectil antes de su deformacin por el forzamiento producido por
la deagracin de la plvora. En las guras adjuntas se observa la forma de medir el
calibre en un proyectil y en el nima de un can.
355
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Largo del can y de las municiones: se debe tener en cuenta que la longitud del can permite
una mayor precisin en la trayectoria del proyectil. Dentro de un mismo calibre pueden presen-
tarse distintos largos de can (2, 4, etc. pulgadas) y de los cartuchos a bala, denominndoselo
por ejemplo: 32 corto o 32 largo.
Sobre el can se encuentra el sistema de puntera compuesto por el guin y el alza.
La correcta utilizacin de estos elementos corrige el efecto de la gravedad sobre el proyectil
(alza) y facilita una correcta puntera.
Mecanismo de disparo: pueden ser de simple o doble accin. En los primeros para poder
concretar un disparo, se hace necesario primeramente montar el martillo desplazndolo hacia
atrs. En los de doble accin el disparo se produce simplemente al ejercer presin sobre la
cola del disparador.
La accin del martillo sobre el percutor produce el estallido de la cpsula fulminante
que da comienzo al proceso de disparo, el que ser descrito conjuntamente con las partes
de los cartuchos a bala. Dentro de las diferencias en el mecanismo de disparo se aclara que
el percutor puede estar jo en forma solidaria o conjunta con el martillo, mvil es parte del
martillo pero tiene posibilidades limitadas de movimiento y/o otante separado del martillo
y dentro de un resorte que permite su recuperacin.
Sistemas de percusin: se distinguen tres sistemas de percusin: percusin de fuego central,
perifrico o anular y lateral. Los primeros central- poseen la cpsula con el fulminante en la
zona central del culote de la vaina. Los segundos perifricos o anular- el anillo perifrico externo
posee el fulminante y en cualquier sector de ste que incida el percutor se produce la ignicin
y el consecuente disparo. Los de percusin lateral son muy antiguos y constituyen verdaderas
piezas de museo -como los denominados Lafouchette-. Los cartuchos poseen una pa o
pivote en el lateral de la vaina y prxima al culote, que al ser golpeado por el martillo se desplaza
al interior golpeando sobre el fulminante, provocando la ignicin.
Sistemas de carga: el almacn cargador de un revolver se denomina tambor y los compartimien-
tos para alojamiento de cada uno de los cartuchos a bala se denominan alvolos. Para su carga
debe procederse segn el sistema que posea, distinguindose entre otros los siguientes:
a) de tambor volcable a la izquierda o a la derecha. Esto permite extraer las vainas y
colocar los cartuchos en cada alvolo;
b) de tambor extrable es decir que para la carga y descarga se debe extraer el tambor
de la armadura;
356
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
c) de can y tambor articulables en una sola pieza que se quiebra y se desplaza hacia
abajo dejando al descubierto los alvolos para su carga y
d) de retn volcable donde a la izquierda o derecha del tambor hay un retn que se
puede desplazar dejando al descubierto un alvolo para su carga, girando el tambor
luego de cargar cada alvolo individualmente.
Obsrvese en la gura siguiente las partes principales de un revlver.
Pistolas: son armas de puo semiautomticas donde el tirador una vez accionada la corredera
y colocado el cartucho a bala en posicin, slo debe efectuar pulsaciones sobre la cola del
disparador para provocar tantos disparos como cartuchos permita su almacn cargador.
Acorde a los diferentes modelos y marcas pueden variar en calibre, cantidad de cartuchos en
el almacn cargador, ser de simple o doble accin, tener martillo a la vista u oculto, siendo
su percutor normalmente otante.
Colocado el cartucho en posicin por accionamiento de la corredera que lo extrae
del almacn cargador- el arma se encuentra en condiciones de ser disparada. Producido el
disparo, la accin de los gases provocados por la deagracin de la plvora no slo expulsa
al proyectil, sino que desplaza hacia atrs la corredera permitiendo la expulsin de la vaina
servida y la carga de un nuevo cartucho durante el movimiento de recuperacin del resorte.
Las piezas bsicas de una pistola son:
a) la armadura, que sostiene las diversas piezas del arma;
b) la corredera, que contiene el aparato de puntera y que se desplaza -por accin de los
gases de la deagracin de la plvora y del resorte o espiral recuperador- hacia atrs
y hacia delante sobre las guas ubicadas en la armadura;
c) el retn de la corredera, que la traba y la mantiene abierta una vez que se agot la carga
del almacn;
357
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
d) el can, normalmente desmontable ubicado en el interior de la corredera;
e) el extractor, ubicado en la corredera y que a travs de su ua extractora tiene como
misin extraer las vainas servidas de la recmara, arrastrndolas hasta su expulsin;
f) el botador, ubicado en la parte posterior de la armadura que tiene como misin expulsar
las vainas servidas por la ventana de la corredera;
g) el almacn cargador ubicado en la empuadura, que tiene como tarea el contener los
cartuchos a bala que luego sern desplazados por la corredera a la recmara y
h) el mecanismo de disparo que produce una vez accionada la cola del disparador, la cada
del martillo sobre el percutor, que al golpear la cpsula fulminante produce el disparo.
Obsrvese en la gura siguiente las partes principales de una pistola.
Municin y /o cartuchos a bala: El inciso 22 del artculo 3 del Decreto reglamentario 395/75
de la Ley 20.429- enuncia como municin a la designacin genrica de un conjunto de
cartuchos o tiros. En tanto que el trmino cartucho que deriva del italiano cartoccio y ste
del latn charta (papel)- signica carga de plvora y municiones o de plvora sola que cor-
responde a cada tiro de un arma de fuego. Podemos denir entonces:
Cartucho a bala; es la unidad de carga de un arma de fuego y puede ser de fuego
anular, central y perifrico.
358
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Se hace necesario aqu aclarar dos trminos que normalmente son mal utilizados.
Se denomina bala a la parte integrante de un cartucho a bala cuyas caractersticas
topogrcas se describirn a continuacin- mientras no haya sido disparado. Se denomina
proyectil a la bala que ha sido separada del cartucho y disparada por accin de los gases
de la deagracin de la plvora. Asimismo se aclara que el trmino deagracin indica
la accin y efecto de arder sbitamente una sustancia con llama pero sin explosin.
Se ilustra con la siguiente gura a modo de detalle de sus componentes, la topografa
y la nomenclatura de un cartucho a bala de calibre. 45 tomado como ejemplo:
Dentro de los diferentes componentes de un cartucho a bala un lugar muy especial
lo ocupan las vainas que parten de un disco metlico que tratado en forma sucesiva con
prensas, tornos y taladros alcanza su conguracin nal. Sus partes no poseen igual es-
tructura, ya que requieren zonas elsticas cuello y hombro- y otras de gran dureza parte
trasera- para cumplir ecazmente con su tarea. Entre los materiales utilizados en su fabri-
cacin pueden mencionarse: el latn, el acero, el acero recubierto con estao o tungsteno,
aluminio, nquel y el amplio campo que presenta la utilizacin de plsticos sintticos.
359
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El culote de las vainas de las pistolas posee un reborde y un canto de reborde
que sirve de enganche a la ua extractora. Todas tienen una cpsula con el fulminante
enfrentada a un yunque. Cuando el percutor golpea sobre ella se deforma y al incidir
sobre el yunque se produce la chispa necesaria para iniciar el proceso del disparo. La
ignicin se trasmite al interior de la vaina a travs de dos odos comunicantes, iniciando
la deagracin de la plvora all alojada.
La plvora que se encuentra en estado slido, al combustionarse pasa a un estado
gaseoso requiriendo mucho ms espacio, por lo que ejerce presin hacia todas direcciones.
La parte ms vulnerable, la que ofrece menos resistencia, es la del cuello de la vaina donde
se encuentra engarzada la bala de plomo.
La bala posee un ncleo que puede estar o no recubierto por una camisa metlica pre-
sentando una punta y una ojiva las que son de menor dimetro que el resto, separado por el
resalto de forzamiento. Entre este resalto y el chan del culote de la bala se encuentra la zona de
forzamiento o zona til del proyectil donde se estampan las caractersticas del nima del arma.
INVESTIGACIONES BALSTICAS CRIMINALSTICAS: Ocurrido un hecho, al practicarse la inspec-
cin ocular o retrato del lugar se dispondr prioritariamente la intervencin de los diferentes
peritos, que determinarn los testigos mudos que han quedado en el lugar y a partir de los
cuales se tratar de dilucidarlo. Dentro del tema balstico especco de esta unidad, se debern
efectuar durante esa inspeccin y en los laboratorios periciales, todas las diligencias tendientes a
dilucidar algunos interrogantes que aportarn datos de inters para la investigacin del caso.
Dentro de las muchas determinaciones balsticas a realizar se pueden men-
cionar las siguientes:
a) determinacin de trayectorias del disparo;
b) determinacin del tipo de arma utilizada partiendo de los proyectiles o de las vainas
secuestradas;
c) determinacin de fecha del disparo;
d) determinacin de celosidad del arma;
e) determinacin del arma utilizada a travs del proyectil o vaina secuestrado y
f) determinacin del oricio de entrada y de distancias del disparo.
Determinacin de trayectorias del disparo: se denomina trayectoria a la lnea que describe
un proyectil en el espacio y su determinacin depender, fundamentalmente, de la dis-
tancia y del tipo de lugar donde se produzcan. Tomando como lugar una ciudad y sus
caractersticas edilicias, en distancias superiores a setenta metros los clculos se efectan
360
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
en base a tablas balsticas de cadas de proyectiles. Cuando no se supera esos valores
salvo en cartuchos destinado a nes especcos- su recorrido ser no parablico, es
decir rectilneo, lo que permite su establecimiento.
La determinacin de la trayectoria de un proyectil puede ser precisa o relativa depen-
diendo de la cantidad de puntos afectados. De determinarse al menos dos puntos afectados
por el mismo proyectil sin desviaciones, la trayectoria ser precisa, es decir se puede establ-
ecer el lugar de donde parti el mismo. Para ello se debe trazar una lnea imaginaria entre los
centros de ambos puntos de impacto. La prolongacin de esa lnea hacia el lado contrario del
recorrido original del proyectil, nos indicar el lugar exacto desde donde parti el disparo.
La reconstruccin de esa lnea se efecta a travs de un hilo o cuerda que pasa por
el interior del centro geomtrico de ambos oricios lo sucientemente tensada como para no
formar curvatura. Alineando ambos ojos con la cuerda hacia el lado exterior del primer impacto,
se establece en forma precisa la trayectoria. Actualmente se sustituye el tendido de la cuerda
por una luz lser bidireccional, que colocada en una posicin intermedia a ambos puntos de
impacto y hacindosela pasar por sus centros, su prolongacin seala la posicin del tirador.
Para ello deben establecerse las siguientes angulaciones:
a) ngulo de tiro: es el conformado por la recta paralela al suelo (horizontal) y el eje longi-
tudinal del can del arma, tomndoselo desde el centro de la boca de fuego y
b) ngulo de incidencia: es el formado por la horizontal del oricio de entrada en cuerpos
mviles (personas, animales, vehculos, etc.) debe tenerse en cuenta su posicin en el
momento del alcance- y la trayectoria del proyectil.
En la siguiente gura se observa la demarcacin de la lnea de trayectoria de un
proyectil que ha ingresado por la ventana de una habitacin perforando su vidrio e impac-
tando sobre una pared para caer luego al suelo por falta de fuerza de penetracin.
361
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
De contarse con un solo punto de impacto de un proyectil por ejemplo sobre el
vidrio de la ventana pero sin impactar sobre la pared por falta de fuerza- la trayectoria se
busca de igual manera pero su determinacin no ser precisa sino relativa, por falta de
datos tcnicos para su medicin.
Determinacin del tipo de arma utilizada partiendo de los proyectiles o de las vainas se-
cuestradas: ocurrido un hecho y secuestradas en el lugar vainas o proyectiles de armas
de fuego, se puede orientar la investigacin en la bsqueda de los posibles tipos de armas
que pudieron haberlas disparado. Como en todos los casos de determinacin indirecta de
identidad, los estudios son por descarte, es decir por eliminacin de todas aquellas armas
que no pudieron haber disparado esos elementos. Como las caractersticas son diferentes,
si se parte de vainas o de proyectiles, se los tratar por separado.
Datos que aportan las vainas: normalmente en el lugar del hecho las vainas encontradas
son de pistolas o armas semiautomticas en las que, como ya se indicara, sus descargas
y cargas son automticas. Sin embargo tambin es posible hallar vainas correspondi-
entes a revlveres cuando se ha efectuado el recambio de la carga de su tambor-. Las
presencias de reborde y de su canto que son indicadoras de vainas de pistolas para
enganche de la ua extractora-, no indican que hayan sido disparadas por ellas, ya que
pueden utilizarse en revlveres como por ejemplo las de calibre 32 y 45.
Se debe determinar primeramente el calibre de las vainas de esta manera se
descartan todas aquellas armas que posean calibre distinto. Si bien muchas vainas tienen
estampado en sus culotes el calibre y la marca del fabricante, su determinacin se efecta
por medicin y comparacin con el muestrario de coleccin de todas las municiones o
cartuchos a bala de produccin nacional o extranjera que, debidamente clasicados por
calibres y armas, debe tener todo profesional balstico. Determinado as, debe vericarse
por comparacin de una vaina disparada con armas de ese calibre.
Si la vaina hubiera sido disparada por un revlver, nicamente se encontrarn sobre
ella las marcas dejadas por la accin de la aguja del percutor y de la friccin contra su es-
paldn, siendo muy difcil la determinacin de los tipos posibles de arma empleada, ya que
slo se poseen los datos de calibre, tipo de sistema de percusin central, anular, lateral- y
su forma. De cualquier manera se habrn descartado varias marcas y modelos.
Si las vainas fueron disparadas por pistolas, adems de los datos ya mencionados
se determinarn sobre ellas las marcas del extractor, del botador salvo en aquellas pis-
tolas que esta tarea es ejercida por los labios del cargador o el extractor-, de los labios del
almacn cargador y de la recmara.
362
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Las diversas huellas que dejan en el culote de las vainas en sus bordes o en su
porcin central- el percutor, la friccin sobre el espaldn, la ua y/o el extractor, y el botador
son muy tiles para la determinacin del arma empleada, especialmente las ubicaciones
relativas del botador y el extractor, ya que las angulaciones que forman son caractersticas
de marcas y modelos de armas. A esto se le deben sumar los surcos o estras que sobre
su supercie cilndrica, dejan los labios del almacn cargador y la recmara.
Si bien en la mayora de las armas semiautomticas las expulsiones de las vainas
son hacia la derecha, en unas pocas son a la izquierda y en otras hacia arriba. Estos
sistemas se pueden establecer, teniendo en cuenta la posicin de la vaina dada por
la huella circular provocada en los bordes del culote por el can. Teniendo en cuenta
esto, los autores Metzger, Hees y Heslacher han distinguido seis tipos de huellas de
expulsin y ocho tipos de huellas provenientes del can, efectuando tablas por los
dimetros del alojamiento del percutor y por el sistema de expulsin.
La sumatoria de todos estos elementos permiten descartar las armas que no
han podido disparar esas vainas, detallndose segn los casos, las marcas y modelos
que s son compatibles con su disparo.
Datos que aportan los proyectiles: son generalmente ms precisos que los aportados por
las vainas. Se hace mencin que los proyectiles incriminados secuestrados en el lugar del
hecho o extrados de las vctimas pueden encontrarse: a) ntegro y sin deformaciones;
b) ntegro pero con deformaciones parciales o totales y c) incompleto.
Acorde el estado en que se encuentran, la determinacin del calibre presentar o no
dicultades. De estar ntegro y sin deformaciones se obtiene midiendo con un calibre dos estras
opuestas y determinando su peso los de igual aleacin- o su peso especco los de distinta o
desconocida aleacin, a travs de una balanza hidrosttica. De estar completo, pero deformado
o aplastado en forma total o parcial en su parte til de manera tal que no sea posible medir dos
estras opuestas, se lo debe medir por su culote, el que normalmente no sufre deformaciones y
efectuarse idnticas determinaciones de peso. Si est incompleto se efectuarn las mediciones y
pesos posibles, acorde a los porcentuales estimativos de prdidas sufridas y se compararn con los
valores de las tabulaciones de aquellos proyectiles que lgicamente pudieran ser compatibles.
Obtenido el calibre quedan automticamente descartadas todas aquellas armas que no
coincidan con l. Del estudio del proyectil se pueden determinar, adems, los siguientes elementos
que aportaran datos para la determinacin del tipo marcas y modelos- del arma utilizada:
a) cantidad de estras; b) ancho de las estras; c) direccin de las estras y d) paso de la espira.
363
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Con respecto a a) cantidad de estras, lo comn es que sean cinco o seis pero pueden
ser entre cuatro y ocho-, debe determinarse cuantos macizos y cuantos campos posee
tenindose en cuenta que stos son jos pero no excluyentes para una determinada marca
y modelo de arma. En cuanto a b) su ancho, tambin lo son, pero debe considerarse que,
dentro de una misma marca y modelo, -por desgastes de troquel empleado- pueden llegar
a tener diferencias de 0,002 de pulgada. Por c), la direccin o inclinacin ms comn es de
izquierda a derecha, pero tambin puede ser de derecha a izquierda como en las pistolas
Colt calibres 25, 32, 38 y 45. Con relacin a d) el paso de la espira, se obtiene midiendo
el recorrido de un campo y su relacin con una vuelta o recorrido completo ideal.
Obtenidos estos datos y del cotejo con el chero de armas de fuego, se descartan
aquellas que se diferencien y se detallan las que se correspondan. Teniendo en cuenta que
el chero puede estar desactualizado, se debe informar -al igual que con las mquinas de
escribir analizadas en la unidad correspondiente- que puede tratarse adems, de otra arma
que presente las mismas caractersticas de las detalladas.
Determinacin de fecha del disparo: el paso del proyectil por el nima del can al ser dis-
parado, va acompaado de residuos o productos originados por la deagracin completa o
incompleta de la plvora, sus gases, etc. Como estos restos no son inertes, la teora indica
que de su correcta interpretacin se podra determinar lo que se ha dado en llamar fecha
o tiempo del disparo. Sin embargo, hasta el presente no se ha logrado un mtodo tcnico
cientco que permita responder a esa requisitoria en forma categrica y fundada.
Una serie de factores intrnsecos, extrnsecos e inciertos dados por las diferencias en los
tipos de armas, en sus municiones, la cantidad de disparos efectuados, temperatura y humedad
ambiente, la falta de mantenimiento o cuidados sobre el arma, etc. conspira para la determinacin
de una ecuacin que permita mensurar la evolucin o transformacin de esos residuos.
Del hisopado del nima del can y de los alvolos en los revlveres, se podrn
recoger los restos all depositados, los que sern sometidos a reconocimientos fsicos y
qumicos. Acorde a lo hallado, se podr determinar: a) la presencia de partculas de dife-
rentes formas y tamaos, de color negruzco, sin restos de lubricantes u xidos, que
podran corresponder a restos de deagracin de plvora. Su fehaciente determinacin
se efecta con procedimientos qumicos, que procuran la identicacin de sustancias
oxidantes, preferentemente nitratos o nitritos. Determinados los mismos se establecer
que el arma fue disparada; b) la presencia de herrumbre. Por medio de sensibles tc-
nicas analticas se podr determinar la aparicin o ausencia de sustancias oxidantes
y nitritos. De no determinarse se armar que el arma no ha sido disparada; y c) la
364
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
presencia de aceites lubricantes. Esto es determinante de una limpieza del arma, por
lo que se puede informar que la misma no ha sido disparada despus de su limpieza,
no pudindose determinar la fecha en que sta ha sido realizada.
De lo expuesto surge que hasta que nuevos mtodos o tcnicas permitan otras
determinaciones, slo es posible informar que un arma a) ha sido accionada; b) que no
lo ha sido; o c) que ha sido limpiada y por lo tanto no es posible expedirse.
Determinacin de celosidad del arma: se denomina celosidad a la fuerza de traccin
que se debe ejercer sobre la cola del disparador de un arma de fuego, para que el
disparo se produzca. Lgicamente, debe mensurarse en toda arma de doble accin, la
fuerza necesaria para producir el disparo estando el martillo montado (accin simple)
y la necesaria si no lo estuviera (doble accin).
Los procedimientos de mensura que brindan mayor exactitud son los obtenidos me-
diante el promedio de los valores logrados en repetitivas experiencias, con la utilizacin de
dinammetros u otros instrumentos de tecnologa electrnica. Cotejados dichos resultados
con la tabla de valores promedio de celosidades obtenida con diferentes armas o con los
datos originales de fbrica, se podr cotejar si son coincidentes, mayores o menores. En
caso de resultar un valor inferior se podr concluir que el arma es celosa.
Determinacin del arma utilizada a travs del proyectil o vaina secuestrada: se hace
necesario aqu hacer una breve referencia sobre lo que se ha denominado personalidad
de un arma de fuego. Toda arma de fuego posee una personalidad bien denida que
la diferencia y distingue de las dems armas de la misma marca y modelo y puede ser
identicada a travs de las representaciones que se imprimen en la zona de forzamiento
o til del proyectil y en el cuerpo de la vaina por ella disparada.
Lgicamente habr semejanza recordar la diferencia con identidad- en todas aquel-
las armas de la misma marca y modelo que fueron producidas en la misma serie y por las
mismas herramientas. Esas semejanzas estarn dadas en su dimetro, nmero, ancho y
direccin de las estras y el paso de su espira, empero cada una de ellas tendr caracter-
sticas individuales que las hacen nicas.
El rayado o estriado efectuado al nima del can de un arma para que los proyectiles
disparados por ella adquieran un giro sobre su eje y un movimiento giroscpico que le da
ms efectividad, le coneren asimismo la personalidad necesaria para identicar al arma
con la cual fueron disparados.
365
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Para su realizacin se utilizan los siguientes mtodos:
a) fresa por raspado: es una barra de dimetro ms pequeo que el nima del can que
presenta una o dos secciones de acero endurecido, que por raspado efecta una en
caso de tener estriado impar- o dos estras por pasada;
b) fresa en forma de gancho: es una barra tambin de dimetro ms pequeo que el
nima, que presenta un sistema de corte en forma de gancho similar a una aguja de
croch- que produce el estriado en forma muy lenta uno por vez-;
c) por broca o escariado: consiste en una barra con anillos de acero endurecido entre 25
y 30- que presenta diferentes dimetros y se encuentran dispuestos de menor a mayor,
formando talladores mltiples al tener ranuras intercaladas a intervalos regulares. Todas
las estras se realizan en una sola pasada;
d) por trelado: este puede ser por varilla o por mandril de acero duro que entra ajusta-
damente comprimiendo el nima a presin y provocando el estriado y
e) por martelado: que se realiza con mquinas que poseen martillos que en forma conjunta
golpean sobre la supercie externa del can y sobre un peregrino con la forma del
estriado, ubicado en su interior.
Los dos primeros sistemas dejan, adems, en cada estriado un complejo de rayas pro-
ducido por las irregularidades de las secciones de corte, que presentan muescas por la accin
del alado. Si bien con una sola fresa por raspado o en forma de gancho-, broca, trelador o
martelado se pueden realizar muchos rayados lo que a prima facie podra suponer la produccin
de iguales caractersticas- cada pasada ocasiona desgastes por friccin sobre esos elementos,
modicndolos y modicando consecuentemente las formas del siguiente estriado.
Los caones si bien estn confeccionados en serie, el acero -a pesar de pertenecer
a una misma colada- no siempre se distribuye en forma homognea provocando zonas de
durezas diferentes. Adems las herramientas de corte, de lijado y tallado, en su accionar,
dejarn sobre los mismos caractersticas que lo hacen nicos y diferentes por el arrastre
de virutas y movimientos de entrada y salida. Si a ello se le suman las caractersticas pro-
vocadas por el estriado, cada can habr adquirido su propia personalidad.
Identicacin de proyectiles: como se ha detallado en la descripcin de los cartuchos a
bala, sta ltima presenta su punta y su ojiva de un tamao menor que el nima del can,
pero su zona de forzamiento o til de tamao mayor. Esto provoca que al pasar por el
can estriado a muy alta presin se expanda y lo ocupe completamente, registrando as
las marcas o huellas del can tanto en sus campos como en sus macizos.
366
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Estas marcas pueden ser reiteradas o accidentales. Las primeras son las que de-
terminan identidad y se detallarn a continuacin. Las segundas pueden ser tiles a la in-
vestigacin de un hecho en particular, pero al no producirse en forma regular en todos los
proyectiles disparados por una misma arma, no sirven a los nes de la identicacin.
Lo ideal sera que las marcas se reproduzcan exactamente igual en todos los campos y
macizos de todos los proyectiles disparados por una misma arma. Sin embargo en la prctica,
esto se da muy pocas veces debido a mltiples factores: encamisado, dureza del plomo, tamao
y estado de los proyectiles; irregularidades en el comienzo del estriado o en la boca del can
por constriccin o rebabas; desalineo de los alvolos del tambor del revlver con el nima del
can, etc., las que pueden constituirse a su vez en particularidades identicativas.
Para lograr la identicacin del proyectil incriminado se requiere la obtencin de
proyectiles testigos, utilizando para ello el mismo tipo de municin en cuanto a marca, ao de
fabricacin, caractersticas, etc., y de ser posible, la proveniente de la municin secuestrada
con el arma. Estos deben obtenerse de manera tal que estn completos y que no adquieran
caractersticas o huellas adicionales. Los procedimientos ms utilizados son los de efec-
tuar disparos sobre algodn limpio, aserrn aceitado, estopa o lana, utilizando dispositivos
recuperatorios especiales. Tambin es posible su recuperacin utilizando un medio lquido
como ser, por ejemplo, agua o acorde al espacio de los recipientes- otros lquidos de mayor
peso especco obtenido mediante el agregado de sustancias apropiadas.
Si bien se han utilizado distintos procedimientos y mtodos para la comparacin de
los proyectiles incriminados y testigos, desde el advenimiento de la extraordinaria herramienta
que es el microscopio de comparacin, la tarea del perito es ms simple y precisa. Este
microscopio es, en realidad, dos microscopios unidos por un puente donde se proyecta la
imagen de ambos objetivos que pueden ser observadas, yuxtapuestas y comparadas simul-
tneamente. Los ms modernos poseen adems documentacin fotogrca computarizada
y adaptadores para videocmaras que permiten estudios indirectos por monitores color.
De esta manera es posible colocar los proyectiles incriminado y testigo- uno en cada
platina observando su imagen proyectada. Localizada sobre el incriminado una zona campo o
macizo- donde puedan visualizarse los complejos lineales formados por su paso forzado por el
nima del can, se debe girar el testigo hasta localizar la misma zona campo o macizo. Yux-
tapuestas ambas imgenes se debe vericar la presencia de caractersticas coincidentes.
De hallarse caractersticas, stas deben reunir los mismos requisitos exigidos para
establecer identidad papiloscpica. Las lneas, puntos o detalles caractersticos deben estar
367
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
igualmente situados campo o macizo, ubicados arriba, abajo o centro de un campo o de
un macizo- y dirigidos -las angulaciones o ramas deben estar orientadas de igual manera.
Obsrvese en las guras siguientes las correspondencias estriales determi-
nantes de identidad, entre dos proyectiles yuxtapuestos comparados.
Identicacin de vainas servidas: Por similares caractersticas de produccin o fabricacin
de las diferentes piezas constitutivas de las armas de fuego -el acero no distribuido en
forma homognea, la accin de las herramientas de corte, de lijado y tallado, posiciones,
encastres, etc. -a lo que se le suma la insuciente o incorrecta limpieza u oxidaciones-, le
coneren desigualdades, rugosidades, asperezas, etc. a la supercie del espaldn, que
se transmiten a las vainas cuando stas retroceden y golpean contra l bajo la presin de
los gases de la deagracin de la plvora. Estas marcas son normalmente semejantes a
las dejadas por un proceso de impresin por cuo.
La forma -extremos planos, romos, redondeados, ahusados, puntiagudos, rotos,
desgastados; ubicacin ngulo de golpe- y complejos lineales de fabricacin y de uso-
producidos por el golpe del percutor o segn el tipo de arma- de la aguja del percutor,
del extractor y no muy frecuentemente del botador, constituyen junto con las del espaldn,
el medio para identicar las vainas servidas.
368
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Obsrvese en la siguiente gura, la yuxtaposicin de las marcas dejadas por el percutor
de un arma de fuego, donde se puede visualizar la correspondencia de los complejos lineales.
Determinacin del oricio de entrada y de distancias del disparo: las heridas causadas
por armas de fuego se caracterizan por las lesiones que provocan sus proyectiles, las
altas temperaturas y los gases y restos de la plvora deagrada, a lo que hay que sumarle
los elementos neorformados como son los torbellinos, las ondas snicas, etc.
Dentro de la balstica criminalstica se encuentra la determinacin de los oricios de
entrada y salida en cuerpos orgnicos y la determinacin de las distancias de los disparos.
Este accionar criminalstico tiene estrecha vinculacin con el mdico legal que trata los
mismos temas, adems de las trayectorias internas de los proyectiles.
A los efectos de determinar desde donde fue alcanzado un cuerpo por el proyectil, se
hace necesario distinguir entre el oricio de entrada y el de salida. Debido a la musculatura que
poseen los cuerpos humanos y animales y por ser esta elstica, no es posible determinar el
calibre de los proyectiles que ingresaron al mismo a travs de estos oricios, ya que sus medidas
pueden ser mayores, iguales o menores, dependiendo del tipo de proyectil, de sus movimientos,
de los factores neoformados, ngulos de posicin y de llegada, zonas de ingreso -que pueden
presentar diferencias elsticas, de grosor o partes seas, penetracin, deformaciones, etc.
Tngase presente que si el proyectil presenta una ojiva aguda y penetra en forma
perpendicular, el oricio de entrada ser redondeado y de dimetro ms pequeo; pero si
penetra tangencial u oblicuamente producir equimosis, escoriacin y herida en canal o lesin
semilunar, respectivamente. Adems, acorde a la fuerza de penetracin mucha o poca-,
producir lesiones en fondo de saco o slo una contusin sin penetracin.
369
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
El oricio de entrada: se determina por la presencia del denominado halo o zona de Fish. Este halo
est conformado por dos anillos que puede presentarse en forma completa o no y se conforman
por el paso del proyectil a travs de la piel y musculatura. El primero lo conforma el golpe o choque
de la ojiva o punta de ingreso del proyectil, que provoca una zona de contusin por la depresin,
estiramiento y escoracin de la piel. El segundo es por el enjugamiento o limpieza del proyectil
efectuada por la elasticidad de la piel por l perforada. El anillo de enjugamiento se sobrepone
al anillo de contusin y retiene las impurezas que portaba el proyectil metales, restos de
plvora deagrada, semi o sin deagrar, restos de lubricantes u xidos del arma, etc.
El oricio de salida: es irregular y/o desgarrado y de tamao igual o mayor que el de entrada,
por desvo, deformacin, esquirlas o arrastres del proyectil. No presenta halo de Fish, pero en
algunos casos puede presentar si al salir golpea sobre una supercie rgida apoyada o muy
prxima a la piel, por ejemplo un cinturn de cuero- el signo de Romanese, constituido nica-
mente por un anillo de contusin.
Determinacin de distancias: al producirse un disparo en un lugar oscuro es posible ver en la
boca del can, la llama o fuego que acompaa la salida del proyectil, cuya intensidad depend-
er del tipo de plvora empleado. Si el arma se apoya o est a menos de un centmetro de la
piel, ese fuego o llamarada y los restos de la plvora despedidos -que la alcanzan y en ella se
incrustan- ocasionarn quemaduras de distintas intensidades, que permiten determinar esa
distancia del disparo denominada zona de llama.
Si el disparo abocado se produce sobre una zona donde haya un hueso subyacente
-como por ejemplo la sien, se produce lo que se denomina golpe de mina o golpe de
Hofmann. Esto se produce porque los gases y los restos de plvora en diferentes estados
que ingresan conjuntamente con el proyectil, al no poder seguir su camino por impedimento
del hueso subyacente, golpean sobre l y retroceden con violencia, provocando desgarros
de adentro hacia fuera similar a los que produce el estallido de una mina.
A un centmetro, los granos de plvora que salen del can ingresan al oricio en
forma de bala todos agrupados-, no provocando tatuaje a su alrededor pero s en el interior
del oricio, los que no desaparecen ni an con el lavado. A partir de all y dependiendo de
la cantidad de detritos de los gases de la plvora, se producirn zonas de tatuajes restos
que se depositan sobre la piel y vestimentas formando puntos oscuros- en una zona vecina
y concntrica al oricio de entrada, que se va ampliando -pero perdiendo en intensidad- a
medida que el arma se aleja.
370
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
A una distancia que no supera los treinta centmetros en armas de puo- aparece la
zona de ahumamiento formada por el humo o suciedad producida por el depsito de
los restos de la combustin de la plvora que se deposita por encima y ms all del tatuaje
y que desaparece por friccin o lavado. Por confronte de las experiencias realizadas -con
un arma y municiones del mismo tipo-, se podr establecer la distancia del disparo.
Entre esta distancia y los sesenta centmetros, se encuentra la zona de deagracin donde
se podr determinar la presencia de plvora deagrada, semi y sin deagrar, establecindose
la distancia de disparo a travs de la realizacin de similares experiencias y cotejos.
Disparos con escopetas: debe tenerse en cuenta que los perdigones y el taco que los impulsa
salen a modo de bala en la boca del can, comenzando a distancias variables lo que se deno-
mina la rosa de dispersin. De no haberse iniciado la dispersin, toda la municin pasa por un
mismo lugar provocando un solo oricio de entrada. Dependiendo del tipo de escopeta se puede
considerar aunque no siempre es exacto- que los perdigones o municiones entran a modo de
bala hasta un metro. A partir de all se comienzan a separar abrindose cada vez segn la distancia
recorrida. Mensurando esa dispersin es posible establecer la distancia de disparo, realizando
para ello experiencias y cotejos a diferentes distancias con igual tipo de arma y municin.
Huellas de herramientas: si bien este no es un tema balstico, se efecta su tratamiento dentro
de esta unidad porque la determinacin de correspondencia o no de los rastros de efraccin
con sus herramientas, se rigen por similares principios tcnicos cientcos. Las huellas de
las herramientas utilizadas, por ejemplo, para forzar una puerta, un cajn, una cerradura o
cortar un candado, pueden cotejarse con las herramientas secuestradas al sospechoso y
de su resultado puede nalmente lograrse su vinculacin y procesamiento.
Del estudio de las huellas producidas sobre las diferentes supercies vulneradas, es
posible determinar el tipo de herramienta utilizado, acordes a las caractersticas de impresin
tamao, forma, etc- lo que permite reducir la bsqueda, eliminando todas aquellas que
no pudieron haber participado. Secuestradas aquellas que presentan igual tipo deben ser
cotejadas con las huellas, de manera similar a lo que se ha detallado para la identicacin
de las vainas y proyectiles disparadas por armas de fuego.
Al igual que las armas, las herramientas de un mismo tipo, marca y modelo son
realizadas en serie, pero las caractersticas ya detalladas que hacen a la personalidad de
aquellas tambin se cumplen en las herramientas. La falta de homogeneidad del metal
utilizado, su corte, pulido, armado, etc. y luego las caractersticas de uso o mal uso, van
dotando a cada utensilio de una personalidad nica que lo distingue de todos sus iguales
y la identicacin puede realizarse tambin en forma directa o indirecta.
371
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Se har en forma directa cotejando las huellas del hecho con las huellas producidas sobre
una supercie similar con las herramientas secuestradas. Ser indirecto si el cotejo se realiza sobre
la huella dubitada y sobre una indubitada aunque no se posea la herramienta. Por ejemplo si en la
casa del sospechoso no se halla la herramienta porque la hizo desaparecer- pero se establecen
huellas de una herramienta similar en un trabajo de reparacin efectuado por el sospechoso y
stas se corresponden entre s, se habr determinado identidad en forma indirecta.
La determinacin se efecta por comparacin microscpica -de manera similar que
en balstica, de los complejos estriales o lineales y/u otras huellas o marcas caractersticas
-restos de pinturas, barnices o sustancias- que producen o quedan sobre las herramientas
o distintas supercies, en los casos de fracturas, roturas, cortes, etc.
Se deja constancia que segn el tipo de herramienta utilizado se deben efec-
tuar varias muestras testigo, ya que la posicin o ngulo de accin de stas y el de
la supercie sobre la que se acta, pueden hacer variar su aspecto.
En la gura siguiente pueden observarse los complejos lineales producidos por
un cuchillo sobre una madera durante una efraccin y su correspondencia con los
obtenidos como testigo, con el cuchillo secuestrado al sospechoso.
372
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
Al igual que en balstica, no siempre es posible determinar correspondencias lineales
como la del ejemplo, pero siempre como resultado de los estudios, anlisis y comprobaciones
realizadas se podr, en toda la temtica tratada, arribar a conclusiones categricas que:
a) identiquen al arma o la herramienta como la empleada en el hecho;
b) determinen la no identidad del arma o la herramienta o
c) que no se determinen caractersticas que permitan la identicacin o descarte del arma
o la herramienta.
Se debe tener siempre presente que la realizacin del hallazgo del testigo mudo,
su resguardo, levantamiento formal y tcnico, transporte, custodia, peritacin y evaluacin
de resultados, siempre ser una tarea del profesional criminalstico, pero la de impulsar,
disponer, valorar, pedir explicaciones, impugnar o aceptar como prueba los resultados peri-
ciales de cualquier tipo que fuere, siempre ser tarea del profesional abogado, por lo que el
conocimiento criminalstico genrico no slo es til, sino que es IMPRESCINDIBLE.
373
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
Dada la extensin del tema balstico imposible de desarrollar en una unidad temtica, se
propone luego de haber asimilado el desarrollo de esta ltima Unidad y como tarea extrapro-
gramtica, leer los temas que le intereses y que no hayan sido desarrollados, de la bibliografa
que se detalla a continuacin:
Manual de Criminalstica de Roberto ALBARRACIN de la Editorial Policial.
Manual de Criminalstica de Carlos A. GUZMN de Ediciones La Rocca.
Nota: Ambos textos se encuentran para consulta y/o prstamo en la Biblioteca del Instituto
Universitario de la Polica Federal Argentina.
integracin bibliogrca
ib
abogaca a distancia
)
374
tomo 1 investigacin cientca del delito
(
educacin a distancia (instituto universitario de la P.F.A.)
375
tomo 1 investigacin cientca del delito
)
educacin a distancia (instituto universitario de la P.F.A.)
( BIBLIOGRAFA DE LA UNIDAD IX )
n ALBARRACIN, Roberto; Manual de Criminalstica; Editorial Policial; Bs. As. 1971.
n GUZMAN, Carlos; Manual de Criminalstica; Ed. La Rocca; Bs. As. 1997.
n GOBBI, Eduardo y otros; Tratado de Criminalstica; Ed. Policial; Bs. As. 1983.
Bibliografa obligatoria