P. 1
Prueba Acceso Grado Superior CV 2008-2009

Prueba Acceso Grado Superior CV 2008-2009

5.0

|Views: 19.133|Likes:
Publicado pormanuelmch
Prueba de acceso a ciclos formativos de grado medio en la Comunidad Valenciana, curso 2008-2009
Prueba de acceso a ciclos formativos de grado medio en la Comunidad Valenciana, curso 2008-2009

More info:

Published by: manuelmch on Jun 19, 2009
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

05/11/2014

pdf

text

original

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Común. Apartado A1 LENGUA Y LITERATURA (CASTELLANO).

Duració: 1 hora.
La arroba es una unidad de medida, cuyo símbolo (@) se ha instalado en la jerga informática tras realizar un viaje alucinante a través de los siglos. Quiso el azar que cuando el inventor del correo electrónico buscaba en la parte alta de su teclado un carácter con el que separar el nombre del destinatario del nombre del servidor, eligiera ese hermoso grafismo, que originalmente representaba un ánfora. Ni en sus más delirantes fantasías habría podido imaginar el autor de este símbolo un futuro tan brillante para su garabato, que se encuentra, por cierto, en la frontera entre la escritura y el dibujo como la estrella de mar (que parece un logotipo) vive en la línea que divide el mundo vegetal del animal. Cualquier diseñador daría el brazo izquierdo a cambio de que una creación suya, además de resistir el paso del tiempo de ese modo, acabara convirtiéndose en el emblema de las tecnologías del porvenir. Pero eso no es todo. Recibo continuamente invitaciones, circulares o cartas que en vez de comenzar con un queridos amigos y queridas amigas, comienzan con un querid@s amig@s. Su uso está tan generalizado que casi podemos afirmar que nuestro alfabeto se ha enriquecido con una nueva y rara vocal que sirve de manera indistinta para el masculino y el femenino porque es simultáneamente una o y una a. Mira por donde, el símbolo de una antiquísima unidad de medida (parece que procede del siglo XVI) ha venido a resolver una insuficiencia del lenguaje, pues queridos amigos utilizado hasta hace poco resulta machista o excluyente y el queridos amigos y queridas amigas resulta fatigoso. Ya no hay problema. Coloque usted, como vienen haciendo algunos adelantados, en el encabezamiento de sus cartas, de sus circulares, de su publicidad, un querid@s alumn@s, un estimad@s compañer@s, un ilustrísim@s diputad@s, y matará dos pájaros de un tiro sin ofender a ninguno de los dos. Esperamos ansiosos que la Academia se pronuncie ante este grafismo polivalente que ha ensanchado por sorpresa nuestro alfabeto y, de paso, que le invente un sonido, pues no vemos modo de utilizarlo en el lenguaje hablado con la facilidad con la que se ha introducido en el escrito. Juan José Millás EL PAIS

1. Resume brevemente el contenido del texto (ten en cuenta los párrafos y la idea fundamental de cada uno, ya que pueden ayudarte a hacer tu resumen) 2. En el texto leemos jerga informática ¿Podrías explicar qué es una jerga? ¿Por qué se refiere a jerga informática? Razónalo. 3. ¿Qué tipo de texto periodístico te parece el escrito de J. J. Millás? ¿Por qué? 4. En el texto podemos observar que la palabra “arroba” es un término polisémico además de un grafismo polivalente ¿Podrías explicarlo? 5. ¿Qué opinión tienes tú al respecto? ¿Utilizas el símbolo para escribir el encabezamiento de tus correos como nos dice el autor y escribes querid@s amigo@s....? Escribe un breve texto dando tu opinión.

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN - Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Común. Apartado A2 LENGUA EXTRANJERA (INGLÉS). Duración: 30 minuts.

QÜESTIONS

1. Summarize the following text: My name is Carla and I am English. I’m from London. I am 20. I’m a student. I like music; my favourite music is rock and roll, I am in a band, Extreme Sounds. I am the singer and the guitarist. My best friend is David, he is also in the band, and he is the drummer. Jake is my new neighbour, he is 22, he is from Hollywood. He is new in town. He is an actor, he likes sports. His best friend is Max, his dog. 2. Answer these questions after reading again the text in question 1: How old is Carla? What nationality is she? Where is she from? What is her hobby? What is her favourite music? Who is her best friend? What is her neighbour’s name? How old is he? What is his job? Who is his best friend? What is his hobby?

3. Introduce yourself the same way Carla did (in exercise 1). You can talk about a friend or neighbour as well. 4. Write a letter or e-mail to a friend, telling him or her about someone you have recently met. 5. Answer the questions: What’s your name? What’s your surname? How many brothers or sisters have you got? What’s your phone number? What’s your address? What’s your e-mail address?

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN - Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Común. Apartado A3 MATEMÁTICAS.

Duració: 1 hora 30 minuts.

1. Una empresa de transportes dispone de camiones y furgonetas para distribuir mercancía. El coste de usar cada camión es de 145 € al día mientras que el de cada furgoneta es de 85 € al día. Si un cliente dispone de 2000 € para realizar una distribución, indica el modelo matemático que permite saber cuantos camiones y cuantas furgonetas podrá utilizar. ¿Cuántos vehículos de cada clase necesitará para gastarse exactamente el dinero disponible?

2. Tres amigos cronometran el tiempo que tardan en ir de su casa al instituto durante dos semanas, de lunes a viernes. Los resultados obtenidos son: Pepe: Lluís: Laura: 15 25 5 20 20 15 18 20 16 15 20 15 17 20 20 18 18 20 16 20 19 17 19 16 18 20 16 19 20 18

El tiempo viene medido en minutos. Encontrar la medida de centralización más representativa en cada caso y justifica tu elección.

3. A Marina, Elena y Josep les ha tocado la lotería y tienen que repartirse un premio de 3.000 €. Marina jugó 10 €, Elena 20 € y Josep 30 €. Completa, razonando las respuestas y haciendo todas las operaciones que consideres necesarias, la siguiente tabla para saber que premio les corresponde a cada uno teniendo en cuenta que el reparto es proporcional a lo jugado. MARINA 10 € ELENA 20 € JOSEP 30 € TOTAL 60 € 3.000 €

DINERO JUGADO PREMIO CONSEGUIDO

4. En mi clase somos 20 estudiantes, y solamente 4 llevan gafas. Si se eligen dos alumnos de la clase al azar, calcula la probabilidad de que: a.- Los dos lleven gafas. b.- ninguno lleve gafas. c.- Uno lleve gafas y el otro no.

CRITERIS D'AVALUACIÓ I QUALIFICACIÓ
- Totes les qüestions puntuen igual. - La qualificació d'esta Part s'adaptarà al que establix la RESOLUCIÓ de 17 d'abril del 2009, de la Direcció General d'Avaluació, Innovació i Qualitat Educativa i de la Formació Professional, per la que es convoquen proves d'accés als cicles formatius de Formació Professional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: BIOLOGÍA (opción B) Duración: 1 hora 15 minutos.

1. a) Recuerda lo que sabes sobre la estabilidad de los ácidos nucleicos y razona qué ventajas puede reportar a los seres vivos el hecho de que el mensaje genético se almacene en forma de DNA y no de RNA. ¿Hay alguna excepción a esta regla general? b) En la purificación de un fragmento de DNA se ha perdido una porción de una de las dos hebras, quedando la secuencia de bases nitrogenadas como se indica a continuación. Reconstruye la porción que falta y explica en qué te basas para reconstruirla. ATTACC.................. TAATGGGCCGAATTCGGCTAAGCT c)Si el ácido nucleico que se estuviera purificando fuera RNA, ¿podrías reconstruir una porción perdida con la misma facilidad que lo has hecho en la cuestión anterior? ¿qué datos necesitarías para intentar dicha reconstrucción

2. Dibuja la estructura de una célula animal. a) Explica la función de los diferentes orgánulos b) Indica las diferencias de esta célula con una célula vegetal y con una célula bacteriana

3. El esquema adjunto representa un orgánulo energético celular. Basándote en él explica: a) b) c) ¿De qué orgánulo se trata? ¿Qué células lo poseen? ¿Qué sustancias penetran en dicho orgánulo? ¿Cuáles se producen en él? ¿Cómo se llama el proceso que genera ATP? Da una explicación razonada de los procesos esquematizados

d) e)

f)

4. Define brevemente los siguientes conceptos: Enzima, Fotosíntesis, Anticuerpo, Vacuna.

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: TECNOLOGÍA (opciones C y T)

Duración: 1 hora 15 minutos.

1. Explica mediante un ejemplo, dónde, cómo o mediante que, se pueden ver las transformaciones de energías siguientes. Energía mecánica en calorífica = Energía eléctrica en química = Energía química en luminosa =

2. En un ordenador personal (PC) indica los tipos de memoria existentes. Y cita las diferencias básicas entre ellas.

3. Qué transformación del movimiento realiza el “mecanismo biela-manivela”. Realiza un sencillo esquema que represente la transformación.

4. Un vehículo automóvil: ¿Qué tipos de motores puede utilizar? Indica el tipo de energía que se utiliza en cada uno de ellos. ¿Qué subsistemas de tipo mecánico, eléctrico y electrónico podrías diferenciar? El combustible que utiliza, ¿de dónde se obtiene?

5. ¿Qué es un sistema de control en bucle cerrado? Dibuja un diagrama de bloques indicando la función de cada uno de ellos.

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: EDUCACIÓN FÍSICA (Opción F)

Duración: 1 hora 15 minutos.

1. Aumentar la resistencia es una de las máximas preocupaciones de los deportistas y de sus entrenadores. ¿Qué es la resistencia?. Describe los tipo de resistencia que conozcas. ¿Qué factores limitan la resistencia?. Explica brevemente los sistemas de entrenamiento que conozcas para desarrollar la resistencia.

2. El deporte es un juego competitivo, con unas reglas muy bien establecidas y que se practica dentro de una organización, Podemos distinguir tres tipo de deportes en función de la existencia o no de adversarios y compañeros y compañeras: deportes individuales, deportes de adversario y deportes colectivos. Dentro de estos últimos, los colectivos, podemos establecer tres grandes categorías, ¿cuáles son?. Nómbralas, explica brevemente en qué consisten y pon algún ejemplo.

3. El esquema corporal es “ la intuición global o conocimiento inmediato de nuestro cuerpo, ya sea en reposo o en movimiento, en función de la interrelación de sus partes y de la relación con el espacio y los objetos que nos rodean. Todos los movimientos que realizamos con nuestro cuerpo se realizan en relación de unos ejes y unos planos imaginarios que junto a las articulaciones, nos delimitan las posibilidades de movimiento. ¿Qué desarrollo comporta el trabajo del esquema corporal? Nombra los tres ejes corporales y las partes en que dividen nuestro cuerpo

4. Cada vez se realizan más actividades en el medio natural; deportes de aventura, las carreras de orientación, la bicicleta todoterreno o la escalada son algunas de estas actividades. ¿Cuáles son las características que diferencian a las actividades físicas en la naturaleza del resto de actividades? Explica brevemente qué son las carreras de orientación; objetivo que persiguen, terreno, material necesario, duración, jugadores, puntuación …

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: HISTORIA DEL MUNDO CONTEMPORÁNEO (Opción H)

Duración: 1 hora 15 minutos.

I. COMENTARIO DE TEXTO:

La era del automóvil hacía tiempo que había llegado a Norteamérica, pero después de la guerra (1945) llegó a Europa. En realidad gran parte de la nueva industrialización de estas décadas {50-60} consistió en la extensión a nuevos países de las viejas industrias basadas en viejas tecnologías: la industrialización del siglo XIX, del carbón el hierro y el acero en los países socialistas agrícolas; las industrias norteamericanas del siglo XX del petróleo y el motor de explosión a Europa y luego, a escala más modesta a algunos lugares de Latinoamérica. Mientras que la baratura de los combustibles hizo del camión y el autobús los principales medios de transporte. En los Estados Unidos los principios de Ford se aplicaron a nuevas formas de producción, desde casas de comida-basura (McDonald’s es un éxito de posguerra) a bienes y servicios que se pensaban ahora para un mercado de masas, como sucedió con el turismo masivo a playas soleadas. Lo que en otro tiempo había sido un lujo se convirtió en un indicador de bienestar habitual, por lo menos en los países ricos: neveras, lavadoras, teléfonos.

HOBSBAWM, E.(1995) Historia del Siglo XX, Barcelona, Crítica, p. 266-272

CUESTIONES: 1. Pon un título al texto. Realiza un resumen de la información que te proporciona el texto. 2. ¿A qué guerra se hace referencia en el primer párrafo?. Explica qué países lucharon en ella, las razones que la desencadenaron y cual fue el desenlace 3. ¿Sabes cómo se denomina al periodo del siglo XX en el que un elevadísimo número de personas puede acceder a todos estos productos –neveras, lavadoras,…-? Explica en qué consiste y sus repercusiones

II. RESPONDE LAS SIGUIENTES PREGUNTAS:

4. Los Felices Años Veinte y la Depresión del 29 5. El crecimiento de las ciudades en la Europa del siglo XIX

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: ECONOMÍA Y ORGANIZACIÓN DE EMPRESAS (opción S)

Duración: 1 hora 15 minutos.

1. Tipos de impuestos. Defínelos.

2. Enumera las fases de un estudio de mercado.

3. La distribución de un producto. Canales de distribución.

4. La empresa X desea realizar un proyecto de inversión Desembolso inicial: 90.000 euros Duración : 3 años Flujos de caja: 20.000 euros primer año, 30.000 el segundo yi 45.000 euros el tercero. Coste del dinero: 5 % a) Calcula el VAN ( Valor Actual Neto ) del proyecto. b) Razona la conveniencia o no de su aceptación.

5. Identifica los siguientes elementos patrimoniales. Ordena las cuentas siguientes en un balance de situación. Capital Social . A determinar Dinero en efectivo: 2.000 euros Dinero en cuenta corriente bancaria: 25.000 euros Edificio propiedad de la empresa: 200.000 euros Amortización correspondiente al edificio: 100.000 euros Ordenador: 1.000 euros Proveedores: 8.000 euros Clientes : 5.400. euros Aplicaciones informáticas, 500 euros Productos destinados a la venta, 800 euros. Prétamo a pagar a largo plazao, 12.000 euros

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: FÍSICA Y QUÍMICA (opciones B y C) Duración: 1 hora 15 minutos.

1. Un tendero pesa 600g de queso con una balanza que aprecia 1g y un químico pesa 0,3g de producto con una balanza que aprecia 1 mg. Calcula el error absoluto y relativo de cada medida e indica qué medida es la mejor.

2. Clasifica las fuentes de energía que conozcas y haz una valoración de sus ventajas y de sus inconvenientes

3. Una plancha eléctrica de 960 W se conecta a 220 V durante un cuarto de hora. Calcula: a) La energía consumida en kWh y en J. b) La intensidad de corriente que pasa y la resistencia eléctrica del aparato.

4. Define los siguientes conceptos y pon un ejemplo de cada uno escribiendo su fórmula química: Disolución, Sustancia pura, Compuesto, Elemento químico, Número atómico, Isótopo.

5. Entre las siguientes sustancias: H2O, Or , NaCl, Dióxido de carbono, C(diamante) , Alcohol etílico. Indica, haciendo una tabla: a) El nombre o la fórmula química. b) Su estado físico en condiciones normals. c) El tipo de enlace químico. d) La unidad estructural básica de que están formadas (átomo, molécula, celda cristalina, etc.) d) Si es o no conductora de la corriente eléctrica en estado normal.

6. Una bombona doméstica de gas butano (C H ) contiene 12,5 kg de gas. Si se quema totalmente. 4 10 a) Ajusta la ecuación de la reacción química i indica si es endotérmica o exotérmica b) Calcula la masa de CO2 producida. DATOS: masas atómicas : C = 12; H = 1; O = 16

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: PSICOLOGÍA (opciones F y H)

Duración: 1 hora 15 minutos.

1. La percepción es un proceso mediante el cual organizamos e interpretamos los estímulos captados por nuestros sentidos, dotándolos de significado; es, pues, una aprehensión de la realidad a través de los sentidos. La información que reciben nuestros sentidos consiste en distintos tipos de energía física (luz, sonidos, olores etc.). Esta información la traducen nuestros órganos sensoriales a energía electroquímica, que viaja desde los órganos receptores (los ojos, los oídos, la nariz, etc.) a través de los nervios, pasando por el tálamo, hasta zonas de la corteza cerebral que elaboran o entienden esa información. Contesta a las siguientes preguntas: ¿Percibimos el mundo tal y como es? ¿Cuál es el objeto de la percepción? ¿Por qué decimos que no percibimos los objetos tal como son?

2. Imaginemos que una persona trabaja en una empresa de la que es socia. Su primera motivación puede ser la de obtener un beneficio económico que le será reportado por la empresa al finalizar el mes. Es posible que dicha persona tenga también como motivación el incrementar la producción de la empresa porque como empresaria, esto le interesa de cara a la competencia; en este caso el motivo sigue siendo de carácter económico. Pero puede ser también que su trabajo le colme de placer, por motivos vocacionales, de manera que el aspecto económico pase a un segundo plano. Por último, también resulta factible que, siendo socia, la persona prefiera, en lugar de limitarse a realizar su función, ascender a puestos de mayor responsabilidad que le suponga una recompensa moral por el hecho de llegar a la dirección u ocupar la presidencia de la empresa. En este ejemplo, podemos observar diferentes tipos de motivación. Explica cada motivación a qué tipo pertenece y por qué

3. “Nuestra personalidad es única e irrepetible. Es la suma de las maneras de actuar, pensar y sentir que nos hace típicos y diferentes a todos los demás individuos. Pero aunque pudiéramos conocernos o conocer a alguien perfectamente, no podríamos predecir con exactitud su comportamiento ante un determinado suceso, porque la personalidad también se ve influida en cada momento por el aprendizaje realizado, por nuestro carácter, por el ambiente en el que vivimos, por nuestras emociones…etc.” La personalidad se ha estudiado considerando una serie de cualidades que son estables e internas en los individuos, y que nos llevan a comportarnos de igual modo en circunstancias que son diferentes. Explica las siguientes cualidades psicológicas que pueden describir la personalidad de una persona: a) introversión y extraversión. b) estabilidad emocional e inestabilidad emocional. c) psicoticismo.

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: GEOGRAFÍA (opción S)

Duración: 1 hora 15 minutos.

COMENTARIO DE TEXTO Al insistir en la importancia que tiene el turismo en la economía española se suele centrar la reflexión en su aportación de divisas y en las cifras de entradas de turistas extranjeros, a las que hay que agregar las del turismo interior -difícilmente evaluable- que también se traslada a otras zonas del país. Ambos grupos, nacionales y extranjeros, generan un consumo y una oferta de puestos de trabajo que repercuten de forma decisiva en la economía española. Pero la concentración turística en determinados lugares privilegiados, provoca un fenómeno que tiene una importancia decisiva: la transformación del paisaje en los usos del suelo. Por eso el turismo no sólo hay que considerarlo como un elemento de la economía del país, sino como un poderoso agente de cambio en las zonas de concentración donde contribuye a la elevación del nivel de vida y representa un auténtico motor de desarrollo económico y de transformación espacial. “El Turismo” E. García Manrique

1. Explica las principales características de las actividades turísticas en España. Localiza las principales zonas turísticas españolas, cita algún ejemplo referido a la Comunidad Valenciana.

2. El sector terciario de la economía en España es más amplio que el referido a las actividades turísticas, explica qué actividades económicas comprende, cuales son sus características y su distribución en el territorio español.

3. A partir de la siguiente frase del texto: “ el turismo (...) hay que considerarlo (...) como un poderoso agente de cambio en las zonas de concentración donde contribuye a la elevación del nivel de vida y representa un auténtico motor de desarrollo económico y de transformación espacial.”, realiza un escrito en el que expliques el papel del turismo como motor de desarrollo económico y de transformación espacial.

4. El desarrollo de las actividades turísticas necesitan de determinadas infraestructuras para su correcto desarrollo, entre ellas tiene especial relevancia los medios de transporte, explica en qué medida el turismo necesita de ellas y cuáles son las principales características de los medios de transporte en España.

5. Partiendo de tu respuesta de la pregunta anterior, ¿qué otras infraestructuras y recursos crees que son necesarios para la correcta realización de las actividades turísticas?

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Todas las cuestiones puntúan igual. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR JUNIO 2009 Parte Específica: DIBUJO (opción T)

Duración: 1 hora 15 minutos.

1. Construye un octógono de lado L = 20 mm.

2. Partiendo de los datos de la figura, resuelve esta a escala 1:1, señalando las tangencias y centros.

CRITERIOS DE EVALUACIÓN Y CALIFICACIÓN
- Pregunta 1: 3 puntos. Pregunta 2: 7 puntos. - La calificación de esta Parte se adaptará a lo establecido en la RESOLUCIÓN de 17 de abril de 2009, de la Dirección general de Evaluación, Innovación y Calidad Educativa y de la Formación Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formación Profesional. (DOCV 28.04.2009)

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->