P. 1
Fundamentos de Algoritmos (1)

Fundamentos de Algoritmos (1)

|Views: 2.696|Likes:

More info:

Published by: Anahí Vasquez Rodriguez on Jul 17, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOCX, PDF, TXT or read online from Scribd
See more
See less

09/17/2015

pdf

text

original

2012

KARR

kene

[APUNTES DE FUNDAMENTOS DE ALGORITMOS ]
El presente documento son apuntes de algoritmos de diferentes autores de libros,
documentos y direcciones de internet

INDICE GENERAL
1. Sistema de procesamiento de información ............................................................ 4
2. Concepto de algoritmo ............................................................................................. 4
2.1. Características de los algoritmos ...................................................................... 4
2.2. Partes de un algoritmo ...................................................................................... 4
3. Resolución de problemas con computadoras y las herramientas de programación
5
3.1. Análisis del problema: ....................................................................................... 5
3.2. Diseño o desarrollo del algoritmo .................................................................... 5
3.3. Resolución del algoritmo en la computadora .................................................. 5
4. Representación de un algoritmo ............................................................................. 5
4.1. Diagrama de flujo .............................................................................................. 5
4.2. Pseudocódigo .................................................................................................... 6
5. Datos y Tipos de datos ............................................................................................. 7
5.1. Datos numéricos ................................................................................................ 7
5.1.1. Enteros: ...................................................................................................... 7
5.1.2. Reales: ........................................................................................................ 7
5.2. Datos Lógicos: .................................................................................................... 7
5.3. Datos carácter: .................................................................................................. 7
6. Constantes y Variables: ............................................................................................ 7
7. Operadores ............................................................................................................... 7
7.1. Relacionales o condicionales: ........................................................................... 7
7.2. Aritméticos : ...................................................................................................... 8
7.3. Alfanuméricos: .................................................................................................. 8
7.4. Lógicos o Booleanos: ......................................................................................... 9
7.5. Paréntesis: ......................................................................................................... 9
8. Expresiones ............................................................................................................... 9
9. Regla de Prioridad .................................................................................................. 10
10. Operación de Asignación .................................................................................... 10
11. Ejercicios .............................................................................................................. 10
12. Estructura General de un Programa ................................................................... 12
12.1. Partes de un programa ................................................................................ 12
13. Instrucciones y tipos de instrucciones ............................................................... 12
13.1. Instrucción ................................................................................................... 12
13.2. Tipos de instrucción ..................................................................................... 12
14. Programación Estructurada ................................................................................ 15
14.1. Estructuras Secuencial ................................................................................. 15
14.2. Estructuras Selectivas .................................................................................. 20
14.2.1. Selectivas simples: ................................................................................... 20
14.2.2. Selectivas Dobles: .................................................................................... 21
14.2.3. Selectivas múltiples: ................................................................................ 21
14.2.4. Ejemplos ................................................................................................... 22
14.2.5. Ejercicios ................................................................................................... 26
14.3. Estructuras Repetitivas ................................................................................ 34
14.3.1. Estructura repetitiva mientras (While o Do while): ............................... 34
14.3.2. Estructura repetitiva para (For): ............................................................. 35
14.3.3. Estructura repetitiva repetir:................................................................... 36
14.3.4. Ejemplos ................................................................................................... 36
14.3.5. Ejercicios ................................................................................................... 39
15. Subprogramas ..................................................................................................... 44
15.1. Procedimientos (Subprograma): ................................................................. 44
15.2. Funciones ..................................................................................................... 45
15.3. Algoritmos Recursivos ................................................................................. 46
16. Estructuras de Datos ........................................................................................... 50
16.1. Arreglos unidimensionales .......................................................................... 51
16.1.1. Ordenación ............................................................................................... 52
16.1.2. Búsqueda .................................................................................................. 55
16.2. Arreglos bidimensionales ............................................................................ 58
17. Estructuras lineal ................................................................................................ 72
17.1. Pilas .............................................................................................................. 72
17.2. Colas ............................................................................................................. 72
18. Estructura no lineal ............................................................................................. 72
18.1. Arboles ......................................................................................................... 72
18.2. Grafos ........................................................................................................... 72


1. Sistema de procesamiento de información
Los temimos procesador de datos y sistema de procesamiento (tratamiento) de la
información se utilizan con frecuencia., el uso de diario de datos e información
son esencialmente sinónimos sin embargo existe una diferencia datos se refiere a
la representación de algún hecho, concepto o entidad real (los datos pueden
tomar diferentes formas, por ejemplo palabras escritas o habladas, números y
dibujos), información implica datos procesados y organizados, un sistema en
general se define como conjunto de componentes conectados e interactivos, que
tienen un propósito y una unidad total. Sistema de procesamiento de información
es un sistema que transforma datos brutos en información organizado,
significativo y útil (Aguilar, 1988)





2. Concepto de algoritmo
Es el conjunto de instrucciones que especifican la secuencia de operaciones a
realizar en orden para resolver un sistema específico o clase de problema. Los
algoritmos son independientes tanto del lenguaje de programación en que se
expresa como de la computadora que los ejecuta. El diseño de la mayoría de los
algoritmos requiere creatividad y conocimientos profundos de la técnica de la
programación. En esencia. Todo problema se puede describir por medio de un
algoritmo (Aguilar, 1988)
2.1. Características de los algoritmos
 Un algoritmo debe ser preciso e indicar el orden de realización de cada
paso
 Un algoritmo debe estar definido. Si se sigue un algoritmo dos veces, se
debe obtener el mismo resultado cada vez
 Un algoritmo debe ser finito. Si se sigue un algoritmo, se debe terminar en
algún momento ósea debe tener un numero finito de pasos
2.2. Partes de un algoritmo
La definición de un algoritmo debe describir tres partes: Entrada, Proceso y
Salida
Entrada: son los datos que van iniciar el proceso
Proceso: Es la secuencia de paso que nos permite ejecutar alguna operación
Salida: Es la información que se requiere al resolver el problema
2.3. Frfr


Procesador
Entrada=Datos
Salida=Información
3. Resolución de problemas con computadoras y las herramientas de programación
Esta se puede dividir en tres fases importantes
3.1. Análisis del problema:
El problema debe estar bien definido si se desea llegar a una solución
satisfactoria, para poder definir con precisión el problema se requiere que las
especificaciones de entrada y salida sean descritas con detalle. Una buena
definición del problema junto con una descripción detallada de las
especificaciones de entrada y salida son los requisitos más importantes para
llegar a una solución eficaz. El Análisis del problema exige una lectura previa
del problema a fin de obtener una idea general de lo que se solicita la segunda
lectura servirá para responder a las preguntas
¿Qué información debe proporcionar la resolución del problema?
¿Qué datos se necesitan para resolver el problema?
3.2. Diseño o desarrollo del algoritmo
La descomposición del problema original en subproblemas más simples y a
continuación dividir estos subproblemas en otros más simples que pueden ser
implementados para la solución en la computadora se denomina diseño
descendente (Top – Down Design.). Las ventajas más importantes del diseño
descendente son.
 El problema se comprende más fácilmente al dividirse en partes más
simples denominados módulos.
 Las modificaciones en los módulos son más fáciles
 La comprobación del problema se puede verificar fácilmente
Tras los pasos anteriores es preciso representar el algoritmo mediante
determinadas herramientas de programación diagrama de flujo, pseudocódigo
o diagrama N-S
3.3. Resolución del algoritmo en la computadora
Una vez que el algoritmo está diseñado y representado gráficamente
mediante una herramienta de programación (diagrama de flujo, pseudocódigo
o diagrama N-S) se debe pasar a la fase de resolución práctica del problema
con la computadora
4. Representación de un algoritmo
Para representar los algoritmos debemos utilizar métodos gráficos o numéricos,
que sea independiente de un lenguaje de programación, de tal manera que nos
permita visualizar el algoritmo que queramos representar, existen varios métodos,
los más usados a nivel internacional son el diagrama de flujo y el pseudocódigo.
4.1. Diagrama de flujo
Es un diagrama que utiliza los símbolos (cajas) estándar mostrados y que tiene
los pasos del algoritmo escritos en esas cajas unidas por flechas, denominadas
líneas de flujo, que indican la secuencia en que se deben ejecutar.
Un diagrama de flujo (flowchart) es una de las técnicas de representación de
algoritmos más antigua y a la vez más utilizada, aunque su empleo ha
disminuido, estos símbolos están normalizados por ANSI y entre las cajas más
importantes tenemos: (Aguilar, 1988)

Símbolo Función





Terminal: representa el comienzo,
inicio, final y fin de un programa.
Puede representar también una
parada o interrupción programada



Entrada / Salida : cualquier tipo de
introducción de datos en la memoria
desde los periféricos o registro dela
información procesada en un
periférico




Proceso: Cualquier tipo de
información que pueda originar
cambio de valor, formato, posición de
la información almacenada en
memoria, operaciones aritméticas, de
transferencia, etc.





Decisión: indican operaciones lógicas
o de comparación entre datos,
normalmente dos y en función del
resultado de la misma determina cuál
de los distintos caminos alternativos
del programa se debe seguir
normalmente tiene dos salidas
respuesta sí o no pero puede tener
tres o más según los casos



Indicador de Dirección o Línea de
Flujo:indica el sentido de ejecución de
las operaciones

4.2. Pseudocódigo
Es un lenguaje especificado de algoritmos. El uso de tal lenguaje hace el paso
de codificación final relativamente fácil. La ventaja de un pseudocódigo es que
en su uso la planificación de un programa, el programador se puede
concentrar en la lógica y en las estructuras de control y preocuparse de las
reglas de un lenguaje de programación. Es también fácil modificar el
pseudocódigo si se descubren errores o anomalías en la lógica del programa
(Aguilar, 1988)
Si
No
El pseudocódigo es un lenguaje algorítmico, de alto lenguaje utilizado para
escribir con mucha más abstracción instrucciones de un lenguaje de
programación.
5. Datos y Tipos de datos
5.1. Datos numéricos
El tipo numérico es el conjunto de los valores numéricos, estos pueden
representarse de dos formas distintas
5.1.1. Enteros:
Es un subconjunto finito de los números enteros. Los enteros son números
completos, no tienen componentes fraccionarios o decimales y pueden
ser negativos o positivos (Aguilar, 1988)
5.1.2. Reales:
El tipo real consiste en un subconjunto de los números reales, Los
números reales siempre tienen su punto decimal y pueden ser positivos o
negativos
5.2. Datos Lógicos:
Tipo lógico también denominado booleano, es aquel dato que solo puede
tener uno o dos valores cierto o verdadero (True ) y falso (False), este tipo de
dato se utiliza para representar alternativas (si/no) a determinadas
conclusiones
5.3. Datos carácter:
Es el conjunto finito y ordenado de caracteres que la computadora reconoce.
Un dato tipo carácter contiene un solo carácter (Aguilar, 1988)
Una cadena de caracteres (String) es una sucesión de caracteres que se
encuentran delimitados por una comilla (apostrofo) o dobles comillas según el
tipo de lenguaje de programación. La longitud de una cadena de caracteres es
el número de ellos comprendidos entre los separadores o delimitadores

6. Constantes y Variables:
Los programas de computadora contiene ciertos valores que no deben cambiar
durante la ejecución del programa tales valores se llaman constantes de igual
forma existen otros valores que cambiaran durante la ejecución del programa a
estos valores se les llama variables.
7. Operadores
Todos los símbolos que representan enlaces entre cada uno de los argumentos
que intervienen en una operación se llaman operadores y se utilizan para construir
expresiones. (Rodriguez Almeida, 1991) Los operadores pueden ser:
7.1. Relacionales o condicionales:
Se utilizan para formar expresiones booleanas, es decir, expresiones que al ser
evaluadas producen un valor booleano: verdadero o falso, tal como se
muestra en la figura (Rodriguez Almeida, 1991)






Fuente: Libro de metodología de la programación deRodríguez Almeida
7.2. Aritméticos :
Para tratar los números se utilizan los operadores aritméticos, que junto con
las variables numéricas forman expresiones aritméticas (Rodriguez Almeida,
1991)










Fuente: Libro de metodología de la programación de Rodríguez Almeida
Los operadores mod y div son de menor prioridad

7.3. Alfanuméricos:
Se utiliza para unir datos alfanuméricos (Rodriguez Almeida, 1991)





Fuente: Libro de metodología de la programación de Rodríguez Almeida
Concatenación, unir expresiones alfanuméricas como si fueran eslabones de
una cadena.
7.4. Lógicos o Booleanos:
Combinan sus operandos de acuerdo con las reglas del algebra de Boole con el
fin de producir un nuevo valor que se convierta en el valor de la expresión






Fuente: Libro de metodología de la programación de Rodríguez Almeida
OR u O: Es un operador binario, afecta a dos operadores. La expresión forma
es cierta cuando al menos algunos de los operandos es cierto. Es el operador
lógico de disyunción.
AND o Y: es un operador binario. La expresión formada es cierta cuando
ambos operandos son ciertos al mismo tiempo. Es el operador lógico de
Conjunción.
NOT o no: es un operador unario. Afecta a la expresión cambiando sus estado
lógico, si era verdad lo transforma en falso o viceversa
7.5. Paréntesis:
Los paréntesis se utilizan para anidar expresiones,




Fuente: Libro de metodología de la programación de Rodríguez Almeida
7.6. ded
8. Expresiones
Las expresiones son combinaciones de constantes, variables, símbolos de
operación, paréntesis, y nombres de funciones especiales. Las mismas ideas son
utilizadas en notación matemática tradicional
Cada expresión toma un valor que se determina tomando los valores de las
variables y constantes implicadas y la ejecución de las operaciones indicadas
Una expresión consta de operando y operadores según el tipo de objetos que se
manipulan, se clasifican las operaciones en:
 Aritméticas
 Relacionales
 Lógicas
 Carácter

9. Regla de Prioridad
Según Rodríguez (Rodriguez Almeida, 1991), la prioridad a la hora de evaluar los
operadores en cualquier expresión es
 Paréntesis
 Potencias
 Productos y divisiones
 Sumas y restas
 Concatenación
 Relacionales
 Lógicos
Según Joyanes(Aguilar, 1988)Las expresiones que tienen dos o más operadores
requieren usar reglas matemáticas que permitan determinar el orden de las
operaciones, se denominan reglas de prioridad o precedencia y son:
a) Las operaciones que están encerradas entre paréntesis se evalúan primero.
Si existen diferentes paréntesis anidados (interiores unos a otros), las
expresiones más internas se evalúan primero.
b) Las expresiones aritméticas dentro de una expresión suelen seguir el
siguiente orden de prioridad:
 Operador exponencial (^)
 Operadores de multiplicación y división
 Operadores de suma y resta
 Operadores lógicos or y and
10. Operación de Asignación
La operación de asignación es el modo de darle valores a una variable. La
operación de asignación se representa con el símbolo u operador ( ÷ ). LA
operación de asignación se conoce como instrucción o sentencia de asignación
cuando se refiere a un lenguaje de programación
El formato general de una operación de asignación es



Expresión ÷Expresión, expresión, variable o constante
Ejemplo
A ÷ 10
Significa que la variable A se le ha asignado el valor entero de 10
11. Ejercicios
 Encontrar el valor de la variable valor después de la ejecución de las
siguientes operaciones
a. Valor ÷ 4.0*5
Nombre de la variable ÷ Expresión
b. X ÷ 3.0
Y ÷ 2.0
Valor ÷ X^Y – Y
c. Valor ÷ 5
X ÷ 3
Valor ÷ valor* X
 Deducir el resultado que se puede producir con las siguientes
instrucciones
Variables x, y = enteros
X ÷ 1
Y ÷ 5
Escribir x,y
 Deducir el valor de las expresiones siguientes
X ÷ A +B +C
X ÷ A + B * C
X ÷ A + B / C
X ÷ A + B mod C
X ÷(A + B )/ C
X ÷ A + (B / C)
X ÷A + (B * C)
Siendo A =5, B =25, C= 10
 Escribir las siguientes expresiones en forma de expresiones algorítmicas

i.

ii.

iii.

iv.

v.

vi.

 Como se intercambian los valores de las A, B y Aux
Aux÷ A
A ÷ B
B ÷Aux




12. Estructura General de un Programa
Es un conjunto de instrucciones, órdenes dadas a la máquina, que producirán la
ejecución de una determinada tarea. En esencia un programa es un medio para
conseguir un fin.
El proceso de la programación es por consiguiente, un proceso de solución de
problemas, y el desarrollo de un programa requiere las siguientes fases
 Definición y análisis del problema
 Diseño de algoritmos
o Diagrama de flujo
o pseudocódigo
 Codificación del programa
 Depuración y verificación del programa
 Documentación
 Mantenimiento
12.1. Partes de un programa







12.2. d
13. Instrucciones y tipos de instrucciones
13.1. Instrucción
Son las acciones o instrucciones que se deben escribir y posteriormente
almacenar en memoria en el mismo orden en que han de ejecutarse, es decir,
en secuencia
13.2. Tipos de instrucción
 Instrucciones de inicio y fin
Son aquellas instrucciones que inicializan y finalizan la escritura y
ejecución del programa por ejemplo en java
public class {
public static void main(String, args[]){
}
}
 Instrucciones de asignación
Son aquellas instrucciones que permite asignar valores a una variable
Ejemplo en perl

$th=23;
Programa
(algoritmo de
resolución)
Entrada
Salida

 Instrucciones de lectura
Esta instrucción lee datos de un dispositivo de entrada ejemplo leer
edad, tiempo. Ejemplos en PERL.

Ejemplo 1
Print " ingrese el nombre del empleado: ";
$nombre=<STDIN>;

Ejemplo 2

print"ingrese la cantidad de horas trabajadas: ";
$th=<STDIN>;
chop($th);

o también puede usarse

chomp($th);

Otro ejemplo de lectura en matlab:
a=input ('ingrese el valor de a :');
b=input ('ingrese el valor de b :');

 Instrucciones de escritura
Esta instrucción escribe en un dispositivo de salida ejemplo escribir A, B, C
Ejemplos
En PERL :
print"empleado sueldo bruto descuento sueldo neto \n";
print"==============================================\n";
print " $sb $desc $sn $nombre";

En matlab :
disp('la suma de dos números es :');
disp(s);

 Instrucciones de bifurcación
El desarrollo lineal de un programa se interrumpe cuando se ejecuta una
bifurcación. Las bifurcaciones pueden ser según el punto del programa a
donde se bifurca hacia adelante o hacia atrás.
o Bifurcación incondicional: se realiza siempre que el flujo del
programa pase por la instrucción sin necesidad del cumplimiento
de ninguna condición














o Bifurcación Condicional: depende del cumplimiento de una
determinada condición. Si se cumple la condición, el flujo sigue
ejecutando la acción F2 si no cumple se ejecuta la acción F1







Ejemplo en PERL
if($num <=1){
return $factor=1;}
else {
return $factor= $num*&factorial($num-1);
}
}
Acción 1
Acción 2
Acción 3
Acción F2
Acción
F1
¿ ?
14. Programación Estructurada
Se refiere a un conjunto de técnicas que aumentan considerablemente la
productividad del programa reduciendo un elevado grado el tiempo para escribir,
verificar, depurar y mantener los programas. La programación estructurada
incorpora
Diseño descendente: es el proceso mediante el cual un problema se descompone
en una serie de niveles o pasos sucesivos de refinamiento
Recursos abstractos: la programación estructura se auxilia de los recursos
abstractos en lugar de los recursos concretos de que se dispone
Estructuras básicas: son tres tipos de control: secuencial, selectiva y repetitivas.

14.1. Estructuras Secuencial
La estructura secuencial es aquella en la que una acción (instrucción) sigue a
otra en secuencia. Las tareas se suceden de tal modo que la salida de una es
la entrada de la siguiente y así sucesivamente hasta el fin del proceso.
(Wilder, 2010)
En Pseudocódigo una Estructura Secuencial se representa de la siguiente
forma:
Ejemplo 1
Tengo un teléfono y necesito llamar a alguien pero no sé cómo hacerlo.












Ejemplo 2
Escriba un algoritmo que pregunte por dos números y muestre como
resultado la suma de estos. Use Pseudocódigo y diagrama de flujos.







Ejemplo 3
A continuación se presenta un Pseudocódigo en PERL.
print" ingrese el nombre del empleado: ";
$nombre=<STDIN>;
#chop($nombre);
print" ingrese la cantidad de horas trabajadas: ";
$th=<STDIN>;
chop($th);
print" ingrese el costo por hora trabajo: " ;
$cph=<STDIN>;
chop($cph);
$sb= $th*$cph;
$desc=$sb*0.13;
$sn=$sb-$desc;
print" sueldo bruto descuento sueldo neto empleado \n";
print"==============================================\n";
print " $sb $desc $sn $nombre";

Ejemplo 4
A continuación se presenta un Pseudocódigo en PERL.
th=input('ingrese el total de horas trabajadas :');
cph=input('ingrese el costo por hora trabajada : ');
sb=th*cph;
desc = sb*0.13;
sn= sb - desc;
disp('sueldo bruto');disp(sb);
disp('descuento');disp(desc);
disp('sueldo neto');disp(sn);

Ejercicios 1 al 11 extraídos de Lic. Salomón Aquino de la materia Lógica
Computacional.(Aquino, 2007)
1. Leer el sueldo de tres empleados y aplicarles un aumento del 10, 12 y
15% respectivamente. Desplegar el resultado.
2. Escribir un programa que calcule el salario de un trabajador de la
manera siguiente. El trabajador cobra un precio fijo por hora y se le
descuento el 10% en concepto de impuesto sobre la renta. El programa
debe pedir el nombre del trabajador, las horas trabajadas y el precio
que cobra por hora. Como salida debe imprimir el sueldo bruto, el
descuento de renta y el salario a pagar.
3. Programa que pida el precio de un artículo y calcule su valor aplicándole
un 18% de IGV.
4. Dada una medida de tiempo expresada en horas, minutos y segundos
con valores arbitrarios, elabore un programa que transforme dicha
medida en una expresión correcta. Por ejemplo, dada la medida 3h
118m 195s, el programa deberá obtener como resultado 5h 1m 15s
5. Escriba un programa que calcule el área de un triángulo rectángulo,
dada la altura y la base.
6. Elabore un programa que realice la conversión de cm. a pulgadas.
Donde 1cm = 0.39737 pulgadas. Por lo tanto, el usuario proporcionara el
dato de N cm. y el programa dirá a cuantas pulgadas es equivalente.
7. Elabore un programa que realice la conversión de pulgadas a cm.
Donde 1 cm. = 0.39737 pulgadas. Por lo tanto, el usuario proporcionara
el dato de N pulgadas y el programa dirá a cuantos centímetros
equivale.
8. Elabore un programa que realice la conversión de metros a pies
Donde 1 m = 3.2808 pies, Por lo tanto, el usuario proporcionara el dato
de N m y el programa dirá a cuantos pies equivale.
9. Elabore un programa que realice la conversión de pies a metros
Donde 1 m = 3.2808 pies. Por lo tanto, el usuario proporcionara el dato
de N pies y el programa dirá a cuantos metros equivale.
10. Elabore un programa que realice la conversión de kilogramos a libras
Donde 1 Kg. = 2.2046 libras. Por lo tanto, el usuario proporcionara el
dato de N Kg. y el programa dirá a cuantas libras equivale.
11. Elabore un programa que realice la conversión de libras a kilogramos
Donde 1 Kg. = 2.2046 libras. Por lo tanto, el usuario proporcionara el
dato de N libras y el programa dirá a cuantos kilogramos equivale.
12. Introducir 5 notas por teclado, obtener la suma de las notas, el
promedio de las mismas y el doble de las notas.
13. Un alumno desea saber cuál será su calificación final en la materia de
Algoritmos. Dicha calificación se compone de los siguientes porcentajes:
55% del promedio de sus tres calificaciones parciales.
30% de la calificación del examen final.
15% de la calificación de un trabajo final.
14. Calcular el número de pulsaciones que una persona debe tener por cada
10 segundos de ejercicio, si la fórmula es:
num. Pulsaciones = (220 - edad)/10
15. Determinar la suma de los N primeros números enteros de acuerdo a la
siguiente formula:




16. En un hospital existen tres áreas: Ginecología, Pediatría, Traumatología.
El presupuesto anual del hospital se reparte conforme a la siguiente
tabla:
Área Porcentaje del presupuesto
Ginecología 40%
Traumatología 30%
Pediatría 30%
*( 1)
2
N N
Suma
+
=
Obtener la cantidad de dinero que recibirá cada área, para cualquier
monto presupuestal.
17. El coste de un automóvil nuevo para un comprador es la suma total del
coste del vehículo, del porcentaje de la ganancia del vendedor y de los
impuestos locales o estatales aplicables (sobre el precio de venta).
Suponer una ganancia del vendedor del 12% en todas las unidades y un
impuesto del 6% y diseñar un algoritmo para leer el coste total del
automóvil e imprimir el coste para el consumidor.
18. Un alumno desea saber cuál será su promedio general en las tres
materias más difíciles que cursa y cuál será el promedio que obtendrá
en cada una de ellas. Estas materias se evalúan como se muestra a
continuación:
La calificación de Matemáticas se obtiene de la sig. Manera:
Examen 90%
Promedio de tareas 10%
En esta materia se pidió un total de tres tareas.
La calificación de Física se obtiene de la sig. Manera:
Examen 80%
Promedio de tareas 20%
En esta materia se pidió un total de dos tareas.
La calificación de Química se obtiene de la sig. Manera:
Examen 85%
Promedio de tareas 15%
En esta materia se pidió un promedio de tres tareas.
19. Dados las coordenadas (x1,y1) y (x2,y2) de dos puntos en el plano
cartesiano, determinar la distancia (d) entre estos dos puntos
20. Se tiene las votaciones de 3 candidatos (v1, v2, v3). Sobre el total (tot),
determinar el porcentaje de votación obtenido por cada uno de los
candidatos (p1,p2,p3)
21. Leer tres valores enteros y realizar las siguientes operaciones
 Sumar todos los valores
 Multiplicar todos los valores
 Restar de las suma de los dos el doble del tercero
 Promedio de todos los valores.
 Suma de las mitades de los últimos valores
22. Leer cuatro valores reales a, b, c y d. Realizar lo siguiente:
 Sumar el cuadrado de los extremos más el cubo de los demás
 Multiplicar el promedio de los tres primeros por el promedio de
los tres últimos valores
 Calcular la siguiente expresión:

2
2
4
2 5 4
a b cd a
Valor cd
a
c
c
a b
+ ÷
= ÷ +
+
+ +


23. Si tenemos una expresión algebraica de la forma

, donde
conocemos los valores de los coeficientes de cada uno de los términos
A, B, C , diseñe una aplicación que realice los siguiente:
 Calcular cinco valores de la expresión para cinco valores
diferentes de la variable independiente x.
 Elevar a la cuarta potencia todos los coeficientes de los temimos
 Calcular las raíces reales, si esa expresión representase a la
ecuación de una curva en el plano cartesiano.
24. Se tiene un triángulo rectángulo de base B y altura H. Calcular lo
siguiente:
 Área de la figura
 Perímetro de la figura
 hipotenusa
25. Se lee el radio de un circulo y el lado de un cuadrado, se le pide que
realice una aplicación que haga lo siguiente:
 Calcular área de las figuras
 Sumar los perímetros de ambas figuras
 Área promedio
 Elevar al cubo el perímetro del triangulo
 Calcular la altura promedio de las figuras
26. Hay un cilindro, una esfera y un cono. Al leer las dimensiones básicas de
cada uno de ellos, haga una aplicación que realice:
 Volumen promedio
 Suma de áreas laterales
 Altura promedio
27. Leer cuatro valores reales y calcular la siguiente expresión:


2
2
4
2 5 4
a b cd a
Valor cd
a
c
c
a b
+ ÷
= ÷ +
+
+ +


28. Leer dos valores reales p y q del teclado y escribir la media aritmética
29. Leer un valor real x del teclado. Calcular y escribir r=x
2
– 2x
3

30. Leer los coeficientes de un polinomio de grado tres de la forma
P(x)=x
3
+ax
2
+bx+c, leer a continuación un cierto valor para la variable
independiente x y calcular y escribir y = P(x)
31. Convertir a radianes un valor de ángulo medido en grados
sexagesimales
32. Calcular y escribir la temperatura T que corresponde a un mol de gas
ideal sometido a una presión P cuando ocupa un volumen V. Se supone
que los valores de P y V se proporcionan por teclado
33. Crea un programa para que almacene la secuencia de DNA que hay a
continuación en una variable, y la escriba en la pantalla.
Secuencia de DNA: ACGGGAGGACGGGAAAATTACTACGGCATTAGC
34. Queremos conocer los datos estadísticos de una asignatura, por lo
tanto, necesitamos un algoritmo que lea el número de reprobados,
aprobados, notables y sobresalientes de una asignatura, y nos devuelva:
¿El tanto por ciento de alumnos que han superado la asignatura?
¿El tanto por ciento de reprobados, aprobados, notables y
sobresalientes de la asignatura?

35. Guarda las dos secuencias de DNA siguientes en dos variables escalares
y escríbelas en la pantalla. A continuación, crea una tercera variable que
contenga las dos primeras concatenadas. Escribe también el resultado.
Primera secuencia de DNA:
ACGGGAGGACGGGAAAATTACTACGGCATTAGC
Segunda secuencia de DNA: ATAGTGCCGTGAGAGTGATGTAGTA

14.2. Estructuras Selectivas
Este tipo de estructuras se utilizan cuando el programador quiere realizar
algunas bifurcaciones o establecer condiciones que cumpla o alguna
determinada condición o restricción
14.2.1. Selectivas simples:
Ejecuta una determinada acción cuando se cumple una determinada
condición. A continuación se muestra su sintaxis

Pseudocódigo

Si condición Entonces
Instrucción
Fin si

En Diagrama de flujo se muestra en la figura














Instrucción
Condición
14.2.2. Selectivas Dobles:
La estructura anterior es muy limitada y normalmente se necesitara una
estructura que permita elegir dos opciones o alternativas posibles en
función del cumplimiento o no de una determinada condición. A
continuación se muestra su sintaxis




Si condición entonces
Instrucción 2
Sino
Instrucción 1
Fin si




14.2.3. Selectivas múltiples:
Con frecuencia en la práctica, es necesario que existan más de dos
elecciones posibles



Diagrama de Flujo













Condición
Instrucción 2
Instrucción 1
Condición
Instrucción 1 Instrucción 2
Instrucción n

Pseudocódigo

Según sea condición

Case 1:
Case 2:
.
.
.
Case n:
Fin según

14.2.4. Ejemplos
Ejemplo 1:
Resolución de una ecuación de primer grado
Si la ecuación es ax + b =0, a y b son los datos y las posibles soluciones
son
 Si a <> 0 entonces x= -b/a
 a=0 b<>0 entonces “solución imposible”
 a= 0 b =0 entonces “ solución indeterminada”
Algoritmo pseudocódigo
Inicio
Leer a, b
Si a <> 0 entonces
x ÷ - b/a
Sino
Si b<>0 entonces
Escribir “solución imposible”
Sino
Escribir “solución indeterminada”
Fin- si
Fin – si

Fin
Ejemplo 2
Resolución de la ecuación de segundo grado teniendo en cuenta los
tres posibles valores de discriminación
La ecuación de segundo grado es:
ax^2 + bx +c = 0
El discriminante D vale
D = b^2 - 4ac
Y las raíces son
X1, x2 =

=

Si el discriminante es menor que cero, las raíces son imaginarias
Algoritmo Pseudocódigo
Inicio
Leer a, b, c
D ÷ b^2 -4*a*c
Según sea D hacer
D <0: escribir “raíces complejas”
D = 0: x ÷ - b/2*a
D >0: rc÷raizcua(D)
X1 ÷ (-b + rc)/2*a
X2 ÷ (-b -rc)/2*a
Escribir x1, x2
Fin _ según
fin
Ejemplo 3
Se desea diseñar un algoritmo que escriba los nombres de los días de
la semana en función del valor de una variable DIA introducida por
teclado
Inicio
Leer Día
Según_ sea DIA hacer
1: escribir “Lunes”
2: escribir “Martes”
3: escribir “Miercoles”
4: escribir “Jueves”
5: escribir “Viernes”
6: escribir “Sabado”
7: escribir “Domingo”
Otros: escribir “Error”
Fin_ según
Fin
Ejemplo 4
El ejercicio 1 de los propuestos en Código en perl
print"ingrese 1ra medida : ";
$m1=<STDIN>;
chop($m1);
print"ingrese 2da medida : ";
$m2=<STDIN>;
chop($m2);
print"ingrese 3ra medida : ";
$m3=<STDIN>;
chop($m3);
print"ingrese 4ta medida : ";
$m4=<STDIN>;
chop($m4);
$media=($m1+$m2+$m3+$m4)/4;
if ($media <= 4) {
print"el ruido no es nocivo \n";
print"su media es: $media";
}
else {
print"el ruido es nocivo \n";
print"su media es: $media" ;
}

Ejemplo 5
El ejercicio 2 de los propuestos en Código en perl

print" ingrese el sueldo del cliente: " ;
$sueldo=<STDIN>;
chop($sueldo);
print"estado del cliente: ";
$est=<STDIN>;
chop($est);
print" numero de hijos: ";
$nh=<STDIN>;
chop($nh);
if ($sueldo > 1200)
{
print" se concede el préstamo";
}
elsif (($sueldo <= 1200) && ($sueldo > 1000) && ($est eq "s") &&
($nh==0))
{
print" se concede el préstamo";
}
elsif (($sueldo <= 1200) && ($sueldo > 1000) && ($est eq "c")
&& ($nh==0))
{
print" se concede el préstamo";
}
else
{
print" no se le concede el préstamo" ;
}
Ejemplo 6
El ejercicio 1 de los propuestos en Código de Matlab

m1=input('ingrese la 1ra media: ');
m2=input('ingrese la 2da media: ');
m3=input('ingrese la 3ra media: ');
m4=input('ingrese la 4ta media: ');
media=(m1+m2+m3+m4)/4;
if (media <= 4 )
disp('el ruido no es nocivo');
disp('la media es ');disp(media);
else
disp('el ruido es nocivo');
disp('la media es ');disp(media);
end

Ejemplo 7
El ejercicio 2 de los propuestos en Código de Matlab

sueldo = input('ingrese el sueldo del cliente');
nh=input('ingrese el número de hijos: ');
est=input('ingrese el estado civil: '); % 0 = casado y 1 =soltero
if (sueldo > 1200)
disp('se le concede el prestamo');
else if ((sueldo <=1200)&&(sueldo > 1000)&& (nh==0) &&(est==1))
disp('se le concede el prestamo');
else if ((sueldo <=1200)&&(sueldo > 1000)&& (nh==0) &&(est==0))
disp('se le concede el prestamo');
else
disp(' no se le concede el prestamo');
end
end
end


14.2.5. Ejercicios
1. Para calcular el nivel de ruido de una calle de una ciudad se
realizan 4 medidas, una cada 8 horas, en un punto concreto. Si la
media de las medidas del nivel de ruido supera la máxima
admitida (por ejemplo máxima =4), significa que el ruido es nocivo
para la salud. Realizar un programa que calcule el nivel medio del
ruido de una calle y determine si el nivel de ruido es nocivo o es
admisible.
2. Un banco antes de conceder un préstamo a 20 años comprueba los
ingresos del solicitante. Si los ingresos son superiores a 1200.00
nuevos soles mensuales el crédito se concede. Si los ingresos son
inferiores a 1200.00 nuevos soles pero superiores a 1000.00
nuevos soles y está soltero el crédito se concede. También se le
concede si tiene ingresos entre 1200.00 y 1000.00 nuevos soles y
está casado sin hijos. Realizar un programa que pida los ingresos
mensuales y el estado civil del solicitante y si tiene hijos y diga si
se le da el crédito o no
3. Escriba un programa que lea el importe de la compra y la cantidad
recibida y calcule el cambio a devolver, teniendo en cuenta que el
número de monedas que devuelva debe ser mínimo. Suponer que
el sistema monetario utilizado consta de monedas de 100, 50, 25,
5, 1 unidad.
4. Escriba un programa que lea tres números enteros y asigne el
valor apropiado TRUE o FALSE a las siguientes variables booleanas
y muestre el tipo de triangulo que es (si es un triángulo)
Triangulo: True si los números pueden representar longitudes de
los lados de un triángulo (La suma de dos cualesquiera de los lados
debe ser mayor que el otro).
Equilátero: True si es un triángulo equilátero (todos los lados son
iguales).
Isósceles: True si es un triángulo isósceles (al menos dos lados son
iguales).
Escaleno: True si es un triángulo escaleno (no tiene dos lados
iguales).
5. Escribe un programa que lea los coeficientes A, B, C de la ecuación
cuadrática AX
2
+ BX + C = 0 y muestre por pantalla la solución
obtenida. Considerar los casos en que no exista solución, que
existan infinitas soluciones, que exista una sola solución (Ecuación
lineal) o que existan dos soluciones.
6. Se quiere realizar un programa que determine si un alumno es
apto o no. Un alumno se considera apto si su nota final es de 5 o
más y no apto en caso contrario. La nota final se calcula como la
media ponderada del trabajo realizado en casa, la media obtenida
en los tests y la puntuación del examen. Nota final = 0.3* Trabajo +
0.5*Test + 0.3*Examen. Además debe tener la calificación de
acuerdo a la tabla:
Nota >=9.5 Matrícula de Honor
8.5 <= Nota < 9.5 Sobresaliente
6.5 <= Nota < 8.5 Notable
5 <= Nota < 6.5 Aprobado
Nota < 5 Suspenso
7. Escribir un algoritmo tal que dada la temperatura máxima del mes
y la temperatura medida hoy, actualice el valor de la máxima si la
temperatura leída hoy es mayor que dicho máximo.
8. Implementar un algoritmo que dados tres números a, b y c, los
devuelva ordenados de menor a mayor
9. El cuadrante de un punto (x, y) se puede determinar a partir del
signo de x e y. Escribir un algoritmo tal que dadas las coordenadas
x e y, indique a que cuadrante pertenece el punto







10. Dados el valor antiguo y el actual del contador de la luz, escribir un
algoritmo que determine a cuánto asciende la factura de la luz de
un determinado abonado. El importe es la suma de la cuota fija
(S/. 12 ) más una cuota variable que depende del consumo y se
calcula por tramos: los primeros 100 Kw, a 0.06 el Kw, los 150 Kw
siguientes a 0.04 el Kw, si el consumo excede de 250 Kw, esa
fracción se cobra 0.02 el kw
11. Supóngase que el importe del seguro obligatorio de un conductor
de un coche depende del modelo del coche, del color y de la edad
del conductor. Sean dos modelos de coche A y B y los precios del
seguro según el color:









Si el conductor tiene menos de 26 años, el precio se incrementa un
25 %; si tiene entre 26 y 30 años se incrementa un 10 %; si tiene
entre 31 y 65 años el precio no se modifica; si tiene más de 65
años el precio se incrementara un 10 %. Además, en cualquier
caso, hay que considerar que si el conductor tiene menos de 2
años el permiso de conducir, el precio se incrementara un 25 %
adicional.
Diseñar un algoritmo que calcule el precio del seguro para un
determinado modelo y un determinado conductor.
12. Diseñar un algoritmo que dado un número, indique si es par o
impar
13. Desarrolle un algoritmo que permita leer dos valores distintos,
determinar cuál de los valores es el mayor y escribirlo.
14. Desarrolle un algoritmo que permita leer tres valores y
almacenarlos en las variables A, B y C respectivamente. El
algoritmo debe imprimir cual es el mayor y cuál es el menor.
Recuerde constatar que los tres valores introducidos por el teclado
sean valores distintos. Presente un mensaje de alerta en caso de
que se detecte el ingreso de valores iguales
15. Determinar la cantidad de dinero que recibirá un trabajador por
concepto de las horas extras trabajadas en una empresa, sabiendo
que cuando las horas de trabajo exceden de 40, el resto se
consideran horas extras y que éstas se pagan al doble de una hora
normal cuando no exceden de 8; si las horas extras exceden de 8
se pagan las primeras 8 al doble de lo que se paga por una hora
normal y el resto al triple.
16. Se desea agregar una letra para representar la calificación de los
alumnos, las calificaciones son notas entre 1 y 10; use los
siguientes parámetros: A para calificaciones mayores o iguales a 9,
B para calificaciones mayores o iguales a 8, C para calificaciones
mayores o iguales a 7, D para calificaciones mayores o iguales a 6,
F para todas las demás calificaciones.
17. La empresa Milagrito S.A. tiene la siguiente tabla de parámetros
para pagar las comisiones de sus ejecutivos de ventas:



Escriba un programa que al introducir la cantidad vendida por el
ejecutivo de ventas, calcule de cuánto será su comisión
18. En base al valor de dos números enteros, determine si estos son:
A. Iguales.
B. No iguales.
C. El primero es mayor que el segundo.
D. El segundo es mayor que el primero.
E. El primero es mayor o igual que el segundo.
F. El segundo es mayor o igual que el primero.
19. Un restaurante, desea dar a conocer a sus clientes el plato que se
ha preparado para cada uno de los tiempos de comida desayuno,
almuerzo y cena. El restaurante prepara un plato único para cada
uno de los tiempos. Cuando el cliente seleccione entre los tiempos
de comida (desayuno, almuerzo o cena) se debe desplegar el
detalle de este.
Ejemplo:
Seleccione su tiempo de Comida: desayuno
Detalle
Plátanos, Frijoles, Queso, Crema, Pan y Café
20. Elabore un programa que pida dos números y que permita mostrar
un menú con las cuatro operaciones básicas, donde el usuario
pueda seleccionar la operación que desea realizar (basta con que
seleccione el número).
21. Leer un número real x, calcular y escribir r = |x|
3

22. Calcular el coste de una llamada telefónica que ha durado t
minutos sabiendo que si t<1, el coste es de 0.4 euros mientras que
para duraciones superiores el coste es 0.4 + (t+1)/4 euros.
23. Leer un número real del teclado. Calcular el valor de p sabiendo
que si x está en el intervalo (2,8], el resultado p toma el valor uno,
en caso contrario toma el valor cero. Escribir posteriormente el
valor de p.
24. Leer un valor x del teclado. Calcular y escribir el valor y = f(x),
siendo f una función definida a trozos del siguiente modo:

x F(x)
X є *-1,3) 10-x
x>50 1
resto 0

25. Leer las componentes de un vector de R
2
(x e y). Calcule el valor de
r que se define como r= NC(x, y), si x≠0, y≠0 y x=0 o si y =0
26. Dado un numero entero x mayor que uno se ha de escribir un uno
si el número es par y un cero en caso contrario.
27. Dados dos números enteros positivos p y q, p > q, se ha de escribir
un uno si son divisibles y cero si no lo son
28. Dada una cantidad N > 1 calcular la raíz cuadrada entera
aproximada r. se ha de cumplir que r*r ≤ N<(r+1)(r+1). Por
ejemplo, si N=24 se tiene que r=4 pues 4*4 =16≤24<25=5*5.
29. Se ha de escribir un uno en el caso de que exista un trio (x, y, z) de
números enteros positivos tales que x
2
+ y
2
= z
2
. Limite a x є (0,
100+, y є (0, 100+. En caso de que no se encuentre solución se ha de
escribir un cero.
30. Determinar el mayor y menor valor de 5 números ingresados
desde el teclado.
31. Ordenar de menor a mayor 5 números ingresados por teclado
32. Un restaurant ofrece un descuento del 20% para un consumo
mayor a S/. 30.00 y aplica un impuesto de 15% para todo
consumo. Determinar el importe a pagar por lo consumido,
mostrando todos los importes.
33. Un profesor desea implementar un algoritmo que le permita
bonificar equitativamente a todos sus alumnos de acuerdo a la
nota conseguida en un examen, de la siguiente forma: si la nota
fuera menor que 5 se bonifica con 3 puntos; si la nota fuera mayor
o igual que 5 pero menor que 10 se bonifica con 2 puntos y si la
nota fuera mayor o igual que 10 pero menor que 15 se bonifica
con 1 punto; y si la nota fuera mayor o igual que 15 pero menor o
igual que 20 se le descuenta el residuo de la nota entre 5,
determinar la nota bonificada para cualquier alumno.
34. Dos personas desean intercambiar sus identidades (nombre,
dirección, teléfono, edad) siempre y cuando la edad del primero
fuese mayor que la edad de segundo en no más de 4 años. Ingresar
los datos de cada persona y mostrar sus nuevas identidades o un
mensaje mostrando la diferencia de edades que impidiera el
intercambio.
35. Un trabajador del estado percibe un sueldo básico mensual de 750
nuevos soles; además recibe incrementos de sueldo de acuerdo a
los siguientes conceptos

instrucción porcentaje
Hasta 5to secundaria 5%
técnico 10%
profesional 20%






También por ley está sujeto a un descuento de 10% si su sueldo
excede de S/. 800. determinar el sueldo neto que recibe un
trabajador
36. En una olimpiada de tiro al blanco se llega a un acuerdo entre los
participantes para que el puntaje obtenido sea calculado en base
al puntaje original (0 al 10) alcanzado en el tiro, multiplicado por
un factor:






Para un tiro realizado determinar su puntaje correspondiente.
37. Una tienda de ropa ha establecido los porcentajes de descuento,
que se indican a continuación, de acuerdo a ciertas características
del comprador: nacionalidad (1,2) y del producto que compra: sexo
(H, M), talla (Niño, Joven, Adulto). Se sabe que una persona puede
comprar varios productos por lo que se desea mostrar como
resultados los siguiente: nombre del comprador, cantidad de
productos comprados, importe comprado, importe descontado, el
importe a pagar; para lo cual se deben ingresar los datos que sean
necesarios. El proceso para la compra de una persona termina
cuando al ingresar el nombre del comprador se presiona ENTER


Condición Social porcentaje
casado 3%
Por cada hijo 2%
Sin vivienda 5%
Puntaje original Factor
0 0
1..5 6
6..8 9
9..10 10
Nacionalidad
niño joven adulto
sexo sexo sexo
H M H M H M
1 5 4 7 9 10 12
2 4 5 9 7 12 10


38. Leer cuatro valores reales a, b, c, y d. realizar lo siguiente:
¿Calcular la siguiente expresión?


39. Leer cuatro valores reales y calcular la siguiente expresión:





40. Escribir un algoritmo cree un menú de conversión para:
¿Pulgadas a centímetros (1 pulgada = 2.54 cm)?
¿Pies a metros (1 pie = 0.3048 metros = 12 pulgadas)?
¿Millas por hora a kilómetros por hora (60 millas\hora = 80
Km\hora)?
¿Grados a radianes (360 grados = 2pi radianes, pi=3.141592)?
¿?

41. Desarrolle un algoritmo para la siguiente función

0 0
0
0 16.67
16.67 0
( )
33.34
16.67 33.34
33.34 16.67
0 33.34
TINS
si x
x
si x
x
x
si x
si x
µ
s ¦
¦
÷
¦
< s
¦ ÷
=
´
÷
¦
< <
¦
÷
¦
>
¹


42. El gobierno del Perú desea reforestar un bosque que mide
determinado número de hectáreas. Si la superficie del terreno
excede a 1 millón de metros cuadrados, entonces decidirá sembrar
de la siguiente manera.
Porcentaje de la superficie del bosque. Tipo de árbol 70% pino,
20% oyamel, 10% cedro.
2
2
4
2 5 4
a b cd a
Valor cd
a
c
c
a b
+ ÷
= ÷ +
+
+ +
2
2
2
4
2 5 4
a b cd a
Valor cd
c
a
c
a b
+ ÷
= ÷ +
+
+ +
Si la superficie del terreno es menor o igual a un millón de metros
cuadrados, entonces decidirá sembrar de la siguiente manera.
Porcentaje de la superficie del bosque tipo de árbol.
50% pino
30% oyamel
20% cedro.
El gobierno desea saber el número de pinos, oyameles y cedros,
que tendrá que sembrar en el bosque. Si se sabe que en 10 metros
cuadrados caben 8 pinos, en 15 metros cuadrados caben 15
oyameles y en 18 metros cuadrados caben 10 cedros. También se
sabe que una hectárea equivale a 10 mil metros cuadrados.
43. Una fábrica ha sido sometida a un programa de control de
contaminación para lo cual se efectúa una revisión de los puntos
IMECA generados por la fábrica. el programa de control de
contaminación consiste en medir los puntos IMECA que emite la
fábrica en cinco días de una semana y si el promedio es superior a
los 170 puntos entonces tendrá la sanción de parar su producción
por una semana y una multa del 50% de las ganancias diarias
cuando no se detiene la producción. Si el promedio obtenido de
puntos IMECA es de 170 o menor entonces no tendrá ni sanción ni
multa. El dueño de la fábrica desea saber cuánto dinero perderá
después de ser sometido a la revisión.
44. Una persona se encuentra con un problema de comprar un
automóvil o un terreno, los cuales cuestan exactamente lo mismo.
Sabe que mientras el automóvil se devalúa, con el terreno sucede
lo contrario. Esta persona comprara el automóvil si al cabo de tres
años la devaluación de este no es mayor que la mitad del
incremento del valor del terreno. Ayúdale a esta persona a
determinar si debe o no comprar el automóvil.
45. Permita ingresar el mes y día de nacimiento, después de evaluar se
debe imprimir el signo zodiacal correspondiente.
46. Luego de ingresar una fecha del día con el formato Día Mes Año.
Se imprime la fecha del día siguiente.
47. Imprima el valor medio de tres números ingresados por el teclado.
48. Permitir ingresar una hora determinada con el formato H M S (H=
Hora, M= Minuto, S= Segundo). Se pide imprimir la hora que será
después de un segundo
49. Leer un números real x y otro entero z. calcular y escribir y = x
z
,
suponiendo que z ≥ 0
50. Los empleados de una fábrica trabajan en dos turnos, diurno y
nocturno. Se desea calcular el jornal diario de acuerdo con los
siguientes puntos:
 Las tarifas de las horas es de 50 nuevos soles
 La tarifa de las horas nocturnas es de 80 nuevos soles
 Caso de ser domingo la tarifa se incrementa en un 100%
tanto en el turno diurno y nocturno
51. Diseñar el algoritmo que dado un número, indique si es par o es
impar
52. Dado un número, se debe contestar si es múltiplo de 3, 6 y 9 a la
vez. Condicionar el algoritmo para cualquier número.
53. Ingresar un numero en forma de ARABICO (entero) y mostrar su
equivalente en ROMANO asumiendo que el número ingresado es
correcto y no debe ser mayor a 3999
Ejemplo si se ingresa el numero 123 debe aparecer como resultado
CXXIII
54.
14.3. Estructuras Repetitivas
Son las estructuras que repiten una secuencia de instrucciones un
determinado número de veces a esto se le denomina bucle y se denomina
iteración al hecho de repetir la ejecución de una secuencia de acciones
Antes de explicar los tipos de estructuras repetitivas definamos que es un
Contador, acumulador o sumador
Un contador es una variable destinada a contener diferentes valores, que
se va incrementando o decrementando cada vez que el ordenador realice
una instrucción que lo contiene. El incremento o decremento si es
negativo, llamado también paso del contador, es siempre constante
ejemplo i ÷ 1, j ÷0, etc.
Acumulador o sumador: es una variable que nos va a permitir guardar un
valor que se incrementa o decrementa de forma no constante durante el
proceso. En un instante determinado tendrá un valor y al siguiente tendrá
otro valor igual o distinto. Ejemplo S ÷S + i , a ÷ a*i , etc

14.3.1. Estructura repetitiva mientras (While o Do while):
La estructura repetitiva mientras, es aquella en que al cuerpo del bucle se
repite mientras se cumple una determinada condición. La representación
en Pseudocódigo y Diagrama de Flujo será:

Mientras condición hacer
Acción 1
Acción 2
.
.
.
Fin mientras













14.3.2. Estructura repetitiva para (For):
En muchas ocasiones se conoce de antemano el número de veces que se
desea ejecutar las acciones de un bucle. En este caso en el que el número
de iteraciones es fija se debe usar la estructura desde o para
La representación en pseudocódigo y diagrama de flujo es

Desde variable (V) = vi hasta vf hacer
Acción 1
Acción 2
.
.
.
Fin desde
V: variable índice
Vi, vf : valor inicial y final de la variable











Calcular valor inicial y final
Fijar la variable índice al valor inicial

Variable índice >
valor final
Acciones

Cuerpo del bucle
Falso
Verdadero
Condició
n
Acciones
Falsa
Verdadera


















14.3.3. Estructura repetitiva repetir:
Existen muchas situaciones en la que se desea que un bucle se ejecute al
menos una vez antes de comprobar la condición de repetición. La
estructura repetir se ejecuta hasta que se cumpla una condición
determinada que se comprueba al final del bucle. El bucle repetir – hasta
que se repite mientras el valor dela expresión booleana de la condición
sea falsa, justo lo opuesto de la sentencia mientras.
La representación en Pseudocódigo y Diagrama de Flujo es

Repetir
Accion1
Acción 2
.
.
.
Hasta _que Condición







14.3.4. Ejemplos
Para o desde i = 1 hasta n hacer
Acciones
Condició
n
Acciones
Falsa
Verdadera
Ejemplo 1
Hallar el factorial de un numero N utilizando la estructura desde
Inicio
Leer N
Fact÷ 1
Desde i ÷ 1 hasta N hacer
Fact÷fact*i
Fin_desde
Escribir “el factorial de”, N, “es”, fact
Fin
Ejemplo 2
Realizar el algoritmo para obtener la suma de los números pares
hasta 1000.
Inicio
Suma ÷ 2
Numero ÷ 4
Mientras número <= 1000 hacer
Suma ÷ suma + numero
Numero ÷ número +2
Fin _ mientras
Fin
Ejemplo 3
Dado dos números enteros, realizar el algoritmo que calcule el
cociente y el resto

Inicio
Leer M, N
Resto ÷ M
Cociente ÷ 0
Repetir
Resto ÷ resto – N
Cociente ÷ cociente + 1
Hasta_ que resto < N
Escribir “dividiendo”, M, “divisor”, N, “Cociente”, cociente, Resto
Fin
Ejemplo 4
Ejemplo 1 en código Perl
print"ingrese un numero para hallar su factorial: ";
$n=<STDIN>;
chop($n);
$i=1;
$fact=1;
if ($n==0)
{
print"$fact" ;
}
else
{
while($i<=$n)
{
$fact=$fact*$i;
$i++;
}
print"el factorial es: $fact" ;
}
Ejemplo 5
El ejemplo 1 En código en Matlab
n=input('ingrese un numero para hallar el factorial : ');
i=1;
fact=1;
if n==0
disp('el factorial es :');
disp(fact);
else
while i<=n
fact=fact*i;
i=i+1;
end
disp('el factorial es: ');
disp(fact);
end
Ejemplo 6
Calcular el factorial de n números leídos por teclado, en código
perl.
print"ingrese el número de factoriales a calcular: ";
$n=<STDIN>;
chop($n);
for($i=1;$i<=$n;$i++)
{
print"ingrese un numero: ";
$num=<STDIN>;
chop($num);
$fact=1;
for($j=1;$j<=$num;$j++ )
{
$fact=$fact*$j;
}
print"el factorial del número $num es $fact \n";
}


Ejemplo 7
Calcular el factorial de n números leídos por teclado, código
matlab
n=input('ingrese el número de factoriales a calcular: ');
for i=1:n
num=input('ingrese un numero: ');
fact=1;
for j=1:num
fact=fact*j;
end
disp(fact);
end

Ejemplo 8
Dados dos números enteros, realizar el algoritmo que calcule el
cociente y el resto en código perl
print"ingrese el primer número: ";
$a=<STDIN>;
chop($a);
print"ingrese el segundo número: ";
$b=<STDIN>;
chop($b);
$resto=$a;
$cociente=0;
do
{
$resto=$resto-$b;
$cociente=$cociente+1;
}
until($resto<$b);
print"dividendo : $a, divisor: $b, cociente: $cociente, resto:$resto";

14.3.5. Ejercicios
1. Hallar el factorial de un numero N utilizando la estructura
mientras y repetir
2. Imprimir los 30 primeras potencias de 4, es decir 4 elevado a 1, 4
elevador a 2 con las tres estructuras.
3. Calcular la suma de los n primeros enteros con las tres estructuras
4. Diseñar un algoritmo para imprimir la suma de los números
impares menores o iguales que n
5. Calcular el número máximo de una serie de 100 números.
6. Realizar un algoritmo que escriba los N primeros números de la
serie de Fibonacci 1,2,3,5,8,13,21
7. Determinar la media de una lista indefinida de números positivos,
terminados con número negativo o cero.
8. Calcular el factorial de los n números leídos por teclado
9. Calcular

, Para N > 0
- Para un N dado
- Para que N sea tal que

< E (por ejemplo e = 10
- 4
)
10. Dadas 3 listas de 10 números de teléfono, donde la primera lista
contiene el número de pasos consumidos en llamadas locales
asociado a cada teléfono, la segunda contiene información sobre
llamadas nacionales y la tercera contiene información sobre
llamadas internacionales, calcular los subtotales del coste década
una de las categorías considerando los costes siguientes: llamada
local, 5 pesetas por paso, llamada nacional 10 pesetas por paso y
llamada internacional 50 pesetas por paso. Construir un programa
que lee los datos de entrada desde el teclado e imprima los
resultados finales por pantalla.
11. Diseñar un algoritmo que determine los números primos entre dos
números dados.
12. El DNA es una hélice formada por dos cadenas, una
complementaria de la otra, que avanzan en sentidos opuestos:


En la cadena complementaria, las sustituciones de nucleótidos son
las siguientes:



La dirección en la que siempre deben dar las secuencias (por

Escribe un programa que, dada una secuencia de DNA, calcule su
complementaria (y reversa).
Secuencia de DNA: ACGGGAGGACGGGAAAATTACTACGGCATTAGC
13. La transcripción es el paso de DNA a RNA, donde todas las timinas
(T) de la secuencia cambian a uridinas (U). En este apartado debes
escribir un programa para transcribir secuencias de DNA.
Introduce la siguiente secuencia de DNA en el programa en forma
de variable escalar, y cambia todas sus T's por U's. Finalmente,
5' ACTCAGA 3'
3' TGAGTCT 5'
A T
T A
C G
G C
como siempre, escribe el resultado para comprobar que el
programa hace lo esperado.
14. Dado un número N, calcular la suma 5 +10 +15 + 20+ . . . +5* n
15. Diseñar el algoritmo que encuentre (muestre) los números pares
que hay entre 100 y 1000.
16. Diseñar el algoritmo que calcule la suma de los pares que hay
entre dos números dados.
17. ¿Calcular los pagos mensuales de una hipoteca y el total a pagar.
El programa debe solicitar el capital, el interés anual y el número
de años y debe escribir la cuota a pagar mensualmente. Para
calcular la cuota se utiliza la siguiente fórmula: Sea C el capital del
préstamo, R la tasa de interés mensual y N el número de pagos. La
cuota mensual viene dada por:





Y el interés mensual será: interés anual / 100 /12
18. Cifrado de datos: dado un número de cuatro dígitos se
reemplazará cada dígito por (dígito +7) módulo 10. A continuación
se intercambiará el primer dígito por el tercero y el segundo por el
cuarto, y ese será el número cifrado.
19. Desarrolle el algoritmo de la bisección para el cálculo de la
siguiente ecuación no lineal












20. Desarrolle el algoritmo del trapecio: para calcular por medio del
método del trapecio la integral de la siguiente función.
F(X) = 0.2 + 25 X - 200 X
2
+ 675 X
3
- 900 X
4
+ 400 X
5

El proceso consiste de la siguiente manera
 Leer el intervalo a, b y el número de sub intervalos
 Dividir el intervalo en n sub intervalo
 Evaluar la función en los extremos de los sub intervalos
 Aplicar la formular
 Salida integral aproximada

2
( ) ( ) cos(1 ) 1 f x sen x x = + ÷ ÷
0 1 2 1
( ( ) 2 ( ) 2 ( ) ... 2 ( ) ( ))
2
n n
t
h f x f x f x f x f x
I
÷
+ + + + +
=
b a
h
n
÷
=
a = f (x
o
)
b = f (x
n
)

21. Desarrollar un algoritmo para Aproximar la siguiente función y =
seno(x)





22. Desarrollar un algoritmo para Aproximar la siguiente función y =
coseno(x)




23. Desarrollar un algoritmo para Aproximar la siguiente función y = e
x





24. Desarrollar un algoritmo para Aproximar la siguiente función y =
ln(1+x)




25. Dado n>0 hallar la suma
1
1
n
k
s
k
=
=
¿

26. Se desea calcular la suma
1
1
n
k
k
s
a
=
=
¿
siendo los valores a
k
los
elementos de la sucesión dada por a
k
= a
k-1
+ a
k-2
, para k > 2, con
a
1
=1 y a
2
=1. El limite n ha de leerse del teclado y se supone mayor
que dos.
27. Se desea calcular la suma
1
1
n
m
k
s
k
=
=
¿
, siendo m y n dos números
enteros positivos que se suponen dados.
28. Escriba los n primeros términos de la sucesión dada por
1
(1 )
n
n
a
n
= + , siendo n un numero entero positivo dado.
29. Escribir un programa que imprima las n primeras líneas de pascal
(n se ingresa por teclado)
1
1 1
1 2 1
1 3 3 1
1 4 6 4 1
30. Escribir un programa que encuentre el logaritmo en cualquier base
de un numero positivo x. la base y el número, lo ingresara el
usuario y el programa debe continuar hasta que se ingrese un
valor 0
10
log ( )
log ( )
log ( )
a
a
x
x
b
=

31. Dado un numero entero x mayor que uno se ha de escribir un uno
si es primo y un cero en caso contrario. Para ello ha de comprobar
si x es divisible por algún entero en el intervalo (1, x).
32. Dado un numero entero mayor que uno se ha de escribir la lista de
sus divisores comprendidos en el intervalo (1, x).
33. Se ha de escribir un uno en el caso de que exista un trio (x, y, z) de
números enteros positivos tales que x
2
+ y
2
= z
2
, escribiendo todas
las soluciones en el intervalo x є (0, 1000+, y є (0, 1000+. En caso
contrario de que no se encuentre solución se ha de escribir un
cero.
34. Dado dos números enteros positivos p y q escriba un algoritmo
que permita hallar el máximo común divisor de los mismos
35. Diseñe un algoritmo que permita descubrir si dos enteros
positivos son primos entre sí, es decir si su máximo común divisor
es uno.
36. Calcule e imprima los números primos entre 1 y 100
37. Mostrar los N primos términos de la siguiente serie, donde N debe
estar entre 5 y 30
5, 7, 10, 14, 19
38. Mostrar los N primeros términos de la siguiente serie, indicando
además la suma de los mismos.
7, 9, 12, 16, 21
39. Determinar la cantidad de términos que son múltiplos de 3 en los
200 primeros términos de la siguiente serie
6, 8, 10, 12, 14
40. Contar y sumar los números enteros positivos introducidos por
teclado.
41. Sume los números del 1 al 200 menos los múltiplos de 5.
42. Calcule la suma y el producto de los números impares
comprendidos entre 11 y 111. Resolver con tres estructuras
distintas.
43. Calcule el MCD (Máximo Común Divisor) de dos números A y B de
acuerdo con el algoritmo de Euclides.
44. Imprima las tablas de multiplicar desde P hasta Q, siendo P y Q dos
valores ingresados por el teclado, tal que P>=0 cada tabla debe
tener el multiplicador desde 1 hasta 12.
45. Imprima los números de Fibonacci menores que 1500. Los
números de Fibonacci se calcula como la suma de los 2 anteriores:
0, 1, 1, 2, 3, 5, 8, 13,…
46. Imprima los 50 primeros números múltiplos de 3 anteriores al 500.
47. Calcule e imprima el número de términos necesarios para que el
valor de la siguiente sumatoria se aproxime lo más cercanamente
a 1000 sin que lo exceda.
2 7
1
1
k
k
k
=
+
¿


48. Calcule el número máximo de términos de la serie de Fibonacci 1,
1, 2, 3, 5,8,.., cuya suma no exceda de 10000.
49. Permita ingresar el nombre del bien, la cantidad a depreciar y el
número de años de depreciación, la salida debe mostrar cada año
y su depreciación. De acuerdo con el método de la suma de los
dígitos empleado en el análisis financiero para calcular la
depreciación. Por ejemplo suponga que un automóvil de $20000
será depreciado durante un periodo de 5 años, la suma de los
dígitos del año: 1+2+3+4+5=15. De acuerdo con el método el
primer año el bien se deprecia 5/15, el segundo 4/15 y así
sucesivamente.
50. La esquina de un rectángulo debe estar sobre la curva elabore el
algoritmo que determine las coordenadas de la esquina del mayor
rectángulo posible (imprima las coordenadas (x, y) y el área
máxima).
2
2 18 y x = ÷ +

15. Subprogramas
La resolución de problemas complejos se facilita considerablemente si se dividen
en problemas más pequeños llamados subproblemas (Subprogramas). Las
herramientas usadas en la programación son las funciones y procedimientos
(subrutinas)
15.1. Procedimientos(Subprograma):
Llamados también subrutina, un procedimiento es un subprograma que
ejecuta un proceso específico, cuando se invoca el procedimiento, los pasos
que lo definen se ejecutan y a continuación se devuelve el control al programa
que le llamo
Declaración de un procedimiento


Procedimiento nombre (parámetros formales, parámetros variables)
Inicio
Acciones

Fin




Donde
Nombre: Es el nombre del procedimiento a invocar
Parámetros formales: Tiene el mismo significado que en las funciones
Parámetros variables: En algunos lenguajes de programación está permitido
este tipo de declaración, para designar que ellos obtendrán resultados del
procedimiento en lugar de los valores actuales asociados a ellos.
Invocación a una función
(Llamar_a) nombre (lista de parámetros actuales)
Por ejemplo
Procedimiento división (dividendo, divisor, cociente, resto)
Inicio
Cociente ÷ dividendo/ divisor
Resto ÷ dividendo - cociente*divisor
Retorno
Fin

Algoritmo aritmética
Inicio
Leer M, N
Llamar_a división (M, N, P, Q)
Escribir p, Q
Fin
15.2. Funciones
Matemáticamente una función es una operación que tiene uno o más valores
llamados argumentos y produce un valor denominado resultado o valor de la
función para los argumentos dados (Aguilar, 1988)
Declaración de una función





Dónde:
Par1, par2,… Lista de parámetros o argumentos
Nombre_ función Nombre asociado con la función, que será un nombre de
identificación valido
Función nombre _ función (par1, par2, par3,…)
Inicio
Acciones

Fin
Acciones instrucciones que constituyen la definición de la función y que debe
contener una acción solo de asignación que asigne un valor al nombre de la
función, es decir, nombre_ función ÷ expresión
Por ejemplo la función

Función fun(x)
Inicio
Fun÷x/(1 + x^2)
Fin
Invocación de una función
Una función puede ser llamada solo mediante referencia de la forma
siguiente:
Variable de asignación ÷ nombre _ función (par1, par2,…)
Por ejemplo
F_x ÷ fun(x)

Procedimiento vs función
i. Un procedimiento es llamado desde el algoritmo o programa principal
mediante su nombre y una lista de parámetros actuales o bien con la
instrucción llamar. Al llamar el procedimiento se detiene
momentáneamente el programa que se estuviera realizando y el
control pasa al procedimiento llamado. Después que las acciones del
procedimiento se ejecutan, se regresa a la acción inmediatamente
siguiente a la que se llamó.
ii. Las funciones devuelven un valor, las subrutinas pueden devolver 0,1 o
más valores y en forma de la lista de parámetros
iii. El procedimiento se declara igual que la función, pero su nombre no
está asociado a ninguno de los resultados que obtiene

15.3. Algoritmos Recursivos
Es un algoritmo que se define en términos de sí mismo. Son implementados
en forma de subrutinas (Funciones,, Procedimientos, subprogramas, etc.) De
tal manera que dentro de una subrutina recursiva hay una o más llamadas a
sí misma.
Es una herramienta muy potente en algunas aplicaciones sobre todo de
cálculo. La recursión puede ser utilizada como una alternativa a la repetición
o estructuras repetitivas. El uso de la recursión es particularmente idóneo
para la solución de aquellos problemas que pueden definirse de modo
natural en términos recursivos (Aguilar, 1988)
Recursividad directa: cuando en una subrutina hay llamadas a ella misma
Recursividad indirecta: cuando se tienen varias subrutinas y estas se llaman
unas a otras formado ciclos.
La recursividad es un elemento muy importante en la solución de algunos
problemas
Ventajas
Algunos problemas son esencialmente recursivos, por lo cual su
implementación se facilita mediante un algoritmo de naturaleza recursiva,
sin tener que cambiarlo a un método iterativo.
Desventajas
Puede llegar a utilizar grandes cantidades de memoria en un instante, pues
implementa una pila cuyo tamaño crece linealmente, con el número de
recursiones necesarias en el algoritmo
Ejemplo 1
Calcular factorial de un número n
Función factorial (n)
Inicio
Si n = 0 entonces
Factorial ÷1
Sino
Factorial ÷ n* factorial(n-1)
Fin si
Fin
Inicio
Leer n
Fact÷ factorial(n)
Escribir “el factorial de n es”, fact
Fin
Ejemplo 2
Calcular factorial de un número n en Perl

sub factorial
{
my $n=$_[0];
if($n==0 || $n==1)
{
$fact=1;
}
else
{
$fact=$n*&factorial($n-1);
}
}
print"ingrese un numero :" ;
$n=<STDIN>;
chop($n);
print "el factorial de $n es ";print &factorial($n);
Ejemplo 3
Calcular factorial de un número n en Matlab
function factor=factorial(n)
if n==0 || n==1
factor=1;
else
factor=n*factorial(n-1);
end
ahora podemos llamarlo desde la venta de comandos de matlab
Ejemplo 4
Desarrollar un algoritmo con procedimientos en perl para Aproximar la
siguiente función y = coseno(x)





sub potencia
{
$k=$_[0];
$x=$_[1];
my $exp=2*$k;
$pot=$x**$exp;
print"la potencia es: $pot \n";
return $pot;
}
sub factorial
{
$k=$_[0];
my $lim=2*$k;
$fact=1;
if($k==0)
{
$fact=1;
}
else
{
my $j=1;
do {
$fact=$fact*$j;
$j=$j+1 ;
}
until($j>$lim);
}

print"factorial es: $fact \n";
return $fact;
}

sub suma
{
$i=$_[0];
$s=$_[1];
$x=$_[2];
my $k=$i-1;
my $sig=(-1)**$i;
$s=$s-(&potencia($k,$x)/&factorial($k))*$sig;

}
Print "ingrese el número de términos: ";
$n=<STDIN>;
chop($n);
print "ingrese el valor de x: ";
$x=<STDIN>;
chop($x);
$s=0;
for($i=1;$i<=$n;$i++)
{
&suma($i,$s,$x);
}
print $s;

Ejercicios
1. Diseñar un algoritmo que calcule el máximo común divisor de dos
números mediante el algoritmo de Euclides con el siguiente
procedimiento
a. Dividir el número mayor (A) por el menor (B). Si el resto de la división
es cero el numero B es el máximo común divisor
b. Si la división no es exacta, se divide el número menor (B) por el resto de
la división anterior
c. Se siguen los pasos anteriores hasta obtener un resto cero. El último
divisor es el mcd buscado
2. Para calcular el máximo común divisor (mcd) de dos números, se recurre a
una función específica definida con un programa con un subprograma. Se
desea calcular la salida del programa principal con dos números A y B,
cuyos valores son 15 y 10, es decir, el mcd (A, B) y comprobar el método
de paso de parámetros por valor
3. Realizar un algoritmo que permita ordenar tres números mediante un
procedimiento de intercambios de dos variables
4. Diseñar una función que calcule la media de tres números leídos del
teclado y poner un ejemplo de su aplicación
5. Realizar un procedimiento que realice la conversión de coordenadas
polares (r, u) a coordenadas cartesianas (x, y)
X = rcos(u)
Y = rseno(u)
6. Función que calcule x
y
, con x є R, y suponiendo que y es un valor entero y
> 0
7. Función que calcule x
y
, con x є R, y suponiendo que y es un valor entero
que puede ser positivo, negativo o cero
8. Función que calcule
m
n
| |
|
\ .
, siendo m y n dos enteros positivos. Puede hacer
uso de las funciones que haya realizado con anterioridad para calcular el
factorial.
9. Función que calcule la suma de las componentes de un vector.
10. Función para calcular la suma
1
n
h
n
h
a
s
h
=
=
¿
, siendo a un vector dado como
argumento, a є R
n
y siendo n > 0, entero otro argumento.
11. Función para calcular el producto escalar de dos vectores v є R
n
y w є R
n
,
suponiendo n > 0 entero.
12. Función Evapol(), que evalué el polinomio A(x) =a
1
x
n
+ … + a
n
x
1
+ a
n+1
x
0
,
dado el grado del polinomio n ≥ 0 entero, el vector de coeficientes a =( a
1
,
…, a
n+1
) y el valor x. Puede hacer uso de las funciones que haya realizado
con anterioridad para calcular las potencias.
13. Función que calcule el vector de coeficientes de un polinomio C suma de
otros dos (A y B). La función ha de recibir los grados na, nb y los vectores
de coeficientes vA = (a
1
,…, a
na+1
) y vB = b
1
,…,b
nb+1
, de cada uno de los dos
polinomios sumados. La función devolverá el grado y el vector de
coeficientes del polinomio suma C = A+B.

16. Estructuras de Datos
Una estructura de datos es una colección de datos que pueden ser caracterizados
por su organización y las operaciones que se definen en ella. La estructuras d datos
son muy importantes en los sistemas de computadoras. Los tipos de datos más
frecuentes utilizados en los diferentes lenguajes de programación son(Aguilar,
1988)























16.1. Arreglos unidimensionales (array)
Es un conjunto finito y ordenado de elementos homogéneos. La propiedad
ordenada significa que el elemento primero, segundo, tercero de un Arreglo
puede ser identificado. Los elementos de un arreglo son homogéneos, es decir
del mismo tipo de datos (Aguilar, 1988)
El tipo más simple de arreglo es el arreglo unidimensional o vector (matriz de
una dimensión) a continuación la representación de un vector

i A(i)
1 14.0
2 12.0
3 8.0
4 7.0
5 8.40
6 8.20
7 8.15
8 7.25

El subíndice o índice de un elemento(1, 2, ..,n) designa su posición en la
ordenación del vector
Datos simples
Datos estructurados
Estándar
Definido por el programador
(No estándar)
Simples o Estáticos
Compuestos o dinámicos
Entero
Real
Carácter
Lógico
Sub rango
Enumerativo
Array (vectores / matrices)
Registros
Ficheros
Conjuntos
Cadenas (String)
Listas (pilas / colas)
Listas enlazadas
Arboles
Grafos
Subíndice o índice
Declaración de un arreglo
Nombre arreglo = arreglo [liminf . . . limsup] de tipo de dato

Donde
Nombre arreglo: nombre valido del arreglo
Liminf . . . limsup :límite inferior y superior del rango del arreglo
Tipo de dato: es el tipo d datos de los elementos del arreglo, puede ser
entero, carácter, real,…
Asignación a un arreglo
A (1) ÷ 10 se asigna el valor 10 a la posición 1 del vector A
A (5) ÷ 20 se asigna el valor 20 a la posición 5 del vector A
Lectura y escritura de datos
La lectura y escritura de un arreglo u operaciones de entrada y salida
normalmente se realizan con estructuras repetitivas.
Final = arreglo [1.. 20] de real
// Lectura
Desde i = 1 hasta 20 hacer
Leer final (i)
Fin desde
// Escritura
Desde i = 1 hasta 20 hacer
Escribir final (i)
Fin desde
16.1.1. Ordenación:
Llamado también clasificación, es el proceso de organizar datos en algún
orden o secuencia específica tal como creciente o decreciente para datos
numéricos o alfanuméricos para datos de caracteres. Los métodos de
ordenación se dividen en dos categorías:
 Ordenación de vectores, tablas (arrays)
 Ordenación de archivos
Los métodos de clasificación se explicaran aplicados a vectores (arrays
unidimensionales) pero se pueden extender a matrices o tablas (arrays
bidimensionales) considerando la ordenación respecto a una fila o
columna los métodos directos son los que se realizan en el espacio
ocupado por el array. Los más populares son:
 Método de intercambio o burbuja
 Método de Selección
 Método de Inserción
Método de intercambio o de Burbuja
Se basa en el principio de comparar pares de elementos adyacentes e
intercambiarlos entre sí, de una lista o vector hasta que estén todos
ordenados.

50 15 56 14 35 1 12 9
A(1) A(2) A(3) A(4) A(5) A(6) A(7) A(8)

Los pasos a dar son:
 Comparar A (1) y A (2), si están en orden, se mantienen como están,
en caso contrario se intercambian entre sí.
 A continuación se comparan los elementos 2 y 3; de nuevo se
intercambian si es necesario.
 El proceso continua hasta que cada elemento del vector ha sido
comparado con sus elementos adyacentes y se han realizado los
intercambios necesarios
Algoritmo:
Desde i ÷ 1 hasta n-1 hacer {este representa el numero pasadas}
Desde j ÷ 1 hasta n-1 hacer {este representa número de
comparaciones}
Si A[ j ] > A [j+1] entonces
Aux÷A[j]
A[j] ÷ A [j+1]
A [j+1] ÷Aux
Fin si
Fin desde j
Fin desde i

Método de Selección
El algoritmo de ordenación por selección de una lista o vector de n
elementos tiene los siguientes pasos.
 Encontrar el elemento mayor de la lista
 Intercambiar el elemento mayor con el elemento de subíndice n (o
bien el elemento menor en el subíndice 1)
 A continuación se busca el elemento mayor en la sablista de
subíndices 1.. n-1 y se intercambia con el elemento de subíndice n-
1, por consiguiente se sitúa el segundo elemento mayor en la
posición n-1.
 A continuación se busca el elemento mayor en la sablista 1..n-2 y
así sucesivamente
Algoritmo
Función Posmayor (j,tabla)
Inicio
Índice_max÷ 1
Desde índice ÷ 2 hasta j hacer
Si tabla [índice]> tabla [índice_max] entonces
Indice_max÷indice
Fin si
Posmayor÷indice_max
Fin desde i
Fin
Inicio {programa principal}
Desde j ÷ límite hasta 2 hacer
Mayor ÷Posmayor(j, tabla)
Aux÷ Tabla [mayor]
Tabla [mayor]÷ Tabla[j]
Tabla[j] ÷Aux
Fin desde j
Fin

Método se Inserción
El método se basa en considerar una parte de la lista ya ordenando y situar
cada uno de los elementos restantes insertándolo en el lugar que le
corresponde por su valor
Algoritmo
Procedimiento desplazar (tabla, aux, k, nuevopos)
Inicio
Encontrado ÷ false
Mientras (k > 1) y (no encontrado) hacer
Si tabla [k-1] >aux entonces
Tabla [k] ÷ tabla [k - 1]
K ÷k – 1
Sino
Encontrado ÷ true
Fin si
Nuevapos÷ k
Fin mientras
Fin
Inicio {programa principal}
Desde K ÷ 2 hasta N hacer
Aux÷ tabla[k]
Desplazar (tabla, k, aux, nuevapos)
Tabla [nuevapos] ÷aux
Fin desde k
Fin
Método de Shell
Este método es una mejora del método de inserción directa que se utiliza
cuando el número de elementos a ordenar es grande se suele denominar
también ordenación por disminución de incrementos.
Pasos

 Se divide la lista original (16 elementos como ejemplo) en este caso
en 8 grupos de dos(considerando un incremento o intervalo de
16/2 =8)
 Se clasifica cada grupo por separado (se comparan las parejas de
elementos y si no están ordenados) se intercambian entre sí de
posiciones)
 Se divide ahora la lista en cuatro grupos d de cuatro (intervalo de
salto 8/4 = 4) y nuevamente se clasifica cada grupo por separado.
 Un tercer paso clasifica dos grupos de ocho registros y luego un
cuarto paso completa el trabajo clasificando todos los 16 registros
Algoritmo
Inicio
Intervalo ÷ n div 2
Mientras (intervalo > 0) hacer
Desde i ÷ (intervalo - 1) hasta n hacer
j÷ i – intervalo
Mientras (j > 0) hacer
K ÷ i + intervalo
Si A[j] <= A[k] entonces
j÷ 0
Sino {intercalar A[j], A[k]}
Aux÷A[j]
A[j] ÷A[k]
A[k] ÷aux
Fin si
j = j - intervalo
Fin mientras
Fin desde i
Intervalo ÷ intervalo div 2
Fin mientras
Fin
Método de ordenación rápida (ojo trabajo)
16.1.2. Búsqueda
La búsqueda de información está relacionada con las tablas para consulta.
Estas tablas contienen una cantidad de información que se almacena en
forma de listas de parejas de datos
Método de búsqueda secuencial
Supongamos una lista de elementos almacenados en un vector (array
unidimensional). El método más sencillo de buscar un elemento en un
vector es explorar secuencialmente el vector o dicho en otras palabras,
recorrer el vector desde el primer elemento hasta el último. Si se
encuentra el elemento buscado visualizar un mensaje similar “fin de la
búsqueda o elemento encontrado”, en casi contrario visualizar un
mensaje similar a “elemento no encontrado” (Aguilar, 1988).
Algoritmo 1
Inicio
Leer t
(Recorrido del vector)
Desde i ÷ 1 1 hasta n hacer
Si A[i] = t entonces
Escribir “elemento encontrado”
Fin si
Fin desde
Fin
Algoritmo 2
Inicio
Leer t
I ÷ 1
Mientras (A[i] <> t) y (i <= n) hacer
I ÷ i+1 (este bucle se detiene bien con A[i]= t o bien con i >n)
Fin mientras
Si A[i] = t entonces (condición de parada)
Escribir “el elemento se ha encontrado en la psicion”, i
Sino
Escribir “el número no se encuentra en el vector”
Fin si
Fin
Método de búsqueda binaria
La búsqueda secuencial es se comienza con el primer elemento del vector
y se busca en el hasta que se encuentra el elemento o se alcanza el final
del vector, aunque este método puede ser un método adecuado para
pocos datos, se necita una técnica más eficaz para conjuntos grandes de
datos.
El método de búsqueda binaria se basa en la división sucesiva del espacio
ocupado por el vector en sucesivas mitades hasta encontrar el elemento
buscado, este vector debe estar ordenado. La búsqueda binaria utiliza el
método de divide y vencerás para localizar el valor buscado. Con este
método se examina primero el elemento central de la lista, si este es el
elemento buscado, entonces la búsqueda ha terminado. En caso contrario
se determina si el elemento buscado está en la primera o la segunda
mitad de la lista y a continuación se repite este proceso, utilizando el
elemento central de esta sablista (Aguilar, 1988)
Algoritmo
Inicio
Leer k (inicializar variables)
Bajo ÷ 1
Alto ÷ N
Central ÷ent((bajo + alto)/2)
Mientras (bajo <= alto) y (A[central] <>K ) hacer
Si K < A[central] entonces
Alto ÷ central - 1
Sino
Bajo ÷ central + 1
Fin si
Central ÷ent((bajo + alto)/2)
Fin mientras
Si k = A[central] entonces
Escribir “valor encontrado en”, central
Sino
Escribir “valor no encontrado”
Fin si
Fin
Método de busca por claves
La búsqueda binaria proporciona un medio para reducir el tiempo
requerido para buscar en una lista. Este método, sin embargo, exige que
los datos estén ordenados. Por lo que surge este método para mejorar la
velocidad de búsqueda sin estar ordenados. El método de transformación
de claves o hashing consiste en convertir la clave dada (numérica o
alfanumérica) en una dirección (índice) dentro del arreglo. La
correspondencia entre claves y la dirección en el medio de
almacenamiento o en el arreglo se establece por una función de
conversión (función o hash). (Aguilar, 1988)
OJO Trabajo
16.1.3. Mezcla o intercalación
La intercalación es el proceso de mezclar (intercalar) dos vectores
ordenados y producir uno nuevo vector ordenado
Algoritmo

Inicio
Leer A, B (A, B vectores de M y N elementos9
I ÷ 1
J ÷ 1
K ÷ 1
Mientras i <= M y j <= N hacer
(seleccionar siguiente elemento de A o B y añadirlo en C)
K ÷ k + 1
Si A[i] < B[j] entonces
C[k] ÷ A[i]
i= i + 1
sino
C[k] ÷ B[j]
J ÷j + 1
Fin si
Fin mientras
Si i <= M entonces
Desde r ÷ i hasta M hacer
K ÷ k +1
C[k] ÷ A[r]
Fin desde
sino
Desde r ÷ j hasta N hacer
K ÷k +1
C[k] ÷ B[r]
Fin desde
Fin si
Escribir C (vector clasificado)
Fin

16.2. Arreglos bidimensionales:

Se puede considerar como un vector de vectores. Es por consiguiente un
conjunto de elementos, todos del mismo tipo en el cual el orden de los
componentes es significativo y en el que se necesitan especificar dos
subíndices para poder identificar a cada elemento del arreglo. (Aguilar, 1988).











Asignación en una arreglo de dos dimensiones
Fila 1
Columna 1
Fila 2
Fila 3
Fila 4
Fila 5
Columna 2
Columna 3
Columna 4
Columna 5
A (1,2) ÷ 10 se asigna el valor 10 en la posición i = 1 y j = 2 de arreglo
bidimensional A
A (5,6) ÷ 20 se asigna el valor 20 a la posición i = 5 y j = 6 del arreglo
bidimensional A
Lectura y escritura de datos
La lectura y escritura de un arreglo u operaciones de entrada y salida
normalmente se realizan con estructuras repetitivas.
Final = arreglo [1.. 20; 1..10] de real
// Lectura
Desde i ÷1 hasta 20 hacer
Desde j ÷ 1 hasta 10 hacer
Leer final [i, j]
Fin desde j
Fin desde i
// Escritura
Desde i ÷1 hasta 20 hacer
Desde j ÷ 1 hasta 10 hacer
Escribir final [i, j]
Fin desde j
Fin desde i
Ejemplo 1
Escribir un algoritmo que permita calcular el cuadrado de los 100
primeros números enteros y a continuación escribir una lista que
contenga dichos 100 números cuadrados.
Algoritmo
Inicio
Desde N ÷ 1 hasta 100 hacer
C ÷ N*N
Escribir N, C
Fin desde
{Escritura de la tabla}
Desde N ÷ 1 hasta 100 hacer
A(N) ÷ N*N
Escribir A(N)
Fin desde
Fin
Ejemplo 2
Se tiene N temperaturas. Se desea calcular su media y determinar entre
todas ellas cuales son superiores o iguales a esa media
Algoritmo
Inicio
Suma ÷ 0
C ÷ 0
Leer N
Desde i ÷ 1 hasta N hacer
Leer temp[i]
Suma ÷ suma/N
Fin desde
Desde i ÷ 1 hasta N hacer
Si temp[i] >= media entonces
C ÷C +1
Escribir temp[i]
Fin si
Fin desde i
Escribir “la media es:”, media
Escribir el total de temperaturas mayores iguales a la medio es : “, C
Fin
Ejemplo 3
Inicializar una matriz de dos dimensiones con un valor constante K
Algoritmo
Inicio
Desde i ÷ 1 hasta M hacer
Desde j ÷ 1 hasta N hacer
Q[i,j] ÷ K
Fin desde j
Fin desde i
fin

Ejemplo 4
Realizar la suma de dos matrices
Algoritmo
Inicio
Desde i ÷ 1 hasta m hacer
Desde j ÷ 1 hasta n hacer
S[i,j] ÷ Q[i,j] + B[i,j]
Fin desde j
Fin desde i
fin

Ejemplo 5

Calcular el porcentaje de cada nucleótido de una secuencia de ADN
ingresado por teclado en perl
#programa para calcular la frecuencia de bases de una secuencia de ADN
print"introducir la se cuencia de ADN :";
$mysec=<STDIN>;
chop($mysec);
$a=0;
$c=0;
$g=0;
$t=0;
$r=0;
$n=length($mysec);
print"el tamaño de la cadena es: $n \n";
@mysec=split //,$mysec;
#print @mysec;
for($i=0;$i<$n;$i++)
{
# $adn=$mysec[$i];
#print $adn;
if(@mysec[$i]eq"a")
{
$a=$a+1;
}
elsif (@mysec[$i]eq"c")
{
$c=$c+1;
}
elsif (@mysec[$i]eq"g")
{
$g=$g+1;
}
elsif (@mysec[$i]eq"t")
{
$t=$t+1;
}
else
{
$r=$r+1;
}
}
$porcentajea=100*$a/$n;
$porcentajec=100*$c/$n;
$porcentajeg=100*$g/$n;
$porcentajet=100*$t/$n;
$procentajer=100*$r/$n;
print"resultado en porcentaje de cada nucleotido es: \n";
print" Adenina: $porcentajea\n";
print" Citocina: $porcentajec\n";
print" Guanina: $porcentajeg\n";
print" Timina: $porcentajet\n";
print"otros Residuos: $procentajer\n";

Ejercicios

1. Leer las componentes de un vector de números reales de dimensión 10.
Escribirlo luego en la pantalla.
2. Leer un entero n supuesto n >0 y un vector v є R
n x 1
, calcular y escribir el
producto escalar m = v
t
v, m є R, donde v
t
simboliza el vector transpuesto
de v.
3. Leer n (suponiendo que es entero y > 0). Leer a continuación la n
componentes de un vector de números reales dimensión n. Calcular y
escribir luego la media aritmética de sus componentes
4. Leer n (suponiendo que es entero y >0) y un vector de dimensión n.
Calcular y escribir la componente de mayor valor y su índice dentro del
vector.
5. Leer n (suponiendo que es entero y mayor que dos). Construir un vector
v є R
n x 1
tal que v
k
= v
k-1
/ 3 + 0.5, para k = 2,…,n y siendo v
1
= 1.
6. Leer n (suponiendo que es entero y mayor de dos). Construir un vector v
є R
n x 1
, tal que sus componentes sean los términos de ls sucesión de
Fibonacci.
7. Se han medido las longitudes de tornillos procedentes de un mismo lote
de fabricación. Se han dispuesto en un vector v de dimensión n>2. Se
dispone de v y n. Diseñe un algoritmo para calcular la media y varianza
de las longitudes. La varianza se calcular como
2
1
1
var ( )
n
k
k
v
n
µ
=
= ÷
¿

Siendo μ la media aritmética de las componentes de v.
8. Máximo de un vector. Dada un vector A є R
n x 1
, calcular el elemento
mayor.
9. Se quiere construir y escribir un vector v de dimensión n cuyas
componentes siguen la ley v
k
= 3*v
k-1
– k, para k ≥ 2. Tanto n como v
1

son cantidades que han de leerse del teclado
10. Determinar los valores de i, j, después de la ejecución de las
instrucciones siguientes.
Inicio
I ÷ 1
J ÷ 2
A[i] ÷ j
A[i] ÷ i
A[j + 1] ÷ j + 1
I ÷ A[j] + A [i]
A[3] ÷ 5
J ÷ A[j] + A [i]
Fin
11. Dados los vectores A = 3 5 6 8 4 7 8 5 3 1 y B = 3 4 6 8 9 1 2 3 0 9,
realice un algoritmo para calcular las siguientes
operaciones





12. Crear un vector de 70 elementos donde cada elemento del vector sea
igual a su posición
13. Dada en una lista no ordenada de números y un número leído por
teclado:
a. Diseñar una solución que busque en la lista el número leído. Si lo
encuentra, debe informar de su posición en la lista, sino debe devolver
la posición cero.
b. Modificar el anterior para que devuelva el número de veces que
aparece.
c. Diseñar una solución que busque el número mayor y devuelva
cuantas veces aparece.
d. Diseñar una solución que devuelva Verdadero si el número leído,
aparece más veces que el mayor.
e. Diseñar una solución que calcule la media de todos los números.
f. Diseñar una solución que calcule la media entre el mayor y el menor.
g. Diseñar una solución que cree una lista inversa a la dada. Es decir,
que genere una nueva lista tal que su primer elemento sea el último de
la lista inicial, su segundo elemento sea el penúltimo de la lista inicial,
etc., etc., etc.
14. Dadas 3 listas de 10 números de teléfono, donde la primera lista
contiene el número de pasos consumidos en llamadas locales asociado a
cada teléfono, la segunda contiene información sobre llamadas
nacionales y la tercera contiene información sobre llamadas
internacionales, calcular los subtotales del coste de cada una de las
categorías considerando los costes siguientes: llamada local, 5pesetas
por paso, llamada nacional 10 pesetas por paso y llamada
internacional50 pesetas por paso. Construir un programa que lee los
datos de entrada desde el teclado e imprima los resultados finales por
pantalla.
15. Dado un vector v de dimensión n cuyas componentes son todas
positivas o cero se desea reordenar sus componentes de mayor a menor
por ejemplo, si
V = [2 3 8 5 4]
El resultado ha de ser un nuevo vector
w= [8 5 4 3 2]

16. Repetir el ejercicio anterior pero sin usar un vector auxiliar como w. el
resultado que se pretende conseguir es que el propio vector v tenga sus
componentes ordenadas( emplear todos los métodos de ordenación)
17. Igual que el anterior pero suponiendo que v contiene cantidades
positivas y negativas, por ejemplo
V=[-7 3 8 -9 5 4 0 -1]
Ha de dar como resultado el propio vector reordenado así:
V= [8 5 4 3 2 -1 -7 -9]
18. Suponiendo que A es un conjunto [1, 3, 5, 7], B es [2, 4, 6] y C es [1, 2, 3]
evalué las siguientes expresiones.
A+(B*C), A+(B+C), A+B+C, A+(B+C), C+(A+C), C-(A-B), (C-A)-B
19. Se desea calcular la mediana de los valores contenidos en un vector T є
R
n
. si n es impar la mediana es el valor central del vector ordenado, en
caso contrario la mediana es la media de los dos elementos que están
más al centro. En ambos casos el paso previo para calcular la mediana es
ordenar el vector. Un ejemplo con n par es T = [10 23 11 15]. La
ordenación produce T° = [23 15 11 10] y la mediana es (15 + 11)/2 = 13.
Un ejemplo con n impar es T = [11.8 12 28 11.5 14], en este caso la
ordenación produce un nuevo vector T° = [11.5 11.8 12 14 28], de
donde se obtiene la mediana que es el valor central 12.
Puede comprobar con lo ejemplos anteriores que la mediana no
coincide con la media aritmética.
20. La cantidad de un cierto isotopo radioactivo presente en una mezcla
varia con el tiempo pues el isotopo se descompone emitiendo radiación.
Se denota mediante y(k) la cantidad en gramos de isotopo en el instante
de tiempo t = k medido en años unos científicos han descubierto que se
cumple que y(k) = 0.99*y(k-1). Si un barril de desechos radioactivos
contiene 1000 gramos de isotopo ¿Cuál será la cantidad de isotopo
presente al cabo de 500 años?
21. La velocidad de un paracaidista en su descenso al suelo una vez que ha
abierto el paracaídas se denota mediante v(k) (m/s), siendo k el tiempo
que lleva cayendo medido en segundos, k > 1. Se ha especulado con la
idea de que dicha velocidad sigue la ley: v(k) = v(k-1) + 10 - 0.4*(v(k-1))
2
.
Sabiendo que una caída típica puede durar 5 minutos y que el
paracaídas se suele abrir con una velocidad de 100 Km/h ¿con que
velocidad llega al suelo?
22. Se sabe que la cantidad de bacterias de cierta especie en un cultivo es
x(k) = 1.1*x(k-1), siendo k el tiempo medido en horas, k >1. Si al cabo de
la primera hora x(1) se contabilizaron 100 unidades ¿Cuántas habrá al
cabo de un día?
23. Dados los arrays lineales ABC(-5:15); EJM(1935:1994);PQR(45)
Se pide calcular el número de elementos de cada array
24. Un arreglo estrictamente triangular inferior A es un arreglo de n x n, en
el cual a*i, j+ ≠ 0, si i<=j,
¿Cuál es el máximo número de elementos no iguales a cero en tal
arreglo?
¿Cómo pueden almacenarse secuencialmente estos elementos en la
memoria?
¿Desarrolle un algoritmos para acceder A[i, j] donde i>=j?
25. En un arreglo se ha almacenado el número total de toneladas de
cereales cosechadas durante cada mes del año anterior. Se desea la
siguiente información:
¿el promedio anual de toneladas cosechadas ?
¿Cuántos meses tuvieron una cosecha superior al promedio anual?
¿Cuántos meses tuvieron una cosecha inferior al promedio anual?
Escriba un programa que proporcione estos datos
26. En un arreglo se almacenan las calificaciones finales de N alumnos.
Escriba un programa que calcule e imprima.
¿El promedio general del grupo?
¿Número de alumnos aprobados y número de alumnos reprobados?
¿Porcentaje de alumnos aprobados y porcentaje de alumnos
reprobados?
¿Número de alumnos cuya calificación fue mayor o igual 11?
27. Lectura / escritura de una matriz m x n. Se han de leer del teclado las
dimensiones m y n (suponga que son números enteros positivos). A
continuación se han de leer los elementos a
kj
de una matriz A de m filas
y n columnas. Finalmente se presentará en la pantalla la matriz leída.
28. Construir una matriz A є R
m x n
cuyo elemento genérico a
kj
viene dado
por a
kj
= k
2
– j
29. Dada una matriz (se supone ya leída) A de dimensiones m x n, se quiere
anular (poner a cero) los elementos de su diagonal principal y escribir la
matriz resultante.
30. Traza de una matriz. Dada una matriz cuadrada A є R
n x n
, dada siendo
n > 0 un entero también dado se ha de diseñar un algoritmo que
permita obtener la traza de A (suma de los elementos de la diagonal)
31. Suma de matrices. Dadas (suponga que ya han sido leídas) dos matrices
A є R
n x n
y B є R
n x n
, se quiere calcular y escribir la matriz C obtenida
como suma de las anteriores c = A +B
32. Matriz traspuesta. Dada una matriz A є R
n x n
, calcular su traspuesta B=
A
t

33. Submatriz triangular. Dada una matriz A є R
n x n
, se desea calcular otra
matriz B є R
n x n
cuyos elementos son ceros excepto los de la submatriz
triangular inferior que son iguales a los elementos de igual posición de
A. Es decir, los elementos que están por debajo de la diagonal principal
de A se copian en B, el resto de elementos de B valen cero. Se supone
que tanto m como n son números enteros mayores que uno ya leídos.
34. Máximo de una matriz. Dada una matriz A є R
n x n
, calcular el elemento
mayor.
35. Máximo de cada matriz. Dada una matriz A є R
n x n
, con m > 1 y n > 1
dados se desea calcular un vector v є R
n x n
cuya componente genérica
v
k
, es el mayor valor de la fila k-esima de A.
36. Escribir el algoritmo que permita determinar el número de elementos
positivos de una tabla
37. Leer una matriz de 3 por 3 elementos y calcular la suma de cada una de
sus filas y columnas, dejando dichos resultados en dos vectores, uno de
la suma de las finas y otro de las columnas
38. Realizar los algoritmos: de la matriz inversa, producto de matrices,
multiplicación de una matriz por un escalar, matriz identidad y matriz
triangular
39. Se dispone de las notas de 40 alumnos, cada uno de ellos puede tener
uno o varias notas. Escribir un algoritmo que permita obtener la media
de cada alumno y la media de la clase a partir de la entrada de las notas
desde un terminal
40. Un avión dispone de 180 plazas de las cuales 60 son de no fumador y
numeradas del 1 al 60 y 120 plazas numeradas de 61 al 120. Diseñar un
algoritmo que permita hacer la reserva de plazas de avión y se detenga
media antes de la salida, cuyo momento se abrirá la lista de espera.
41. Juego del Rojo-amarillo-verde. El programa genera tres dígitos
aleatorios distintos entre 0 y 9. A estos dígitos se les asignan las
posiciones 1, 2 y 3. El objetivo del juego es adivinar los dígitos así como
sus posiciones correctas en el menor número de intentos posibles. Para
cada intento, el jugador proporciona tres dígitos para las posiciones 1, 2,
y 3. El programa responde con una pista que consta de rojo, amarillo y
verde. Si un dígito adivinado está en la posición correcta la respuesta es
verde. Si el digito adivinado está en posición incorrecta, la respuesta es
amarillo. Si el dígito para una posición dada no coincide con ninguno de
los tres dígitos, la respuesta es rojo. Ejemplo: dígitos 6,5,8 en las
posiciones 1,2,3







42. Jhon Pérez ha heredado $1.000. Él ha decidido invertir su dinero por un
año. Un inversionista le ha sugerido cinco inversiones posibles: oro,
bonos, negocio en desarrollo, certificado de depósito, acciones. Jhon
debe decidir cuánto invertir en cada opción. La siguiente tabla
representa las ganancias que obtendría para cada escenario posible de
comportamiento del mercado


Utilizar el Criterio de Hurwicz: Es un criterio intermedio entre maximin y
el maximax: Supone la combinación de ponderaciones de optimismo y
pesimismo. Sugiere la definición del llamado coeficiente de optimismo
(α), y propone que se utilice como criterio de decisión una media
ponderada entre el máximo resultado asociado a cada alternativa, y el
mínimo resultado asociado a la misma.
{ }
max max ( , ) (1 ) min ( , )
j i j
i j i j
a
v a v a
u u
o u o u + ÷
Para el optimista
{ }
min min ( , ) (1 ) max ( , )
i j j
i j i j
a
v a v a
u u
o u o u + ÷
Para el pesimista

Para hallar la solución óptima se marca el máximo y el mínimo de cada
alternativa. Según el coeficiente de optimismo del decidor (α), se
multiplica el máximo por éste y el mínimo se multiplica por (1-α). Luego
se suman los dos. Luego elegimos el máximo entre todas las
alternativas. En nuestro ejemplo, si suponemos que el empresario es
neutral α=0,5
43. Escriba un algoritmo que busque el valor máximo de los elementos de
un vector de N números reales, donde N es una constante a la que le
daremos un valor cualquiera. El algoritmo debe escribir por pantalla el
valor máximo. Supongamos que:
44. Lea una matriz de N x M (variables) e indique luego ,
Cuantos elementos positivos contiene la matriz
Cuantos elementos pares y positivos contiene
Cuál es el mayor elemento que contiene la matriz y cuantas veces
figura.
45. Crear una matriz de dimensiones variables y llenarlas de unos e
imprimirla
46. Crear a una matriz N x N , cuya diagonal principal (i = j) esté formada
por unos y el resto por ceros
47. Crear una matriz de 5 x 5 donde cada elemento de esta corresponda a
la suma de los índices de la fila con la columna (i + j)
48. Su ponga que ya ha sido leída una matriz de 9 x 5, se le pide que
encuentre el número de elementos pares que contiene la matriz. Luego
imprima la matriz completa
49. Lea una matriz de dimensiones 5 x 5 y luego entregue:
El promedio de los elementos de la segunda fila de la matriz
La suma de elementos de la cuarta columna de la matriz
50. Un fabricante de automóviles dispone de un modelo de vehículo en
cinco colores. Para saber la aceptación de cada color realiza una
encuesta usando un programa en su ordenador. El programa ha de
ayudarle a contar los votos de los encuestados. El encuestador tecleara
el número del color elegido (de uno a cinco) cada vez que pregunte a
una persona nueva. Cuando no quiera preguntar a nadie más
introducirá el valor -1. En ese momento el programa le indicara el
número de votos que cada color ha obtenido. Posteriormente se han de
ordenar los colores según los resultados de la votación.
51. Multiplicación de matrices. Suponga ya leídas A є R
m x n
y B є R
n x p
,
calcule C=A*B.
52. Matriz al cubo. Diseñe un algoritmo que permita obtener B = A
3
, siendo
A є R
n x n
una matriz cuadrada que se supone ya leída.
53. Exponenciación de matrices. Diseñe un algoritmo que permita obtener B
= A
p
, siendo A є R
n x n
, una matriz dada y p >0 un entero también dado.
54. Dados dos enteros positivos m y n se desea construir la matriz S є R
m x n
,
cuyo elemento genérico viene dado por
1
1
n
kj j
k
s
h
=
=
¿

55. Dados los array multidimensionales:
X(-5:5;3:33) y Y(3:10;1:15;10:20)
Se pide calcular la longitud de cada dimensión y el número de
elementos de X e Y
56. La empresa ACME S.A. ha asignado un código a cada uno de sus obreros.
El código está formado por 5 caracteres y tienen la siguiente estructura:
XX-Y-ZZ
Donde
XX= especialidad
Y=categoría
ZZ=numero (0 - 90)
Especialidad
CO=Construcción
CA=Carpintería
IS=Instalaciones
LI=Limpieza
Categorías:
F=oficial
O=operario
P=Peón
Escribir un algoritmo que permita ingresar el código de cada
obrero y mostrar en pantalla la especialidad y la categoría. Se
debe considerar que el código ingresado por el operador tenga 5
caracteres, si el código no corresponde a una especialidad o
categoría, el programa deberá mostrar el mensaje “código no
valido”.
57. Construir un algoritmo que imprima el calendario correspondiente a un
mes y año determinado. Por ejemplo considera años bisiestos entre
1980 y 2020. Los días domingos deben aparecer resaltados
58. de


16.3. Ecdscds

17. Estructuras lineal
17.1. Pilas
17.2. Colas
18. Estructura no lineal
18.1. Arboles
18.2. Grafos



Supongamos que un problema requiere de 2 pilas: A(n1) y B(n2). No disponemos de
mucha memoria y para evitar desbordamiento, es decir que la cantidad de elementos
de A sea mayor que n1 o que la cantidad de elementos de B sea mayor que n2.
Empleamos un solo array C con n1+n2 elementos con la particularidad que la pila A
mete sus datos por la izquierda desde el elemento 1 y la pila B mete sus datos por la
derecha desde el elemento n. Elabore las operaciones meter y sacar para este caso.

Desarrollar el algoritmo que lea una cadena de caracteres y determine si forma un
palindrome. Un palindrome es una secuencia de caracteres que se lee igual hacia
adelante que hacia atrás por ejemplo.

ABLE WAS I ERE I SAW ELBA
El carácter “.” (punto) termina la cadena. Escribir un mensaje indicando si la cadena es
un palindrome. Puede asumir que los datos son correctos y que el número máximo de
caracteres es 80.

Escriba el algoritmo de conversión de una expresión infija a prefija. Supongamos que EI
es una expresión aritmética escrita en notación infija. EI puede tener paréntesis
izquierdos y derechos, operandos (dígitos 0 – 9 y letras A - Z), operadores (^ =
potencia, * = multiplicación, / = división, + = suma, - = resta de acuerdo con sus
prioridades). Efectué la prueba de escritorio para la siguiente expresión: Z
=((((X+1)*2)-5)/Y)

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->